Structured Review

Roche huat2 primer pairs
( a ) FISH of BAC probes for hUAT to metaphase chromosomes. Chromosomes fluoresce blue with DAPI. The green fluorescent signal results from avidin-FITC binding to the biotin-labeled BAC 452D14 probe for hUAT , and the red signal reflects anti-digoxigenin–Cy3 binding to the digoxigenin-labeled BAC 305N23 probe. Both probes bind to the same region of each chromosome 17 in the metaphase. ( b ) Enlarged image demonstrating overlapping labeling by both probes of the centromeric region of the short arm of chromosome 17. ( c ) Interphase nuclei demonstrating overlapping binding of the two BAC probes for hUAT . ( d ) Ideogram of chromosome 17 depicting the localization of hUAT and <t>hUAT2</t> . PCR of the Stanford G3 radiation hybrid panel with primers specific for hUAT or hUAT2 indicates that hUAT (marker D17S2123) and hUAT2 (D17S1857) map to nearby markers on the short arm of chromosome 17 between 17p11.2 and 17p12.
Huat2 Primer Pairs, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 3374 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/huat2 primer pairs/product/Roche
Average 85 stars, based on 3374 article reviews
Price from $9.99 to $1999.99
huat2 primer pairs - by Bioz Stars, 2020-05
85/100 stars

Images

1) Product Images from "Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter"

Article Title: Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter

Journal: Journal of Clinical Investigation

doi:

( a ) FISH of BAC probes for hUAT to metaphase chromosomes. Chromosomes fluoresce blue with DAPI. The green fluorescent signal results from avidin-FITC binding to the biotin-labeled BAC 452D14 probe for hUAT , and the red signal reflects anti-digoxigenin–Cy3 binding to the digoxigenin-labeled BAC 305N23 probe. Both probes bind to the same region of each chromosome 17 in the metaphase. ( b ) Enlarged image demonstrating overlapping labeling by both probes of the centromeric region of the short arm of chromosome 17. ( c ) Interphase nuclei demonstrating overlapping binding of the two BAC probes for hUAT . ( d ) Ideogram of chromosome 17 depicting the localization of hUAT and hUAT2 . PCR of the Stanford G3 radiation hybrid panel with primers specific for hUAT or hUAT2 indicates that hUAT (marker D17S2123) and hUAT2 (D17S1857) map to nearby markers on the short arm of chromosome 17 between 17p11.2 and 17p12.
Figure Legend Snippet: ( a ) FISH of BAC probes for hUAT to metaphase chromosomes. Chromosomes fluoresce blue with DAPI. The green fluorescent signal results from avidin-FITC binding to the biotin-labeled BAC 452D14 probe for hUAT , and the red signal reflects anti-digoxigenin–Cy3 binding to the digoxigenin-labeled BAC 305N23 probe. Both probes bind to the same region of each chromosome 17 in the metaphase. ( b ) Enlarged image demonstrating overlapping labeling by both probes of the centromeric region of the short arm of chromosome 17. ( c ) Interphase nuclei demonstrating overlapping binding of the two BAC probes for hUAT . ( d ) Ideogram of chromosome 17 depicting the localization of hUAT and hUAT2 . PCR of the Stanford G3 radiation hybrid panel with primers specific for hUAT or hUAT2 indicates that hUAT (marker D17S2123) and hUAT2 (D17S1857) map to nearby markers on the short arm of chromosome 17 between 17p11.2 and 17p12.

Techniques Used: Fluorescence In Situ Hybridization, BAC Assay, Avidin-Biotin Assay, Binding Assay, Labeling, Polymerase Chain Reaction, Marker

PCR of human genomic DNA (lanes 1, 2) and BAC clones 452D14 (lanes 3–6) and 305N23 (lanes 7–10). Lanes 1, 3, 4, 7, and 8 are PCR products obtained with hUAT -specific primers. Lanes 2, 5, 6, 9, and 10 are PCR products obtained with hUAT2 -specific primers. Lane 0 is a 1-kbp DNA ladder.
Figure Legend Snippet: PCR of human genomic DNA (lanes 1, 2) and BAC clones 452D14 (lanes 3–6) and 305N23 (lanes 7–10). Lanes 1, 3, 4, 7, and 8 are PCR products obtained with hUAT -specific primers. Lanes 2, 5, 6, 9, and 10 are PCR products obtained with hUAT2 -specific primers. Lane 0 is a 1-kbp DNA ladder.

Techniques Used: Polymerase Chain Reaction, BAC Assay, Clone Assay

Comparison of PCR products amplified from CLONTECH Laboratories Inc. MTC cDNA panels using primers specific for hUAT, hUAT2, or GAPDH. The specific gene amplified is indicated to the left of the figure, the tissue from which the cDNA was isolated at the top, and the size of the PCR product on the right.
Figure Legend Snippet: Comparison of PCR products amplified from CLONTECH Laboratories Inc. MTC cDNA panels using primers specific for hUAT, hUAT2, or GAPDH. The specific gene amplified is indicated to the left of the figure, the tissue from which the cDNA was isolated at the top, and the size of the PCR product on the right.

Techniques Used: Polymerase Chain Reaction, Amplification, Isolation

2) Product Images from "High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic"

Article Title: High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic

Journal: BMC Medical Genetics

doi: 10.1186/1471-2350-8-32

Confirmation and characterization of the rearrangements . (A) Confirmation of the deletion of exons 1A/1B-2 by long-range PCR and sequencing of the breakpoints. (B) Confirmation of the deletion of exons 5–14 by long-range PCR and sequencing of the breakpoints. (C) Confirmation of the deletion of exons 11–12 by long-range PCR and sequencing of the breakpoints. Lanes 1+, 2+, carriers of the deletion; lane C-, negative control (wt); lane B, blank; lane M, marker (Ready-Load™ 1 Kb DNA Ladder, Invitrogen).
Figure Legend Snippet: Confirmation and characterization of the rearrangements . (A) Confirmation of the deletion of exons 1A/1B-2 by long-range PCR and sequencing of the breakpoints. (B) Confirmation of the deletion of exons 5–14 by long-range PCR and sequencing of the breakpoints. (C) Confirmation of the deletion of exons 11–12 by long-range PCR and sequencing of the breakpoints. Lanes 1+, 2+, carriers of the deletion; lane C-, negative control (wt); lane B, blank; lane M, marker (Ready-Load™ 1 Kb DNA Ladder, Invitrogen).

Techniques Used: Polymerase Chain Reaction, Sequencing, Negative Control, Marker

Confirmation and characterization of the rearrangements . (A) Confirmation of the deletion of exons 18–19 by long-range PCR and sequencing of the breakpoints. (B) Confirmation of the deletion of exon 20 and sequencing of the breakpoints.Lanes 1+, 2+, carriers of the deletion; lane C-, negative control (wt); lane B, blank; lane M, marker (Ready-Load™ 1 Kb DNA Ladder, Invitrogen).
Figure Legend Snippet: Confirmation and characterization of the rearrangements . (A) Confirmation of the deletion of exons 18–19 by long-range PCR and sequencing of the breakpoints. (B) Confirmation of the deletion of exon 20 and sequencing of the breakpoints.Lanes 1+, 2+, carriers of the deletion; lane C-, negative control (wt); lane B, blank; lane M, marker (Ready-Load™ 1 Kb DNA Ladder, Invitrogen).

Techniques Used: Polymerase Chain Reaction, Sequencing, Negative Control, Marker

Confirmation and characterization of the rearrangements . Confirmation of the deletion of the exons 21–22 by long-range PCR and sequencing of the breakpoints. The deletion/insertion event was characterized as g.77128_80906del3779ins236. Lanes 1+, 2+, carriers of the deletion; lane C-, negative control (wt); lane B, blank; lane M, marker (Ready-Load™ 1 Kb DNA Ladder, Invitrogen).
Figure Legend Snippet: Confirmation and characterization of the rearrangements . Confirmation of the deletion of the exons 21–22 by long-range PCR and sequencing of the breakpoints. The deletion/insertion event was characterized as g.77128_80906del3779ins236. Lanes 1+, 2+, carriers of the deletion; lane C-, negative control (wt); lane B, blank; lane M, marker (Ready-Load™ 1 Kb DNA Ladder, Invitrogen).

Techniques Used: Polymerase Chain Reaction, Sequencing, Negative Control, Marker

3) Product Images from "Long Range Regulation of Human FXN Gene Expression"

Article Title: Long Range Regulation of Human FXN Gene Expression

Journal: PLoS ONE

doi: 10.1371/journal.pone.0022001

Cross species sequence comparison. Analysis of cross species sequence comparison of the upstream non-coding region of the FXN gene utilizing data from the UCSC Genome Browser using the March 2006 (NCBI36/hg18) assembly ( http://genome.cse.ucsc.edu ). (A) The position of the human FXN gene on chromosome 9 is shown. The BLASTZ track shows the BLASTZ alignment of human FXN and the mouse Fxn genes. BlastZ alignments were taken from GenomeTraFaC [27] . The genomic sequences with flanking (upstream to 5′ and downstream to 3′) 40 kb base pairs of more than 12,000 human and mouse orthologous gene pairs that had a validated RefSeq ID from the Reference Sequence data of NCBI were downloaded from the UCSC Genome Browser (Human May 2004 and March 2006 assemblies, and Mouse August 2005 and February 2006 assemblies). Sequence alignment was done using the BlastZ algorithm of PipMaker. The location of each conserved non-coding region identified upstream of the human FXN gene is shown. The 7× regulatory potential (ESPERR Regulatory Potential) displays the regulatory potential (RP) scores computed from alignment of human, chimpanzee, macaque, mouse, rat, dog, and cow. The peaks illustrate the position of sequences conserved between the human FXN gene and orthologs in each of the individual species. The PhastCons track shows predictions of conserved elements produced by the PhastCons program, which identifies conserved elements given a multiple alignment and a hidden Markov model [20] . Both the ESPERR and PhastCons tracks were obtained from the UCSC Genome Browser [18] . (B) The location (UCSC Genome Browser, Human March 2006 assembly) and size of eight highly conserved regions located upstream of exon 1 of the FXN gene are shown. The size of the deletion encompassing each conserved region made in the RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct is indicated.
Figure Legend Snippet: Cross species sequence comparison. Analysis of cross species sequence comparison of the upstream non-coding region of the FXN gene utilizing data from the UCSC Genome Browser using the March 2006 (NCBI36/hg18) assembly ( http://genome.cse.ucsc.edu ). (A) The position of the human FXN gene on chromosome 9 is shown. The BLASTZ track shows the BLASTZ alignment of human FXN and the mouse Fxn genes. BlastZ alignments were taken from GenomeTraFaC [27] . The genomic sequences with flanking (upstream to 5′ and downstream to 3′) 40 kb base pairs of more than 12,000 human and mouse orthologous gene pairs that had a validated RefSeq ID from the Reference Sequence data of NCBI were downloaded from the UCSC Genome Browser (Human May 2004 and March 2006 assemblies, and Mouse August 2005 and February 2006 assemblies). Sequence alignment was done using the BlastZ algorithm of PipMaker. The location of each conserved non-coding region identified upstream of the human FXN gene is shown. The 7× regulatory potential (ESPERR Regulatory Potential) displays the regulatory potential (RP) scores computed from alignment of human, chimpanzee, macaque, mouse, rat, dog, and cow. The peaks illustrate the position of sequences conserved between the human FXN gene and orthologs in each of the individual species. The PhastCons track shows predictions of conserved elements produced by the PhastCons program, which identifies conserved elements given a multiple alignment and a hidden Markov model [20] . Both the ESPERR and PhastCons tracks were obtained from the UCSC Genome Browser [18] . (B) The location (UCSC Genome Browser, Human March 2006 assembly) and size of eight highly conserved regions located upstream of exon 1 of the FXN gene are shown. The size of the deletion encompassing each conserved region made in the RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct is indicated.

Techniques Used: Sequencing, Genomic Sequencing, Produced, Construct

Expression analysis of BAC dual-reporter constructs containing deletions in conserved region 1. BHK-21 cells were transfected with the RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct and derivatives individually containing deletions of the entire conserved region 1 or the identified 17 bp sequence within conserved region 1. EGFP and DsRed-Express expression were measured by flow cytometry 72 hours post transfection. The expression of the different deletion constructs was compared to the expression of the control plasmid RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct. Assays were performed in triplicate on at least three independent occasions. Error bars represent standard error of the mean. ** p
Figure Legend Snippet: Expression analysis of BAC dual-reporter constructs containing deletions in conserved region 1. BHK-21 cells were transfected with the RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct and derivatives individually containing deletions of the entire conserved region 1 or the identified 17 bp sequence within conserved region 1. EGFP and DsRed-Express expression were measured by flow cytometry 72 hours post transfection. The expression of the different deletion constructs was compared to the expression of the control plasmid RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct. Assays were performed in triplicate on at least three independent occasions. Error bars represent standard error of the mean. ** p

Techniques Used: Expressing, BAC Assay, Construct, Transfection, Sequencing, Flow Cytometry, Cytometry, Plasmid Preparation

Expression analysis of BAC dual-reporter deletion constructs. BHK-21 cells were transfected with the RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct and derivatives individually containing deletions of the identified conserved non-coding regions. EGFP and DsRed-Express expression were measured by flow cytometry 72 hours post transfection. The expression of the different deletion constructs was compared to the expression of the control RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct. Assays were performed in triplicate on at least three independent occasions. Error bars represent standard error of the mean. * p
Figure Legend Snippet: Expression analysis of BAC dual-reporter deletion constructs. BHK-21 cells were transfected with the RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct and derivatives individually containing deletions of the identified conserved non-coding regions. EGFP and DsRed-Express expression were measured by flow cytometry 72 hours post transfection. The expression of the different deletion constructs was compared to the expression of the control RP11-265B8::Ex5a-EK-DsAmp (Dual Reporter) construct. Assays were performed in triplicate on at least three independent occasions. Error bars represent standard error of the mean. * p

Techniques Used: Expressing, BAC Assay, Construct, Transfection, Flow Cytometry, Cytometry

4) Product Images from "Tmem26 Is Dynamically Expressed during Palate and Limb Development but Is Not Required for Embryonic Survival"

Article Title: Tmem26 Is Dynamically Expressed during Palate and Limb Development but Is Not Required for Embryonic Survival

Journal: PLoS ONE

doi: 10.1371/journal.pone.0025228

Tmem26 Ex2−/Ex2− mice appear phenotypically normal. ( A ) Dorsal and ( B ) ventral views of adult WT and Tmem26 Ex2−/Ex2− littermate mice. ( C–J ) Alcian blue/alizarin red staining of WT and Tmem26 Ex2−/Ex2− adult littermate skeletal preparations. ( C ) and ( D ) are at the same magnification. ( E,H ) Dorsal, ( F,I ) ventral and ( G,J ) lateral views of skull. In ( F,I ) the mandible has been removed to allow visualisation of the palate. ( K,L ) Transverse sections through the secondary palate of 15.5 dpc WT and Tmem26 Ex2−/Ex2− embryos. ( M ) Mean distance between the inner canthi of the eyes, and ( N ) mean length of the snout were compared between WT and Tmem26 Ex2−/Ex2− adult mice (n = 18 female mice, 20 male mice per genotype). ( O ) diagram showing the measurements taken. L-snout length; w-distance between the eyes. Error bars represent standard error of the mean (SEM), statistical analysis (Student's t-test) revealed no significant difference.
Figure Legend Snippet: Tmem26 Ex2−/Ex2− mice appear phenotypically normal. ( A ) Dorsal and ( B ) ventral views of adult WT and Tmem26 Ex2−/Ex2− littermate mice. ( C–J ) Alcian blue/alizarin red staining of WT and Tmem26 Ex2−/Ex2− adult littermate skeletal preparations. ( C ) and ( D ) are at the same magnification. ( E,H ) Dorsal, ( F,I ) ventral and ( G,J ) lateral views of skull. In ( F,I ) the mandible has been removed to allow visualisation of the palate. ( K,L ) Transverse sections through the secondary palate of 15.5 dpc WT and Tmem26 Ex2−/Ex2− embryos. ( M ) Mean distance between the inner canthi of the eyes, and ( N ) mean length of the snout were compared between WT and Tmem26 Ex2−/Ex2− adult mice (n = 18 female mice, 20 male mice per genotype). ( O ) diagram showing the measurements taken. L-snout length; w-distance between the eyes. Error bars represent standard error of the mean (SEM), statistical analysis (Student's t-test) revealed no significant difference.

Techniques Used: Mouse Assay, Staining

Expression of Tmem26 in wild-type embryos by section in situ hybridisation. ( A–D, E–G,J ) radioisotopic; ( H,I ) DIG detection. ( A–D ) Transverse sections through the secondary palate at indicated stages. At 12.5 dpc and 13.5 dpc Tmem26 is expressed in mesenchyme of the vertical palatal shelves. At 14.5 dpc the shelves have fused but the medial epithelial seam still remains and expression within the mesenchyme is apparent. By 15.5 dpc the epithelial seam is absent and Tmem26 expression is virtually undetectable. ( A′–D′ ) Corresponding serial sections stained with toluidine blue. ( E–G ) Sections through the facial prominences and primary palate region at indicated stages. Tmem26 is not detected at 10.5 dpc but is upregulated at 11.5 dpc and 12.5 dpc. ( E′–G′ ) Corresponding sections stained with toluidine blue. ( H ) Parasagittal section through the lateral hindbrain at 12.5 dpc, showing expression in the nucleus of the seventh facial nerve region within the pons. ( I ) Longitudinal section through the stomach at 11.5 dpc, showing expression in the anterior stomach mesenchyme. ( J ) Magnification of the left eyelid from D , ( J′ ) same section counterstained with haematoxylin. 1p-primary palate, bt-mesencyme at the base of the tongue, c-cornea, el-eyelid, em-extraocular mesenchyme and developing extrinsic muscles of the eye, ep-epithelim, L-eye lens, lnp-lateral nasal prominence, n7-nucleus of the seventh facial nerve, mn-mandible, mnp-medial nasal prominence, mx-maxillary prominence, ns-nasal septum, p-palatal shelf, pd-eyelid periderm, st-stomach mesenchyme. Size bars indicate 1 mm.
Figure Legend Snippet: Expression of Tmem26 in wild-type embryos by section in situ hybridisation. ( A–D, E–G,J ) radioisotopic; ( H,I ) DIG detection. ( A–D ) Transverse sections through the secondary palate at indicated stages. At 12.5 dpc and 13.5 dpc Tmem26 is expressed in mesenchyme of the vertical palatal shelves. At 14.5 dpc the shelves have fused but the medial epithelial seam still remains and expression within the mesenchyme is apparent. By 15.5 dpc the epithelial seam is absent and Tmem26 expression is virtually undetectable. ( A′–D′ ) Corresponding serial sections stained with toluidine blue. ( E–G ) Sections through the facial prominences and primary palate region at indicated stages. Tmem26 is not detected at 10.5 dpc but is upregulated at 11.5 dpc and 12.5 dpc. ( E′–G′ ) Corresponding sections stained with toluidine blue. ( H ) Parasagittal section through the lateral hindbrain at 12.5 dpc, showing expression in the nucleus of the seventh facial nerve region within the pons. ( I ) Longitudinal section through the stomach at 11.5 dpc, showing expression in the anterior stomach mesenchyme. ( J ) Magnification of the left eyelid from D , ( J′ ) same section counterstained with haematoxylin. 1p-primary palate, bt-mesencyme at the base of the tongue, c-cornea, el-eyelid, em-extraocular mesenchyme and developing extrinsic muscles of the eye, ep-epithelim, L-eye lens, lnp-lateral nasal prominence, n7-nucleus of the seventh facial nerve, mn-mandible, mnp-medial nasal prominence, mx-maxillary prominence, ns-nasal septum, p-palatal shelf, pd-eyelid periderm, st-stomach mesenchyme. Size bars indicate 1 mm.

Techniques Used: Expressing, In Situ, Hybridization, Staining

Gene targeting strategy for the Tmem26 locus. ( A ) Targeting construct for Tmem26 conditional inactivation compared to the wild type allele and the floxed Tmem26 allele after homologous recombination. In the presence of Cre recombinase, the region between LoxP sites will be excised, including exon 2, exon 2a (red) and the neomycin selection cassette (green). The neomycin selection cassette can be independently excised by Flp recombinase ( frt sites). A Southern probe (open box) and PCR primers (small arrows) external to the targeting construct were used to screen stem cells for successful homologous recombination. An Eco RV site (E*) was introduced with the targeting construct and was diagnostic during Southern and PCR assays for 5′ LoxP integration. ( B ) Two transcripts were detected, one lacking exons 2 and 2a as predicted, and another variant in which exon 3 was also absent. In both cases exon 1 is retained, and the exons after the deleted exons are out of frame. A premature stop codon is introduced in both cases ( C ) Southern blot showing the wild type and mutant band arising from Cre-mediated excision ( Tmem26 Ex2− ).
Figure Legend Snippet: Gene targeting strategy for the Tmem26 locus. ( A ) Targeting construct for Tmem26 conditional inactivation compared to the wild type allele and the floxed Tmem26 allele after homologous recombination. In the presence of Cre recombinase, the region between LoxP sites will be excised, including exon 2, exon 2a (red) and the neomycin selection cassette (green). The neomycin selection cassette can be independently excised by Flp recombinase ( frt sites). A Southern probe (open box) and PCR primers (small arrows) external to the targeting construct were used to screen stem cells for successful homologous recombination. An Eco RV site (E*) was introduced with the targeting construct and was diagnostic during Southern and PCR assays for 5′ LoxP integration. ( B ) Two transcripts were detected, one lacking exons 2 and 2a as predicted, and another variant in which exon 3 was also absent. In both cases exon 1 is retained, and the exons after the deleted exons are out of frame. A premature stop codon is introduced in both cases ( C ) Southern blot showing the wild type and mutant band arising from Cre-mediated excision ( Tmem26 Ex2− ).

Techniques Used: Construct, Homologous Recombination, Selection, Polymerase Chain Reaction, Diagnostic Assay, Variant Assay, Southern Blot, Mutagenesis

Expression of Tmem26 in wild-type embryos by whole mount in situ hybridisation analysis. ( A–E ) Whole embryos aged 11.0 dpc-14.5 dpc. No expression was detected before 11.0 dpc. ( F–J ) Forelimbs of corresponding embryos shown in A–E , dorsal view, limb anterior is to the top. ( K,L ) At 11.0 and 11.5 dpc Tmem26 expression in the facial prominences is restricted primarily to mesenchyme underlying areas of facial prominence fusion and merging. ( M ) At 12.5 dpc striking expression is observed in the primary palate, and expression remains at the midline of the mandible. ( N ) After fusion is complete at 13.5 dpc, expression is restricted to maxillary tissue at the distal tip of the snout. ( O,P ) The developing secondary palate at 14.5 dpc, taken from below with the mandible removed, one showing the palatal shelves wide apart, and one as the shelves are coming together to fuse. Tmem26 is expressed in the palatal shelves prior to fusion but downregulated upon palate fusion, most obvious at 15.5 dpc ( Q ). ( R ) Ventral and ( S ) lateral views of a 13.5 dpc genital tubercle. Dorsal-ventral and anterior-posterior axes are indicated. 1p-primary palate, 2p-secondary palatal shelves, e-external ear, em-extraoccular musculature, fl-forelimb, lnp-lateral nasal prominence, mes-medial epithelial seam, md-mandible, mnp-medial nasal prominence, mx-maxillary prominence, n-nasal opening, vcm-ventral cephalic mesenchyme.
Figure Legend Snippet: Expression of Tmem26 in wild-type embryos by whole mount in situ hybridisation analysis. ( A–E ) Whole embryos aged 11.0 dpc-14.5 dpc. No expression was detected before 11.0 dpc. ( F–J ) Forelimbs of corresponding embryos shown in A–E , dorsal view, limb anterior is to the top. ( K,L ) At 11.0 and 11.5 dpc Tmem26 expression in the facial prominences is restricted primarily to mesenchyme underlying areas of facial prominence fusion and merging. ( M ) At 12.5 dpc striking expression is observed in the primary palate, and expression remains at the midline of the mandible. ( N ) After fusion is complete at 13.5 dpc, expression is restricted to maxillary tissue at the distal tip of the snout. ( O,P ) The developing secondary palate at 14.5 dpc, taken from below with the mandible removed, one showing the palatal shelves wide apart, and one as the shelves are coming together to fuse. Tmem26 is expressed in the palatal shelves prior to fusion but downregulated upon palate fusion, most obvious at 15.5 dpc ( Q ). ( R ) Ventral and ( S ) lateral views of a 13.5 dpc genital tubercle. Dorsal-ventral and anterior-posterior axes are indicated. 1p-primary palate, 2p-secondary palatal shelves, e-external ear, em-extraoccular musculature, fl-forelimb, lnp-lateral nasal prominence, mes-medial epithelial seam, md-mandible, mnp-medial nasal prominence, mx-maxillary prominence, n-nasal opening, vcm-ventral cephalic mesenchyme.

Techniques Used: Expressing, In Situ, Hybridization

Expression of Tmem26 as determined by qRT-PCR. Graph shows the mean 2 −ΔCT and the standard error of the mean (SEM).
Figure Legend Snippet: Expression of Tmem26 as determined by qRT-PCR. Graph shows the mean 2 −ΔCT and the standard error of the mean (SEM).

Techniques Used: Expressing, Quantitative RT-PCR

Predicted gene and protein structure. ( A ) Predicted exon structure of Tmem26 . ( B ) RT-PCR across exon2, showing the main Tmem26 transcript incorporating exon2 only, and a minor variant generated by alternative splicing in some tissues (arrow), which incorporates an extra exon (2a). ( C ) The topographic prediction for TMEM26 generated by the program SVTtm. Other predictions vary dependent on the presence or absence of a leader sequence and the number of transmembrane domains. 1,2,3 – non-membrane loops; C-terminus, N-terminus.
Figure Legend Snippet: Predicted gene and protein structure. ( A ) Predicted exon structure of Tmem26 . ( B ) RT-PCR across exon2, showing the main Tmem26 transcript incorporating exon2 only, and a minor variant generated by alternative splicing in some tissues (arrow), which incorporates an extra exon (2a). ( C ) The topographic prediction for TMEM26 generated by the program SVTtm. Other predictions vary dependent on the presence or absence of a leader sequence and the number of transmembrane domains. 1,2,3 – non-membrane loops; C-terminus, N-terminus.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Variant Assay, Generated, Sequencing

5) Product Images from "Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms"

Article Title: Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

Journal: Retrovirology

doi: 10.1186/1742-4690-2-64

DNA methylation of provirus is not associated with methylated CpG sites in the genome. Integration sites of HTLV-I provirus in leukemic cells have been determined by inverse PCR, and then DNA methylation in genome has been analyzed by sodium bisulfite sequencing. DNA methylation of 5'-LTR was also analyzed by sodium bisulfite sequencing method. Vertical bars represent CpG sites. Open circle indicates unmethylated CpG site, and closed one means methylated CpG site. N: normal PBMCs from non-carrier donor.
Figure Legend Snippet: DNA methylation of provirus is not associated with methylated CpG sites in the genome. Integration sites of HTLV-I provirus in leukemic cells have been determined by inverse PCR, and then DNA methylation in genome has been analyzed by sodium bisulfite sequencing. DNA methylation of 5'-LTR was also analyzed by sodium bisulfite sequencing method. Vertical bars represent CpG sites. Open circle indicates unmethylated CpG site, and closed one means methylated CpG site. N: normal PBMCs from non-carrier donor.

Techniques Used: DNA Methylation Assay, Methylation, Inverse PCR, Methylation Sequencing

DNA methylation and histone modifications in fresh ATL cases. A. The relationships among DNA methylation, tax gene expression and histone modification in 5'-LTR were analyzed in three ATL cases. Cases 1 and 3 have one copy of the complete HTLV-I provirus, while Case 2 has a defective provirus that lacks part of the pol gene. DNA methylation was analyzed by COBRA. The tax gene transcripts could be detected in Case 1, but not in Cases 2 or 3, by RT-PCR. ChIP assays were also performed using primers for 5'-LTR to analyze acetylation of histone H3 (Ac-H3) and H4 (Ac-H4). W.C.E.: whole cell extract. B. Recovery of tax gene expression ex vivo . The PBMCs isolated from Case 3 were immediately cultured ex vivo for several hours and tested the transcription of tax mRNA by RT-PCR.
Figure Legend Snippet: DNA methylation and histone modifications in fresh ATL cases. A. The relationships among DNA methylation, tax gene expression and histone modification in 5'-LTR were analyzed in three ATL cases. Cases 1 and 3 have one copy of the complete HTLV-I provirus, while Case 2 has a defective provirus that lacks part of the pol gene. DNA methylation was analyzed by COBRA. The tax gene transcripts could be detected in Case 1, but not in Cases 2 or 3, by RT-PCR. ChIP assays were also performed using primers for 5'-LTR to analyze acetylation of histone H3 (Ac-H3) and H4 (Ac-H4). W.C.E.: whole cell extract. B. Recovery of tax gene expression ex vivo . The PBMCs isolated from Case 3 were immediately cultured ex vivo for several hours and tested the transcription of tax mRNA by RT-PCR.

Techniques Used: DNA Methylation Assay, Expressing, Modification, Combined Bisulfite Restriction Analysis Assay, Reverse Transcription Polymerase Chain Reaction, Chromatin Immunoprecipitation, Ex Vivo, Isolation, Cell Culture

DNA methylation in ATL cell lines, HTLV-I carriers and ATL cases. The tax gene transcription in ATL cell lines was studied by RT-PCR (A), and the expression of GAPDH gene has been used as a control. DNA methylation throughout the HTLV-I provirus was studied by COBRA in tax gene-expressing (B) and non-expressing cell lines (C). Furthermore, DNA methylation was also analyzed in 20 carriers and 20 ATL cases by COBRA, and representative patterns of DNA methylation are shown in D. The number of HTLV-I provirus has been analyzed by Southern blot method, and shown in the parenthesis (B, C and D). Each bar indicates the extent of DNA methylation that was calculated by COBRA.
Figure Legend Snippet: DNA methylation in ATL cell lines, HTLV-I carriers and ATL cases. The tax gene transcription in ATL cell lines was studied by RT-PCR (A), and the expression of GAPDH gene has been used as a control. DNA methylation throughout the HTLV-I provirus was studied by COBRA in tax gene-expressing (B) and non-expressing cell lines (C). Furthermore, DNA methylation was also analyzed in 20 carriers and 20 ATL cases by COBRA, and representative patterns of DNA methylation are shown in D. The number of HTLV-I provirus has been analyzed by Southern blot method, and shown in the parenthesis (B, C and D). Each bar indicates the extent of DNA methylation that was calculated by COBRA.

Techniques Used: DNA Methylation Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Combined Bisulfite Restriction Analysis Assay, Southern Blot

Comparison of the DNA methylation in carriers and ATL cases. A. DNA methylation at eight different regions in the HTLV-I provirus was compared between carriers (C) and ATL cases (A). DNA methylation was quantified by COBRA in 20 carriers and 20 ATL cases. Each sample was analyzed three times by COBRA at each site, and circles indicate mean values of DNA methylation. The differences of DNA methylation are statistically significant in the gag , pol and env regions by the Mann-Whitney's U-test. Horizontal bars represent median of DNA methylation in each group. B. The relation between tax gene transcription and DNA methylation of 5'-LTR in the fresh ATL cells has been shown. DNA methylation of 5'-LTR was quantified by COBRA assay and the tax gene transcripts were detected by RT-PCR.
Figure Legend Snippet: Comparison of the DNA methylation in carriers and ATL cases. A. DNA methylation at eight different regions in the HTLV-I provirus was compared between carriers (C) and ATL cases (A). DNA methylation was quantified by COBRA in 20 carriers and 20 ATL cases. Each sample was analyzed three times by COBRA at each site, and circles indicate mean values of DNA methylation. The differences of DNA methylation are statistically significant in the gag , pol and env regions by the Mann-Whitney's U-test. Horizontal bars represent median of DNA methylation in each group. B. The relation between tax gene transcription and DNA methylation of 5'-LTR in the fresh ATL cells has been shown. DNA methylation of 5'-LTR was quantified by COBRA assay and the tax gene transcripts were detected by RT-PCR.

Techniques Used: DNA Methylation Assay, Combined Bisulfite Restriction Analysis Assay, MANN-WHITNEY, Reverse Transcription Polymerase Chain Reaction

DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.
Figure Legend Snippet: DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.

Techniques Used: DNA Methylation Assay, Methylation Sequencing, Combined Bisulfite Restriction Analysis Assay, Expressing, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Methylation

6) Product Images from "Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice"

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20041074

Defective Ig production in Atm −/− B cells activated in vitro. CD19 + B cells were isolated from the spleens of Atm −/− and WT mice and cultured with CD40L and IL-4 (IgG1, IgG2a, and IgM), CD40L, IL-4, IL-5, TGF-β, and anti-IgD dextran (IgA) or LPS (IgG2b, IgG3). Results are displayed as the mean of three to four experiments ± SEM Atm −/− titer as a percentage of the Atm +/+ controls.
Figure Legend Snippet: Defective Ig production in Atm −/− B cells activated in vitro. CD19 + B cells were isolated from the spleens of Atm −/− and WT mice and cultured with CD40L and IL-4 (IgG1, IgG2a, and IgM), CD40L, IL-4, IL-5, TGF-β, and anti-IgD dextran (IgA) or LPS (IgG2b, IgG3). Results are displayed as the mean of three to four experiments ± SEM Atm −/− titer as a percentage of the Atm +/+ controls.

Techniques Used: In Vitro, Isolation, Mouse Assay, Cell Culture

Surface Ig expression of IgG1 and IgE isotypes on in vitro–stimulated wild type and Atm −/− B cells. Cells were harvested after 4 d of in vitro stimulation with CD40L and IL-4, and flow cytometric analysis was used to determine surface IgG1 and IgE expression. Numbers on the dot plots show the percentage of switched cells as a proportion of B220 + B cells. Results are representative of four independent experiments.
Figure Legend Snippet: Surface Ig expression of IgG1 and IgE isotypes on in vitro–stimulated wild type and Atm −/− B cells. Cells were harvested after 4 d of in vitro stimulation with CD40L and IL-4, and flow cytometric analysis was used to determine surface IgG1 and IgE expression. Numbers on the dot plots show the percentage of switched cells as a proportion of B220 + B cells. Results are representative of four independent experiments.

Techniques Used: Expressing, In Vitro, Flow Cytometry

Clonal expansion of IgG1-switched B cells. CFSE-stained resting B cells were stimulated in vitro with CD40L and IL-4 for 3–6 d and counterstained with goat anti–mouse IgG1 as described in Materials and Methods. (A) CFSE staining profiles of Atm +/+ and Atm −/− B cells are presented in the first two columns. The third column shows the percentage of recovered Atm −/− and Atm +/+ cells that have undergone the indicated number of cell divisions. (B) Two-color flow cytometric profiles indicate IgG1 expression on CFSE stained cells. The percentage of B cells expressing IgG1 is indicated for Atm +/+ B cells and Atm −/− B cells that have undergone the indicated numbers of cell divisions. Results are representative of three independent experiments.
Figure Legend Snippet: Clonal expansion of IgG1-switched B cells. CFSE-stained resting B cells were stimulated in vitro with CD40L and IL-4 for 3–6 d and counterstained with goat anti–mouse IgG1 as described in Materials and Methods. (A) CFSE staining profiles of Atm +/+ and Atm −/− B cells are presented in the first two columns. The third column shows the percentage of recovered Atm −/− and Atm +/+ cells that have undergone the indicated number of cell divisions. (B) Two-color flow cytometric profiles indicate IgG1 expression on CFSE stained cells. The percentage of B cells expressing IgG1 is indicated for Atm +/+ B cells and Atm −/− B cells that have undergone the indicated numbers of cell divisions. Results are representative of three independent experiments.

Techniques Used: Staining, In Vitro, Flow Cytometry, Expressing

7) Product Images from "A large deletion in RPGR causes XLPRA in Weimaraner dogs"

Article Title: A large deletion in RPGR causes XLPRA in Weimaraner dogs

Journal: Canine Genetics and Epidemiology

doi: 10.1186/s40575-016-0037-x

The deletion in the X chromosomal RPGR gene as identified in a PRA pedigree of Weimaraner dogs via whole exome sequencing; the breakpoint (BP) region is indicated. a Pedigree structure and RPGR deletion genotypes of 18 investigated individuals of the XLPRA Weimaraner family. PRA segregates in two generations of the family. Squares represent males, circles indicate females, crossed-out symbols represent deceased dogs. Filled squares show ophthalmologically diagnosed PRA-affected male dogs. Half-filled circles indicate females with ophthalmologically confirmed mild PRA symptoms. Open symbols represent male and female dogs with normal sight as revealed by general veterinarian examinations, respectively. An asterisk below solid square symbols indicates PRA-diagnosed dogs, which were used for whole exome sequencing. Genotypes of RPGR deletion screening are shown below the symbols. X M (colored in red) refers to an allele with RPGR deletion, X and Y symbols illustrate normal X- (with wildtype RPGR alleles) and Y-chromosomes, respectively. b Integrated Genomics Viewer (IGV) display of the canine RPGR deletion and surrounding regions (CFAX: 3310100–33106500, CanFam3.1 UCSC genome browser) as well as graphical illustration of exon-intron boundaries from the 5′UTR to exon 5. As viewed in IGV, the control and male PRA-affected dog are represented by two separate panels. The upper panel is a histogram where the height of each mountain-like grey area is representative of the read depth at that location. The lower panel is a graphical view of some of the reads that align to that location. Lack of reads (horizontal bars in lower panel) is characteristic for complete loss of exonic sequences. The deletion comprising exons 1–4 (~5 kb) is obvious in the male PRA-affected dog in hemizygous state in contrast to the PRA-unaffected dog. Thus the gap region includes exon 1 in the canine genomic RPGR sequence explaining only non-specific read alignments in the lower panel for the control. c QPCR-based copy number analysis of the deleted exons 3–4 and the non-deleted exon 5 of RPGR gene in four individuals of the pedigree of Weimaraners in comparison to a healthy control. Error bars indicate the standard deviation of three replicates. d Chromatogram and graphical representation of the BP region in the RPGR gene in a male PRA-affected Weimaraner. The graphical illustration indicates part of intron 4 sequence and of 5′UTR of RPGR . Deleted sequences of intron 4 and 5′UTR are coloured in light grey, non-deleted sequences are indicated by coloured letters. The BP region comprises three nucleotides (TTC) from either end which are underlined. The chromatogram also shows the BP (marked with arrows) as well as flanking sequences of intron 4 and 5′UTR of RPGR as identified in a male PRA-affected Weimaraner
Figure Legend Snippet: The deletion in the X chromosomal RPGR gene as identified in a PRA pedigree of Weimaraner dogs via whole exome sequencing; the breakpoint (BP) region is indicated. a Pedigree structure and RPGR deletion genotypes of 18 investigated individuals of the XLPRA Weimaraner family. PRA segregates in two generations of the family. Squares represent males, circles indicate females, crossed-out symbols represent deceased dogs. Filled squares show ophthalmologically diagnosed PRA-affected male dogs. Half-filled circles indicate females with ophthalmologically confirmed mild PRA symptoms. Open symbols represent male and female dogs with normal sight as revealed by general veterinarian examinations, respectively. An asterisk below solid square symbols indicates PRA-diagnosed dogs, which were used for whole exome sequencing. Genotypes of RPGR deletion screening are shown below the symbols. X M (colored in red) refers to an allele with RPGR deletion, X and Y symbols illustrate normal X- (with wildtype RPGR alleles) and Y-chromosomes, respectively. b Integrated Genomics Viewer (IGV) display of the canine RPGR deletion and surrounding regions (CFAX: 3310100–33106500, CanFam3.1 UCSC genome browser) as well as graphical illustration of exon-intron boundaries from the 5′UTR to exon 5. As viewed in IGV, the control and male PRA-affected dog are represented by two separate panels. The upper panel is a histogram where the height of each mountain-like grey area is representative of the read depth at that location. The lower panel is a graphical view of some of the reads that align to that location. Lack of reads (horizontal bars in lower panel) is characteristic for complete loss of exonic sequences. The deletion comprising exons 1–4 (~5 kb) is obvious in the male PRA-affected dog in hemizygous state in contrast to the PRA-unaffected dog. Thus the gap region includes exon 1 in the canine genomic RPGR sequence explaining only non-specific read alignments in the lower panel for the control. c QPCR-based copy number analysis of the deleted exons 3–4 and the non-deleted exon 5 of RPGR gene in four individuals of the pedigree of Weimaraners in comparison to a healthy control. Error bars indicate the standard deviation of three replicates. d Chromatogram and graphical representation of the BP region in the RPGR gene in a male PRA-affected Weimaraner. The graphical illustration indicates part of intron 4 sequence and of 5′UTR of RPGR . Deleted sequences of intron 4 and 5′UTR are coloured in light grey, non-deleted sequences are indicated by coloured letters. The BP region comprises three nucleotides (TTC) from either end which are underlined. The chromatogram also shows the BP (marked with arrows) as well as flanking sequences of intron 4 and 5′UTR of RPGR as identified in a male PRA-affected Weimaraner

Techniques Used: Sequencing, Real-time Polymerase Chain Reaction, Standard Deviation

8) Product Images from "Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis"

Article Title: Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis

Journal: Infection and Immunity

doi: 10.1128/IAI.00144-12

fpt genes are expressed during intracellular growth. J774.1 cells were infected with LVS for a period of 20 h. Following overnight incubation, RNA was isolated, cDNA was generated, and the presence of fpt transcripts was confirmed by PCR with Fpt gene-specific primers. For each labeled gene, lane 1 represents the gene-specific PCR product amplified from cDNA, lane 2 is a non-RT negative control for genomic DNA contamination, and lane 3 is a positive control where the specified gene was amplified from LVS genomic DNA.
Figure Legend Snippet: fpt genes are expressed during intracellular growth. J774.1 cells were infected with LVS for a period of 20 h. Following overnight incubation, RNA was isolated, cDNA was generated, and the presence of fpt transcripts was confirmed by PCR with Fpt gene-specific primers. For each labeled gene, lane 1 represents the gene-specific PCR product amplified from cDNA, lane 2 is a non-RT negative control for genomic DNA contamination, and lane 3 is a positive control where the specified gene was amplified from LVS genomic DNA.

Techniques Used: Infection, Incubation, Isolation, Generated, Polymerase Chain Reaction, Labeling, Amplification, Negative Control, Positive Control

9) Product Images from "Effects of two common polymorphisms in the 3' untranslated regions of estrogen receptor ? on mRNA stability and translatability"

Article Title: Effects of two common polymorphisms in the 3' untranslated regions of estrogen receptor ? on mRNA stability and translatability

Journal: BMC Genetics

doi: 10.1186/1471-2156-10-55

Allelic expression of ERβ 3'UTR SNPs in breast tumor samples . A . Genomic DNA was sequenced in two independent assays. cDNA synthesis was performed twice and each cDNA was sequenced in two independent assays. For each sample and allele, the average peak heights from the four cDNA sequencing assays were normalized by the average peak heights from the two DNA sequencing assays. The results from five breast tumor samples heterozygous for each SNP are presented as relative allelic ratios for cDNA versus genomic DNA. Data are shown as mean ± SD, with allele G set to 100%. (a) ERβ1 3'UTR polymorphism (rs4986938 G↔A); (b) ERβ2 polymorphism (rs928554 G↔A). B . Representative examples of genomic DNA and mRNA sequencing. (a) ERβ1 3'UTR polymorphism (rs4986938); (b) ERβ2 3'UTR polymorphism (rs928554). Observe that for rs928554 G↔A, the bottom strand was sequenced therefore the DNA sequence reads C and T, respectively.
Figure Legend Snippet: Allelic expression of ERβ 3'UTR SNPs in breast tumor samples . A . Genomic DNA was sequenced in two independent assays. cDNA synthesis was performed twice and each cDNA was sequenced in two independent assays. For each sample and allele, the average peak heights from the four cDNA sequencing assays were normalized by the average peak heights from the two DNA sequencing assays. The results from five breast tumor samples heterozygous for each SNP are presented as relative allelic ratios for cDNA versus genomic DNA. Data are shown as mean ± SD, with allele G set to 100%. (a) ERβ1 3'UTR polymorphism (rs4986938 G↔A); (b) ERβ2 polymorphism (rs928554 G↔A). B . Representative examples of genomic DNA and mRNA sequencing. (a) ERβ1 3'UTR polymorphism (rs4986938); (b) ERβ2 3'UTR polymorphism (rs928554). Observe that for rs928554 G↔A, the bottom strand was sequenced therefore the DNA sequence reads C and T, respectively.

Techniques Used: Expressing, Sequencing, DNA Sequencing

10) Product Images from "New Molecular Mechanism for Ullrich Congenital Muscular Dystrophy: A Heterozygous In-Frame Deletion in the COL6A1 Gene Causes a Severe Phenotype"

Article Title: New Molecular Mechanism for Ullrich Congenital Muscular Dystrophy: A Heterozygous In-Frame Deletion in the COL6A1 Gene Causes a Severe Phenotype

Journal: American Journal of Human Genetics

doi:

Mutational analysis of the COL6A1 gene. A, Schematic diagram of the COL6A1 genomic region including exons 7–15 ( blackened boxes ). Exon 8 encodes the beginning of the triple-helical domain, and exons 9–15 each encode discrete numbers of Gly-Xaa-Yaa repeats in the triple-helical domain. A minisatellite ( unblackened box labeled “VNTR” ) is present at the 5′ end of intron 8. In patient UC-1, one of the COL6A1 alleles contains a 1.1-kb gene deletion ( dotted box ) extending from intron 8 to intron 10. Patient UC-4 carries a heterozygous G→A transition at the +1 position of intron 14. B, PCR amplification of genomic DNA from patient UC-1 and his family ( lanes 2–6 ) and from four unaffected control individuals ( lanes 7–10 ) with primers in introns 6 and 12 ( arrows in A ). Lanes 1 and 11 contain DNA size markers. C, DNA sequence of the 1.8-kb PCR product from UC-1, showing the breakpoint of the internal gene deletion ( middle line ) and its alignment with the normal COL6A1 genomic sequence of intron 8 ( top line ) and of intron 9–exon 10–intron 10 ( bottom line ). Exon sequences are in capital letters. Between the arrows are 15-bp inserted sequences in the deletion junction, which contains an 11-bp direct duplication of the sequence in intron 10 ( boxed ). The dotted box depicts the last repeat of the minisatellite sequence in intron 8. In = intron; Ex = exon.
Figure Legend Snippet: Mutational analysis of the COL6A1 gene. A, Schematic diagram of the COL6A1 genomic region including exons 7–15 ( blackened boxes ). Exon 8 encodes the beginning of the triple-helical domain, and exons 9–15 each encode discrete numbers of Gly-Xaa-Yaa repeats in the triple-helical domain. A minisatellite ( unblackened box labeled “VNTR” ) is present at the 5′ end of intron 8. In patient UC-1, one of the COL6A1 alleles contains a 1.1-kb gene deletion ( dotted box ) extending from intron 8 to intron 10. Patient UC-4 carries a heterozygous G→A transition at the +1 position of intron 14. B, PCR amplification of genomic DNA from patient UC-1 and his family ( lanes 2–6 ) and from four unaffected control individuals ( lanes 7–10 ) with primers in introns 6 and 12 ( arrows in A ). Lanes 1 and 11 contain DNA size markers. C, DNA sequence of the 1.8-kb PCR product from UC-1, showing the breakpoint of the internal gene deletion ( middle line ) and its alignment with the normal COL6A1 genomic sequence of intron 8 ( top line ) and of intron 9–exon 10–intron 10 ( bottom line ). Exon sequences are in capital letters. Between the arrows are 15-bp inserted sequences in the deletion junction, which contains an 11-bp direct duplication of the sequence in intron 10 ( boxed ). The dotted box depicts the last repeat of the minisatellite sequence in intron 8. In = intron; Ex = exon.

Techniques Used: Labeling, Polymerase Chain Reaction, Amplification, Sequencing

11) Product Images from "Genome-wide analysis reveals a cell cycle-dependent mechanism controlling centromere propagation"

Article Title: Genome-wide analysis reveals a cell cycle-dependent mechanism controlling centromere propagation

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200806038

Mitotic defects caused by CLD depletion. (A) FACS analysis of control and CLD-depleted Kc167 cells. The graph shows the distribution of the DNA content of control and dsRNA-treated cells after a 4-d incubation with dsRNA. Ploidy is shown on the x axis. A high number of polyploid cells accumulated after CYCA and RCA1 depletion. A milder effect on ploidy was observed in CENP-C–depleted cells. (B) The number of defective mitoses was quantified after a 4-d incubation with control (no RNA; n = 38), CID ( n = 53), CENP-C ( n = 50), CAL1 ( n = 58), CYCA ( n = 31), or RCA1 ( n = 34) dsRNA. n represents the number of cells examined in each condition. The percentage of cells with abnormal prometaphase or metaphase figures is shown on the left, and the percentage of cells with abnormal anaphase or telophase figures is shown on the right. The data are taken from a single experiment, but a duplicate experiment yielded similar results. (C) Still frames from time-lapse experiments of mitotic defects associated with RNAi depletion of CLDs in cells expressing mCherry-tubulin and H2B-GFP. Control cells (left) displayed accurate and timely chromosome segregation. CID-, CENP-C–, and CAL1-depleted cells showed a dramatic mitotic delay, little to no chromosome movement, abnormally elongated and defective spindles, and chromosome missegregation; nevertheless, cytokinesis occurred. CYCA depletion caused defective spindles, missegregation of chromosomes, and cytokinesis defects. RCA1 depletion predominantly caused a cell cycle arrest; most cells did not divide after RNAi treatment. Times are minutes from the start of the video (see Videos 6 [control], 7 [CID-RNAi], 8 [CENP-C–RNAi], 9 [CAL1-RNAi], and 10 [CYCA-RNAi], available at http://www.jcb.org/cgi/content/full/jcb.200806038/DC1 ). Bars, 5 μm.
Figure Legend Snippet: Mitotic defects caused by CLD depletion. (A) FACS analysis of control and CLD-depleted Kc167 cells. The graph shows the distribution of the DNA content of control and dsRNA-treated cells after a 4-d incubation with dsRNA. Ploidy is shown on the x axis. A high number of polyploid cells accumulated after CYCA and RCA1 depletion. A milder effect on ploidy was observed in CENP-C–depleted cells. (B) The number of defective mitoses was quantified after a 4-d incubation with control (no RNA; n = 38), CID ( n = 53), CENP-C ( n = 50), CAL1 ( n = 58), CYCA ( n = 31), or RCA1 ( n = 34) dsRNA. n represents the number of cells examined in each condition. The percentage of cells with abnormal prometaphase or metaphase figures is shown on the left, and the percentage of cells with abnormal anaphase or telophase figures is shown on the right. The data are taken from a single experiment, but a duplicate experiment yielded similar results. (C) Still frames from time-lapse experiments of mitotic defects associated with RNAi depletion of CLDs in cells expressing mCherry-tubulin and H2B-GFP. Control cells (left) displayed accurate and timely chromosome segregation. CID-, CENP-C–, and CAL1-depleted cells showed a dramatic mitotic delay, little to no chromosome movement, abnormally elongated and defective spindles, and chromosome missegregation; nevertheless, cytokinesis occurred. CYCA depletion caused defective spindles, missegregation of chromosomes, and cytokinesis defects. RCA1 depletion predominantly caused a cell cycle arrest; most cells did not divide after RNAi treatment. Times are minutes from the start of the video (see Videos 6 [control], 7 [CID-RNAi], 8 [CENP-C–RNAi], 9 [CAL1-RNAi], and 10 [CYCA-RNAi], available at http://www.jcb.org/cgi/content/full/jcb.200806038/DC1 ). Bars, 5 μm.

Techniques Used: FACS, Incubation, Expressing

CLDs are interdependent for centromeric localization and are physically associated. (A) CLD depletions cause CID and CENP-C mislocalization. Control cells showed strong centromeric localization of CID (red) and CENP-C (green; merged panel across top; DAPI shown in gray). Depletion of CID, CENP-C, CAL1, CYCA, and RCA1 all resulted in absent or reduced centromeric staining of CID and CENP-C. Note that CAL1 depletion resulted in diffuse mislocalization of CENP-C in the nucleus, which is in contrast to the elimination of CENP-C observed after CID depletion. In addition, residual centromeric CID staining was observed after CENP-C depletion. (B) CID or CLD depletion causes loss of centromeric CAL1. Control cells showed strong colocalization between CID (red) and GFP-CAL1 (green), whereas cells depleted for CID, CENP-C, CYCA, or RCA1 displayed severely reduced centromeric CAL1. (C) Centromeric enrichment of CYCA (green) was visible in control cells and was lost in cells depleted for CID (red) after CID, CENP-C, or CAL1 RNAi (DNA is shown in gray). RCA1 depletion resulted in a general decrease in CYCA staining. (D) Coimmunoprecipitation of CLDs. GFP-CLD fusions were immunoprecipitated from stable cell lines expressing GFP-CID, GFP–CENP-C, or GFP-CAL1 or from the parent Kc167 cell line (control). Immunoprecipitates were Western blotted with antibodies against CID (top), CENP-C (middle), and CAL1 (bottom). The position of the GFP fusion and the endogenous protein is labeled on the right. (E) Summary of epistatic and physical relationships. CID, CAL1, and CENP-C physically interact and are interdependent for centromere localization. CID, CAL1, and CENP-C require RCA1 and CYCA for centromere localization, and CYCA requires all three for centromere enrichment. Bars, 5 μm.
Figure Legend Snippet: CLDs are interdependent for centromeric localization and are physically associated. (A) CLD depletions cause CID and CENP-C mislocalization. Control cells showed strong centromeric localization of CID (red) and CENP-C (green; merged panel across top; DAPI shown in gray). Depletion of CID, CENP-C, CAL1, CYCA, and RCA1 all resulted in absent or reduced centromeric staining of CID and CENP-C. Note that CAL1 depletion resulted in diffuse mislocalization of CENP-C in the nucleus, which is in contrast to the elimination of CENP-C observed after CID depletion. In addition, residual centromeric CID staining was observed after CENP-C depletion. (B) CID or CLD depletion causes loss of centromeric CAL1. Control cells showed strong colocalization between CID (red) and GFP-CAL1 (green), whereas cells depleted for CID, CENP-C, CYCA, or RCA1 displayed severely reduced centromeric CAL1. (C) Centromeric enrichment of CYCA (green) was visible in control cells and was lost in cells depleted for CID (red) after CID, CENP-C, or CAL1 RNAi (DNA is shown in gray). RCA1 depletion resulted in a general decrease in CYCA staining. (D) Coimmunoprecipitation of CLDs. GFP-CLD fusions were immunoprecipitated from stable cell lines expressing GFP-CID, GFP–CENP-C, or GFP-CAL1 or from the parent Kc167 cell line (control). Immunoprecipitates were Western blotted with antibodies against CID (top), CENP-C (middle), and CAL1 (bottom). The position of the GFP fusion and the endogenous protein is labeled on the right. (E) Summary of epistatic and physical relationships. CID, CAL1, and CENP-C physically interact and are interdependent for centromere localization. CID, CAL1, and CENP-C require RCA1 and CYCA for centromere localization, and CYCA requires all three for centromere enrichment. Bars, 5 μm.

Techniques Used: Staining, Immunoprecipitation, Stable Transfection, Expressing, Western Blot, Labeling

Identification and localization of CLDs. (A) IF of cells depleted of the top four positive hits from the screen. Cells were stained for DNA, CID, and HP1. CID localization to the centromere (bottom) is highly reduced or absent after RNAi depletion of all four candidates or CID in comparison with the control (left), and HP1 staining is normal in all cases. Notice that in addition to CID depletion, RCA1 and CYCA RNAi result in endoreduplication and an increase in nuclear size. (B) CLD dynamics through mitosis. Still images from time-lapse analysis of stable S2 cell lines expressing mCherry-tubulin (red) and GFP-CID, –CENP-C, -CAL1, -CYCA, and -RCA1; relative times in minutes from the start of the video are indicated in each frame. See Videos 1–5 (available at http://www.jcb.org/cgi/content/full/jcb.200806038/DC1 ). (C) Localization of GFP-CAL1, CID, and Rod. Metaphase chromosome spreads of S2 cells stably expressing GFP-CAL1 were stained with anti-CID (red), anti-GFP (green), and anti-Rod (blue) antibodies. The GFP-CAL1 signal overlapped significantly with the outer kinetochore protein Rod, whereas only a little overlap was observed with CID, indicating that CAL1 is located close to the outer kinetochore in mitotic chromosomes, which is in contrast to localization to CID chromatin in interphase. Inset shows magnification of image. Bars: (A) 15 μm; (B and C) 5 μm.
Figure Legend Snippet: Identification and localization of CLDs. (A) IF of cells depleted of the top four positive hits from the screen. Cells were stained for DNA, CID, and HP1. CID localization to the centromere (bottom) is highly reduced or absent after RNAi depletion of all four candidates or CID in comparison with the control (left), and HP1 staining is normal in all cases. Notice that in addition to CID depletion, RCA1 and CYCA RNAi result in endoreduplication and an increase in nuclear size. (B) CLD dynamics through mitosis. Still images from time-lapse analysis of stable S2 cell lines expressing mCherry-tubulin (red) and GFP-CID, –CENP-C, -CAL1, -CYCA, and -RCA1; relative times in minutes from the start of the video are indicated in each frame. See Videos 1–5 (available at http://www.jcb.org/cgi/content/full/jcb.200806038/DC1 ). (C) Localization of GFP-CAL1, CID, and Rod. Metaphase chromosome spreads of S2 cells stably expressing GFP-CAL1 were stained with anti-CID (red), anti-GFP (green), and anti-Rod (blue) antibodies. The GFP-CAL1 signal overlapped significantly with the outer kinetochore protein Rod, whereas only a little overlap was observed with CID, indicating that CAL1 is located close to the outer kinetochore in mitotic chromosomes, which is in contrast to localization to CID chromatin in interphase. Inset shows magnification of image. Bars: (A) 15 μm; (B and C) 5 μm.

Techniques Used: IF-cells, Staining, Expressing, Stable Transfection

12) Product Images from "Human Endogenous Retrovirus Family HERV-K(HML-2) RNA Transcripts Are Selectively Packaged into Retroviral Particles Produced by the Human Germ Cell Tumor Line Tera-1 and Originate Mainly from a Provirus on Chromosome 22q11.21 ▿Human Endogenous Retrovirus Family HERV-K(HML-2) RNA Transcripts Are Selectively Packaged into Retroviral Particles Produced by the Human Germ Cell Tumor Line Tera-1 and Originate Mainly from a Provirus on Chromosome 22q11.21 ▿ †"

Article Title: Human Endogenous Retrovirus Family HERV-K(HML-2) RNA Transcripts Are Selectively Packaged into Retroviral Particles Produced by the Human Germ Cell Tumor Line Tera-1 and Originate Mainly from a Provirus on Chromosome 22q11.21 ▿Human Endogenous Retrovirus Family HERV-K(HML-2) RNA Transcripts Are Selectively Packaged into Retroviral Particles Produced by the Human Germ Cell Tumor Line Tera-1 and Originate Mainly from a Provirus on Chromosome 22q11.21 ▿ †

Journal: Journal of Virology

doi: 10.1128/JVI.01016-08

Analysis of HML-2 RNA transcripts in Tera-1 cells and pRVLP. (A) RT-PCR for HML-2 gag (primers HERV-K gag+ and gag−) and env (primers HERV-K env 7036 and env 7602) was carried out on total RNAs isolated from Tera-1 cells and pRVLP, which were subjected (+) or not subjected (−) to reverse transcription. Mock RNA purifications were performed as described in Materials and Methods. Amplicon sizes are indicated on the right. g, Tera-1 cell genomic DNA; M, DNA size marker; H 2 O, PCR negative control. (B) There are two types of HERV-K(HML-2) proviruses in the human genome, characterized by the presence (type 2) or absence (type 1) of a stretch of 292 bp (filled area) at the pol-env junction. Positions and names of the primers used for detection of type 1 and 2 transcripts are indicated. (C) Analysis of HML-2 type 1 and type 2 RNA transcripts in Tera-1 cells and pRVLP. Note that the primer pair polF/envR amplifies a 786-bp fragment from type 2 and a 494-bp fragment from type 1 proviruses.
Figure Legend Snippet: Analysis of HML-2 RNA transcripts in Tera-1 cells and pRVLP. (A) RT-PCR for HML-2 gag (primers HERV-K gag+ and gag−) and env (primers HERV-K env 7036 and env 7602) was carried out on total RNAs isolated from Tera-1 cells and pRVLP, which were subjected (+) or not subjected (−) to reverse transcription. Mock RNA purifications were performed as described in Materials and Methods. Amplicon sizes are indicated on the right. g, Tera-1 cell genomic DNA; M, DNA size marker; H 2 O, PCR negative control. (B) There are two types of HERV-K(HML-2) proviruses in the human genome, characterized by the presence (type 2) or absence (type 1) of a stretch of 292 bp (filled area) at the pol-env junction. Positions and names of the primers used for detection of type 1 and 2 transcripts are indicated. (C) Analysis of HML-2 type 1 and type 2 RNA transcripts in Tera-1 cells and pRVLP. Note that the primer pair polF/envR amplifies a 786-bp fragment from type 2 and a 494-bp fragment from type 1 proviruses.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Marker, Polymerase Chain Reaction, Negative Control

13) Product Images from "Gauging NOTCH1 Activation in Cancer Using Immunohistochemistry"

Article Title: Gauging NOTCH1 Activation in Cancer Using Immunohistochemistry

Journal: PLoS ONE

doi: 10.1371/journal.pone.0067306

Identification of an activating deletion in NOTCH1 in REC-1 mantle cell lymphoma cells. A) 5’-RACE products synthesized from input RNA from REC-1 MCL cells and DND-41 T-ALL cells; the latter have intact NOTCH1 alleles. B) Results of PCR of genomic REC-1 and DND-41 cell DNA with a NOTCH1 exon 1/exon 28-specific primer pair. C) Sequence of the 5’-RACE product in A and the genomic PCR product in B. Both showed an in-frame fusion of exon 1 and exon 28 NOTCH1 coding sequences. D) Cartoon depicting the intragenic NOTCH1 deletion in REC-1 cells and its consequences at the level of NOTCH1 RNA and protein. The red X denotes the position of a frame-shift mutation in exon 34 of NOTCH1 . L, leader peptide; TM, transmembrane domain; R, RAM domain; ANK, ankyrin repeat domain; TAD, transcriptional activation domain. E) Western blot showing the effect of treatment of REC-1 cells with the gamma-secretase inhibitor (GSI) compound E for 72 hours versus DMSO control. GSI depletes NICD1 (detected with the NICD1-specific V1744 antibody) and leads to the accumulation of a polypeptide of the size predicted by virtual translation of the aberrant NOTCH1 mRNA. Total NOTCH1 was detected with a polyclonal antibody raised against the NOTCH1 TAD.
Figure Legend Snippet: Identification of an activating deletion in NOTCH1 in REC-1 mantle cell lymphoma cells. A) 5’-RACE products synthesized from input RNA from REC-1 MCL cells and DND-41 T-ALL cells; the latter have intact NOTCH1 alleles. B) Results of PCR of genomic REC-1 and DND-41 cell DNA with a NOTCH1 exon 1/exon 28-specific primer pair. C) Sequence of the 5’-RACE product in A and the genomic PCR product in B. Both showed an in-frame fusion of exon 1 and exon 28 NOTCH1 coding sequences. D) Cartoon depicting the intragenic NOTCH1 deletion in REC-1 cells and its consequences at the level of NOTCH1 RNA and protein. The red X denotes the position of a frame-shift mutation in exon 34 of NOTCH1 . L, leader peptide; TM, transmembrane domain; R, RAM domain; ANK, ankyrin repeat domain; TAD, transcriptional activation domain. E) Western blot showing the effect of treatment of REC-1 cells with the gamma-secretase inhibitor (GSI) compound E for 72 hours versus DMSO control. GSI depletes NICD1 (detected with the NICD1-specific V1744 antibody) and leads to the accumulation of a polypeptide of the size predicted by virtual translation of the aberrant NOTCH1 mRNA. Total NOTCH1 was detected with a polyclonal antibody raised against the NOTCH1 TAD.

Techniques Used: Synthesized, Polymerase Chain Reaction, Sequencing, Mutagenesis, Activation Assay, Western Blot

14) Product Images from "The critical role of the linear plasmid lp36 in the infectious cycle of Borrelia burgdorferi"

Article Title: The critical role of the linear plasmid lp36 in the infectious cycle of Borrelia burgdorferi

Journal: Molecular Microbiology

doi: 10.1111/j.1365-2958.2007.05746.x

Quantitative assessment of spirochetal loads in infected mouse tissues A. DNA was isolated from ear, heart and joint tissues from a subset of RML mice that were reisolation-positive 7 weeks post feeding by larval or nymphal ticks infected with lp36-minus (□ lp36 - ) or lp36-minus/lp36-gent (▪ lp36–/lp36+) spirochetes. Samples were assessed for spirochete flaB and murine nidogen DNA copies by qPCR. The data are expressed as flaB copies per 1000 nidogen copies. Each data point represents the average of triplicate measures from the tissue DNA of an individual mouse. B. DNA was isolated from ear and heart tissues (joint tissue was not available from these experiments) from C3H/HeN mice that were reisolation-positive 4 weeks post inoculation with 1 × 10 7 or 1 × 10 8 lp36-minus (□ lp36 - ) or lp36-minus/lp36-gent (▪ lp36–/lp36+) spirochetes. Data shown are pooled data from individual mice inoculated with either 1 × 10 7 or 1 × 10 8 spirochetes. The data were collected and presented as described in A. C. DNA was isolated from ear, joint and heart tissues from C3H/HeN mice that were reisolation positive 6 weeks post inoculation with 5 × 10 3 lp36-minus/pBSV2G bbk17 (∇ lp36 - /pBSV2G bbk17 ) or lp36-minus/lp36-gent (▪ lp36–/lp36+) spirochetes. The data were collected and presented as described in A. D. DNA was isolated from ear and heart tissues (joint tissue was not available from these experiments) from C3H/HeN mice that were reisolation-positive 4 weeks post inoculation with 1 × 10 4 Δ bbk17 /pBSV2G (○) or Δ bbk17 /pBSV2G bbk17 (•) spirochetes. The data were collected and presented as described in A.
Figure Legend Snippet: Quantitative assessment of spirochetal loads in infected mouse tissues A. DNA was isolated from ear, heart and joint tissues from a subset of RML mice that were reisolation-positive 7 weeks post feeding by larval or nymphal ticks infected with lp36-minus (□ lp36 - ) or lp36-minus/lp36-gent (▪ lp36–/lp36+) spirochetes. Samples were assessed for spirochete flaB and murine nidogen DNA copies by qPCR. The data are expressed as flaB copies per 1000 nidogen copies. Each data point represents the average of triplicate measures from the tissue DNA of an individual mouse. B. DNA was isolated from ear and heart tissues (joint tissue was not available from these experiments) from C3H/HeN mice that were reisolation-positive 4 weeks post inoculation with 1 × 10 7 or 1 × 10 8 lp36-minus (□ lp36 - ) or lp36-minus/lp36-gent (▪ lp36–/lp36+) spirochetes. Data shown are pooled data from individual mice inoculated with either 1 × 10 7 or 1 × 10 8 spirochetes. The data were collected and presented as described in A. C. DNA was isolated from ear, joint and heart tissues from C3H/HeN mice that were reisolation positive 6 weeks post inoculation with 5 × 10 3 lp36-minus/pBSV2G bbk17 (∇ lp36 - /pBSV2G bbk17 ) or lp36-minus/lp36-gent (▪ lp36–/lp36+) spirochetes. The data were collected and presented as described in A. D. DNA was isolated from ear and heart tissues (joint tissue was not available from these experiments) from C3H/HeN mice that were reisolation-positive 4 weeks post inoculation with 1 × 10 4 Δ bbk17 /pBSV2G (○) or Δ bbk17 /pBSV2G bbk17 (•) spirochetes. The data were collected and presented as described in A.

Techniques Used: Infection, Isolation, Mouse Assay, Real-time Polymerase Chain Reaction

HPLC chromatograms of adenine deaminase enzyme assays from B. burgdorferi cell lysates containing or lacking bbk17 A. A representative chromatogram for a cell lysate of wild-type clone A3-M9 30 min after the addition of 0.3 mM adenine (+ bbk17 , –xanthine oxidase treatment). Excess adenine was detected as a peak at a retention time of 6.3 min, identical to that of the adenine standard (data not shown). Hypoxanthine production was detected as a peak at a retention time of 4.7 min, identical to that of the hypoxanthine standard (data not shown). Peak retention times are shown in minutes along the x -axis. B. No peak at a retention time consistent with hypoxanthine was detected in an identical A3-M9 cell lysate sample 30 min after the addition of 0.3 mM adenine treated with xanthine oxidase (+ bbk17 , +xanthine oxidase treatment), as indicated by an arrow. C. A representative chromatogram for a cell lysate of clone A3-M 9 Δ bbk17 :: flg p -kan /pBSV2G 30 min after the addition of 0.3 mM adenine (Δ bbk17 , –xanthine oxidase treatment). No peak at a retention time consistent with hypoxanthine was detected in the sample lacking the bbk17 gene, as indicated by an arrow.
Figure Legend Snippet: HPLC chromatograms of adenine deaminase enzyme assays from B. burgdorferi cell lysates containing or lacking bbk17 A. A representative chromatogram for a cell lysate of wild-type clone A3-M9 30 min after the addition of 0.3 mM adenine (+ bbk17 , –xanthine oxidase treatment). Excess adenine was detected as a peak at a retention time of 6.3 min, identical to that of the adenine standard (data not shown). Hypoxanthine production was detected as a peak at a retention time of 4.7 min, identical to that of the hypoxanthine standard (data not shown). Peak retention times are shown in minutes along the x -axis. B. No peak at a retention time consistent with hypoxanthine was detected in an identical A3-M9 cell lysate sample 30 min after the addition of 0.3 mM adenine treated with xanthine oxidase (+ bbk17 , +xanthine oxidase treatment), as indicated by an arrow. C. A representative chromatogram for a cell lysate of clone A3-M 9 Δ bbk17 :: flg p -kan /pBSV2G 30 min after the addition of 0.3 mM adenine (Δ bbk17 , –xanthine oxidase treatment). No peak at a retention time consistent with hypoxanthine was detected in the sample lacking the bbk17 gene, as indicated by an arrow.

Techniques Used: High Performance Liquid Chromatography

15) Product Images from "Allele-Specific H3K79 Di- versus Trimethylation Distinguishes Opposite Parental Alleles at Imprinted Regions ▿Allele-Specific H3K79 Di- versus Trimethylation Distinguishes Opposite Parental Alleles at Imprinted Regions ▿ †"

Article Title: Allele-Specific H3K79 Di- versus Trimethylation Distinguishes Opposite Parental Alleles at Imprinted Regions ▿Allele-Specific H3K79 Di- versus Trimethylation Distinguishes Opposite Parental Alleles at Imprinted Regions ▿ †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.01537-09

Activating chromatin composition along the H19 / Igf2 imprinted domain. Allele-specific activating chromatin was measured by quantitative ChIP-SNuPE assays at the H19 / Igf2 imprinted domain, using the 7-plex assay (see Fig. S1 in the supplemental material) and the H19 promoter assay. The regions of interest are depicted in the schematic drawing and indicated under each column. ChIP was done in duplicate, using antibodies against specific histone modifications (indicated on the left side of each row of charts) to precipitate chromatin from 129 mother × CS father MEFs or reciprocal CS mother × 129 father MEFs (indicated at the top). The ratio of an allele-specific histone modification at a specific region was expressed as a percentage of maternal (MAT) or paternal (PAT) allele in the total (maternal plus paternal, or 100%) immunoprecipitation. Standard deviations are indicated as error bars. Active chromatin histone globular domain modifications H4K91ac (A), H3K79me1 (B), and H3K79me2 (C) and the control histone tail modification H3K4me2 (D) clearly distinguished the paternal alleles at the Igf2 regions. These modifications were slightly biased or not biased toward the maternal alleles at the H19 regions. No allele-specific chromatin differences existed at a “neutral” intermediary region −8 kb upstream of the H19 promoter (PR). Reciprocal mouse crosses had very similar allele-specific chromatin composition.
Figure Legend Snippet: Activating chromatin composition along the H19 / Igf2 imprinted domain. Allele-specific activating chromatin was measured by quantitative ChIP-SNuPE assays at the H19 / Igf2 imprinted domain, using the 7-plex assay (see Fig. S1 in the supplemental material) and the H19 promoter assay. The regions of interest are depicted in the schematic drawing and indicated under each column. ChIP was done in duplicate, using antibodies against specific histone modifications (indicated on the left side of each row of charts) to precipitate chromatin from 129 mother × CS father MEFs or reciprocal CS mother × 129 father MEFs (indicated at the top). The ratio of an allele-specific histone modification at a specific region was expressed as a percentage of maternal (MAT) or paternal (PAT) allele in the total (maternal plus paternal, or 100%) immunoprecipitation. Standard deviations are indicated as error bars. Active chromatin histone globular domain modifications H4K91ac (A), H3K79me1 (B), and H3K79me2 (C) and the control histone tail modification H3K4me2 (D) clearly distinguished the paternal alleles at the Igf2 regions. These modifications were slightly biased or not biased toward the maternal alleles at the H19 regions. No allele-specific chromatin differences existed at a “neutral” intermediary region −8 kb upstream of the H19 promoter (PR). Reciprocal mouse crosses had very similar allele-specific chromatin composition.

Techniques Used: Chromatin Immunoprecipitation, Plex Assay, Promoter Assay, Modification, Immunoprecipitation

CTCF is responsible for region-specific enrichment of chromatin components at the H19 and Igf2 loci. The overall enrichment for specific chromatin modifications was compared between 129 × CS MEFs (white bars) and CTCFm × CS MEFs (black bars) by ChIP and real-time PCR. The schematic drawings at the top depict the expressed versus silenced status (horizontal arrow versus X) and methylation of the H19 and Igf2 ). In normal cells, CTCF protein (vertical oval) binding in the ICR (rectangle) in the unmethylated (white lollipop) maternal allele (M) but not in the methylated (black lollipop) paternal allele (P) insulates the Igf2 promoter from the downstream enhancers (small horizontal ovals). In the mutant cells, CTCF binding is abolished in the maternal ICR by point mutations (x) resulting in lack of insulation and, hence, biallelic Igf2 expression. The levels of active chromatin marks H4K91ac (A), H3K79me1 (B), and H3K79me2 (C) greatly increased in the mutant cells at the DMR1, the DMR2, and the Igf2 P2 promoter. The repressive H3K79me3 signal (D) greatly increased at the H19 ICR in CTCFm × CS MEFs compared to that in normal cells. There was no change at the −8-kb region. Average precipitation values are expressed in copy numbers and are shown with standard deviations.
Figure Legend Snippet: CTCF is responsible for region-specific enrichment of chromatin components at the H19 and Igf2 loci. The overall enrichment for specific chromatin modifications was compared between 129 × CS MEFs (white bars) and CTCFm × CS MEFs (black bars) by ChIP and real-time PCR. The schematic drawings at the top depict the expressed versus silenced status (horizontal arrow versus X) and methylation of the H19 and Igf2 ). In normal cells, CTCF protein (vertical oval) binding in the ICR (rectangle) in the unmethylated (white lollipop) maternal allele (M) but not in the methylated (black lollipop) paternal allele (P) insulates the Igf2 promoter from the downstream enhancers (small horizontal ovals). In the mutant cells, CTCF binding is abolished in the maternal ICR by point mutations (x) resulting in lack of insulation and, hence, biallelic Igf2 expression. The levels of active chromatin marks H4K91ac (A), H3K79me1 (B), and H3K79me2 (C) greatly increased in the mutant cells at the DMR1, the DMR2, and the Igf2 P2 promoter. The repressive H3K79me3 signal (D) greatly increased at the H19 ICR in CTCFm × CS MEFs compared to that in normal cells. There was no change at the −8-kb region. Average precipitation values are expressed in copy numbers and are shown with standard deviations.

Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Methylation, Binding Assay, Mutagenesis, Expressing

CTCF is required for allele-specific chromatin composition locally and at a distance. Quantitative analyses of chromatin composition reveal the consequences of ICR CTCF site mutations. Allele-specific enrichment is no longer apparent: the activating globular domain histone marks H4K91ac (A), H3K79me1 (B), and H3K79me2 (C) have shifted toward the maternal allele at the Igf2 locus. (D) H3K79me3 has shifted toward the maternal allele at the H19 locus. Chromatin was precipitated from CTCFm × CS MEFs in duplicate with the specific antibodies indicated on top of each chart. Allele-specific histone modification at a specific region was expressed as a percentage of the maternal mutant (MATmut) or paternal wild type (PAT) allele in the total immunoprecipitate.
Figure Legend Snippet: CTCF is required for allele-specific chromatin composition locally and at a distance. Quantitative analyses of chromatin composition reveal the consequences of ICR CTCF site mutations. Allele-specific enrichment is no longer apparent: the activating globular domain histone marks H4K91ac (A), H3K79me1 (B), and H3K79me2 (C) have shifted toward the maternal allele at the Igf2 locus. (D) H3K79me3 has shifted toward the maternal allele at the H19 locus. Chromatin was precipitated from CTCFm × CS MEFs in duplicate with the specific antibodies indicated on top of each chart. Allele-specific histone modification at a specific region was expressed as a percentage of the maternal mutant (MATmut) or paternal wild type (PAT) allele in the total immunoprecipitate.

Techniques Used: Modification, Mutagenesis

16) Product Images from "Genetic variants and cellular stressors associated with exfoliation syndrome modulate promoter activity of a lncRNA within the LOXL1 locus"

Article Title: Genetic variants and cellular stressors associated with exfoliation syndrome modulate promoter activity of a lncRNA within the LOXL1 locus

Journal: Human Molecular Genetics

doi: 10.1093/hmg/ddv347

Dual-luciferase reporter assay to test for promoter activity in the LOXL1 intron 1 region. ( A ) To test the hypothesis that the highly associated ∼7-kb region at the LOXL1 exon 1/intron 1 boundary contains a promoter for the LOXL1 antisense RNA
Figure Legend Snippet: Dual-luciferase reporter assay to test for promoter activity in the LOXL1 intron 1 region. ( A ) To test the hypothesis that the highly associated ∼7-kb region at the LOXL1 exon 1/intron 1 boundary contains a promoter for the LOXL1 antisense RNA

Techniques Used: Luciferase, Reporter Assay, Activity Assay

DNase I hypersensitivity site mapping in the LOXL1 / LOXL1-AS1 genomic region in ocular cells. DNase I hypersensitivity mapping was used to query the region of interest at the LOXL1 exon 1/intron 1 boundary for evidence of regulatory elements. Cells from
Figure Legend Snippet: DNase I hypersensitivity site mapping in the LOXL1 / LOXL1-AS1 genomic region in ocular cells. DNase I hypersensitivity mapping was used to query the region of interest at the LOXL1 exon 1/intron 1 boundary for evidence of regulatory elements. Cells from

Techniques Used:

Identification of a novel LOXL1-AS1 isoform. Forward and reverse primers (arrowheads) were designed to amplify a known LOXL1-AS1 isoform (ENST00000566011). This isoform was expressed in a dermal fibroblast cell line (NHDF-Ad, Lonza), resulting in a 2099-bp
Figure Legend Snippet: Identification of a novel LOXL1-AS1 isoform. Forward and reverse primers (arrowheads) were designed to amplify a known LOXL1-AS1 isoform (ENST00000566011). This isoform was expressed in a dermal fibroblast cell line (NHDF-Ad, Lonza), resulting in a 2099-bp

Techniques Used:

Effects of Ocular Cell Stressors on LOXL1-AS1 gene expression. ( A ) To test for the effects of oxidative stress on LOXL1-AS1 expression, B-3 human LE cells were treated with 100, 250 or 500 μ m H 2 O 2 . A dose–response relationship was seen,
Figure Legend Snippet: Effects of Ocular Cell Stressors on LOXL1-AS1 gene expression. ( A ) To test for the effects of oxidative stress on LOXL1-AS1 expression, B-3 human LE cells were treated with 100, 250 or 500 μ m H 2 O 2 . A dose–response relationship was seen,

Techniques Used: Expressing

Effects of XFS-associated alleles on LOXL1-AS1 promoter activity. The highest promoter activity was seen in the construct containing 1240 bp of sequence upstream of the LOXL1-AS1 start site (Fig. ). This −1240-bp construct contains
Figure Legend Snippet: Effects of XFS-associated alleles on LOXL1-AS1 promoter activity. The highest promoter activity was seen in the construct containing 1240 bp of sequence upstream of the LOXL1-AS1 start site (Fig. ). This −1240-bp construct contains

Techniques Used: Activity Assay, Construct, Sequencing

LocusZoom plot of association in a South African XFS data set. The entire LOXL1 genomic region (∼40 kb) was sequenced in a data set of 50 black South African XFS cases and 50 age- and gender-matched controls. This region included all LOXL1 and
Figure Legend Snippet: LocusZoom plot of association in a South African XFS data set. The entire LOXL1 genomic region (∼40 kb) was sequenced in a data set of 50 black South African XFS cases and 50 age- and gender-matched controls. This region included all LOXL1 and

Techniques Used:

17) Product Images from "Expression of Neuronal Trace Amine-associated Receptor (Taar) mRNAs in Leukocytes"

Article Title: Expression of Neuronal Trace Amine-associated Receptor (Taar) mRNAs in Leukocytes

Journal: Journal of neuroimmunology

doi: 10.1016/j.jneuroim.2007.08.006

Semiquantitative RT-PCR analysis of expression of all Taar genes in mouse B cells, macrophages and dendritic cells Total RNA was isolated and incubated with DNase prior to cDNA synthesis. The PCR product for GAPDH from these samples is included to indicate the presence of cDNA. PCR of genomic DNA is included as a positive control for the PCR reaction. Although there is no evidence of expression of any of the mouse Taar genes in mouse macrophages, or dendritic cells, low levels of expression are apparent for most Taar genes in B cells.
Figure Legend Snippet: Semiquantitative RT-PCR analysis of expression of all Taar genes in mouse B cells, macrophages and dendritic cells Total RNA was isolated and incubated with DNase prior to cDNA synthesis. The PCR product for GAPDH from these samples is included to indicate the presence of cDNA. PCR of genomic DNA is included as a positive control for the PCR reaction. Although there is no evidence of expression of any of the mouse Taar genes in mouse macrophages, or dendritic cells, low levels of expression are apparent for most Taar genes in B cells.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Incubation, Polymerase Chain Reaction, Positive Control

Semiquantitative RT-PCR analysis of Taar mRNA expression in mouse spleen cells Total RNA was isolated from whole spleen, and from splenic T, B and NK cells, and treated with DNase prior to cDNA synthesis. PCR of both ERM (a low abundance, constitutively expressed transcription factor) and GAPDH are included as positive controls for the presence of cDNA, and the PCR of genomic DNA included as a positive control for the PCR reaction. The results suggest low levels of expression of Taar1, 2, 3 and 5 in B and NK cells.
Figure Legend Snippet: Semiquantitative RT-PCR analysis of Taar mRNA expression in mouse spleen cells Total RNA was isolated from whole spleen, and from splenic T, B and NK cells, and treated with DNase prior to cDNA synthesis. PCR of both ERM (a low abundance, constitutively expressed transcription factor) and GAPDH are included as positive controls for the presence of cDNA, and the PCR of genomic DNA included as a positive control for the PCR reaction. The results suggest low levels of expression of Taar1, 2, 3 and 5 in B and NK cells.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Polymerase Chain Reaction, Positive Control

Semiquantitative RT-PCR analysis of Taar mRNA expression in human peripheral blood lymphocytes Lymphocytes were isolated from whole human blood and incubated for 24 hr in the presence and absence of PHA. Total RNA was prepared from whole blood cells, freshly prepared lymphocytes and lymphocytes incubated in the presence and absence of PHA for 24 hours. Each sample was treated with DNase, the DNase inactivated and cDNA synthesized. PCR for GAPDH is presented as a positive control for the presence of cDNA. The results suggest low levels of expression of Taar1 and Taar2 in human lymphocytes.
Figure Legend Snippet: Semiquantitative RT-PCR analysis of Taar mRNA expression in human peripheral blood lymphocytes Lymphocytes were isolated from whole human blood and incubated for 24 hr in the presence and absence of PHA. Total RNA was prepared from whole blood cells, freshly prepared lymphocytes and lymphocytes incubated in the presence and absence of PHA for 24 hours. Each sample was treated with DNase, the DNase inactivated and cDNA synthesized. PCR for GAPDH is presented as a positive control for the presence of cDNA. The results suggest low levels of expression of Taar1 and Taar2 in human lymphocytes.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Incubation, Synthesized, Polymerase Chain Reaction, Positive Control

Semiquantitative RT-PCR analysis of Taar1 mRNA expression in mouse macrophages and dendritic cells (no DNase) Apparent mRNA expression of Taar1 in mouse macrophages and dendritic cells during LPS activation, in the absence of DNase treatment of the total RNA. The mRNA expression of the housekeeping gene, GAPDH, is used as a positive control to indicate that similar amounts of cDNA are present in each sample. IL-6 mRNA expression is used to demonstrate cell activation. RT-PCR was performed using total RNA and the results presented as amplified products electrophoresed on ethidium bromide stained agarose gels. DNA sizes in base pairs are shown to the left of the DNA standard. Putative Taar1 expression in the absence of DNase digestion is also shown for liver and brain.
Figure Legend Snippet: Semiquantitative RT-PCR analysis of Taar1 mRNA expression in mouse macrophages and dendritic cells (no DNase) Apparent mRNA expression of Taar1 in mouse macrophages and dendritic cells during LPS activation, in the absence of DNase treatment of the total RNA. The mRNA expression of the housekeeping gene, GAPDH, is used as a positive control to indicate that similar amounts of cDNA are present in each sample. IL-6 mRNA expression is used to demonstrate cell activation. RT-PCR was performed using total RNA and the results presented as amplified products electrophoresed on ethidium bromide stained agarose gels. DNA sizes in base pairs are shown to the left of the DNA standard. Putative Taar1 expression in the absence of DNase digestion is also shown for liver and brain.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Activation Assay, Positive Control, Amplification, Staining

18) Product Images from "Rapid spread of mouse mammary tumor virus in cultured human breast cells"

Article Title: Rapid spread of mouse mammary tumor virus in cultured human breast cells

Journal: Retrovirology

doi: 10.1186/1742-4690-4-73

Neutralization of viral infectivity and AZT treatment . (A) The presence of proviral DNA in the infected Hs578T cells was determined by PCR. The virus released from the second round infected Hs578T cells was, prior infection, pre-incubated either with anti-MMTV neutralizing antibody (Ab) or PBS. Where indicated AZT was added to the cells infected with the virus. NC: non-infected Hs578T cells. M: 1 kb marker. (B) Spread of the virus was abrogated in medium containing AZT. The third-round infected Hs578T cells were cultured for four weeks in medium containing DEX either supplemented with AZT or not and the presence proviral DNA was monitored by a semiquantitative PCR. GAPDH-specific PCR was used to demonstrate equal loading of all PCR reactions (bottom panels). M: 1 kb marker. (C) Real-time TaqMan PCR quantifying proviral loads in the infected Hs578T cells during the AZT treatment experiment. (D) Equal loading was contolled in a Real-time TaqMan PCR specific for GAPDH gene.
Figure Legend Snippet: Neutralization of viral infectivity and AZT treatment . (A) The presence of proviral DNA in the infected Hs578T cells was determined by PCR. The virus released from the second round infected Hs578T cells was, prior infection, pre-incubated either with anti-MMTV neutralizing antibody (Ab) or PBS. Where indicated AZT was added to the cells infected with the virus. NC: non-infected Hs578T cells. M: 1 kb marker. (B) Spread of the virus was abrogated in medium containing AZT. The third-round infected Hs578T cells were cultured for four weeks in medium containing DEX either supplemented with AZT or not and the presence proviral DNA was monitored by a semiquantitative PCR. GAPDH-specific PCR was used to demonstrate equal loading of all PCR reactions (bottom panels). M: 1 kb marker. (C) Real-time TaqMan PCR quantifying proviral loads in the infected Hs578T cells during the AZT treatment experiment. (D) Equal loading was contolled in a Real-time TaqMan PCR specific for GAPDH gene.

Techniques Used: Neutralization, Infection, Polymerase Chain Reaction, Incubation, Marker, Cell Culture

Quantification of proviral DNA and viral RNA in cell lysates and supernatants of the third-round infected human breast cells during a time-course experiment . (A and B) The third-round infected cells were cultured in the presence (A) or absence (B) of 10 -6 M DEX. Genomic DNA was extracted from the infected cells at the indicated time points and semiquantitative PCR was performed. NC: non-transduced HS578T cells. PC: second-round infected Hs578T cells. Equal DNA loading was controlled in a PCR assay with GAPDH-specific primers (bottom panels). M: 1 kb marker. (C) Real-time TaqMan PCR quantifying proviral loads in the infected Hs578T cells during the time-course experiment. (D) Equal loading of the PCR reactions was controlled in a Real-time TaqMan PCR specific for GAPDH gene. (E) The viral RNA was quantified by Real-time RT-PCR in cell culture fluids of the infected Hs578T cells grown either in the presence or absence of 10 -6 M DEX.
Figure Legend Snippet: Quantification of proviral DNA and viral RNA in cell lysates and supernatants of the third-round infected human breast cells during a time-course experiment . (A and B) The third-round infected cells were cultured in the presence (A) or absence (B) of 10 -6 M DEX. Genomic DNA was extracted from the infected cells at the indicated time points and semiquantitative PCR was performed. NC: non-transduced HS578T cells. PC: second-round infected Hs578T cells. Equal DNA loading was controlled in a PCR assay with GAPDH-specific primers (bottom panels). M: 1 kb marker. (C) Real-time TaqMan PCR quantifying proviral loads in the infected Hs578T cells during the time-course experiment. (D) Equal loading of the PCR reactions was controlled in a Real-time TaqMan PCR specific for GAPDH gene. (E) The viral RNA was quantified by Real-time RT-PCR in cell culture fluids of the infected Hs578T cells grown either in the presence or absence of 10 -6 M DEX.

Techniques Used: Infection, Cell Culture, Polymerase Chain Reaction, Marker, Quantitative RT-PCR

19) Product Images from "Expansion of a novel endogenous retrovirus throughout the pericentromeres of modern humans"

Article Title: Expansion of a novel endogenous retrovirus throughout the pericentromeres of modern humans

Journal: Genome Biology

doi: 10.1186/s13059-015-0641-1

Mapping of K222 proviruses in the human genome. (A) Schematic representation of the primer sets used to isolate K222 by PCR. The genomic structure of a centromeric provirus K111 is shown; the viral genes gag , pro , pol , env , and np9 , surrounded by LTRs, integrated into centromeric repeats (CER:D22Z3). The target site duplication of K111 GAATTC is indicated. The primers P1 and P2 bind CER:D22Z3. These primers were used in combination with primers that span the provirus genome. Arrows indicate the position and orientation of the primers; the number above indicates the nucleotide position they bind in reference to K111. Mapping to the 5′ end of the provirus was performed using the primer P1 and a set of HERV-K (HML-2) reverse primers. Mapping to the 3′ end of the provirus was performed with the reverse primer P2 and a set of HERV-K (HML-2) forward primers. (B, C) Isolation of K222 provirus. The sequence of K222 was detected by PCR from DNA of the cell lines H9 and HUT78, which lack K111 5′ end. Normal human DNA, containing K111, was used as a control for the PCR reaction. The number shown for each lane represents the primers. The gels show the amplification products of the 5′ mapping (B) or 3′ mapping (C) of centromeric proviruses in H9, HUT78, and normal human DNA using different combinations of primers. A molecular size ladder is indicated at the left. No amplification products were detected in H9 and HUT78 cell lines, in contrast to normal human DNA, when using the primer sets P1-982R, P1-2499R (B) , or primer sets P2-1965F, and P2-2641F (C) . An asterisk indicates a band that was shown by sequencing to be the result of non-specific amplification. Sequencing of the mapping products obtained from DNA of H9 and HUT78 cells reveals the sequence of K222.
Figure Legend Snippet: Mapping of K222 proviruses in the human genome. (A) Schematic representation of the primer sets used to isolate K222 by PCR. The genomic structure of a centromeric provirus K111 is shown; the viral genes gag , pro , pol , env , and np9 , surrounded by LTRs, integrated into centromeric repeats (CER:D22Z3). The target site duplication of K111 GAATTC is indicated. The primers P1 and P2 bind CER:D22Z3. These primers were used in combination with primers that span the provirus genome. Arrows indicate the position and orientation of the primers; the number above indicates the nucleotide position they bind in reference to K111. Mapping to the 5′ end of the provirus was performed using the primer P1 and a set of HERV-K (HML-2) reverse primers. Mapping to the 3′ end of the provirus was performed with the reverse primer P2 and a set of HERV-K (HML-2) forward primers. (B, C) Isolation of K222 provirus. The sequence of K222 was detected by PCR from DNA of the cell lines H9 and HUT78, which lack K111 5′ end. Normal human DNA, containing K111, was used as a control for the PCR reaction. The number shown for each lane represents the primers. The gels show the amplification products of the 5′ mapping (B) or 3′ mapping (C) of centromeric proviruses in H9, HUT78, and normal human DNA using different combinations of primers. A molecular size ladder is indicated at the left. No amplification products were detected in H9 and HUT78 cell lines, in contrast to normal human DNA, when using the primer sets P1-982R, P1-2499R (B) , or primer sets P2-1965F, and P2-2641F (C) . An asterisk indicates a band that was shown by sequencing to be the result of non-specific amplification. Sequencing of the mapping products obtained from DNA of H9 and HUT78 cells reveals the sequence of K222.

Techniques Used: Polymerase Chain Reaction, Isolation, Sequencing, Amplification

ChIP analysis shows that K222 proviruses are found in pericentromeric regions. Quantitative PCR of K222 DNA, the centromeric 11-mer alphoid repeat of chromosome 21 (alphoidChr.21) DNA, and 5S ribosomal DNA immunoprecipitated by antibodies to CENPA, CENPB, H3K9Me3, or control IgG. (A) Compared to the control IgG fraction, K222 is enriched 50-fold in the H3K9Me3 fraction, but not in the centromeric CENPA and CENPB protein fractions. (B) The positive control, the alphoid Chr.21 , is enriched approximately 8-fold in each of the CENPA and CENPB fractions, and approximately 650-fold in the H3K9Me3 fraction. (C) The negative control, 5S ribosomal DNA pre sent in the q arm of chromosome 1, shows no significant enrichment with antibodies to CENPA, CENPB, or H3K9Me3. Graphs show the relative enrichment normalized to control IgG-precipitated fractions from three independent experiments. Asterisks indicate statistical significance: *** = P
Figure Legend Snippet: ChIP analysis shows that K222 proviruses are found in pericentromeric regions. Quantitative PCR of K222 DNA, the centromeric 11-mer alphoid repeat of chromosome 21 (alphoidChr.21) DNA, and 5S ribosomal DNA immunoprecipitated by antibodies to CENPA, CENPB, H3K9Me3, or control IgG. (A) Compared to the control IgG fraction, K222 is enriched 50-fold in the H3K9Me3 fraction, but not in the centromeric CENPA and CENPB protein fractions. (B) The positive control, the alphoid Chr.21 , is enriched approximately 8-fold in each of the CENPA and CENPB fractions, and approximately 650-fold in the H3K9Me3 fraction. (C) The negative control, 5S ribosomal DNA pre sent in the q arm of chromosome 1, shows no significant enrichment with antibodies to CENPA, CENPB, or H3K9Me3. Graphs show the relative enrichment normalized to control IgG-precipitated fractions from three independent experiments. Asterisks indicate statistical significance: *** = P

Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Positive Control, Negative Control

Detection of K222 in human chromosomes. (A) K222 was detected by PCR using the set of primers K222F and K222bR in DNA from human/rodent hybrid cell lines, which carry only one specific human chromosome. K222 was found in chromosomes 1, 7, 12, 13, 14, 15, 18, 21, and 22. Other bands (for example the PCR products detected in chromosomes 17, 19, 20, X, and Y) were shown by sequencing to be the result of non-specific PCR amplification. (B) Quantitation of K222 copies by qPCR in human chromosomes. The number of K222 copies was calculated from 250 ng of DNA from human/rodent cells lines. Assuming that human cells have between 8 and 61 K222 copies, then we could estimate that about one copy of K222 is present in chromosomes 1, 18, 21, 22, and perhaps more than one in chromosome 12. Several copies of K222, however, exist in chromosomes 7, 13, 14, and 15.
Figure Legend Snippet: Detection of K222 in human chromosomes. (A) K222 was detected by PCR using the set of primers K222F and K222bR in DNA from human/rodent hybrid cell lines, which carry only one specific human chromosome. K222 was found in chromosomes 1, 7, 12, 13, 14, 15, 18, 21, and 22. Other bands (for example the PCR products detected in chromosomes 17, 19, 20, X, and Y) were shown by sequencing to be the result of non-specific PCR amplification. (B) Quantitation of K222 copies by qPCR in human chromosomes. The number of K222 copies was calculated from 250 ng of DNA from human/rodent cells lines. Assuming that human cells have between 8 and 61 K222 copies, then we could estimate that about one copy of K222 is present in chromosomes 1, 18, 21, 22, and perhaps more than one in chromosome 12. Several copies of K222, however, exist in chromosomes 7, 13, 14, and 15.

Techniques Used: Polymerase Chain Reaction, Sequencing, Amplification, Quantitation Assay, Real-time Polymerase Chain Reaction

K222 provirus in the genomes of Old World monkeys, primates and humans. (A) Phylogenetic neighbor-joining tree of K222 integration sequences amplified from the DNA of baboon, orangutan, gorilla, chimpanzee, and human. The tree is unrooted, with taxa arranged for a balanced shape. The tree was constructed using the Kimura 2-parameter model. The stability of branches was evaluated by bootstrap tests with 10,000 replications. The scale bars represent the nucleotide substitutions per sequence. (B) Nucleotide sequence alignment of K222 insertion sequences amplified from the genomes of Old World monkeys, primates, and humans. The sequences are compared to the olive baboon sequence, which is the oldest germline sequence. Dots indicate nucleotide similarities to the master sequence. Nucleotide substitutions are indicated in letters. Several nucleotide insertions can be seen in the sequence of K222 in the orangutan, but not other primates or humans (B) , which cause the divergence of the orangutan K222 in the phylogenetic tree (A) , suggesting that these insertions arose only during the evolution of modern orangutans.
Figure Legend Snippet: K222 provirus in the genomes of Old World monkeys, primates and humans. (A) Phylogenetic neighbor-joining tree of K222 integration sequences amplified from the DNA of baboon, orangutan, gorilla, chimpanzee, and human. The tree is unrooted, with taxa arranged for a balanced shape. The tree was constructed using the Kimura 2-parameter model. The stability of branches was evaluated by bootstrap tests with 10,000 replications. The scale bars represent the nucleotide substitutions per sequence. (B) Nucleotide sequence alignment of K222 insertion sequences amplified from the genomes of Old World monkeys, primates, and humans. The sequences are compared to the olive baboon sequence, which is the oldest germline sequence. Dots indicate nucleotide similarities to the master sequence. Nucleotide substitutions are indicated in letters. Several nucleotide insertions can be seen in the sequence of K222 in the orangutan, but not other primates or humans (B) , which cause the divergence of the orangutan K222 in the phylogenetic tree (A) , suggesting that these insertions arose only during the evolution of modern orangutans.

Techniques Used: Amplification, Construct, Sequencing

Detection of K222 and recombinant K222/K111 sequences in individuals lacking the K111 5′ end. (A) Amplification of K222/K111 recombinant sequences. K222/K111 sequences were amplified with the primer 7972F and the primer P2, which binds to the K111 3′ flanking sequence (see Figure 2 ) in the DNA from individuals who lack the K111 5′ end (68, 90, and 95) and the cell line HUT78, which also lacks the K111 integration. As a positive control we used the DNA of individual 96, who is positive for K111 5′ end. (B) Amplification of K222 3′ integration. K222 was amplified with the primer 7972F and K222LTR-pCER:D22Z8R, the latter primer binding to the LTR-pCER:D22Z8 junction sequence present in K222, but not in K111. K111 3′ integration instead has a 5 bp sequence from the LTR and the target site duplication GAATTC not present in K222. Amplification of K222 3′ integration was seen in individuals having (96) or lacking (68, 90, and HUT78) the K111 5′ end. (C) Evolution of K222 and K222/K111 recombinant sequences in humans. A Bayesian inference tree of K222 and K222/K111 LTR sequences obtained by PCR in individuals lacking the K111 5′ end. The K222 sequences amplified are indicated with a K222 label. The tree reveals two different K222 LTR clades; K222 sequences similar to the K222 provirus (blue) and sequences that cluster to the K111 provirus (red). K222 sequences in individuals lacking the K111 5′ end clustering to K111 indicate the likely existence of K111 in the ancestral human lineage of those individuals. The K222/K111 recombinant clade (red) also suggests that K222 and K111 likely recombined by recombination/gene conversion during human evolution before K111 was lost from the lineage. Posterior probability values > 85 are shown for the best tree.
Figure Legend Snippet: Detection of K222 and recombinant K222/K111 sequences in individuals lacking the K111 5′ end. (A) Amplification of K222/K111 recombinant sequences. K222/K111 sequences were amplified with the primer 7972F and the primer P2, which binds to the K111 3′ flanking sequence (see Figure 2 ) in the DNA from individuals who lack the K111 5′ end (68, 90, and 95) and the cell line HUT78, which also lacks the K111 integration. As a positive control we used the DNA of individual 96, who is positive for K111 5′ end. (B) Amplification of K222 3′ integration. K222 was amplified with the primer 7972F and K222LTR-pCER:D22Z8R, the latter primer binding to the LTR-pCER:D22Z8 junction sequence present in K222, but not in K111. K111 3′ integration instead has a 5 bp sequence from the LTR and the target site duplication GAATTC not present in K222. Amplification of K222 3′ integration was seen in individuals having (96) or lacking (68, 90, and HUT78) the K111 5′ end. (C) Evolution of K222 and K222/K111 recombinant sequences in humans. A Bayesian inference tree of K222 and K222/K111 LTR sequences obtained by PCR in individuals lacking the K111 5′ end. The K222 sequences amplified are indicated with a K222 label. The tree reveals two different K222 LTR clades; K222 sequences similar to the K222 provirus (blue) and sequences that cluster to the K111 provirus (red). K222 sequences in individuals lacking the K111 5′ end clustering to K111 indicate the likely existence of K111 in the ancestral human lineage of those individuals. The K222/K111 recombinant clade (red) also suggests that K222 and K111 likely recombined by recombination/gene conversion during human evolution before K111 was lost from the lineage. Posterior probability values > 85 are shown for the best tree.

Techniques Used: Recombinant, Amplification, Sequencing, Positive Control, Binding Assay, Polymerase Chain Reaction

K222 integrated into the primate germline after the divergence of New and Old World monkeys and expanded in copy number during the evolution of humans. (A) Genomic organization of centromeric K111 and K222 proviruses. The positions of the primers used to amplify K222 insertions by PCR and qPCR are indicated by arrows. (B) Detection of K222 from DNA of New and Old-World primates. K222 was detected by PCR with the primers K222F and K222bR in the baboon, orangutan, gorilla, chimpanzee, and human, but not in macaques, African green monkeys, and New World monkeys. Other bands (for example, the PCR products detected in mouse, hamster, and rhesus macaque) were shown by sequencing to be the result of non-specific PCR amplification. A phylogeny of New World monkeys, Old World monkeys, and hominoids (humans and apes) is shown. Estimated times of divergence are shown. MYA: million years ago. (C) Quantitation of K222 copies by qPCR in the genomes of Old World monkeys, humans, and a number of other primates. K222 is likely present as a single copy in the genomes of baboon, orangutan, gorilla and chimpanzee, while present in multiple copies in the human genome. The label of each species in (B) matches to the bars.
Figure Legend Snippet: K222 integrated into the primate germline after the divergence of New and Old World monkeys and expanded in copy number during the evolution of humans. (A) Genomic organization of centromeric K111 and K222 proviruses. The positions of the primers used to amplify K222 insertions by PCR and qPCR are indicated by arrows. (B) Detection of K222 from DNA of New and Old-World primates. K222 was detected by PCR with the primers K222F and K222bR in the baboon, orangutan, gorilla, chimpanzee, and human, but not in macaques, African green monkeys, and New World monkeys. Other bands (for example, the PCR products detected in mouse, hamster, and rhesus macaque) were shown by sequencing to be the result of non-specific PCR amplification. A phylogeny of New World monkeys, Old World monkeys, and hominoids (humans and apes) is shown. Estimated times of divergence are shown. MYA: million years ago. (C) Quantitation of K222 copies by qPCR in the genomes of Old World monkeys, humans, and a number of other primates. K222 is likely present as a single copy in the genomes of baboon, orangutan, gorilla and chimpanzee, while present in multiple copies in the human genome. The label of each species in (B) matches to the bars.

Techniques Used: Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Sequencing, Amplification, Quantitation Assay

Detection of the K222 provirus in the genome of human cell lines by slot blot analysis. The DNA of human cell lines that were found to have or lack the 5′ end of K111 by PCR, and presumably contain the truncated K222 provirus, were screened for K111 and K222 by slot blot analyses. (A) Generation of K111 and K222-specific biotinylated probes. Probes were generated by PCR incorporation of biotin-labeled dCTP. The K111 probe is 422 bp long and spans the CER:D22Z3 flanking sequence and the beginning of the LTR of K111. The K222 probe is 464 bp long and covers the pCER:D22Z8 flanking sequence and pro gene of K222. (B) DNA from the B-cell lines BJAB (having the 5′ end of K111) and IRA (lacking the 5′ end) as observed by PCR, were screened for K111 and K222 virus by slot blotting. DNA was cross-linked to PVDF membranes and screened for K111 and K222 using biotinylated probes. The probes were detected by chemiluminescence with HRP-conjugated streptavidin. The K111 probe, which targets the 5′ end of genomic K111, reacted with the DNA of BJAB cells but not IRA cells, confirming the lack of the 5′ end of the viral genome in IRA cells. The K222 probe reacted with the DNA of both BJAB and IRA cells, confirming that both cell lines have provirus K222, which is truncated at the 5′ end. Mouse DNA served as a negative control, and plasmids containing either K111 or K222 genomes were used as positive controls. The K111 probe did not react with the K222 plasmid and vice versa.
Figure Legend Snippet: Detection of the K222 provirus in the genome of human cell lines by slot blot analysis. The DNA of human cell lines that were found to have or lack the 5′ end of K111 by PCR, and presumably contain the truncated K222 provirus, were screened for K111 and K222 by slot blot analyses. (A) Generation of K111 and K222-specific biotinylated probes. Probes were generated by PCR incorporation of biotin-labeled dCTP. The K111 probe is 422 bp long and spans the CER:D22Z3 flanking sequence and the beginning of the LTR of K111. The K222 probe is 464 bp long and covers the pCER:D22Z8 flanking sequence and pro gene of K222. (B) DNA from the B-cell lines BJAB (having the 5′ end of K111) and IRA (lacking the 5′ end) as observed by PCR, were screened for K111 and K222 virus by slot blotting. DNA was cross-linked to PVDF membranes and screened for K111 and K222 using biotinylated probes. The probes were detected by chemiluminescence with HRP-conjugated streptavidin. The K111 probe, which targets the 5′ end of genomic K111, reacted with the DNA of BJAB cells but not IRA cells, confirming the lack of the 5′ end of the viral genome in IRA cells. The K222 probe reacted with the DNA of both BJAB and IRA cells, confirming that both cell lines have provirus K222, which is truncated at the 5′ end. Mouse DNA served as a negative control, and plasmids containing either K111 or K222 genomes were used as positive controls. The K111 probe did not react with the K222 plasmid and vice versa.

Techniques Used: Dot Blot, Polymerase Chain Reaction, Generated, Labeling, Sequencing, Negative Control, Plasmid Preparation

Absence of K111 5′ end in the genome of some cell lines. (A) Genomic structure of the K111 provirus. Arrows indicate the position of the primers P1 and P4, which amplify the 5′ integration of K111, and the primer/probe combination K111F, K111R, and K111P that specifically discriminates the K111 and K222 env gene from other HERV-K (HML-2) env sequences due to a 6 bp mutation [ 10 ]. (B) Detection of K111 5′ end insertions in human cell lines. The 5′ flanking K111 insertions were detected in all human cell lines tested in this study by PCR using the primers P1 and P4 [ 10 ], except for the DNA of cell lines H9, HUT78, H9/HTLVIII, and the IRA B-cell line. Arrows indicate individual K111 insertional polymorphisms. Integrity of the DNA was assessed by amplification of GAPDH (see lower gel). The molecular size of the DNA ladder is shown on the left of the gel. On top of each lane is the name of each cell line subjected to study. The weak bands observed in H9 and H9/HTLVIII were shown by sequencing to be the result of non-specific PCR amplification.
Figure Legend Snippet: Absence of K111 5′ end in the genome of some cell lines. (A) Genomic structure of the K111 provirus. Arrows indicate the position of the primers P1 and P4, which amplify the 5′ integration of K111, and the primer/probe combination K111F, K111R, and K111P that specifically discriminates the K111 and K222 env gene from other HERV-K (HML-2) env sequences due to a 6 bp mutation [ 10 ]. (B) Detection of K111 5′ end insertions in human cell lines. The 5′ flanking K111 insertions were detected in all human cell lines tested in this study by PCR using the primers P1 and P4 [ 10 ], except for the DNA of cell lines H9, HUT78, H9/HTLVIII, and the IRA B-cell line. Arrows indicate individual K111 insertional polymorphisms. Integrity of the DNA was assessed by amplification of GAPDH (see lower gel). The molecular size of the DNA ladder is shown on the left of the gel. On top of each lane is the name of each cell line subjected to study. The weak bands observed in H9 and H9/HTLVIII were shown by sequencing to be the result of non-specific PCR amplification.

Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Sequencing

Detection of K111 and K222 in the human population. (A) Genomic organization of K111 and K222 proviruses. The location of the primers to map K111 and K222 is shown. (B) Detection of K111 5′ end in the human population. The 5′ end of K111 was detected using the primers P1 and P4. The black arrow A indicates the K111 5′ end. The gray arrow indicates non-specific PCR products. On top of each lane is a number signifying each individual subjected to study. (C, D) Mapping of K111 (C) and K222 (D) in five individuals, who are positive or negative for the K111 5′ end, respectively. K111 mapping (C) was carried out with primer P1 and reverse primers that bind at positions 982, 2499, and 3460 bp of a K111 provirus. Black arrows indicate specific K111 insertions; A (product P1-982R), C (product P1-2499R), and D (product P1-3460R). The gray arrow indicates non-specific PCR amplifications. K111 detection was observed in the individuals labeled with the numbers, 1, 2, 3, 5, and 6, which are positive for the 5′ K111 end. Non-specific PCR product was detected in individuals labeled with the numbers 4, 68, 86, 90, and 95, which are negative for the 5′ K111 end as shown in B. The primers P1 and 3460R also detect K222 in individuals either negative or positive for the 5′ K111 integration (see stars). K222 mapping was carried out with the primer K222F and reverse primers that bind at positions 982, 1968, 2499, and 3460 bp in reference to K111. PCR products A, B, and C (black arrows) seen in the DNA of K111 positive individuals were shown to be the amplification of K111. No amplification products were seen in individuals lacking the 5′ end of K111. D represents the amplification product of K222.
Figure Legend Snippet: Detection of K111 and K222 in the human population. (A) Genomic organization of K111 and K222 proviruses. The location of the primers to map K111 and K222 is shown. (B) Detection of K111 5′ end in the human population. The 5′ end of K111 was detected using the primers P1 and P4. The black arrow A indicates the K111 5′ end. The gray arrow indicates non-specific PCR products. On top of each lane is a number signifying each individual subjected to study. (C, D) Mapping of K111 (C) and K222 (D) in five individuals, who are positive or negative for the K111 5′ end, respectively. K111 mapping (C) was carried out with primer P1 and reverse primers that bind at positions 982, 2499, and 3460 bp of a K111 provirus. Black arrows indicate specific K111 insertions; A (product P1-982R), C (product P1-2499R), and D (product P1-3460R). The gray arrow indicates non-specific PCR amplifications. K111 detection was observed in the individuals labeled with the numbers, 1, 2, 3, 5, and 6, which are positive for the 5′ K111 end. Non-specific PCR product was detected in individuals labeled with the numbers 4, 68, 86, 90, and 95, which are negative for the 5′ K111 end as shown in B. The primers P1 and 3460R also detect K222 in individuals either negative or positive for the 5′ K111 integration (see stars). K222 mapping was carried out with the primer K222F and reverse primers that bind at positions 982, 1968, 2499, and 3460 bp in reference to K111. PCR products A, B, and C (black arrows) seen in the DNA of K111 positive individuals were shown to be the amplification of K111. No amplification products were seen in individuals lacking the 5′ end of K111. D represents the amplification product of K222.

Techniques Used: Polymerase Chain Reaction, Labeling, Amplification

20) Product Images from "Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice"

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20041074

DC-PCR analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic DNA was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.
Figure Legend Snippet: DC-PCR analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic DNA was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.

Techniques Used: Polymerase Chain Reaction, Isolation, In Vitro

21) Product Images from "B-cell display-based one-step method to generate chimeric human IgG monoclonal antibodies"

Article Title: B-cell display-based one-step method to generate chimeric human IgG monoclonal antibodies

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq1122

The chicken/human chimeric IgG expression construct. ( A ) Strategy for the knock-in of the human IgHG1 constant region at the chicken IgHM locus. The chicken IgHM region from the exon C H 1 to C H 3 was cloned to make the targeting vector. The intronic region digested by BseRI was replaced by the human IgHG1 region from H to C H 3 and a selectable marker. Bsd = blasticidin S deaminase. p(A) = polyadenylation sites. Genomic size and distances are not to scale (distance of chicken C H 1 to C H 2 = 4.5 kb; human H-C H 2-C H 3 insert = 1 kb). ( B ) Final genomic structure after integration of the knock-in plasmid and expected mRNA variants produced by alternative splicing. Thick horizontal bars indicate the approximate positions of the primers for PCR and RT–PCR used to confirm genomic integration and expression of IgHM and IgHG1 transcripts. ( C ) Expression of IgHM and of chimeric IgHG1 detected by RT–PCR in the wild-type parental strain (WT) and a positive chimeric transformant (CX13). ( D ) Schematic outline of the ADLib system applied to the selection of chimeric human IgG. (From left to right) The enhancement of sequence diversification at the Ig variable locus in TSA-treated DT40 cultures allows the generation of an autonomously diversifying library of cells expressing various surface IgM; the clones specific for the target antigen are isolated using antigen-coated magnetic beads; CX13 cells co-express secreted-form chicken IgM and chimeric IgG with the same antigen-binding domain; antigen-specific chimeric IgG can therefore be isolated directly from the culture supernatant for further use.
Figure Legend Snippet: The chicken/human chimeric IgG expression construct. ( A ) Strategy for the knock-in of the human IgHG1 constant region at the chicken IgHM locus. The chicken IgHM region from the exon C H 1 to C H 3 was cloned to make the targeting vector. The intronic region digested by BseRI was replaced by the human IgHG1 region from H to C H 3 and a selectable marker. Bsd = blasticidin S deaminase. p(A) = polyadenylation sites. Genomic size and distances are not to scale (distance of chicken C H 1 to C H 2 = 4.5 kb; human H-C H 2-C H 3 insert = 1 kb). ( B ) Final genomic structure after integration of the knock-in plasmid and expected mRNA variants produced by alternative splicing. Thick horizontal bars indicate the approximate positions of the primers for PCR and RT–PCR used to confirm genomic integration and expression of IgHM and IgHG1 transcripts. ( C ) Expression of IgHM and of chimeric IgHG1 detected by RT–PCR in the wild-type parental strain (WT) and a positive chimeric transformant (CX13). ( D ) Schematic outline of the ADLib system applied to the selection of chimeric human IgG. (From left to right) The enhancement of sequence diversification at the Ig variable locus in TSA-treated DT40 cultures allows the generation of an autonomously diversifying library of cells expressing various surface IgM; the clones specific for the target antigen are isolated using antigen-coated magnetic beads; CX13 cells co-express secreted-form chicken IgM and chimeric IgG with the same antigen-binding domain; antigen-specific chimeric IgG can therefore be isolated directly from the culture supernatant for further use.

Techniques Used: Expressing, Construct, Knock-In, Clone Assay, Plasmid Preparation, Marker, Produced, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Selection, Sequencing, Isolation, Magnetic Beads, Binding Assay

22) Product Images from "Effects of two common polymorphisms in the 3' untranslated regions of estrogen receptor ? on mRNA stability and translatability"

Article Title: Effects of two common polymorphisms in the 3' untranslated regions of estrogen receptor ? on mRNA stability and translatability

Journal: BMC Genetics

doi: 10.1186/1471-2156-10-55

Allelic expression of ERβ 3'UTR SNPs in breast tumor samples . A . Genomic DNA was sequenced in two independent assays. cDNA synthesis was performed twice and each cDNA was sequenced in two independent assays. For each sample and allele, the average peak heights from the four cDNA sequencing assays were normalized by the average peak heights from the two DNA sequencing assays. The results from five breast tumor samples heterozygous for each SNP are presented as relative allelic ratios for cDNA versus genomic DNA. Data are shown as mean ± SD, with allele G set to 100%. (a) ERβ1 3'UTR polymorphism (rs4986938 G↔A); (b) ERβ2 polymorphism (rs928554 G↔A). B . Representative examples of genomic DNA and mRNA sequencing. (a) ERβ1 3'UTR polymorphism (rs4986938); (b) ERβ2 3'UTR polymorphism (rs928554). Observe that for rs928554 G↔A, the bottom strand was sequenced therefore the DNA sequence reads C and T, respectively.
Figure Legend Snippet: Allelic expression of ERβ 3'UTR SNPs in breast tumor samples . A . Genomic DNA was sequenced in two independent assays. cDNA synthesis was performed twice and each cDNA was sequenced in two independent assays. For each sample and allele, the average peak heights from the four cDNA sequencing assays were normalized by the average peak heights from the two DNA sequencing assays. The results from five breast tumor samples heterozygous for each SNP are presented as relative allelic ratios for cDNA versus genomic DNA. Data are shown as mean ± SD, with allele G set to 100%. (a) ERβ1 3'UTR polymorphism (rs4986938 G↔A); (b) ERβ2 polymorphism (rs928554 G↔A). B . Representative examples of genomic DNA and mRNA sequencing. (a) ERβ1 3'UTR polymorphism (rs4986938); (b) ERβ2 3'UTR polymorphism (rs928554). Observe that for rs928554 G↔A, the bottom strand was sequenced therefore the DNA sequence reads C and T, respectively.

Techniques Used: Expressing, Sequencing, DNA Sequencing

23) Product Images from "Primary microRNA transcripts are processed co-transcriptionally"

Article Title: Primary microRNA transcripts are processed co-transcriptionally

Journal: Nature structural & molecular biology

doi: 10.1038/nsmb.1475

miRNA maturation from the second intron and 3′ flanking region of the β-globin gene in HeLa cells. ( a ) Diagram of the β-globin construct with or without insertion of either miR-330 or let-7a3 pre-miRNAs in intron 2 (βInt2-miR-330 or βInt2-let-7a3 constructs). The exons (gray boxes), introns (lines) and miRNAs (white box). Below, northern blot analysis of cytoplasmic RNA from transfected HeLa cells. Specific antisense oligonucleotides were used to detect miR-330, let-7a3 and miR-21 miRNAs. Lower northern blots detect endogenous miR-21, used as a loading control. ( b ) Diagram of βInt2-miR-330 showing positions of the NRO probes (underlined). ‘M’ denotes background signal. The HIV-1 promoter with the 5′ portion of the β-globin gene as a dashed line and the backbone plasmid are indicated as is the position of a biotinylated probe (Bio-int2). Graph shows the ratio between B3 and a hybridization signal (left) from selected and unselected fractions. ( c ) β-globin gene constructs with 3′ flanking CoTC and miRNA sequences shown as white boxes and CoTC deletion indicated by a white triangle. NRO probe positions are underlined. Left, NRO analysis of HeLa cells transiently transfected with constructs indicated. Whereas the β construct shows dramatic Pol II termination after probe B4, ΔCoTC and β3′-miR-330 and β3′-let-7a3 demonstrate read-through signals around the transfected plasmids, as detected by high signals over probes A and U3. Right, northern blot analysis of miRNAs produced from the indicated plasmid constructs, indicating that 3′ flanking and intronically located pre-miRNAs are expressed at similar levels.
Figure Legend Snippet: miRNA maturation from the second intron and 3′ flanking region of the β-globin gene in HeLa cells. ( a ) Diagram of the β-globin construct with or without insertion of either miR-330 or let-7a3 pre-miRNAs in intron 2 (βInt2-miR-330 or βInt2-let-7a3 constructs). The exons (gray boxes), introns (lines) and miRNAs (white box). Below, northern blot analysis of cytoplasmic RNA from transfected HeLa cells. Specific antisense oligonucleotides were used to detect miR-330, let-7a3 and miR-21 miRNAs. Lower northern blots detect endogenous miR-21, used as a loading control. ( b ) Diagram of βInt2-miR-330 showing positions of the NRO probes (underlined). ‘M’ denotes background signal. The HIV-1 promoter with the 5′ portion of the β-globin gene as a dashed line and the backbone plasmid are indicated as is the position of a biotinylated probe (Bio-int2). Graph shows the ratio between B3 and a hybridization signal (left) from selected and unselected fractions. ( c ) β-globin gene constructs with 3′ flanking CoTC and miRNA sequences shown as white boxes and CoTC deletion indicated by a white triangle. NRO probe positions are underlined. Left, NRO analysis of HeLa cells transiently transfected with constructs indicated. Whereas the β construct shows dramatic Pol II termination after probe B4, ΔCoTC and β3′-miR-330 and β3′-let-7a3 demonstrate read-through signals around the transfected plasmids, as detected by high signals over probes A and U3. Right, northern blot analysis of miRNAs produced from the indicated plasmid constructs, indicating that 3′ flanking and intronically located pre-miRNAs are expressed at similar levels.

Techniques Used: Construct, Northern Blot, Transfection, Plasmid Preparation, Hybridization, Produced

Co-transcriptional processing of pre-miRNAs from the β-globin gene intron 2. ( a A diagram of β-globin transcript containing the pre-miRNA in intron 2 is shown (1). Grey boxes are exons whereas miRNA sequence is indicated by a hairpin within intron 2 (solid line). Drosha cleavage sites are shown as lightening bolts. Hybrid selection of this transcript was carried out using antisense biotinylated RNA (black line and circle) and selected transcripts were released by RNase H digestion directed by antisense DNA oligonucleotide (dotted line). Released RNAs were circularized by RNA ligation and reverse transcribed with a primer (arrow) across the ligation junction (2,3). PCR amplification using a primer pair (gray and black arrows) amplifies only cDNA obtained from the ligated RNA (4). Products were analyzed on agarose gel, cloned and sequenced (5). Right, agarose gel analysis of hscRACE products obtained from βInt2-miR-330 and βInt2-miR-let7a3 constructs. Major products are indicated by arrows and minor products by an asterisk. M indicates the molecular weight DNA marker. ( b ) Diagram of chimeric βInt2-miR-330 transcript with labeled arrows indicating the primers used for RT-PCR analysis. Hairpin sequences depict the miR-330 stem-loop with the mature miRNA position sequence as a thick line and the mutant sequence change as indicated. Right, northern blot analysis of miRNAs produced from the wild-type and mut plasmid constructs. Below, an endogenous miR-21 control. (c) RT-PCR analysis of the chromatin-associated (Pellet) and nucleoplasmic (SN) fractions carried out with the primer pairs indicated to the right of the agarose gels. Identities of the PCR products are shown to the right. Quantitative analysis was carried out by real-time PCR, as shown below as % RNA in Pellet or SN fractions.
Figure Legend Snippet: Co-transcriptional processing of pre-miRNAs from the β-globin gene intron 2. ( a A diagram of β-globin transcript containing the pre-miRNA in intron 2 is shown (1). Grey boxes are exons whereas miRNA sequence is indicated by a hairpin within intron 2 (solid line). Drosha cleavage sites are shown as lightening bolts. Hybrid selection of this transcript was carried out using antisense biotinylated RNA (black line and circle) and selected transcripts were released by RNase H digestion directed by antisense DNA oligonucleotide (dotted line). Released RNAs were circularized by RNA ligation and reverse transcribed with a primer (arrow) across the ligation junction (2,3). PCR amplification using a primer pair (gray and black arrows) amplifies only cDNA obtained from the ligated RNA (4). Products were analyzed on agarose gel, cloned and sequenced (5). Right, agarose gel analysis of hscRACE products obtained from βInt2-miR-330 and βInt2-miR-let7a3 constructs. Major products are indicated by arrows and minor products by an asterisk. M indicates the molecular weight DNA marker. ( b ) Diagram of chimeric βInt2-miR-330 transcript with labeled arrows indicating the primers used for RT-PCR analysis. Hairpin sequences depict the miR-330 stem-loop with the mature miRNA position sequence as a thick line and the mutant sequence change as indicated. Right, northern blot analysis of miRNAs produced from the wild-type and mut plasmid constructs. Below, an endogenous miR-21 control. (c) RT-PCR analysis of the chromatin-associated (Pellet) and nucleoplasmic (SN) fractions carried out with the primer pairs indicated to the right of the agarose gels. Identities of the PCR products are shown to the right. Quantitative analysis was carried out by real-time PCR, as shown below as % RNA in Pellet or SN fractions.

Techniques Used: Sequencing, Selection, Ligation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Clone Assay, Construct, Molecular Weight, Marker, Labeling, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Northern Blot, Produced, Plasmid Preparation, Real-time Polymerase Chain Reaction

24) Product Images from "Chemoresistance to Valproate Treatment of Bovine Leukemia Virus-Infected Sheep; Identification of Improved HDAC Inhibitors"

Article Title: Chemoresistance to Valproate Treatment of Bovine Leukemia Virus-Infected Sheep; Identification of Improved HDAC Inhibitors

Journal: Pathogens

doi: 10.3390/pathogens1020065

BLV proviral integrity and integration sites during VPA treatment and relapse: A. DNA was extracted from BLV-infected sheep PBMCs (2213, 3002, 3003, 4213, 4535) isolated just before VPA treatment at day 0 (B) and at the end of the relapse period (R). The full length proviral sequence was amplified by PCR using primers located in the 5' and 3' LTRs. PCR amplification products were migrated onto an agarose gel. The molecular weight of the amplicon is indicated in kilobases (8 Kb). B. Southern blot hybridization using a BLV probe of genomic DNA digested with EcoRI. The molecular weight markers (in Kb) are indicated on the left. Lanes correspond to those of panel A.
Figure Legend Snippet: BLV proviral integrity and integration sites during VPA treatment and relapse: A. DNA was extracted from BLV-infected sheep PBMCs (2213, 3002, 3003, 4213, 4535) isolated just before VPA treatment at day 0 (B) and at the end of the relapse period (R). The full length proviral sequence was amplified by PCR using primers located in the 5' and 3' LTRs. PCR amplification products were migrated onto an agarose gel. The molecular weight of the amplicon is indicated in kilobases (8 Kb). B. Southern blot hybridization using a BLV probe of genomic DNA digested with EcoRI. The molecular weight markers (in Kb) are indicated on the left. Lanes correspond to those of panel A.

Techniques Used: Infection, Isolation, Sequencing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight, Southern Blot, Hybridization

BLV proviral loads during VPA treatment and relapse: The proviral loads (empty squares), represented as numbers of viral copies per 10 3 B-lymphocytes, were measured by real time PCR using genomic DNA isolated from sheep peripheral blood mononuclear cells (PBMCs). Data result from triplicate measurements (error bars represent means ± standard deviations). Absolute leukocyte numbers are indicated as reference (dotted line).
Figure Legend Snippet: BLV proviral loads during VPA treatment and relapse: The proviral loads (empty squares), represented as numbers of viral copies per 10 3 B-lymphocytes, were measured by real time PCR using genomic DNA isolated from sheep peripheral blood mononuclear cells (PBMCs). Data result from triplicate measurements (error bars represent means ± standard deviations). Absolute leukocyte numbers are indicated as reference (dotted line).

Techniques Used: Real-time Polymerase Chain Reaction, Isolation

25) Product Images from "Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis"

Article Title: Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis

Journal: Infection and Immunity

doi: 10.1128/IAI.00144-12

fpt genes are expressed during intracellular growth. J774.1 cells were infected with LVS for a period of 20 h. Following overnight incubation, RNA was isolated, cDNA was generated, and the presence of fpt transcripts was confirmed by PCR with Fpt gene-specific primers. For each labeled gene, lane 1 represents the gene-specific PCR product amplified from cDNA, lane 2 is a non-RT negative control for genomic DNA contamination, and lane 3 is a positive control where the specified gene was amplified from LVS genomic DNA.
Figure Legend Snippet: fpt genes are expressed during intracellular growth. J774.1 cells were infected with LVS for a period of 20 h. Following overnight incubation, RNA was isolated, cDNA was generated, and the presence of fpt transcripts was confirmed by PCR with Fpt gene-specific primers. For each labeled gene, lane 1 represents the gene-specific PCR product amplified from cDNA, lane 2 is a non-RT negative control for genomic DNA contamination, and lane 3 is a positive control where the specified gene was amplified from LVS genomic DNA.

Techniques Used: Infection, Incubation, Isolation, Generated, Polymerase Chain Reaction, Labeling, Amplification, Negative Control, Positive Control

26) Product Images from "Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans"

Article Title: Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans

Journal: Human Molecular Genetics

doi: 10.1093/hmg/ddu210

The 5′UTR CGG repeat causes a significant increase in mRNA level. Total RNA from adult transgenic animals was extracted, reverse-transcribed into cDNA, and quantified by real-time PCR. GFP mRNA expression was increased ∼5-fold in animals expressing p AWC ::FMR(CGG) 99 ::GFP compared with control (0CGG) animals, which was set to 1. (Error bars: SEM.) The data were collected from four independently isolated populations of animals.
Figure Legend Snippet: The 5′UTR CGG repeat causes a significant increase in mRNA level. Total RNA from adult transgenic animals was extracted, reverse-transcribed into cDNA, and quantified by real-time PCR. GFP mRNA expression was increased ∼5-fold in animals expressing p AWC ::FMR(CGG) 99 ::GFP compared with control (0CGG) animals, which was set to 1. (Error bars: SEM.) The data were collected from four independently isolated populations of animals.

Techniques Used: Transgenic Assay, Real-time Polymerase Chain Reaction, Expressing, Isolation

Expression of 99 CGG repeats in the 5′UTR results in olfactory adaptation defects. ( A ) Animals carrying the control GFP reporter with 0 CGGs in the 5′UTR behave like wild type. Transgenic strains (‘+’; express the FMR1 reporter and p unc-122 ::GFP in coelomocytes) and siblings that lost the transgene (‘−’) were grown on the same plates. Bars and error bars represent the mean CIs and standard errors of the mean (SEM) from at least 3 independent assay days from populations that were either naïve (white or gray bars) or pre-exposed to odor (black or hatched bars). To quantitate the relative gDNA levels, total gDNA from the larval stage 4 (L4) animals was extracted and subjected to real-time PCR. The relative levels of the 0CGG and 99CGG reporters were normalized to the housekeeping gene, act-3 . The data were collected from three independent experiments. ‘±’ indicates the values of SEM. ( B ) 100% of lines that express 99 CGG repeats are defective for olfactory adaptation. The chemotaxis and adaptation values for seven transgenic lines (lines 1–7) carrying the p AWC ::FMR(CGG) 99 ::GFP construct (labeled (+)) were compared with their siblings without transgenes (labeled (−)). Data are from at least five independent assays and are labeled as in Figure 3 A. P -values indicate results of two-tailed t -tests between the CIs of transgenic- (+) and non-transgenic (−) adapted animals in the same transgenic strain. ‘n.s.’ indicates no significant difference, as P -value is > 0.05. The relative gDNA levels are presented at the bottom line. ( C ) PCR genotyping of transgenic animals carrying 99 CGG repeats. gDNA from individual strains was extracted and genotyped with two primers flanking the CGG-repeat area. The PCR product is 505 bp, indicated by an arrow, and the p AWC ::FMR(CGG) 99 ::GFP plasmid, referred as CGG plasmid, was used as a positive control. Amplification of an endogenous control, act-3 , is shown below. ‘*’ indicates non-specific amplification. The absence of a band for line 8 indicates that this line had lost the FMR1 reporter.
Figure Legend Snippet: Expression of 99 CGG repeats in the 5′UTR results in olfactory adaptation defects. ( A ) Animals carrying the control GFP reporter with 0 CGGs in the 5′UTR behave like wild type. Transgenic strains (‘+’; express the FMR1 reporter and p unc-122 ::GFP in coelomocytes) and siblings that lost the transgene (‘−’) were grown on the same plates. Bars and error bars represent the mean CIs and standard errors of the mean (SEM) from at least 3 independent assay days from populations that were either naïve (white or gray bars) or pre-exposed to odor (black or hatched bars). To quantitate the relative gDNA levels, total gDNA from the larval stage 4 (L4) animals was extracted and subjected to real-time PCR. The relative levels of the 0CGG and 99CGG reporters were normalized to the housekeeping gene, act-3 . The data were collected from three independent experiments. ‘±’ indicates the values of SEM. ( B ) 100% of lines that express 99 CGG repeats are defective for olfactory adaptation. The chemotaxis and adaptation values for seven transgenic lines (lines 1–7) carrying the p AWC ::FMR(CGG) 99 ::GFP construct (labeled (+)) were compared with their siblings without transgenes (labeled (−)). Data are from at least five independent assays and are labeled as in Figure 3 A. P -values indicate results of two-tailed t -tests between the CIs of transgenic- (+) and non-transgenic (−) adapted animals in the same transgenic strain. ‘n.s.’ indicates no significant difference, as P -value is > 0.05. The relative gDNA levels are presented at the bottom line. ( C ) PCR genotyping of transgenic animals carrying 99 CGG repeats. gDNA from individual strains was extracted and genotyped with two primers flanking the CGG-repeat area. The PCR product is 505 bp, indicated by an arrow, and the p AWC ::FMR(CGG) 99 ::GFP plasmid, referred as CGG plasmid, was used as a positive control. Amplification of an endogenous control, act-3 , is shown below. ‘*’ indicates non-specific amplification. The absence of a band for line 8 indicates that this line had lost the FMR1 reporter.

Techniques Used: Expressing, Transgenic Assay, Real-time Polymerase Chain Reaction, Activated Clotting Time Assay, Chemotaxis Assay, Construct, Labeling, Two Tailed Test, Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Amplification

Interactions between the premutation CGG repeats and adaptation-promoting pathways. ( A ) Olfactory adaptation. 99CGG animals were crossed with mutants defining three pathways: ALG-2 is an miRNA-specific Argonaute, FBF-1 up-regulates EGL-4 translation, and MUT-7 is required for siRNA processing. alg-2 knockout decreased the effect of expanded CGG repeats, reducing adaptation defects in the double mutants. Conversely, the adaptation defects of 99CGG animals crossed with fbf-1 and mut-7 mutants were partially additive to defects in 99CGG animals alone. CI experiments were performed in at least triplicate, and error bars represent SEM. ( B ) Genotyping of animals with transgenes. 206- and 505-bp PCR fragments were amplified in animals carrying p AWC ::FMR(CGG) 0 ::GFP and p AWC ::FMR(CGG) 99 ::GFP plasmids. A few non-specific bands are indicated by ‘*’. ( C ) Expanded-repeat mRNA levels had no significant change after crossing with alg-2 , fbf-1 , and mut-7 knockout lines. Bars represent the fold change of FMR(CGG) 99 mRNA levels in p AWC ::FMR(CGG) 99 ::GFP, or in either alg-2 , fbf-1 or mut-7 double mutants, respectively, compared to the mRNA levels of a control p AWC ::FMR(CGG) 0 ::GFP. The data were collected from four independent experiments.
Figure Legend Snippet: Interactions between the premutation CGG repeats and adaptation-promoting pathways. ( A ) Olfactory adaptation. 99CGG animals were crossed with mutants defining three pathways: ALG-2 is an miRNA-specific Argonaute, FBF-1 up-regulates EGL-4 translation, and MUT-7 is required for siRNA processing. alg-2 knockout decreased the effect of expanded CGG repeats, reducing adaptation defects in the double mutants. Conversely, the adaptation defects of 99CGG animals crossed with fbf-1 and mut-7 mutants were partially additive to defects in 99CGG animals alone. CI experiments were performed in at least triplicate, and error bars represent SEM. ( B ) Genotyping of animals with transgenes. 206- and 505-bp PCR fragments were amplified in animals carrying p AWC ::FMR(CGG) 0 ::GFP and p AWC ::FMR(CGG) 99 ::GFP plasmids. A few non-specific bands are indicated by ‘*’. ( C ) Expanded-repeat mRNA levels had no significant change after crossing with alg-2 , fbf-1 , and mut-7 knockout lines. Bars represent the fold change of FMR(CGG) 99 mRNA levels in p AWC ::FMR(CGG) 99 ::GFP, or in either alg-2 , fbf-1 or mut-7 double mutants, respectively, compared to the mRNA levels of a control p AWC ::FMR(CGG) 0 ::GFP. The data were collected from four independent experiments.

Techniques Used: Knock-Out, Polymerase Chain Reaction, Amplification

27) Product Images from "An integrated genomic approach identifies that the PI3K/AKT/FOXO pathway is involved in breast cancer tumor initiation"

Article Title: An integrated genomic approach identifies that the PI3K/AKT/FOXO pathway is involved in breast cancer tumor initiation

Journal: Oncotarget

doi: 10.18632/oncotarget.6354

Positive selection shRNA screen mammosphere formation A. Schematic illustration of pooled RNAi screen. Cells were transduced with the retroviral NKI library of 24000 shRNAs and part of the cells were used as P1. Cells were cultured for 4 days (M1), 7 days (M2) and 7 days (M3) in mammosphere culture conditions and mammospheres were harvested (M1,M2 and M3). Using PCR amplification, labeling with Cy3 or Cy5 and hybridization to an array containing probes for the 24000 shRNAs present within the MCF7 cells the abundance of each shRNA expression construct in the pool of cells (P1,M1-M3) was determined. NOTCH signaling increases mammosphere formation and blocks differentiation. B. Activation of the NOTCH signaling pathway by transduction of IC-NOTCH-GFP in MCF7 cells and the effect on mammosphere formation. C. Representative data from one of several experiments showing the increased proportion of GFP-positive cells in mammospheres compared to attached cultures of IC-NOTCH-GFP and control-GFP transduced MCF7 cells. D. The effect of expression of IC-NOTCH-GFP or control-GFP on prolactin-induced HC11 cell differentiation shown by a block in proliferation and β-casein promoter activity. A representative β-casein promoter-luciferase reporter expression experiment is shown. E. Comparison of the mammosphere shRNA screen, genes downregulated in the 2nd round of mammospheres and genes downregulated in MCF7 cells activated by NOTCH signaling resulted in one gene; FOXO3A.
Figure Legend Snippet: Positive selection shRNA screen mammosphere formation A. Schematic illustration of pooled RNAi screen. Cells were transduced with the retroviral NKI library of 24000 shRNAs and part of the cells were used as P1. Cells were cultured for 4 days (M1), 7 days (M2) and 7 days (M3) in mammosphere culture conditions and mammospheres were harvested (M1,M2 and M3). Using PCR amplification, labeling with Cy3 or Cy5 and hybridization to an array containing probes for the 24000 shRNAs present within the MCF7 cells the abundance of each shRNA expression construct in the pool of cells (P1,M1-M3) was determined. NOTCH signaling increases mammosphere formation and blocks differentiation. B. Activation of the NOTCH signaling pathway by transduction of IC-NOTCH-GFP in MCF7 cells and the effect on mammosphere formation. C. Representative data from one of several experiments showing the increased proportion of GFP-positive cells in mammospheres compared to attached cultures of IC-NOTCH-GFP and control-GFP transduced MCF7 cells. D. The effect of expression of IC-NOTCH-GFP or control-GFP on prolactin-induced HC11 cell differentiation shown by a block in proliferation and β-casein promoter activity. A representative β-casein promoter-luciferase reporter expression experiment is shown. E. Comparison of the mammosphere shRNA screen, genes downregulated in the 2nd round of mammospheres and genes downregulated in MCF7 cells activated by NOTCH signaling resulted in one gene; FOXO3A.

Techniques Used: Selection, shRNA, Transduction, Cell Culture, Polymerase Chain Reaction, Amplification, Labeling, Hybridization, Expressing, Construct, Activation Assay, Cell Differentiation, Blocking Assay, Activity Assay, Luciferase

28) Product Images from "Haploinsufficiency of Activation-Induced Deaminase for Antibody Diversification and Chromosome Translocations both In Vitro and In Vivo"

Article Title: Haploinsufficiency of Activation-Induced Deaminase for Antibody Diversification and Chromosome Translocations both In Vitro and In Vivo

Journal: PLoS ONE

doi: 10.1371/journal.pone.0003927

c-myc/IgH translocation frequency is reduced in IL6tgAID +/− mice. (A) Schematic representation of the IgH and c-myc genes (upper) and the derivative chromosomes (c-myc/IgHμ and c-myc/IgHα, lower) arising from proximal and distal translocations, respectively. Variable (V H ) and constant (Cμ and Cα) genes are represented as grey and black boxes, respectively. Sμ and Sα switch regions and Eμ enhancer are shown as striped and black ellipses, respectively. C-myc exons are drawn as white boxes. Arrows show the position of primers used for PCR amplification. (B) Proximal (left) and distal (right) c-myc/IgH translocations detected in IL6tgAID +/+ (upper gels) and IL6tgAID +/− (lower gels) mice. DNA from IL6tgAID +/+ and IL6tgAID +/− hyperplastic lymph node B cells was amplified as described in materials and methods using the primers depicted in (A). Representative amplification products analysed in ethidium bromide stained gels are shown. Mouse identifications are shown above the lanes. (C) Frequency of c-myc/IgH translocations in IL6tgAID +/+ and IL6tgAID +/− mice. Translocation frequency was determined by serial dilution of DNA samples, followed by PCR amplification, cloning and sequencing. Graphs show the overall translocation frequency (left), frequency of proximal c-myc/IgHμ translocations (middle) and frequency of distal c-myc/IgHα translocations (right). (D) Representation of translocation breakpoints at the c-myc and IgHμ genes found in IL6tgAID +/+ and IL6tgAID +/− B cells. Amplification products of proximal c-myc/IgH translocations were cloned and sequenced. Translocation breakpoints at the c-myc (upper diagram) and IgH (lower diagram) genes are shown as closed (IL6tgAID +/+ ) and open (IL6tgAID +/− ) circles. C-myc exon 1 and IgH Eμ enhancer are represented as grey boxes and distance to these elements is shown underneath (bps). Arrows on the right indicate the position of the PCR oligonucleotides used for amplification.
Figure Legend Snippet: c-myc/IgH translocation frequency is reduced in IL6tgAID +/− mice. (A) Schematic representation of the IgH and c-myc genes (upper) and the derivative chromosomes (c-myc/IgHμ and c-myc/IgHα, lower) arising from proximal and distal translocations, respectively. Variable (V H ) and constant (Cμ and Cα) genes are represented as grey and black boxes, respectively. Sμ and Sα switch regions and Eμ enhancer are shown as striped and black ellipses, respectively. C-myc exons are drawn as white boxes. Arrows show the position of primers used for PCR amplification. (B) Proximal (left) and distal (right) c-myc/IgH translocations detected in IL6tgAID +/+ (upper gels) and IL6tgAID +/− (lower gels) mice. DNA from IL6tgAID +/+ and IL6tgAID +/− hyperplastic lymph node B cells was amplified as described in materials and methods using the primers depicted in (A). Representative amplification products analysed in ethidium bromide stained gels are shown. Mouse identifications are shown above the lanes. (C) Frequency of c-myc/IgH translocations in IL6tgAID +/+ and IL6tgAID +/− mice. Translocation frequency was determined by serial dilution of DNA samples, followed by PCR amplification, cloning and sequencing. Graphs show the overall translocation frequency (left), frequency of proximal c-myc/IgHμ translocations (middle) and frequency of distal c-myc/IgHα translocations (right). (D) Representation of translocation breakpoints at the c-myc and IgHμ genes found in IL6tgAID +/+ and IL6tgAID +/− B cells. Amplification products of proximal c-myc/IgH translocations were cloned and sequenced. Translocation breakpoints at the c-myc (upper diagram) and IgH (lower diagram) genes are shown as closed (IL6tgAID +/+ ) and open (IL6tgAID +/− ) circles. C-myc exon 1 and IgH Eμ enhancer are represented as grey boxes and distance to these elements is shown underneath (bps). Arrows on the right indicate the position of the PCR oligonucleotides used for amplification.

Techniques Used: Translocation Assay, Mouse Assay, Polymerase Chain Reaction, Amplification, Staining, Serial Dilution, Clone Assay, Sequencing

29) Product Images from "Interplay between Exonic Splicing Enhancers, mRNA Processing, and mRNA Surveillance in the Dystrophic Mdx Mouse"

Article Title: Interplay between Exonic Splicing Enhancers, mRNA Processing, and mRNA Surveillance in the Dystrophic Mdx Mouse

Journal: PLoS ONE

doi: 10.1371/journal.pone.0000427

SR proteins mediate associations of exons 22, 23 and 24. Biotinylated and non-biotinylated dystrophin exons labeled with 32 P-ATP (sense exons) or 32 P-UTP (antisense exons), were mixed with purified SR proteins. Following incubation, biotinylated RNAs were purified with streptavidin magnetic beads and the formation of RNA complexes was analyzed on 10% denaturing polyacrylamide gel. Asterisks and A indicate biotinylated and antisense exons respectively. Lanes 1 and 2, showing the relative migration of exons 22, 23 and 24, contain one-fourth of the RNA inputs assayed in lanes 8–11 and 13–14 respectively. Lane 15 and 16 contain one-fourth of the supernatants collected from reactions loaded in lanes 13–14. Background levels, probably generated by non-specific trapping of RNA or RNA/protein complexes into the magnetic beads, are shown in lanes 3, 4, and 12 and 17 respectively. Comparable results were obtained in three independent experiments.
Figure Legend Snippet: SR proteins mediate associations of exons 22, 23 and 24. Biotinylated and non-biotinylated dystrophin exons labeled with 32 P-ATP (sense exons) or 32 P-UTP (antisense exons), were mixed with purified SR proteins. Following incubation, biotinylated RNAs were purified with streptavidin magnetic beads and the formation of RNA complexes was analyzed on 10% denaturing polyacrylamide gel. Asterisks and A indicate biotinylated and antisense exons respectively. Lanes 1 and 2, showing the relative migration of exons 22, 23 and 24, contain one-fourth of the RNA inputs assayed in lanes 8–11 and 13–14 respectively. Lane 15 and 16 contain one-fourth of the supernatants collected from reactions loaded in lanes 13–14. Background levels, probably generated by non-specific trapping of RNA or RNA/protein complexes into the magnetic beads, are shown in lanes 3, 4, and 12 and 17 respectively. Comparable results were obtained in three independent experiments.

Techniques Used: Labeling, Purification, Incubation, Magnetic Beads, Migration, Generated

SR proteins interact with dystrophin exon 22 and 24. A) Different SR proteins associate with exons 22 and 24. 32 P labeled exon 22 and 24 RNAs, incubated with SR proteins were subjected to UV-crosslinking as described in Figure 3 . Molecular weight markers are shown at the left; exon 22A and 24A correspond to the antisense RNAs used as controls. B) Exon 24, but not exon 22 activates splicing of the enhancer-dependent Dpy2 RNA. Different regions of dystrohin exon 22 (145 nt) and 24 (113 nt) were cloned in the second exon of the enhancer-dependent Dpy2 substrate. The structure of the chimeric constructs subjected to in vitro splicing reactions is shown on the right of the panel, with black boxes indicating exon 22 and 24 and dashed boxes the portion of the corresponding exon not included in the pre-mRNA. A indicates the anti-sense orientation of each region, while numbers after the slash indicate their nucleotide length. Dpy2 and Dpy2E are defined as in Figure 1 . The structures and the mobility of the products and intermediates of splicing are shown on both sides of the panel. Asterisks indicate the position of the spliced RNAs. The molecular weigh of the band detected below the D24/60 RNA precursor does not correspond to the expected splicing product. In vitro splicing reactions were carried out as in Figure 1 . Comparable results were obtained in two independent experiments. C) Schematic representation of SR binding sites within dystrophin exon 22 and 24 computed by ESEfinder [61] , [62] .
Figure Legend Snippet: SR proteins interact with dystrophin exon 22 and 24. A) Different SR proteins associate with exons 22 and 24. 32 P labeled exon 22 and 24 RNAs, incubated with SR proteins were subjected to UV-crosslinking as described in Figure 3 . Molecular weight markers are shown at the left; exon 22A and 24A correspond to the antisense RNAs used as controls. B) Exon 24, but not exon 22 activates splicing of the enhancer-dependent Dpy2 RNA. Different regions of dystrohin exon 22 (145 nt) and 24 (113 nt) were cloned in the second exon of the enhancer-dependent Dpy2 substrate. The structure of the chimeric constructs subjected to in vitro splicing reactions is shown on the right of the panel, with black boxes indicating exon 22 and 24 and dashed boxes the portion of the corresponding exon not included in the pre-mRNA. A indicates the anti-sense orientation of each region, while numbers after the slash indicate their nucleotide length. Dpy2 and Dpy2E are defined as in Figure 1 . The structures and the mobility of the products and intermediates of splicing are shown on both sides of the panel. Asterisks indicate the position of the spliced RNAs. The molecular weigh of the band detected below the D24/60 RNA precursor does not correspond to the expected splicing product. In vitro splicing reactions were carried out as in Figure 1 . Comparable results were obtained in two independent experiments. C) Schematic representation of SR binding sites within dystrophin exon 22 and 24 computed by ESEfinder [61] , [62] .

Techniques Used: Labeling, Incubation, Molecular Weight, Clone Assay, Construct, In Vitro, Binding Assay

Splicing of dystrophin mini-genes in vivo. Cos 7 cells were transfected with plasmids expressing different portions of the genomic region of the dystrophin gene spanning from exon 22 to exon 23/24. Northern blot analysis was carried out on total RNA prepared 24 hr after transfection, as described in Materials and Methods . Band intensities, quantified by phosphorimager analysis, were normalized for transfection efficiency and RNA recovery to the level of the co-expressed neomycin mRNA (neo). Normalized values were expressed as a percentage of wt mRNAs that were defined as 100. The schematic structure of the substrates is shown on the right part of both panels A and B. Dystrophin exons are identified as in Figure 1 . β-globin exons are shown as gray boxes while the 5′ and 3′ UTRs as white thinner boxes. (A) Two exon mini-genes carrying dystrophin exons 22 and 23. (B) Three exon mini-genes carrying dystrophin exon 22 and 23 and 24, chimeric constructs, and the β-globin system (β−globin wt and β−globin 39 carrying a nonsense mutation at codon 39) used as a reference [81] . Comparable results were obtained in three independent experiments. (C) Left panel: autoradiogram of a representative quantitative RT-PCR performed as described in Materials and Methods . The upper bands correspond to RT-PCR products from dystrophin mRNA obtained with primers located in exons 22 and 24; the lower bands correspond to the neomycin gene used as an internal control. −and+lanes correspond to reactions carried out in absence or presence of reverse transcriptase. Right panel: non-quantitative RT-PCR performed as described in Materials and Methods . Mobility of the predicted splicing products is shown on the right. The PCR product deriving from skipping of exon 23 was not detected.
Figure Legend Snippet: Splicing of dystrophin mini-genes in vivo. Cos 7 cells were transfected with plasmids expressing different portions of the genomic region of the dystrophin gene spanning from exon 22 to exon 23/24. Northern blot analysis was carried out on total RNA prepared 24 hr after transfection, as described in Materials and Methods . Band intensities, quantified by phosphorimager analysis, were normalized for transfection efficiency and RNA recovery to the level of the co-expressed neomycin mRNA (neo). Normalized values were expressed as a percentage of wt mRNAs that were defined as 100. The schematic structure of the substrates is shown on the right part of both panels A and B. Dystrophin exons are identified as in Figure 1 . β-globin exons are shown as gray boxes while the 5′ and 3′ UTRs as white thinner boxes. (A) Two exon mini-genes carrying dystrophin exons 22 and 23. (B) Three exon mini-genes carrying dystrophin exon 22 and 23 and 24, chimeric constructs, and the β-globin system (β−globin wt and β−globin 39 carrying a nonsense mutation at codon 39) used as a reference [81] . Comparable results were obtained in three independent experiments. (C) Left panel: autoradiogram of a representative quantitative RT-PCR performed as described in Materials and Methods . The upper bands correspond to RT-PCR products from dystrophin mRNA obtained with primers located in exons 22 and 24; the lower bands correspond to the neomycin gene used as an internal control. −and+lanes correspond to reactions carried out in absence or presence of reverse transcriptase. Right panel: non-quantitative RT-PCR performed as described in Materials and Methods . Mobility of the predicted splicing products is shown on the right. The PCR product deriving from skipping of exon 23 was not detected.

Techniques Used: In Vivo, Transfection, Expressing, Northern Blot, Construct, Mutagenesis, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

30) Product Images from "ATM-independent, high-fidelity nonhomologous end joining predominates in human embryonic stem cells"

Article Title: ATM-independent, high-fidelity nonhomologous end joining predominates in human embryonic stem cells

Journal: Aging (Albany NY)

doi:

DNA-PKcs knockdown partially reduces NHEJ in hESCs. ( A ) Western blot showing DNA-PKcs expression 48 and 72 h after transfection of BG01V cells with GFP control siRNAs or siRNAs targeting DNA-PKcs or ATR [ 5 ]. The fold change in DNA-PKcs was calculated after normalization to ATR which served as a loading control together with a non-specific (N.S.) band. ( B ) Western blot showing HA-SceI levels in BG01V cells 48 h after infection which occurred 48 h after knockdown. ( C ) BG01V/NHEJ-red cells were infected with Ad-I-SceI at 30 MOI, 48 h after knockdown. DsRed events were determined by FACS 48 h after infection. (Columns) % DsRed+ cells with 10,000 events collected; (Error bars) SEM for data sets n = 3. ( D ) BG01V/NHEJ-red cells were infected with Ad-I-SceI at an MOI of 30 48 h after knockdown. Cells were collected at 24 h post-infection. (Columns) Relative NHEJ levels were determined by genomic DNA qPCR and normalized to β-actin levels; (Error bars) SEM for three samples. Fold (x) and statistical significance indicates changes in the relative repair levels compared to the siGFP sample.
Figure Legend Snippet: DNA-PKcs knockdown partially reduces NHEJ in hESCs. ( A ) Western blot showing DNA-PKcs expression 48 and 72 h after transfection of BG01V cells with GFP control siRNAs or siRNAs targeting DNA-PKcs or ATR [ 5 ]. The fold change in DNA-PKcs was calculated after normalization to ATR which served as a loading control together with a non-specific (N.S.) band. ( B ) Western blot showing HA-SceI levels in BG01V cells 48 h after infection which occurred 48 h after knockdown. ( C ) BG01V/NHEJ-red cells were infected with Ad-I-SceI at 30 MOI, 48 h after knockdown. DsRed events were determined by FACS 48 h after infection. (Columns) % DsRed+ cells with 10,000 events collected; (Error bars) SEM for data sets n = 3. ( D ) BG01V/NHEJ-red cells were infected with Ad-I-SceI at an MOI of 30 48 h after knockdown. Cells were collected at 24 h post-infection. (Columns) Relative NHEJ levels were determined by genomic DNA qPCR and normalized to β-actin levels; (Error bars) SEM for three samples. Fold (x) and statistical significance indicates changes in the relative repair levels compared to the siGFP sample.

Techniques Used: Non-Homologous End Joining, Western Blot, Expressing, Transfection, Infection, FACS, Real-time Polymerase Chain Reaction

NHEJ occurs with faster kinetics after terminal differentiation. ( A ) hESCs, NPs and astrocytes were seeded and 12 h later infected with Ad-SceI at an MOI of 100. Expression of HA-tagged I-SceI was examined in samples harvested 24 h after infection. ( B ) BG01V/-, NP/-, and astrocyte/NHEJ-red cells were infected with Ad-SceI and collected 24 h later. (Columns) Relative NHEJ levels were determined by genomic DNA qPCR and normalized to β-actin levels; (Error bars) SEM for data sets n = 3. Fold (x) indicates changes in the relative repair levels when compared to the hESC sample. *p
Figure Legend Snippet: NHEJ occurs with faster kinetics after terminal differentiation. ( A ) hESCs, NPs and astrocytes were seeded and 12 h later infected with Ad-SceI at an MOI of 100. Expression of HA-tagged I-SceI was examined in samples harvested 24 h after infection. ( B ) BG01V/-, NP/-, and astrocyte/NHEJ-red cells were infected with Ad-SceI and collected 24 h later. (Columns) Relative NHEJ levels were determined by genomic DNA qPCR and normalized to β-actin levels; (Error bars) SEM for data sets n = 3. Fold (x) indicates changes in the relative repair levels when compared to the hESC sample. *p

Techniques Used: Non-Homologous End Joining, Infection, Expressing, Real-time Polymerase Chain Reaction

Repair by NHEJ monitored by genomic DNA qPCR. ( A ) Time course exhibiting an increase in SYBR green fluorescence after amplification by qPCR in hESCs (left panel). Polyacrylamide gel showing the NHEJ repair product at ~125 base pair fragment at the indicated times (right panel). ( B ) Relative NHEJ levels after infection with Ad-SceI adenovirus with 30 MOI at 24 h. Fold (x) and statistical significance indicates changes in the relative repair levels when compared to the Ad-SceI infected sample. The difference in increases in the relative quantity of NHEJ at 27 h in ( A ) compared to 24 h in ( B ) is mostly due to a difference in the values obtained from the samples without I-SceI between the two data sets.
Figure Legend Snippet: Repair by NHEJ monitored by genomic DNA qPCR. ( A ) Time course exhibiting an increase in SYBR green fluorescence after amplification by qPCR in hESCs (left panel). Polyacrylamide gel showing the NHEJ repair product at ~125 base pair fragment at the indicated times (right panel). ( B ) Relative NHEJ levels after infection with Ad-SceI adenovirus with 30 MOI at 24 h. Fold (x) and statistical significance indicates changes in the relative repair levels when compared to the Ad-SceI infected sample. The difference in increases in the relative quantity of NHEJ at 27 h in ( A ) compared to 24 h in ( B ) is mostly due to a difference in the values obtained from the samples without I-SceI between the two data sets.

Techniques Used: Non-Homologous End Joining, Real-time Polymerase Chain Reaction, SYBR Green Assay, Fluorescence, Amplification, Infection

XRCC4 knockdown and expression of a XRRC4 decoy partially reduces NHEJ in hESCs ( A ) XRCC4 knockdown and NHEJ in hESCs. Western blot analysis of extracts with XRCC4 antibody was carried out 48 and 72 h after transfection of BG01V/NHEJ-red cells with non-targeted control siRNAs or siRNAs targeting XRCC4. The fold change in XRCC4 levels was calculated after normalization to GAPDH which served as a loading control. ( B ) BG01V/NHEJ-red cells were infected with Ad-I-SceI at 30 MOI, 48 h after knockdown. Cells were collected at 24 h post-infection for genomic DNA qPCR to determine repair. ( C ) XRCC4 decoy reduces NHEJ in hESCs. Immunocytochemistry ( top panel ) and western blot ( bottom panel ) of BG01V/NHEJ-red cells 48 h after infection with the Ad-Flag-XRCC4 115-293 virus described previously [ 31 ], or an EGFP expressing adenovirus. ( D ) BG01V/NHEJ-red cells were infected with either adenovirus for 48 h and then infected with Ad-SceI and harvested 24 h later. (Columns) Relative NHEJ levels were determined by qPCR and normalized to β-actin levels (Error bars) SEM of three samples. Fold (x) and statistical significance indicate changes in the relative repair levels as compared to those in the I-SceI-expressing cells treated with non-targeting control siRNA.
Figure Legend Snippet: XRCC4 knockdown and expression of a XRRC4 decoy partially reduces NHEJ in hESCs ( A ) XRCC4 knockdown and NHEJ in hESCs. Western blot analysis of extracts with XRCC4 antibody was carried out 48 and 72 h after transfection of BG01V/NHEJ-red cells with non-targeted control siRNAs or siRNAs targeting XRCC4. The fold change in XRCC4 levels was calculated after normalization to GAPDH which served as a loading control. ( B ) BG01V/NHEJ-red cells were infected with Ad-I-SceI at 30 MOI, 48 h after knockdown. Cells were collected at 24 h post-infection for genomic DNA qPCR to determine repair. ( C ) XRCC4 decoy reduces NHEJ in hESCs. Immunocytochemistry ( top panel ) and western blot ( bottom panel ) of BG01V/NHEJ-red cells 48 h after infection with the Ad-Flag-XRCC4 115-293 virus described previously [ 31 ], or an EGFP expressing adenovirus. ( D ) BG01V/NHEJ-red cells were infected with either adenovirus for 48 h and then infected with Ad-SceI and harvested 24 h later. (Columns) Relative NHEJ levels were determined by qPCR and normalized to β-actin levels (Error bars) SEM of three samples. Fold (x) and statistical significance indicate changes in the relative repair levels as compared to those in the I-SceI-expressing cells treated with non-targeting control siRNA.

Techniques Used: Expressing, Non-Homologous End Joining, Western Blot, Transfection, Infection, Real-time Polymerase Chain Reaction, Immunocytochemistry

31) Product Images from "Chemoresistance to Valproate Treatment of Bovine Leukemia Virus-Infected Sheep; Identification of Improved HDAC Inhibitors"

Article Title: Chemoresistance to Valproate Treatment of Bovine Leukemia Virus-Infected Sheep; Identification of Improved HDAC Inhibitors

Journal: Pathogens

doi: 10.3390/pathogens1020065

BLV proviral integrity and integration sites during VPA treatment and relapse: A. DNA was extracted from BLV-infected sheep PBMCs (2213, 3002, 3003, 4213, 4535) isolated just before VPA treatment at day 0 (B) and at the end of the relapse period (R). The full length proviral sequence was amplified by PCR using primers located in the 5' and 3' LTRs. PCR amplification products were migrated onto an agarose gel. The molecular weight of the amplicon is indicated in kilobases (8 Kb). B. Southern blot hybridization using a BLV probe of genomic DNA digested with EcoRI. The molecular weight markers (in Kb) are indicated on the left. Lanes correspond to those of panel A.
Figure Legend Snippet: BLV proviral integrity and integration sites during VPA treatment and relapse: A. DNA was extracted from BLV-infected sheep PBMCs (2213, 3002, 3003, 4213, 4535) isolated just before VPA treatment at day 0 (B) and at the end of the relapse period (R). The full length proviral sequence was amplified by PCR using primers located in the 5' and 3' LTRs. PCR amplification products were migrated onto an agarose gel. The molecular weight of the amplicon is indicated in kilobases (8 Kb). B. Southern blot hybridization using a BLV probe of genomic DNA digested with EcoRI. The molecular weight markers (in Kb) are indicated on the left. Lanes correspond to those of panel A.

Techniques Used: Infection, Isolation, Sequencing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight, Southern Blot, Hybridization

BLV proviral loads during VPA treatment and relapse: The proviral loads (empty squares), represented as numbers of viral copies per 10 3 B-lymphocytes, were measured by real time PCR using genomic DNA isolated from sheep peripheral blood mononuclear cells (PBMCs). Data result from triplicate measurements (error bars represent means ± standard deviations). Absolute leukocyte numbers are indicated as reference (dotted line).
Figure Legend Snippet: BLV proviral loads during VPA treatment and relapse: The proviral loads (empty squares), represented as numbers of viral copies per 10 3 B-lymphocytes, were measured by real time PCR using genomic DNA isolated from sheep peripheral blood mononuclear cells (PBMCs). Data result from triplicate measurements (error bars represent means ± standard deviations). Absolute leukocyte numbers are indicated as reference (dotted line).

Techniques Used: Real-time Polymerase Chain Reaction, Isolation

32) Product Images from "An RNA-targeted therapy for dystrophic epidermolysis bullosa"

Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx669

Analysis of the trans -spliced COL7A1 mRNA in the LV-RTM-S6m corrected RDEB single cell clone C47. ( A ) Via sqRT-PCR using primers specifically hybridizing to endogenous COL7A1 exon 62/63 and the introduced silent mutation in exon 65 on the RTM, we detected a product of 216 bp, corresponding to the trans -spliced COL7A1 mRNA in LV-RTM-S6m transduced RDEB cell pool and single cell clone C47. LV-RTM-woBD transduced cells served as negative control. ( B ) Sequence analysis of trans-spliced COL7A1 mRNA shows the correct exon 64/65 junction as well as the amplified silent mutations. ( C ) SqRT-PCR analysis showed that 2.113% of COL7A1 mRNA in C47 was correctly trans -spliced. Mean of four individual experiments and error bars (SEM). ***P-value
Figure Legend Snippet: Analysis of the trans -spliced COL7A1 mRNA in the LV-RTM-S6m corrected RDEB single cell clone C47. ( A ) Via sqRT-PCR using primers specifically hybridizing to endogenous COL7A1 exon 62/63 and the introduced silent mutation in exon 65 on the RTM, we detected a product of 216 bp, corresponding to the trans -spliced COL7A1 mRNA in LV-RTM-S6m transduced RDEB cell pool and single cell clone C47. LV-RTM-woBD transduced cells served as negative control. ( B ) Sequence analysis of trans-spliced COL7A1 mRNA shows the correct exon 64/65 junction as well as the amplified silent mutations. ( C ) SqRT-PCR analysis showed that 2.113% of COL7A1 mRNA in C47 was correctly trans -spliced. Mean of four individual experiments and error bars (SEM). ***P-value

Techniques Used: Polymerase Chain Reaction, Mutagenesis, Negative Control, Sequencing, Amplification

33) Product Images from "Evidence Consistent with Human L1 Retrotransposition in Maternal Meiosis I"

Article Title: Evidence Consistent with Human L1 Retrotransposition in Maternal Meiosis I

Journal: American Journal of Human Genetics

doi:

Insertion analyses.  A, CYBB- specific Southern blot with  Eco RI-digested DNA—from an unrelated control individual, the patient's mother, and the patient—demonstrating the shift, in the patient's sample, of the exon 4–containing fragment. The sizes of the wild-type bands are given; the arrow (←) indicates the aberrant band. The probe was constructed with coding cDNA of  CYBB  as template.  B,  Expand Long Template PCR of exon 4, in the patient, the patient’s mother, and an unrelated control. The arrows (→) indicate markers in the ladder.
Figure Legend Snippet: Insertion analyses. A, CYBB- specific Southern blot with Eco RI-digested DNA—from an unrelated control individual, the patient's mother, and the patient—demonstrating the shift, in the patient's sample, of the exon 4–containing fragment. The sizes of the wild-type bands are given; the arrow (←) indicates the aberrant band. The probe was constructed with coding cDNA of CYBB as template. B, Expand Long Template PCR of exon 4, in the patient, the patient’s mother, and an unrelated control. The arrows (→) indicate markers in the ladder.

Techniques Used: Southern Blot, Construct, Polymerase Chain Reaction

Insertion sequence analyses. A, Schematic representation of the CYBB insertion. PT = important sequence of a PCR product from the patient’s exon 4. B, CYBB- sequence at the point of insertion, into exon 4, of CYBB; PT = sequence of a PCR product from the patient’s CYBB exon 4 (which includes the disease-causing insertion); LRE3 = sequence of a PCR product from the patient’s chromosome 2q24.1; L1 RP sequence of the most active element known (the nucleotide number of the adjacent base is given in parentheses). A possible 2-bp TSD in the disease-causing insertion is underlined; differences between sequences are shaded; leader dots indicate sequence that is consistent with the L1 RP sequence.
Figure Legend Snippet: Insertion sequence analyses. A, Schematic representation of the CYBB insertion. PT = important sequence of a PCR product from the patient’s exon 4. B, CYBB- sequence at the point of insertion, into exon 4, of CYBB; PT = sequence of a PCR product from the patient’s CYBB exon 4 (which includes the disease-causing insertion); LRE3 = sequence of a PCR product from the patient’s chromosome 2q24.1; L1 RP sequence of the most active element known (the nucleotide number of the adjacent base is given in parentheses). A possible 2-bp TSD in the disease-causing insertion is underlined; differences between sequences are shaded; leader dots indicate sequence that is consistent with the L1 RP sequence.

Techniques Used: Sequencing, Polymerase Chain Reaction

34) Product Images from "Mice deleted for heart-type cytochrome c oxidase subunit 7a1 develop dilated cardiomyopathy"

Article Title: Mice deleted for heart-type cytochrome c oxidase subunit 7a1 develop dilated cardiomyopathy

Journal: Mitochondrion

doi: 10.1016/j.mito.2011.11.002

Cox7a1 knockout mouse
Figure Legend Snippet: Cox7a1 knockout mouse

Techniques Used: Knock-Out

Lack of Cox7a1 (Cox7aH) in the Cox7a1 knockouts is complemented by increased Cox7a2 (Cox7aL) isoform incorporation into the Cox holoenzyme
Figure Legend Snippet: Lack of Cox7a1 (Cox7aH) in the Cox7a1 knockouts is complemented by increased Cox7a2 (Cox7aL) isoform incorporation into the Cox holoenzyme

Techniques Used:

Cox activity and ATP levels in Cox7a1 heterozygous and knockout mice
Figure Legend Snippet: Cox activity and ATP levels in Cox7a1 heterozygous and knockout mice

Techniques Used: Activity Assay, Knock-Out, Mouse Assay

35) Product Images from "Long Non-coding RNAs (LncRNA) Regulated by Transforming Growth Factor (TGF) β"

Article Title: Long Non-coding RNAs (LncRNA) Regulated by Transforming Growth Factor (TGF) β

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M114.610915

Elevated levels of lncRNA-HIT are associated with invasive breast cancer in human. A, lncRNA-HIT is conserved between mouse and human. B, locked nucleic acid in situ hybridization. LNA-oligonucleotide of lncRNA-HIT was labeled with digoxigenin-ddUTP using
Figure Legend Snippet: Elevated levels of lncRNA-HIT are associated with invasive breast cancer in human. A, lncRNA-HIT is conserved between mouse and human. B, locked nucleic acid in situ hybridization. LNA-oligonucleotide of lncRNA-HIT was labeled with digoxigenin-ddUTP using

Techniques Used: In Situ Hybridization, Labeling

LncRNA-HIT mediates TGFβ-induced cell migration, invasion, and EMT. A , NMuMG cells were transfected with indicated siRNAs. After treatment with vehicle or TGFβ for 48 h, RNAs were isolated and analyzed for lncRNA-HIT expression using real-time
Figure Legend Snippet: LncRNA-HIT mediates TGFβ-induced cell migration, invasion, and EMT. A , NMuMG cells were transfected with indicated siRNAs. After treatment with vehicle or TGFβ for 48 h, RNAs were isolated and analyzed for lncRNA-HIT expression using real-time

Techniques Used: Migration, Transfection, Isolation, Expressing

LncRNA-HIT is elevated in highly metastatic 4T1 cells and its knockdown results in significant reduction of cell migration and invasion. A, expression of lncRNA-HIT was evaluated in 4 isogenic mouse breast cancer cell lines 67NR, 168FARN, 4T07, and 4T1
Figure Legend Snippet: LncRNA-HIT is elevated in highly metastatic 4T1 cells and its knockdown results in significant reduction of cell migration and invasion. A, expression of lncRNA-HIT was evaluated in 4 isogenic mouse breast cancer cell lines 67NR, 168FARN, 4T07, and 4T1

Techniques Used: Migration, Expressing

E-cadherin is a target of lncRNA-HIT. A , Affymetrix Gene Expression Analysis was performed on NMuMG cells transfected with vector and lncRNA-HIT. B, RT-qPCR was performed to confirm a loss of E-cadherin expression as indicated as down-regulated in the
Figure Legend Snippet: E-cadherin is a target of lncRNA-HIT. A , Affymetrix Gene Expression Analysis was performed on NMuMG cells transfected with vector and lncRNA-HIT. B, RT-qPCR was performed to confirm a loss of E-cadherin expression as indicated as down-regulated in the

Techniques Used: Expressing, Transfection, Plasmid Preparation, Quantitative RT-PCR

Overexpression of lncRNA-HIT promotes migration, invasion and disrupts tight junction. A, lncRNA-HIT was ectopically expressed in NMuMG cells for 48 h. Cells were then seeded in the upper Boyden chamber without ( B ) and with ( C ) Matrigel to determine changes
Figure Legend Snippet: Overexpression of lncRNA-HIT promotes migration, invasion and disrupts tight junction. A, lncRNA-HIT was ectopically expressed in NMuMG cells for 48 h. Cells were then seeded in the upper Boyden chamber without ( B ) and with ( C ) Matrigel to determine changes

Techniques Used: Over Expression, Migration

LncRNA-HIT locates in Hoxa gene cluster and is induced by TGFβ. A, diagram shows lncRNA-HIT location. B , RT-qPCR revealed that lncRNA-HIT is progressively induced in NMuMG cells after tracking expression over a 24-h time course of TGFβ
Figure Legend Snippet: LncRNA-HIT locates in Hoxa gene cluster and is induced by TGFβ. A, diagram shows lncRNA-HIT location. B , RT-qPCR revealed that lncRNA-HIT is progressively induced in NMuMG cells after tracking expression over a 24-h time course of TGFβ

Techniques Used: Quantitative RT-PCR, Expressing

36) Product Images from "Phase-defined complete sequencing of the HLA genes by next-generation sequencing"

Article Title: Phase-defined complete sequencing of the HLA genes by next-generation sequencing

Journal: BMC Genomics

doi: 10.1186/1471-2164-14-355

Size selection of the Nextera DNA libraries by agarose gel size selection. ( A ) Electropherogram of DNA library analyzed by 2100 Bioanalyzer. The library size of the Nextera DNA Sample Prep Kits was 150 bp to more than 10 kb (mean size: 902 bp). ( B ) Bioanalyzer electropherogram of a selected DNA library by cutting from the agarose gel. We selected large fragments with sizes ranging from 500 to 2,000 bp to remove short DNA fragments for effective HLA gene haplotype phasing. The size selection also determines an actual molar concentration for bridge PCR to generate clusters in flowcell, because DNA fragments with over 1.5 kb size are not efficiently amplified. The mean size of the selected fragments was 1,561 bp.
Figure Legend Snippet: Size selection of the Nextera DNA libraries by agarose gel size selection. ( A ) Electropherogram of DNA library analyzed by 2100 Bioanalyzer. The library size of the Nextera DNA Sample Prep Kits was 150 bp to more than 10 kb (mean size: 902 bp). ( B ) Bioanalyzer electropherogram of a selected DNA library by cutting from the agarose gel. We selected large fragments with sizes ranging from 500 to 2,000 bp to remove short DNA fragments for effective HLA gene haplotype phasing. The size selection also determines an actual molar concentration for bridge PCR to generate clusters in flowcell, because DNA fragments with over 1.5 kb size are not efficiently amplified. The mean size of the selected fragments was 1,561 bp.

Techniques Used: Selection, Agarose Gel Electrophoresis, Sample Prep, Concentration Assay, Bridge PCR, Amplification

37) Product Images from "Isolation and Characterization of a Replication-Competent Molecular Clone of an HIV-1 Circulating Recombinant Form (CRF33_01B)"

Article Title: Isolation and Characterization of a Replication-Competent Molecular Clone of an HIV-1 Circulating Recombinant Form (CRF33_01B)

Journal: PLoS ONE

doi: 10.1371/journal.pone.0006666

Outline for constructing a replication-competent DNA clone of HIV-1 CRF33_01B (p05MYKL045.1). Near full-length proviral DNA of CRF33_01B was amplified by long-range PCR using pbsA- Nar I and 9KU5B primers and TA-cloned into a pCR-XL-TOPO vector. DNA clone containing CRF33_01B genome and p93JP-NH1, an infectious clone of CRF01_AE origin [13] , were linearized by Nar I and Eco RI. The Nar I- Eco RI fragment from the respective CRF33_01B proviral DNA was directionally ligated with the pBR-SK2 vector that contains the p93JP-NH1 5′ long terminal repeat (LTR) to reconstitute a chimeric full-length construct. Each clone was purified and transformed into HeLa cells to determine proviral replication. Constructs producing non-replicating viruses were then rescued by reconstituting a 3.7 kb proviral fragment (with Nco I and Eco RI sites) that includes the functional env gene to recover an infectious CRF33_01B clone, designated as p05MYKL045.1. Restriction enzyme sites in the DNA and the p93JP-NH1-derived 5′ LTR region in p05MYKL045.1 (shaded) are indicated. Refer text for complete descriptions.
Figure Legend Snippet: Outline for constructing a replication-competent DNA clone of HIV-1 CRF33_01B (p05MYKL045.1). Near full-length proviral DNA of CRF33_01B was amplified by long-range PCR using pbsA- Nar I and 9KU5B primers and TA-cloned into a pCR-XL-TOPO vector. DNA clone containing CRF33_01B genome and p93JP-NH1, an infectious clone of CRF01_AE origin [13] , were linearized by Nar I and Eco RI. The Nar I- Eco RI fragment from the respective CRF33_01B proviral DNA was directionally ligated with the pBR-SK2 vector that contains the p93JP-NH1 5′ long terminal repeat (LTR) to reconstitute a chimeric full-length construct. Each clone was purified and transformed into HeLa cells to determine proviral replication. Constructs producing non-replicating viruses were then rescued by reconstituting a 3.7 kb proviral fragment (with Nco I and Eco RI sites) that includes the functional env gene to recover an infectious CRF33_01B clone, designated as p05MYKL045.1. Restriction enzyme sites in the DNA and the p93JP-NH1-derived 5′ LTR region in p05MYKL045.1 (shaded) are indicated. Refer text for complete descriptions.

Techniques Used: Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Construct, Purification, Transformation Assay, Functional Assay, Derivative Assay

38) Product Images from "Dual Nature of the Adaptive Immune System in Lampreys"

Article Title: Dual Nature of the Adaptive Immune System in Lampreys

Journal: Nature

doi: 10.1038/nature08068

Monoallelic assembly of VLRA and VLRB genes a,b, Schematic of VLRA ( a ) and VLRB ( b ) genes before (top panel) and after (middle panel) gene assembly. Forward and reverse primer locations and predicted sizes of PCR products are indicated. Lymphocytes from the indicated tissues were stained with anti-VLRA (R110) and anti-VLR-B (4C4) antibodies and lymphocyte-gated cells were FACS sorted into three populations: VLRA − /VLRB − (DN), VLRA + (A + ), and VLRB + (B + ). VLRs were amplified from genomic DNA of the sorted lymphocyte populations (bottom panel). Germ-line (GL) and mature (M) products were verified by sequence analysis of representative DNA clones. c , CDA1 and CDA2 expression in sorted lymphocytes was measured by QPCR. Error bars indicate s.e.m., n = 3.
Figure Legend Snippet: Monoallelic assembly of VLRA and VLRB genes a,b, Schematic of VLRA ( a ) and VLRB ( b ) genes before (top panel) and after (middle panel) gene assembly. Forward and reverse primer locations and predicted sizes of PCR products are indicated. Lymphocytes from the indicated tissues were stained with anti-VLRA (R110) and anti-VLR-B (4C4) antibodies and lymphocyte-gated cells were FACS sorted into three populations: VLRA − /VLRB − (DN), VLRA + (A + ), and VLRB + (B + ). VLRs were amplified from genomic DNA of the sorted lymphocyte populations (bottom panel). Germ-line (GL) and mature (M) products were verified by sequence analysis of representative DNA clones. c , CDA1 and CDA2 expression in sorted lymphocytes was measured by QPCR. Error bars indicate s.e.m., n = 3.

Techniques Used: Polymerase Chain Reaction, Staining, FACS, Amplification, Sequencing, Clone Assay, Expressing, Real-time Polymerase Chain Reaction

39) Product Images from "Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues"

Article Title: Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

Journal: Investigative ophthalmology & visual science

doi: 10.1167/iovs.02-1152

Organization of the srds gene. ( A ) Map shows the introns in the mouse peripherin/ rds cDNA and the positions of the primers used to identify the presence of introns in the skate homologue. ( B ) PCR amplification and analysis of DNA fragments from skate genomic DNA reveals the presence of a 208-bp intervening sequence in fragments amplified by primer pairs 160/189 and 188/189, but not in the fragment amplified by primer pair 188/161. ( C ) Sequence of the intron-exon junctions of the srds gene. Uppercase letters : exon sequences; lowercase letters : intron sequences.
Figure Legend Snippet: Organization of the srds gene. ( A ) Map shows the introns in the mouse peripherin/ rds cDNA and the positions of the primers used to identify the presence of introns in the skate homologue. ( B ) PCR amplification and analysis of DNA fragments from skate genomic DNA reveals the presence of a 208-bp intervening sequence in fragments amplified by primer pairs 160/189 and 188/189, but not in the fragment amplified by primer pair 188/161. ( C ) Sequence of the intron-exon junctions of the srds gene. Uppercase letters : exon sequences; lowercase letters : intron sequences.

Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing

40) Product Images from "Application of long single-stranded DNA donors in genome editing: generation and validation of mouse mutants"

Article Title: Application of long single-stranded DNA donors in genome editing: generation and validation of mouse mutants

Journal: BMC Biology

doi: 10.1186/s12915-018-0530-7

Generation of a Syt7 floxed allele. a Diagrammatic representation of the genomic sequence with the Syt7 critical exon highlighted, the corresponding template for lssDNA synthesis and the position of sgRNAs for in vivo delivery together with the primer locations used for reverse transcription and for genotyping. Note loxP sites in the lssDNA prevent reprocessing of repaired alleles by CRISPR-Cas9 complex. Diagram shows the process for the generation of lssDNA through in vitro transcription and reverse transcription. HA homology arm. b PCR products amplified from genomic DNA extracted from the 17 F 0 born from the microinjection session using Syt7-F1 and Syt7-R1 primers. L1 = 1 kb DNA molecular weight ladder (thick band is 3 kb). L2 = 100 bp DNA molecular weight ladder (thick bands are 1000 and 500 bp). Sequence trace data derived from animals Syt7-4 and Syt7-8 are displayed in Additional file 2 : Figure S1.
Figure Legend Snippet: Generation of a Syt7 floxed allele. a Diagrammatic representation of the genomic sequence with the Syt7 critical exon highlighted, the corresponding template for lssDNA synthesis and the position of sgRNAs for in vivo delivery together with the primer locations used for reverse transcription and for genotyping. Note loxP sites in the lssDNA prevent reprocessing of repaired alleles by CRISPR-Cas9 complex. Diagram shows the process for the generation of lssDNA through in vitro transcription and reverse transcription. HA homology arm. b PCR products amplified from genomic DNA extracted from the 17 F 0 born from the microinjection session using Syt7-F1 and Syt7-R1 primers. L1 = 1 kb DNA molecular weight ladder (thick band is 3 kb). L2 = 100 bp DNA molecular weight ladder (thick bands are 1000 and 500 bp). Sequence trace data derived from animals Syt7-4 and Syt7-8 are displayed in Additional file 2 : Figure S1.

Techniques Used: Sequencing, In Vivo, CRISPR, In Vitro, Polymerase Chain Reaction, Amplification, Molecular Weight, Derivative Assay

Related Articles

Electroporation:

Article Title: Tmem26 Is Dynamically Expressed during Palate and Limb Development but Is Not Required for Embryonic Survival
Article Snippet: .. The 3 Tmem26 genomic regions were PCR amplified, using the Expand Long Template PCR System (Roche), from DNA extracted from liver tissue of a C57BL/6 mouse. pN9KO DNA was prepared from E.coli by CsCl density gradient as described in , and linearised using Cla I prior to electroporation. .. The ES cell line used for pN9KO electroporation (C2) is derived from the C57BL/6 strain and was produced and kindly supplied by Dr Andras Nagy (Samuel Lunenfield Research Institute, Toronto, Canada).

Transfection:

Article Title: Two Chromatin Remodeling Activities Cooperate during Activation of Hormone Responsive Promoters
Article Snippet: .. Right: T47D-MTVL cells were transfected with Control or BAF 180 siRNAs in RPMI medium and cultured for 48 h. After one day in serum-free conditions, cells were incubated with 10 nM R5020 for 2 hs and total RNA was prepared, cDNA was generated and used as template for real time PCR with specific Luciferase and GAPDH primers. .. Each luciferase mRNA value was corrected by the GAPDH mRNA level and is expressed as relative RNA abundance over time zero.

Amplification:

Article Title: Phase-defined complete sequencing of the HLA genes by next-generation sequencing
Article Snippet: .. The six highly polymorphic HLA genes (HLA-A, -C, -B, -DRB1, -DQB1, and -DPB1 ) were amplified by long-range PCR and the PCR amplicons covering full sequences of the genes were subjected to the MiSeq sequencer via the transposase-based library preparation. .. The derived paired-end reads (2 × 250 bp) from the MiSeq sequencer were analyzed by the one step alignments to the UCSC hg19 to obtain phase-defined complete sequences.

Article Title: Tmem26 Is Dynamically Expressed during Palate and Limb Development but Is Not Required for Embryonic Survival
Article Snippet: .. The 3 Tmem26 genomic regions were PCR amplified, using the Expand Long Template PCR System (Roche), from DNA extracted from liver tissue of a C57BL/6 mouse. pN9KO DNA was prepared from E.coli by CsCl density gradient as described in , and linearised using Cla I prior to electroporation. .. The ES cell line used for pN9KO electroporation (C2) is derived from the C57BL/6 strain and was produced and kindly supplied by Dr Andras Nagy (Samuel Lunenfield Research Institute, Toronto, Canada).

Article Title: Targeting of Arenavirus RNA Synthesis by a Carboxamide-Derivatized Aromatic Disulfide with Virucidal Activity
Article Snippet: .. The cDNA was further amplified using GPC-specific primers by real time PCR as above. .. Average viral RNA Ct values were normalized to the average Ct values of actin and ΔΔCt based fold-change calculations for untreated and treated- virus infected cells were set relative to the value of untreated-virus infected cells at 1 h p.i., defined as 1, using Bio-Rad iQ5 2.1 software.

Expressing:

Article Title: Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter
Article Snippet: .. To assure that the differences in expression did not result from disparate efficiencies of the hUAT versus hUAT2 primer pairs, PCR was performed with these primers using genomic DNA as a template with the Expand Long Template PCR kit in buffer number 1 (Roche Molecular Biochemicals). .. Since expression of hUAT was much greater than hUAT2 in the MTC panels, tissue levels of hUAT expression were determined by Northern analysis and dot-blot array.

Gel Permeation Chromatography:

Article Title: Targeting of Arenavirus RNA Synthesis by a Carboxamide-Derivatized Aromatic Disulfide with Virucidal Activity
Article Snippet: .. The cDNA was further amplified using GPC-specific primers by real time PCR as above. .. Average viral RNA Ct values were normalized to the average Ct values of actin and ΔΔCt based fold-change calculations for untreated and treated- virus infected cells were set relative to the value of untreated-virus infected cells at 1 h p.i., defined as 1, using Bio-Rad iQ5 2.1 software.

Incubation:

Article Title: Two Chromatin Remodeling Activities Cooperate during Activation of Hormone Responsive Promoters
Article Snippet: .. Right: T47D-MTVL cells were transfected with Control or BAF 180 siRNAs in RPMI medium and cultured for 48 h. After one day in serum-free conditions, cells were incubated with 10 nM R5020 for 2 hs and total RNA was prepared, cDNA was generated and used as template for real time PCR with specific Luciferase and GAPDH primers. .. Each luciferase mRNA value was corrected by the GAPDH mRNA level and is expressed as relative RNA abundance over time zero.

Cell Culture:

Article Title: Two Chromatin Remodeling Activities Cooperate during Activation of Hormone Responsive Promoters
Article Snippet: .. Right: T47D-MTVL cells were transfected with Control or BAF 180 siRNAs in RPMI medium and cultured for 48 h. After one day in serum-free conditions, cells were incubated with 10 nM R5020 for 2 hs and total RNA was prepared, cDNA was generated and used as template for real time PCR with specific Luciferase and GAPDH primers. .. Each luciferase mRNA value was corrected by the GAPDH mRNA level and is expressed as relative RNA abundance over time zero.

Real-time Polymerase Chain Reaction:

Article Title: Targeting of Arenavirus RNA Synthesis by a Carboxamide-Derivatized Aromatic Disulfide with Virucidal Activity
Article Snippet: .. The cDNA was further amplified using GPC-specific primers by real time PCR as above. .. Average viral RNA Ct values were normalized to the average Ct values of actin and ΔΔCt based fold-change calculations for untreated and treated- virus infected cells were set relative to the value of untreated-virus infected cells at 1 h p.i., defined as 1, using Bio-Rad iQ5 2.1 software.

Article Title: Two Chromatin Remodeling Activities Cooperate during Activation of Hormone Responsive Promoters
Article Snippet: .. Right: T47D-MTVL cells were transfected with Control or BAF 180 siRNAs in RPMI medium and cultured for 48 h. After one day in serum-free conditions, cells were incubated with 10 nM R5020 for 2 hs and total RNA was prepared, cDNA was generated and used as template for real time PCR with specific Luciferase and GAPDH primers. .. Each luciferase mRNA value was corrected by the GAPDH mRNA level and is expressed as relative RNA abundance over time zero.

Article Title: Development and optimization of quantitative PCR for the diagnosis of invasive aspergillosis with bronchoalveolar lavage fluid
Article Snippet: .. This implies that the IAC was monitoring for qPCR inhibition independent of the large quantities of human genomic DNA found in extracted BAL fluid. .. A ROC curve of the Aspergillus qPCR assay depicted diagnostic sensitivity versus 1-specificity as a function of detection threshold of fungal burden (e.g. femtograms of DNA).

Generated:

Article Title: Two Chromatin Remodeling Activities Cooperate during Activation of Hormone Responsive Promoters
Article Snippet: .. Right: T47D-MTVL cells were transfected with Control or BAF 180 siRNAs in RPMI medium and cultured for 48 h. After one day in serum-free conditions, cells were incubated with 10 nM R5020 for 2 hs and total RNA was prepared, cDNA was generated and used as template for real time PCR with specific Luciferase and GAPDH primers. .. Each luciferase mRNA value was corrected by the GAPDH mRNA level and is expressed as relative RNA abundance over time zero.

Luciferase:

Article Title: Two Chromatin Remodeling Activities Cooperate during Activation of Hormone Responsive Promoters
Article Snippet: .. Right: T47D-MTVL cells were transfected with Control or BAF 180 siRNAs in RPMI medium and cultured for 48 h. After one day in serum-free conditions, cells were incubated with 10 nM R5020 for 2 hs and total RNA was prepared, cDNA was generated and used as template for real time PCR with specific Luciferase and GAPDH primers. .. Each luciferase mRNA value was corrected by the GAPDH mRNA level and is expressed as relative RNA abundance over time zero.

BAC Assay:

Article Title: Long Range Regulation of Human FXN Gene Expression
Article Snippet: .. The RP11-265B8 BAC clone was used as a template for PCR-amplification using the Expand Long Template PCR kit (Roche Applied Science, Castle Hill, NSW, Australia). .. PCR products were gel extracted, digested with Hin dIII and Bgl II and cloned into the same sites of the pGL3-Basic vector (Promega, Alexandria, NSW, Australia).

Polymerase Chain Reaction:

Article Title: Phase-defined complete sequencing of the HLA genes by next-generation sequencing
Article Snippet: .. The six highly polymorphic HLA genes (HLA-A, -C, -B, -DRB1, -DQB1, and -DPB1 ) were amplified by long-range PCR and the PCR amplicons covering full sequences of the genes were subjected to the MiSeq sequencer via the transposase-based library preparation. .. The derived paired-end reads (2 × 250 bp) from the MiSeq sequencer were analyzed by the one step alignments to the UCSC hg19 to obtain phase-defined complete sequences.

Article Title: Tmem26 Is Dynamically Expressed during Palate and Limb Development but Is Not Required for Embryonic Survival
Article Snippet: .. The 3 Tmem26 genomic regions were PCR amplified, using the Expand Long Template PCR System (Roche), from DNA extracted from liver tissue of a C57BL/6 mouse. pN9KO DNA was prepared from E.coli by CsCl density gradient as described in , and linearised using Cla I prior to electroporation. .. The ES cell line used for pN9KO electroporation (C2) is derived from the C57BL/6 strain and was produced and kindly supplied by Dr Andras Nagy (Samuel Lunenfield Research Institute, Toronto, Canada).

Article Title: High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic
Article Snippet: .. Confirmation and characterization of the rearrangements Positive results detected by MLPA of two independently drawn samples of genomic DNA were confirmed by long-range PCR (Expand Long Template PCR System, Roche Applied Science), conducted in accordance with the manufacturer's instructions. ..

Article Title: Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter
Article Snippet: .. To assure that the differences in expression did not result from disparate efficiencies of the hUAT versus hUAT2 primer pairs, PCR was performed with these primers using genomic DNA as a template with the Expand Long Template PCR kit in buffer number 1 (Roche Molecular Biochemicals). .. Since expression of hUAT was much greater than hUAT2 in the MTC panels, tissue levels of hUAT expression were determined by Northern analysis and dot-blot array.

Article Title: Long Range Regulation of Human FXN Gene Expression
Article Snippet: .. The RP11-265B8 BAC clone was used as a template for PCR-amplification using the Expand Long Template PCR kit (Roche Applied Science, Castle Hill, NSW, Australia). .. PCR products were gel extracted, digested with Hin dIII and Bgl II and cloned into the same sites of the pGL3-Basic vector (Promega, Alexandria, NSW, Australia).

Multiplex Ligation-dependent Probe Amplification:

Article Title: High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic
Article Snippet: .. Confirmation and characterization of the rearrangements Positive results detected by MLPA of two independently drawn samples of genomic DNA were confirmed by long-range PCR (Expand Long Template PCR System, Roche Applied Science), conducted in accordance with the manufacturer's instructions. ..

Inhibition:

Article Title: Development and optimization of quantitative PCR for the diagnosis of invasive aspergillosis with bronchoalveolar lavage fluid
Article Snippet: .. This implies that the IAC was monitoring for qPCR inhibition independent of the large quantities of human genomic DNA found in extracted BAL fluid. .. A ROC curve of the Aspergillus qPCR assay depicted diagnostic sensitivity versus 1-specificity as a function of detection threshold of fungal burden (e.g. femtograms of DNA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Roche genomic pcr amplification genomic long pcr
    Generation of Xb130 −/− mice. A. Schematic strategy of xb130 gene targeting. Structure of Xb130 gene (5′ part), targeting construct, targeted allele and final knockout allele are shown (Empty Boxes: exons; S: SacI; B: BamHI, Filled boxes: Sites for Southern blot probes). Homologous recombination of ES cell genomic DNA with targeting construct inserts Loxp and Frt sites flanking an 879 bp region including Exon 7 and a floxed neomycin cassette. The deletion of Exon 7 causes a frame shift mutation and translation termination in Exon 8. B. Southern blotting with 3′ probe. Mice were derived from Xb130 +/− progeny. C. Western blotting. Protein lysates were extracted from spleen and lung tissues of Xb130 +/+ , Xb130 +/− and Xb130 −/− mice that were genotyped by Southern blotting. D. <t>PCR</t> based genotyping . Arrows indicate the location of primers used for PCR amplification. PCR product amplified from <t>F1</t> and R1 in WT allele was undetectable due to competition from short product F2/R1. E. RT-PCR. The exons of RT-PCR products from WT (a) and knockout (b and c) mice are indicated based on sequencing data. Red stars indicate induced in-frame stop codons. F. Predicted Xb130 knockout allele based on RT-PCR and genomic PCR data. The primers used for long PCR and the amplicon are indicated as arrows and green line respectively.
    Genomic Pcr Amplification Genomic Long Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr amplification genomic long pcr/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic pcr amplification genomic long pcr - by Bioz Stars, 2020-05
    86/100 stars
      Buy from Supplier

    Image Search Results


    Generation of Xb130 −/− mice. A. Schematic strategy of xb130 gene targeting. Structure of Xb130 gene (5′ part), targeting construct, targeted allele and final knockout allele are shown (Empty Boxes: exons; S: SacI; B: BamHI, Filled boxes: Sites for Southern blot probes). Homologous recombination of ES cell genomic DNA with targeting construct inserts Loxp and Frt sites flanking an 879 bp region including Exon 7 and a floxed neomycin cassette. The deletion of Exon 7 causes a frame shift mutation and translation termination in Exon 8. B. Southern blotting with 3′ probe. Mice were derived from Xb130 +/− progeny. C. Western blotting. Protein lysates were extracted from spleen and lung tissues of Xb130 +/+ , Xb130 +/− and Xb130 −/− mice that were genotyped by Southern blotting. D. PCR based genotyping . Arrows indicate the location of primers used for PCR amplification. PCR product amplified from F1 and R1 in WT allele was undetectable due to competition from short product F2/R1. E. RT-PCR. The exons of RT-PCR products from WT (a) and knockout (b and c) mice are indicated based on sequencing data. Red stars indicate induced in-frame stop codons. F. Predicted Xb130 knockout allele based on RT-PCR and genomic PCR data. The primers used for long PCR and the amplicon are indicated as arrows and green line respectively.

    Journal: PLoS ONE

    Article Title: XB130 Deficiency Affects Tracheal Epithelial Differentiation during Airway Repair

    doi: 10.1371/journal.pone.0108952

    Figure Lengend Snippet: Generation of Xb130 −/− mice. A. Schematic strategy of xb130 gene targeting. Structure of Xb130 gene (5′ part), targeting construct, targeted allele and final knockout allele are shown (Empty Boxes: exons; S: SacI; B: BamHI, Filled boxes: Sites for Southern blot probes). Homologous recombination of ES cell genomic DNA with targeting construct inserts Loxp and Frt sites flanking an 879 bp region including Exon 7 and a floxed neomycin cassette. The deletion of Exon 7 causes a frame shift mutation and translation termination in Exon 8. B. Southern blotting with 3′ probe. Mice were derived from Xb130 +/− progeny. C. Western blotting. Protein lysates were extracted from spleen and lung tissues of Xb130 +/+ , Xb130 +/− and Xb130 −/− mice that were genotyped by Southern blotting. D. PCR based genotyping . Arrows indicate the location of primers used for PCR amplification. PCR product amplified from F1 and R1 in WT allele was undetectable due to competition from short product F2/R1. E. RT-PCR. The exons of RT-PCR products from WT (a) and knockout (b and c) mice are indicated based on sequencing data. Red stars indicate induced in-frame stop codons. F. Predicted Xb130 knockout allele based on RT-PCR and genomic PCR data. The primers used for long PCR and the amplicon are indicated as arrows and green line respectively.

    Article Snippet: Expand long genomic PCR amplification Genomic long PCR product was amplified by Forward Primer GT-F1 (5′ CCTCTGCCGAAAACTCATAC 3′) and Reverse primer Intron7-R1 (5′ GAAACCCAAATACAATTTGTCTAGGCTGTAG 3′) using Expand Long Template PCR System (Roche Applied Science).

    Techniques: Mouse Assay, Construct, Knock-Out, Southern Blot, Homologous Recombination, Mutagenesis, Derivative Assay, Western Blot, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Sequencing