genomic pcr  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Thermo Fisher genomic pcr
    <t>CRISPR/Cas9-mediated</t> generation of syngeneic HEK293 cells expressing a unique copy of MA4 or A4M in the AAVS1 safe harbor A. , F. Schematic representation of the donor vector used for insertion of the dTo-MA4 A. or A4M-GFP F. cassette into the AAVS1 locus. dTo, dTomato fluorescent protein; SD, splice donor; SA, splice acceptor; CAG, CMV early enhancer/chicken β actin promoter. Black (5′; junction) and green (3′; junction) arrows depict genomic location of primers used to confirm targeted integration. B. , G. Representative images of dTo-MA4- and A4M-GFP-expressing HEK293 cells after puromycin or G418 selection, respectively. C. , H. Targeted integration analysis of MA4 and A4M into the AAVS1 locus by <t>PCR</t> using primers specific for the 5ʹ (top panels) and 3ʹ (bottom panels) integration junctions. D. , I. RNA expression of MA4 D. and A4M I. in antibiotic-selected cells. E. , J. Homologous recombination confirmed by southern blot analysis after BglII digestion of genomic DNA from puromycin/G418-resistant clones using a MA4 probe E. or an AAVS1 exon2 probe outside the targeting construct J. . A 4Kb band represents a targeted integration of MA4 in PPP1R12C. The 8kb band corresponds to the targeted integration of A4M in PPP1R12C. Untargeted allele gives a 12Kb band J. . L. qPCR of the MA4 targets HOXA9 and PROM1 is comparable between HEK293 cells ectopically expressing MA4 upon CRISPR/Cas9-mediated genome edition (left panel) or lentiviral transduction (right panel) * p
    Genomic Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr/product/Thermo Fisher
    Average 91 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    genomic pcr - by Bioz Stars, 2020-05
    91/100 stars

    Images

    1) Product Images from "Expression of MLL-AF4 or AF4-MLL fusions does not impact the efficiency of DNA damage repair"

    Article Title: Expression of MLL-AF4 or AF4-MLL fusions does not impact the efficiency of DNA damage repair

    Journal: Oncotarget

    doi: 10.18632/oncotarget.8938

    CRISPR/Cas9-mediated generation of syngeneic HEK293 cells expressing a unique copy of MA4 or A4M in the AAVS1 safe harbor A. , F. Schematic representation of the donor vector used for insertion of the dTo-MA4 A. or A4M-GFP F. cassette into the AAVS1 locus. dTo, dTomato fluorescent protein; SD, splice donor; SA, splice acceptor; CAG, CMV early enhancer/chicken β actin promoter. Black (5′; junction) and green (3′; junction) arrows depict genomic location of primers used to confirm targeted integration. B. , G. Representative images of dTo-MA4- and A4M-GFP-expressing HEK293 cells after puromycin or G418 selection, respectively. C. , H. Targeted integration analysis of MA4 and A4M into the AAVS1 locus by PCR using primers specific for the 5ʹ (top panels) and 3ʹ (bottom panels) integration junctions. D. , I. RNA expression of MA4 D. and A4M I. in antibiotic-selected cells. E. , J. Homologous recombination confirmed by southern blot analysis after BglII digestion of genomic DNA from puromycin/G418-resistant clones using a MA4 probe E. or an AAVS1 exon2 probe outside the targeting construct J. . A 4Kb band represents a targeted integration of MA4 in PPP1R12C. The 8kb band corresponds to the targeted integration of A4M in PPP1R12C. Untargeted allele gives a 12Kb band J. . L. qPCR of the MA4 targets HOXA9 and PROM1 is comparable between HEK293 cells ectopically expressing MA4 upon CRISPR/Cas9-mediated genome edition (left panel) or lentiviral transduction (right panel) * p
    Figure Legend Snippet: CRISPR/Cas9-mediated generation of syngeneic HEK293 cells expressing a unique copy of MA4 or A4M in the AAVS1 safe harbor A. , F. Schematic representation of the donor vector used for insertion of the dTo-MA4 A. or A4M-GFP F. cassette into the AAVS1 locus. dTo, dTomato fluorescent protein; SD, splice donor; SA, splice acceptor; CAG, CMV early enhancer/chicken β actin promoter. Black (5′; junction) and green (3′; junction) arrows depict genomic location of primers used to confirm targeted integration. B. , G. Representative images of dTo-MA4- and A4M-GFP-expressing HEK293 cells after puromycin or G418 selection, respectively. C. , H. Targeted integration analysis of MA4 and A4M into the AAVS1 locus by PCR using primers specific for the 5ʹ (top panels) and 3ʹ (bottom panels) integration junctions. D. , I. RNA expression of MA4 D. and A4M I. in antibiotic-selected cells. E. , J. Homologous recombination confirmed by southern blot analysis after BglII digestion of genomic DNA from puromycin/G418-resistant clones using a MA4 probe E. or an AAVS1 exon2 probe outside the targeting construct J. . A 4Kb band represents a targeted integration of MA4 in PPP1R12C. The 8kb band corresponds to the targeted integration of A4M in PPP1R12C. Untargeted allele gives a 12Kb band J. . L. qPCR of the MA4 targets HOXA9 and PROM1 is comparable between HEK293 cells ectopically expressing MA4 upon CRISPR/Cas9-mediated genome edition (left panel) or lentiviral transduction (right panel) * p

    Techniques Used: CRISPR, Expressing, Plasmid Preparation, Selection, Polymerase Chain Reaction, RNA Expression, Homologous Recombination, Southern Blot, Clone Assay, Construct, Real-time Polymerase Chain Reaction, Transduction

    2) Product Images from "PRAS40 plays a pivotal role in protecting against stroke by linking the Akt and mTOR pathways"

    Article Title: PRAS40 plays a pivotal role in protecting against stroke by linking the Akt and mTOR pathways

    Journal: Neurobiology of disease

    doi: 10.1016/j.nbd.2014.02.006

    Confirmation of PRAS40 gene KO in mice and increased ischemic infarction and neurological score in PRAS40 KO mice compared to WT mice. A . PCR for genotyping PRAS40 KO mice. PCR product analysis on 4% agarose gel. Lane M: DNA size marker; Lane 1: C57BL/6
    Figure Legend Snippet: Confirmation of PRAS40 gene KO in mice and increased ischemic infarction and neurological score in PRAS40 KO mice compared to WT mice. A . PCR for genotyping PRAS40 KO mice. PCR product analysis on 4% agarose gel. Lane M: DNA size marker; Lane 1: C57BL/6

    Techniques Used: Mouse Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

    3) Product Images from "Partial duplication of DHH causes minifascicular neuropathy"

    Article Title: Partial duplication of DHH causes minifascicular neuropathy

    Journal: Annals of Clinical and Translational Neurology

    doi: 10.1002/acn3.417

    (A) Long‐range PCR amplification of the whole region of DHH in the three MN patients (left). We amplified the entire DHH region including all three exons using the following primer set: F1 (5′‐ GCAGCTTCCAACTGAGAAGTCA ‐3′) and R1 (5′‐ GCTGATATGCCCTTGTTTAGGG ‐3′). DHH is approximately 700 bp longer in the three cases than in the normal control. M, size standard marker (1 kb DNA ladder); C, normal control; P1, patient 1; P2, patient 2; P3, patient 3. (B): Detection of breakpoint junction by PCR . We performed genomic PCR using the following primer set: F2 (5′‐ CTACCATCGACTCAGATTCT ‐3′) and R2 (5′‐ GCTCCCCTCCCTCCGCCTGA ‐3′). M, size standard marker (1 kb DNA ladder); C, normal control; P1, patient 1; P2, patient 2; P3, patient 3. Only the patients’ genomic DNA s carrying the duplication can be PCR amplified. (C) Structure of mutation in DHH . Direct nucleotide sequence analysis of the PCR products amplified using a primer set (F2 and R2) showed the breakpoint junctions. One of them was found in exon 2 and the other in intron 1 (chromosome 12: 49,484,984‐49,485,744). The black boxes represent exons and the white arrows duplicated regions. (D) RT ‐ PCR analysis of DHH mRNA expression in the sural nerves. In the RT ‐ PCR analyses of DHH using primers located on exons 1 and 3 (f1 and r1 in Fig 2 E) and primers located on exons 1 and 2 (f2 and r2 in Fig 2 E), the PCR products (565 bp and 94 bp bands) were revealed only in a control subject, confirming the absence of DHH mRNA expression in the sural nerve of the patient 1. RT ‐ PCR of ACTB revealed bands corresponding to 285 bp in both the patient 1 and a control subject. M, size standard marker (FlashGel DNA marker); C, normal control; P1, patient 1; ACTB , actin beta. (E) A schematic presentation of normal DHH mRNA along with primers used in the RT ‐ PCR analysis.
    Figure Legend Snippet: (A) Long‐range PCR amplification of the whole region of DHH in the three MN patients (left). We amplified the entire DHH region including all three exons using the following primer set: F1 (5′‐ GCAGCTTCCAACTGAGAAGTCA ‐3′) and R1 (5′‐ GCTGATATGCCCTTGTTTAGGG ‐3′). DHH is approximately 700 bp longer in the three cases than in the normal control. M, size standard marker (1 kb DNA ladder); C, normal control; P1, patient 1; P2, patient 2; P3, patient 3. (B): Detection of breakpoint junction by PCR . We performed genomic PCR using the following primer set: F2 (5′‐ CTACCATCGACTCAGATTCT ‐3′) and R2 (5′‐ GCTCCCCTCCCTCCGCCTGA ‐3′). M, size standard marker (1 kb DNA ladder); C, normal control; P1, patient 1; P2, patient 2; P3, patient 3. Only the patients’ genomic DNA s carrying the duplication can be PCR amplified. (C) Structure of mutation in DHH . Direct nucleotide sequence analysis of the PCR products amplified using a primer set (F2 and R2) showed the breakpoint junctions. One of them was found in exon 2 and the other in intron 1 (chromosome 12: 49,484,984‐49,485,744). The black boxes represent exons and the white arrows duplicated regions. (D) RT ‐ PCR analysis of DHH mRNA expression in the sural nerves. In the RT ‐ PCR analyses of DHH using primers located on exons 1 and 3 (f1 and r1 in Fig 2 E) and primers located on exons 1 and 2 (f2 and r2 in Fig 2 E), the PCR products (565 bp and 94 bp bands) were revealed only in a control subject, confirming the absence of DHH mRNA expression in the sural nerve of the patient 1. RT ‐ PCR of ACTB revealed bands corresponding to 285 bp in both the patient 1 and a control subject. M, size standard marker (FlashGel DNA marker); C, normal control; P1, patient 1; ACTB , actin beta. (E) A schematic presentation of normal DHH mRNA along with primers used in the RT ‐ PCR analysis.

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker, Mutagenesis, Sequencing, Reverse Transcription Polymerase Chain Reaction, Expressing

    4) Product Images from "Rolling Circle Amplification, a Powerful Tool for Genetic and Functional Studies of Complete Hepatitis B Virus Genomes from Low-Level Infections and for Directly Probing Covalently Closed Circular DNA ▿"

    Article Title: Rolling Circle Amplification, a Powerful Tool for Genetic and Functional Studies of Complete Hepatitis B Virus Genomes from Low-Level Infections and for Directly Probing Covalently Closed Circular DNA ▿

    Journal:

    doi: 10.1128/AAC.01318-07

    RCA plus genomic HBV PCR with cccDNA extracted from serial liver biopsy specimens. Ethidium bromide-stained agarose gel of final products of combined RCA and PCR with material from serial liver biopsies. H2O, negative control; LB, liver biopsy; T+,
    Figure Legend Snippet: RCA plus genomic HBV PCR with cccDNA extracted from serial liver biopsy specimens. Ethidium bromide-stained agarose gel of final products of combined RCA and PCR with material from serial liver biopsies. H2O, negative control; LB, liver biopsy; T+,

    Techniques Used: Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Negative Control

    5) Product Images from "T Cells Contribute to Stroke-Induced Lymphopenia in Rats"

    Article Title: T Cells Contribute to Stroke-Induced Lymphopenia in Rats

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0059602

    PCR-RFLP assay for genotyping SD-rnu rats. A. The PCR products were analyzed on 4% agarose gel. Lane M: DNA size marker; Lane 1, 4, 6: SD homozygote (+/+); Lane 2, 3: heterozygote (rnu/+); Lane 5, 7: nude homozygote (rnu/rnu). B. Representative appearance of WT SD rat and nude rat without hair. C. The WT SD rat has a thymus (arrow) while the nude rat is athymic.
    Figure Legend Snippet: PCR-RFLP assay for genotyping SD-rnu rats. A. The PCR products were analyzed on 4% agarose gel. Lane M: DNA size marker; Lane 1, 4, 6: SD homozygote (+/+); Lane 2, 3: heterozygote (rnu/+); Lane 5, 7: nude homozygote (rnu/rnu). B. Representative appearance of WT SD rat and nude rat without hair. C. The WT SD rat has a thymus (arrow) while the nude rat is athymic.

    Techniques Used: Polymerase Chain Reaction, RFLP Assay, Agarose Gel Electrophoresis, Marker

    6) Product Images from "A novel mutation causing mild, atypical fumarylacetoacetase deficiency (Tyrosinemia type I): a case report"

    Article Title: A novel mutation causing mild, atypical fumarylacetoacetase deficiency (Tyrosinemia type I): a case report

    Journal: Orphanet Journal of Rare Diseases

    doi: 10.1186/1750-1172-4-28

    Identification of the Ala35Thr mutation . PCR-amplified genomic DNA was sequenced and revealed a G to A transition in the first nucleotide of codon 35 in exon 2 of the FAH gene, leading to a substitution of Ala by Thr.
    Figure Legend Snippet: Identification of the Ala35Thr mutation . PCR-amplified genomic DNA was sequenced and revealed a G to A transition in the first nucleotide of codon 35 in exon 2 of the FAH gene, leading to a substitution of Ala by Thr.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification

    7) Product Images from "Metastasis-associated protein 1 (MTA1) is transferred by exosomes and contributes to the regulation of hypoxia and estrogen signaling in breast cancer cells"

    Article Title: Metastasis-associated protein 1 (MTA1) is transferred by exosomes and contributes to the regulation of hypoxia and estrogen signaling in breast cancer cells

    Journal: Cell Communication and Signaling : CCS

    doi: 10.1186/s12964-019-0325-7

    CRISPR/Cas9 deletion of MTA1 in breast cancer cells. a . T7 endonuclease assay PCR results. Electropherogram of the T7 endonuclease digestion of MTA1 genomic PCR products visualized on an Agilent Bioanalyzer DNA 1000 Chip. Due to location of sgRNA target site, digestion of PCR products was predicted to generate the following fragments: wildtype 800 bp, sgRNA #1: 500 and 310 bp, sgRNA#3: 700 and 100 bp, and sgRNA #5: 760 and 40 bp. b . Western blot of MTA1 in MCF7 and MDA-MB-231 MTA1 knockout cells. GAPDH is included as an equal loading control. c . Cell proliferation assay of MCF7 and MDA-MB-231 knockout cells, compared to cells expressing an empty vector, n = 4 **** p
    Figure Legend Snippet: CRISPR/Cas9 deletion of MTA1 in breast cancer cells. a . T7 endonuclease assay PCR results. Electropherogram of the T7 endonuclease digestion of MTA1 genomic PCR products visualized on an Agilent Bioanalyzer DNA 1000 Chip. Due to location of sgRNA target site, digestion of PCR products was predicted to generate the following fragments: wildtype 800 bp, sgRNA #1: 500 and 310 bp, sgRNA#3: 700 and 100 bp, and sgRNA #5: 760 and 40 bp. b . Western blot of MTA1 in MCF7 and MDA-MB-231 MTA1 knockout cells. GAPDH is included as an equal loading control. c . Cell proliferation assay of MCF7 and MDA-MB-231 knockout cells, compared to cells expressing an empty vector, n = 4 **** p

    Techniques Used: CRISPR, Polymerase Chain Reaction, Chromatin Immunoprecipitation, Western Blot, Multiple Displacement Amplification, Knock-Out, Proliferation Assay, Expressing, Plasmid Preparation

    8) Product Images from "A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis"

    Article Title: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis

    Journal: Scientific Reports

    doi: 10.1038/srep41497

    AoMYB35 is absent in female Asparagus officinalis plants. ( a ) Genomic PCR analysis of the genes encoding MYB and bHLH transcription factors that could regulate anther development. Genomic DNA was extracted from female ( mm ) and supermale ( MM ) plants of the A. officinalis cultivar Gijnlim, and used as the PCR template. ( b ) Genomic DNA of male ( Mm ) plants of Gijnlim was also subjected to the PCR analysis of AoMYB35 and AoAMS as in panel a. The middle (fourth) lane shows the pattern of a DNA size marker. ( c ) Genomic DNA was prepared from female (F) and male (M) plants of the indicated cultivars (MW500W: Mary Washington 500 W; NJ264: New Jersey 264; RvB: Ruhm von Braunschweig), and subjected to the PCR analysis of AoMYB35 and AoAMS as in panel a. Experiments were repeated more than three times for each gene in the panels a–c, and representative cropped gel images are shown. ( d ) Southern blot analysis of AoMYB35 . Twenty μg genomic DNA of female (F) and male (M) plants of NJ264 was digested by either Xba I or Hind III, and subjected to Southern blotting. Signals were detected using a digoxigenin (DIG)-labeled AoMYB35 -specific probe (left panel). In the right panel, gel images are shown as loading controls (Ctrl: 1.5 μg undigested DNA was run in each lane; Hind III and Xba I: 20 μg digested DNA was run in each lane). Experiments were repeated three times, and a representative result is shown.
    Figure Legend Snippet: AoMYB35 is absent in female Asparagus officinalis plants. ( a ) Genomic PCR analysis of the genes encoding MYB and bHLH transcription factors that could regulate anther development. Genomic DNA was extracted from female ( mm ) and supermale ( MM ) plants of the A. officinalis cultivar Gijnlim, and used as the PCR template. ( b ) Genomic DNA of male ( Mm ) plants of Gijnlim was also subjected to the PCR analysis of AoMYB35 and AoAMS as in panel a. The middle (fourth) lane shows the pattern of a DNA size marker. ( c ) Genomic DNA was prepared from female (F) and male (M) plants of the indicated cultivars (MW500W: Mary Washington 500 W; NJ264: New Jersey 264; RvB: Ruhm von Braunschweig), and subjected to the PCR analysis of AoMYB35 and AoAMS as in panel a. Experiments were repeated more than three times for each gene in the panels a–c, and representative cropped gel images are shown. ( d ) Southern blot analysis of AoMYB35 . Twenty μg genomic DNA of female (F) and male (M) plants of NJ264 was digested by either Xba I or Hind III, and subjected to Southern blotting. Signals were detected using a digoxigenin (DIG)-labeled AoMYB35 -specific probe (left panel). In the right panel, gel images are shown as loading controls (Ctrl: 1.5 μg undigested DNA was run in each lane; Hind III and Xba I: 20 μg digested DNA was run in each lane). Experiments were repeated three times, and a representative result is shown.

    Techniques Used: Polymerase Chain Reaction, Marker, Southern Blot, Labeling

    Related Articles

    Clone Assay:

    Article Title: Rolling Circle Amplification, a Powerful Tool for Genetic and Functional Studies of Complete Hepatitis B Virus Genomes from Low-Level Infections and for Directly Probing Covalently Closed Circular DNA ▿
    Article Snippet: .. Full-length genomes amplified by RCA and then genomic PCR were cloned into pCR2.1-TOPO (Invitrogen, Cergy Pontoise, France) and fully sequenced. .. HuH7 cells were grown in Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal calf serum and antibiotics.

    Amplification:

    Article Title: Rolling Circle Amplification, a Powerful Tool for Genetic and Functional Studies of Complete Hepatitis B Virus Genomes from Low-Level Infections and for Directly Probing Covalently Closed Circular DNA ▿
    Article Snippet: .. Full-length genomes amplified by RCA and then genomic PCR were cloned into pCR2.1-TOPO (Invitrogen, Cergy Pontoise, France) and fully sequenced. .. HuH7 cells were grown in Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal calf serum and antibiotics.

    Article Title: A novel mutation causing mild, atypical fumarylacetoacetase deficiency (Tyrosinemia type I): a case report
    Article Snippet: .. Genomic PCR, sequencing and restriction analysis A genomic DNA product of 252 bp across FAH exon 2 was PCR amplified with primers 5'-GGACTCTTCAATAGACAGG-3' (sense, intron 1) and 5'-CCACAGTAAGTGCCACTGAG-3' (antisense, intron 2) and used for direct sequencing (Thermo Sequenase radiolabeled terminator cycle sequencing kit from Amersham, The Netherlands). .. For enzyme restriction analysis a 175 bp PCR product across the mutation was amplified by 30 cycles of 94°C for 30 sec and 60°C for 60 sec, followed by 3 min final extension at 72°C.

    Mouse Assay:

    Article Title: PRAS40 plays a pivotal role in protecting against stroke by linking the Akt and mTOR pathways
    Article Snippet: .. In brief, genomic DNA was extracted from the tail of mice using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA), and genomic PCR was performed with Taq DNA Polymerase High Fidelity (Invitrogen, Carlsbad, CA, USA) under the following conditions: 94 °C for 60 s; 30 cycles at 94 °C for 60 s, 55 °C for 45 s, and 72 °C for 45 s; and 72 °C for 6 min. One primer pair (forward PCR primer: GGGGCGCTCTGAGATTAAAG, reverse PCR primer: GGTGACAGTCCTCTAGCCC) amplifies a fragment of 225 bp in mice homozygous or heterozygous for endogenous gene (no band will be generated by this oligo pair in a cre-recombinant homozygous mice). .. Another set of primers (forward PCR primer: GTGGTGTGCATGTGTGACTTG, reverse PCR primer: GGTGACAGTCCTCTAGCCC) generates a product of 300 bp in a cre recombined homozygous and heterozygous mice but not in non-recombined mice.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis
    Article Snippet: .. RT-PCR and genomic PCR For RT-PCR to clone the AoMYB35 cDNA, total RNA was extracted using TRIzol reagent (Thermo Fischer Scientific, Waltham, MA) from young flower buds of female and male plants of the A. officinalis cultivar New Jersey 264 (NJ264) maintained for 10–20 years in the open field of Hokkaido University. .. First-strand cDNA was synthesized from 2 μg total RNA using the M-MLV reverse transcriptase (Promega, Fitchburg, WI) and the primer 5′-AAGCAGTGGTAACAACGCAGAG(T)30 VN-3′.

    Polymerase Chain Reaction:

    Article Title: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis
    Article Snippet: .. RT-PCR and genomic PCR For RT-PCR to clone the AoMYB35 cDNA, total RNA was extracted using TRIzol reagent (Thermo Fischer Scientific, Waltham, MA) from young flower buds of female and male plants of the A. officinalis cultivar New Jersey 264 (NJ264) maintained for 10–20 years in the open field of Hokkaido University. .. First-strand cDNA was synthesized from 2 μg total RNA using the M-MLV reverse transcriptase (Promega, Fitchburg, WI) and the primer 5′-AAGCAGTGGTAACAACGCAGAG(T)30 VN-3′.

    Article Title: PRAS40 plays a pivotal role in protecting against stroke by linking the Akt and mTOR pathways
    Article Snippet: .. In brief, genomic DNA was extracted from the tail of mice using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA), and genomic PCR was performed with Taq DNA Polymerase High Fidelity (Invitrogen, Carlsbad, CA, USA) under the following conditions: 94 °C for 60 s; 30 cycles at 94 °C for 60 s, 55 °C for 45 s, and 72 °C for 45 s; and 72 °C for 6 min. One primer pair (forward PCR primer: GGGGCGCTCTGAGATTAAAG, reverse PCR primer: GGTGACAGTCCTCTAGCCC) amplifies a fragment of 225 bp in mice homozygous or heterozygous for endogenous gene (no band will be generated by this oligo pair in a cre-recombinant homozygous mice). .. Another set of primers (forward PCR primer: GTGGTGTGCATGTGTGACTTG, reverse PCR primer: GGTGACAGTCCTCTAGCCC) generates a product of 300 bp in a cre recombined homozygous and heterozygous mice but not in non-recombined mice.

    Article Title: Expression of MLL-AF4 or AF4-MLL fusions does not impact the efficiency of DNA damage repair
    Article Snippet: .. PCR detection of targeted homologous recombination In order to verify the CRISPR/Cas9-mediated integration in the AAVS locus, genomic PCR was performed using Taq DNA polymerase (Invitrogen) according to the manufacturer's instructions. .. To amplify the 5′; junction, two pairs of primers were designed inside the donor cassette (in the puro or neo gene) and outside the 5′; homologous recombination (HR) region.

    Article Title: Partial duplication of DHH causes minifascicular neuropathy
    Article Snippet: .. To search for the breakpoint junctions, we performed genomic PCR using the primer set: F2 (5′‐CTACCATCGACTCAGATTCT‐3′) and R2 (5′‐GCTCCCCTCCCTCCGCCTGA‐3′) (Fig. C), followed by direct nucleotide sequence analysis using a Big Dye Terminator version 3.1 and an ABI 3130xl genetic analyzer (Applied Biosystems, Carlsbad, CA). .. RT‐PCR analysis of DHH mRNA expression in sural nerves Total RNAs were extracted from the sural nerves of patient 1 and a control individual using TRIzol reagent (Invitrogen, Carlsbad, CA). cDNA synthesis was performed using the ReverTra Ace‐α ‐™ (Toyobo, Osaka, Japan) with an oligo dT primer.

    Article Title: Rolling Circle Amplification, a Powerful Tool for Genetic and Functional Studies of Complete Hepatitis B Virus Genomes from Low-Level Infections and for Directly Probing Covalently Closed Circular DNA ▿
    Article Snippet: .. Full-length genomes amplified by RCA and then genomic PCR were cloned into pCR2.1-TOPO (Invitrogen, Cergy Pontoise, France) and fully sequenced. .. HuH7 cells were grown in Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal calf serum and antibiotics.

    Article Title: T Cells Contribute to Stroke-Induced Lymphopenia in Rats
    Article Snippet: .. In brief, genomic DNA was extracted from the tail of rats using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA), and genomic PCR was performed with Taq DNA Polymerase High Fidelity (Invitrogen, Carlsbad, CA, USA) under the following conditions: 95°C for 30 s; 30 cycles at 94°C for 15 s, 55°C for 15 s, and 72°C for 35 s; and 72°C for 5 min. .. Forward PCR primers were 5′-CACCAGCAGCCATTGTTGTCA-3′ and reverse primers were 5′-CATGGTCCTGGCTGAGGAAG-3′ .

    Article Title: Metastasis-associated protein 1 (MTA1) is transferred by exosomes and contributes to the regulation of hypoxia and estrogen signaling in breast cancer cells
    Article Snippet: .. Genomic PCR, T7 endonuclease assay, and sanger sequencing Genomic DNA was extracted from wildtype and Cas9/sgRNA transduced and puromycin selected MCF7 cells using the Pure Link Genomic DNA Mini-kit (Invitrogen) according to the manufacturer’s protocol. ..

    Generated:

    Article Title: PRAS40 plays a pivotal role in protecting against stroke by linking the Akt and mTOR pathways
    Article Snippet: .. In brief, genomic DNA was extracted from the tail of mice using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA), and genomic PCR was performed with Taq DNA Polymerase High Fidelity (Invitrogen, Carlsbad, CA, USA) under the following conditions: 94 °C for 60 s; 30 cycles at 94 °C for 60 s, 55 °C for 45 s, and 72 °C for 45 s; and 72 °C for 6 min. One primer pair (forward PCR primer: GGGGCGCTCTGAGATTAAAG, reverse PCR primer: GGTGACAGTCCTCTAGCCC) amplifies a fragment of 225 bp in mice homozygous or heterozygous for endogenous gene (no band will be generated by this oligo pair in a cre-recombinant homozygous mice). .. Another set of primers (forward PCR primer: GTGGTGTGCATGTGTGACTTG, reverse PCR primer: GGTGACAGTCCTCTAGCCC) generates a product of 300 bp in a cre recombined homozygous and heterozygous mice but not in non-recombined mice.

    CRISPR:

    Article Title: Expression of MLL-AF4 or AF4-MLL fusions does not impact the efficiency of DNA damage repair
    Article Snippet: .. PCR detection of targeted homologous recombination In order to verify the CRISPR/Cas9-mediated integration in the AAVS locus, genomic PCR was performed using Taq DNA polymerase (Invitrogen) according to the manufacturer's instructions. .. To amplify the 5′; junction, two pairs of primers were designed inside the donor cassette (in the puro or neo gene) and outside the 5′; homologous recombination (HR) region.

    Sequencing:

    Article Title: Partial duplication of DHH causes minifascicular neuropathy
    Article Snippet: .. To search for the breakpoint junctions, we performed genomic PCR using the primer set: F2 (5′‐CTACCATCGACTCAGATTCT‐3′) and R2 (5′‐GCTCCCCTCCCTCCGCCTGA‐3′) (Fig. C), followed by direct nucleotide sequence analysis using a Big Dye Terminator version 3.1 and an ABI 3130xl genetic analyzer (Applied Biosystems, Carlsbad, CA). .. RT‐PCR analysis of DHH mRNA expression in sural nerves Total RNAs were extracted from the sural nerves of patient 1 and a control individual using TRIzol reagent (Invitrogen, Carlsbad, CA). cDNA synthesis was performed using the ReverTra Ace‐α ‐™ (Toyobo, Osaka, Japan) with an oligo dT primer.

    Article Title: A novel mutation causing mild, atypical fumarylacetoacetase deficiency (Tyrosinemia type I): a case report
    Article Snippet: .. Genomic PCR, sequencing and restriction analysis A genomic DNA product of 252 bp across FAH exon 2 was PCR amplified with primers 5'-GGACTCTTCAATAGACAGG-3' (sense, intron 1) and 5'-CCACAGTAAGTGCCACTGAG-3' (antisense, intron 2) and used for direct sequencing (Thermo Sequenase radiolabeled terminator cycle sequencing kit from Amersham, The Netherlands). .. For enzyme restriction analysis a 175 bp PCR product across the mutation was amplified by 30 cycles of 94°C for 30 sec and 60°C for 60 sec, followed by 3 min final extension at 72°C.

    Article Title: Metastasis-associated protein 1 (MTA1) is transferred by exosomes and contributes to the regulation of hypoxia and estrogen signaling in breast cancer cells
    Article Snippet: .. Genomic PCR, T7 endonuclease assay, and sanger sequencing Genomic DNA was extracted from wildtype and Cas9/sgRNA transduced and puromycin selected MCF7 cells using the Pure Link Genomic DNA Mini-kit (Invitrogen) according to the manufacturer’s protocol. ..

    Homologous Recombination:

    Article Title: Expression of MLL-AF4 or AF4-MLL fusions does not impact the efficiency of DNA damage repair
    Article Snippet: .. PCR detection of targeted homologous recombination In order to verify the CRISPR/Cas9-mediated integration in the AAVS locus, genomic PCR was performed using Taq DNA polymerase (Invitrogen) according to the manufacturer's instructions. .. To amplify the 5′; junction, two pairs of primers were designed inside the donor cassette (in the puro or neo gene) and outside the 5′; homologous recombination (HR) region.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher ncm460 cells
    Expression levels of SRPK1 in CRC cells. Notes: ( A ) SRPK1 mRNA levels in Caco2 and HT-29 CRC cells were detected by RT-qPCR, compared with that in <t>NCM460</t> cells; ( B ) SRPK1 protein levels in Caco2 and HT-29 CRC cells were detected by Western blot. * P
    Ncm460 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncm460 cells/product/Thermo Fisher
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    ncm460 cells - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    92
    Thermo Fisher dgat2 transcripts
    13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. <t>DGAT2</t> knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p
    Dgat2 Transcripts, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dgat2 transcripts/product/Thermo Fisher
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dgat2 transcripts - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    93
    Thermo Fisher balf cells
    Measurement of (A) PINK1 <t>mRNA,</t> (B) PARKIN mRNA and (C) PINK1 protein levels revealed similar results in <t>BALF</t> cells derived from patients with IPF and RA-ILD. (A and B) PINK1 and PARKIN expression levels showed no statistically significant differences between the IPF and RA-ILD samples. Data were normalized to GAPDH and are represented as the median with 10–90% range. No significant differences, as determined by the Mann-Whitney U test (P > 0.05). (C) Western blot analysis of pink1 protein normalized to actin. No significant difference, as determined by the Mann-Whitney U test (P > 0.05). RA-ILD, rheumatoid arthritis-interstitial lung disease; IPF, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.
    Balf Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/balf cells/product/Thermo Fisher
    Average 93 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    balf cells - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    Image Search Results


    Expression levels of SRPK1 in CRC cells. Notes: ( A ) SRPK1 mRNA levels in Caco2 and HT-29 CRC cells were detected by RT-qPCR, compared with that in NCM460 cells; ( B ) SRPK1 protein levels in Caco2 and HT-29 CRC cells were detected by Western blot. * P

    Journal: OncoTargets and therapy

    Article Title: SRPK1 is a poor prognostic indicator and a novel potential therapeutic target for human colorectal cancer

    doi: 10.2147/OTT.S172541

    Figure Lengend Snippet: Expression levels of SRPK1 in CRC cells. Notes: ( A ) SRPK1 mRNA levels in Caco2 and HT-29 CRC cells were detected by RT-qPCR, compared with that in NCM460 cells; ( B ) SRPK1 protein levels in Caco2 and HT-29 CRC cells were detected by Western blot. * P

    Article Snippet: Caco2, HT29, and NCM460 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Waltham, MA, USA) at 37°C in a humidified incubator with 5% CO2 . siRNA was designed for targeting SRPK1 (siSRPK1), and an siSRPK1 sequence-scrambled RNA oligo used as the siRNA negative control (siNC).

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. DGAT2 knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p

    Journal: Cell Reports

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    doi: 10.1016/j.celrep.2018.08.015

    Figure Lengend Snippet: 13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. DGAT2 knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p

    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Techniques: Liquid Chromatography with Mass Spectroscopy, shRNA, Inhibition, Knock-Out, Labeling, Staining

    DGAT Loss Reduces Tumor Growth and Alters Lipid Composition In Vivo (A) Diagram of fatty acid and lipid synthesis and the influence of O 2 and exogenous lipid. (B) Growth curves for A498 xenograft tumors with induced (doxycycline chow) and un-induced (control chow) DGAT1 and DGAT2 shRNAs (hereafter called DGAT shRNA). (C) Tumor weights after necropsy. (D) Immunohistochemistry for cleaved caspase-3 and Ki67 in xenograft tumors collected on day 5 of treatment, with accompanying quantification. (E) Total TG abundance derived from summing individual TG species abundance after liquid chromatography-mass spectrometry (LC-MS) quantification. (F) TG species binned according to the number of fully saturated FA chains present and the abundance of each category summed and displayed as a ratio of doxycycline-treated versus control groups. All results are means of n = 10 tumors (2 tumors per mouse) per arm; error bars represent ± SD (B, D, and F) or ± SEM (C). Statistical significance by t test or ANOVA, as appropriate; ∗ p

    Journal: Cell Reports

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    doi: 10.1016/j.celrep.2018.08.015

    Figure Lengend Snippet: DGAT Loss Reduces Tumor Growth and Alters Lipid Composition In Vivo (A) Diagram of fatty acid and lipid synthesis and the influence of O 2 and exogenous lipid. (B) Growth curves for A498 xenograft tumors with induced (doxycycline chow) and un-induced (control chow) DGAT1 and DGAT2 shRNAs (hereafter called DGAT shRNA). (C) Tumor weights after necropsy. (D) Immunohistochemistry for cleaved caspase-3 and Ki67 in xenograft tumors collected on day 5 of treatment, with accompanying quantification. (E) Total TG abundance derived from summing individual TG species abundance after liquid chromatography-mass spectrometry (LC-MS) quantification. (F) TG species binned according to the number of fully saturated FA chains present and the abundance of each category summed and displayed as a ratio of doxycycline-treated versus control groups. All results are means of n = 10 tumors (2 tumors per mouse) per arm; error bars represent ± SD (B, D, and F) or ± SEM (C). Statistical significance by t test or ANOVA, as appropriate; ∗ p

    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Techniques: In Vivo, shRNA, Immunohistochemistry, Derivative Assay, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy

    TGs Promote Cell Viability in Low O 2 and Serum by Absorbing FA Saturation (A) Viability of A498 cells expressing inducible shRNA against DGAT1 and DGAT2 mRNAs ( DGAT shRNA), assessed after 72 hr under the indicated conditions (hypoxia = 0.5% O 2 ; serum deprivation = low serum, 0.5% fetal bovine serum [FBS]) by Annexin-propidium iodide (PI) flow cytometry assay. (B) Viability of cells expressing inducible DGAT shRNAs after 72 hr under the indicated conditions (SCDi, 1 μM CAY10566) by Annexin-PI assay using flow cytometry. (C) Volcano plot showing fold change and significance of alterations in the lipidome of A498 cells cultured in low (0.5%) versus high (5%) serum. Lipids with ≥ 1.5 fold change and p ≤ 0.05 are displayed in color to denote lipid class. (D) Changes in FA composition or saturation of TGs, calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values are normalized to control conditions (5% serum). (E) Lipid class-specific saturation indices (defined by (palmitate + stearate) / oleate) for A498 cells cultured under hypoxic (0.5% O 2 ) versus normoxic conditions (both in low serum). (F) As (E) but with pharmacological SCD inhibition (1 μM CAY10566) instead of hypoxia. (G) Effect of serum deprivation and DGAT shRNA on total TG abundances. (H) Changes in FA makeup of TGs following DGAT knockdown; values were calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values were normalized to the control condition (vehicle [Veh] treatment). (I) TG saturation indices for the indicated conditions. Values are relative to normoxic untreated cells. (J) As (G) but with pharmacological SCD inhibition (1 μM CAY10566). Values are relative to the untreated vehicle control. Data are means of 3 (A, B, and D–J) or 5 (C) replicate wells and were confirmed in independent experiments; error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗∗ p

    Journal: Cell Reports

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    doi: 10.1016/j.celrep.2018.08.015

    Figure Lengend Snippet: TGs Promote Cell Viability in Low O 2 and Serum by Absorbing FA Saturation (A) Viability of A498 cells expressing inducible shRNA against DGAT1 and DGAT2 mRNAs ( DGAT shRNA), assessed after 72 hr under the indicated conditions (hypoxia = 0.5% O 2 ; serum deprivation = low serum, 0.5% fetal bovine serum [FBS]) by Annexin-propidium iodide (PI) flow cytometry assay. (B) Viability of cells expressing inducible DGAT shRNAs after 72 hr under the indicated conditions (SCDi, 1 μM CAY10566) by Annexin-PI assay using flow cytometry. (C) Volcano plot showing fold change and significance of alterations in the lipidome of A498 cells cultured in low (0.5%) versus high (5%) serum. Lipids with ≥ 1.5 fold change and p ≤ 0.05 are displayed in color to denote lipid class. (D) Changes in FA composition or saturation of TGs, calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values are normalized to control conditions (5% serum). (E) Lipid class-specific saturation indices (defined by (palmitate + stearate) / oleate) for A498 cells cultured under hypoxic (0.5% O 2 ) versus normoxic conditions (both in low serum). (F) As (E) but with pharmacological SCD inhibition (1 μM CAY10566) instead of hypoxia. (G) Effect of serum deprivation and DGAT shRNA on total TG abundances. (H) Changes in FA makeup of TGs following DGAT knockdown; values were calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values were normalized to the control condition (vehicle [Veh] treatment). (I) TG saturation indices for the indicated conditions. Values are relative to normoxic untreated cells. (J) As (G) but with pharmacological SCD inhibition (1 μM CAY10566). Values are relative to the untreated vehicle control. Data are means of 3 (A, B, and D–J) or 5 (C) replicate wells and were confirmed in independent experiments; error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗∗ p

    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Techniques: Expressing, shRNA, Flow Cytometry, Cytometry, Cell Culture, Inhibition

    Measurement of (A) PINK1 mRNA, (B) PARKIN mRNA and (C) PINK1 protein levels revealed similar results in BALF cells derived from patients with IPF and RA-ILD. (A and B) PINK1 and PARKIN expression levels showed no statistically significant differences between the IPF and RA-ILD samples. Data were normalized to GAPDH and are represented as the median with 10–90% range. No significant differences, as determined by the Mann-Whitney U test (P > 0.05). (C) Western blot analysis of pink1 protein normalized to actin. No significant difference, as determined by the Mann-Whitney U test (P > 0.05). RA-ILD, rheumatoid arthritis-interstitial lung disease; IPF, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.

    Journal: Molecular Medicine Reports

    Article Title: Investigation of key autophagy-and mitophagy-related proteins and gene expression in BALF cells from patients with IPF and RA-ILD

    doi: 10.3892/mmr.2018.9356

    Figure Lengend Snippet: Measurement of (A) PINK1 mRNA, (B) PARKIN mRNA and (C) PINK1 protein levels revealed similar results in BALF cells derived from patients with IPF and RA-ILD. (A and B) PINK1 and PARKIN expression levels showed no statistically significant differences between the IPF and RA-ILD samples. Data were normalized to GAPDH and are represented as the median with 10–90% range. No significant differences, as determined by the Mann-Whitney U test (P > 0.05). (C) Western blot analysis of pink1 protein normalized to actin. No significant difference, as determined by the Mann-Whitney U test (P > 0.05). RA-ILD, rheumatoid arthritis-interstitial lung disease; IPF, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.

    Article Snippet: RNA extraction and mRNA expression analysis Total RNA was isolated from BALF cells using the mirVana™ miRNA isolation kit (Ambion/Thermo Fisher Scientific) with minor modifications.

    Techniques: Derivative Assay, Expressing, MANN-WHITNEY, Western Blot

    (A) mRNA expression of p62 in patients with IPF (n=55) and RA-ILD (n=20). Data were analyzed by RT-qPCR and normalized to GAPDH . No significant differences, as determined by the Mann-Whitney U test (P > 0.05). Data are represented as the median with 10–90% range. (B) Representative western blot showing similar protein levels of p62 in BALF cells from patients with IPF and RA-ILD. Analysis of patients with IPF (n=5) and RA-ILD (n=3) revealed no significant differences in the p62 protein levels (p62/actin). RA-ILD, rheumatoid arthritis-interstitial lung disease; IPF, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.

    Journal: Molecular Medicine Reports

    Article Title: Investigation of key autophagy-and mitophagy-related proteins and gene expression in BALF cells from patients with IPF and RA-ILD

    doi: 10.3892/mmr.2018.9356

    Figure Lengend Snippet: (A) mRNA expression of p62 in patients with IPF (n=55) and RA-ILD (n=20). Data were analyzed by RT-qPCR and normalized to GAPDH . No significant differences, as determined by the Mann-Whitney U test (P > 0.05). Data are represented as the median with 10–90% range. (B) Representative western blot showing similar protein levels of p62 in BALF cells from patients with IPF and RA-ILD. Analysis of patients with IPF (n=5) and RA-ILD (n=3) revealed no significant differences in the p62 protein levels (p62/actin). RA-ILD, rheumatoid arthritis-interstitial lung disease; IPF, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.

    Article Snippet: RNA extraction and mRNA expression analysis Total RNA was isolated from BALF cells using the mirVana™ miRNA isolation kit (Ambion/Thermo Fisher Scientific) with minor modifications.

    Techniques: Expressing, Quantitative RT-PCR, MANN-WHITNEY, Western Blot