genomic dna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher genomic dna
    Gel (2% agarose) showing a lack of <t>PCR</t> amplification with genomic <t>DNA</t> from P. shumwayae ) and P. shumwayae -specific primers (PfBSSU/16s-B) confirm the presence of P. shumwayae DNA. Lane 5 is a 100-bp ladder.
    Genomic Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3163 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/Thermo Fisher
    Average 99 stars, based on 3163 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "Are Pfiesteria species toxicogenic? Evidence against production of ichthyotoxins by Pfiesteriashumwayae"

    Article Title: Are Pfiesteria species toxicogenic? Evidence against production of ichthyotoxins by Pfiesteriashumwayae

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.172221699

    Gel (2% agarose) showing a lack of PCR amplification with genomic DNA from P. shumwayae ) and P. shumwayae -specific primers (PfBSSU/16s-B) confirm the presence of P. shumwayae DNA. Lane 5 is a 100-bp ladder.
    Figure Legend Snippet: Gel (2% agarose) showing a lack of PCR amplification with genomic DNA from P. shumwayae ) and P. shumwayae -specific primers (PfBSSU/16s-B) confirm the presence of P. shumwayae DNA. Lane 5 is a 100-bp ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification

    Gel (1% agarose) of RT-PCR products showing lack of expression of type I or II PKS genes by P. shumwayae . No amplification was observed with cDNA from P. shumwayae using type I PKSI (lane 2) or type II PKSII (lane 3) primer. Expression, likewise, is not seen with primers PKSI and PKSII (lanes 5 and 6, respectively) for the same culture exposed to larval fish ( C. variegatus ) 18 h before RNA extraction or with negative control of the algal food, R. salina ) for CCMP 2089 (lane 4), CCMP 2089 exposed to C. variegatus (lane 7), and R. salina (lane 10). Amplification of the type I PKS sequences was observed for positive control plasmids PL29 (lane 11) and AK112 (lane 12). Negative controls of no template (lanes 13, 14, and 15, respectively) showed no amplification with PKSI, PKSII, or 18S primers. Lane 1 is a 1-kb DNA ladder.
    Figure Legend Snippet: Gel (1% agarose) of RT-PCR products showing lack of expression of type I or II PKS genes by P. shumwayae . No amplification was observed with cDNA from P. shumwayae using type I PKSI (lane 2) or type II PKSII (lane 3) primer. Expression, likewise, is not seen with primers PKSI and PKSII (lanes 5 and 6, respectively) for the same culture exposed to larval fish ( C. variegatus ) 18 h before RNA extraction or with negative control of the algal food, R. salina ) for CCMP 2089 (lane 4), CCMP 2089 exposed to C. variegatus (lane 7), and R. salina (lane 10). Amplification of the type I PKS sequences was observed for positive control plasmids PL29 (lane 11) and AK112 (lane 12). Negative controls of no template (lanes 13, 14, and 15, respectively) showed no amplification with PKSI, PKSII, or 18S primers. Lane 1 is a 1-kb DNA ladder.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Amplification, Fluorescence In Situ Hybridization, RNA Extraction, Negative Control, Positive Control

    Gel (2% agarose) of RT-PCR products showing amplification with P. shumwayae -specific primer. Amplification of the expected 400-bp sequence was observed with cDNA from P. shumwayae (CCMP 2089) as well as the same culture exposed to larval C. variegatus 18 h before RNA extraction using the primers PfBSU/PfBITSR201L (lanes 2 and 5), confirming the presence of P. shumwayae cDNA. No amplification was seen (lane 8) with the algal food, R. salina . Positive amplification was also observed for all positive controls of P. shumwayae genomic DNA (lanes 3, 6, and 9). No amplification was observed for any of the negative controls of no template (lanes 4, 7, and 10). Lanes 1 and 11 are 100-bp DNA ladders.
    Figure Legend Snippet: Gel (2% agarose) of RT-PCR products showing amplification with P. shumwayae -specific primer. Amplification of the expected 400-bp sequence was observed with cDNA from P. shumwayae (CCMP 2089) as well as the same culture exposed to larval C. variegatus 18 h before RNA extraction using the primers PfBSU/PfBITSR201L (lanes 2 and 5), confirming the presence of P. shumwayae cDNA. No amplification was seen (lane 8) with the algal food, R. salina . Positive amplification was also observed for all positive controls of P. shumwayae genomic DNA (lanes 3, 6, and 9). No amplification was observed for any of the negative controls of no template (lanes 4, 7, and 10). Lanes 1 and 11 are 100-bp DNA ladders.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Sequencing, RNA Extraction

    2) Product Images from "SMK-1/PPH-4.1-mediated silencing of the CHK-1 response to DNA damage in early C. elegans embryos"

    Article Title: SMK-1/PPH-4.1-mediated silencing of the CHK-1 response to DNA damage in early C. elegans embryos

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200705182

    rad-2 corresponds to mutations in the smk-1 gene. (A) The first embryonic cell cycle was timed in the indicated strains as described previously ( Holway et al., 2006 ). NEB, nuclear envelop breakdown; control, regular media; +MMS, media containing 0.05 mg/ml MMS. (B) Cartoon depicting the construct used to generate the rad-2 ( pie-1–smk-1– GFP) strain. The arrow and stop indicate the locations of the start and termination of translation, respectively. (C) Embryonic sensitivity to the indicated DNA-damaging agents was determined as described previously ( Holway et al., 2006 ). Error bars represent SD.
    Figure Legend Snippet: rad-2 corresponds to mutations in the smk-1 gene. (A) The first embryonic cell cycle was timed in the indicated strains as described previously ( Holway et al., 2006 ). NEB, nuclear envelop breakdown; control, regular media; +MMS, media containing 0.05 mg/ml MMS. (B) Cartoon depicting the construct used to generate the rad-2 ( pie-1–smk-1– GFP) strain. The arrow and stop indicate the locations of the start and termination of translation, respectively. (C) Embryonic sensitivity to the indicated DNA-damaging agents was determined as described previously ( Holway et al., 2006 ). Error bars represent SD.

    Techniques Used: Construct

    Identification of mutations in the smk-1 gene from the rad-2 strain. (A) Three mutations (E497G, D580G, and D703G) in genomic DNA sequences for the smk-1 gene isolated from the rad-2 strain were identified. (B) The aspartic acid residue at 703 is highly conserved from yeast to human (SMK-1, worm; PP4R3, human; flfl, fly; and Psy2, yeast). The gray shaded areas indicate similar and identical amino acids. (C) Recombinant myc-tagged SMK-1 or SMK-1 (D703G) was optionally mixed with recombinant untagged PPH-4.1, and the reactions were immunoprecipitated with anti-myc antibodies or nonspecific antibodies (IgG). Input, input material; IP, immunoprecipitated material.
    Figure Legend Snippet: Identification of mutations in the smk-1 gene from the rad-2 strain. (A) Three mutations (E497G, D580G, and D703G) in genomic DNA sequences for the smk-1 gene isolated from the rad-2 strain were identified. (B) The aspartic acid residue at 703 is highly conserved from yeast to human (SMK-1, worm; PP4R3, human; flfl, fly; and Psy2, yeast). The gray shaded areas indicate similar and identical amino acids. (C) Recombinant myc-tagged SMK-1 or SMK-1 (D703G) was optionally mixed with recombinant untagged PPH-4.1, and the reactions were immunoprecipitated with anti-myc antibodies or nonspecific antibodies (IgG). Input, input material; IP, immunoprecipitated material.

    Techniques Used: Isolation, Recombinant, Immunoprecipitation

    3) Product Images from "Granulosa cell-derived induced pluripotent stem cells exhibit pro-trophoblastic differentiation potential"

    Article Title: Granulosa cell-derived induced pluripotent stem cells exhibit pro-trophoblastic differentiation potential

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-015-0005-5

    In vitro and in vivo differentiation of human granulosa cell-derived induced pluripotent stem cells. (A) Immunofluorescence staining against three germ layer markers in a representative induced pluripotent stem cell line (iGRA1) following in vitro differentiation. (B) Hematoxylin and eosin staining of teratoma derived from a representative iGRA line (iGRA1). (C) RT-PCR analysis of expression of genes associated with three germ layers in in vitro differentiated iGRAs. 1, 2 and 7, iGRA1, iGRA2, and iGRA7, respectively. N, RNA transcripts untreated with reverse transcriptase (no RT control) served as a negative control for genomic DNA contamination. Scale bars = 50 μm (A) and 30 μm (B) .
    Figure Legend Snippet: In vitro and in vivo differentiation of human granulosa cell-derived induced pluripotent stem cells. (A) Immunofluorescence staining against three germ layer markers in a representative induced pluripotent stem cell line (iGRA1) following in vitro differentiation. (B) Hematoxylin and eosin staining of teratoma derived from a representative iGRA line (iGRA1). (C) RT-PCR analysis of expression of genes associated with three germ layers in in vitro differentiated iGRAs. 1, 2 and 7, iGRA1, iGRA2, and iGRA7, respectively. N, RNA transcripts untreated with reverse transcriptase (no RT control) served as a negative control for genomic DNA contamination. Scale bars = 50 μm (A) and 30 μm (B) .

    Techniques Used: In Vitro, In Vivo, Derivative Assay, Immunofluorescence, Staining, Reverse Transcription Polymerase Chain Reaction, Expressing, Negative Control

    4) Product Images from "The Splicing Efficiency of Activating HRAS Mutations Can Determine Costello Syndrome Phenotype and Frequency in Cancer"

    Article Title: The Splicing Efficiency of Activating HRAS Mutations Can Determine Costello Syndrome Phenotype and Frequency in Cancer

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006039

    Analysis of patient DNA and cDNA. ( a ) RT-PCR analysis of lymphocyte cDNA from four unrelated controls and three individuals with Costello syndrome (CS), caused by heterozygosity for c.34G > A, c.37G > T and c.35_36GC > TG (index individual), revealed pronounced exon 2 skipping in the index individual. The low levels of exon 2 skipping observed in controls and individuals with CS with other genotypes indicates that exon 2 is inefficiently spliced. RPL13A was amplified as a control. ( b ) Comparison of sequence analysis of genomic DNA and lymphocyte cDNA from the index individual, shows that wild type and c.35_36GC > TG alleles are equally present in genomic DNA, but not in full length cDNA. ( c ) Chromatograms from sequencing of the full length band (exon 2 inclusion) from lymphocyte cDNA in forward and reverse direction from individuals with CS heterozygous for c.35_36GC > TG, c.34G > A and c.37G > T.
    Figure Legend Snippet: Analysis of patient DNA and cDNA. ( a ) RT-PCR analysis of lymphocyte cDNA from four unrelated controls and three individuals with Costello syndrome (CS), caused by heterozygosity for c.34G > A, c.37G > T and c.35_36GC > TG (index individual), revealed pronounced exon 2 skipping in the index individual. The low levels of exon 2 skipping observed in controls and individuals with CS with other genotypes indicates that exon 2 is inefficiently spliced. RPL13A was amplified as a control. ( b ) Comparison of sequence analysis of genomic DNA and lymphocyte cDNA from the index individual, shows that wild type and c.35_36GC > TG alleles are equally present in genomic DNA, but not in full length cDNA. ( c ) Chromatograms from sequencing of the full length band (exon 2 inclusion) from lymphocyte cDNA in forward and reverse direction from individuals with CS heterozygous for c.35_36GC > TG, c.34G > A and c.37G > T.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Sequencing

    5) Product Images from "Drosophila Ana2 is a conserved centriole duplication factor"

    Article Title: Drosophila Ana2 is a conserved centriole duplication factor

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200910016

    Overexpression of Ana2 drives centriole overduplication in spermatocytes. (A and B) Centriole number (A) and conformation (B) in G2 primary spermatocytes expressing either the centriole marker RFP-PACT alone or both RFP-PACT and GFP-Ana2. Centrioles were counted in a total of 109 RFP-PACT cells and 138 GFP-Ana2 RFP-PACT cells from seven testes per condition. (C and D) G2 primary spermatocytes expressing either RFP-PACT (red) alone (C) or both RFP-PACT and GFP-Ana2 (D). DNA is in blue. The cell in C has the normal two centriole pairs. Overexpression of GFP-Ana2 induces centriole triplets and quadruplets (D). (E–G) Magnified images of RFP-PACT–labeled doublet (E), triplet (F), and quadruplet (G) centriole groups. (H and I) Secondary spermatocytes in meiosis II expressing either RFP-PACT (red) alone (H) or both RFP-PACT and GFP-Ana2 (I). Tubulin is in green and DNA in blue. The cell in H has the normal two centrioles whereas the one in I has three centrioles forming a tripolar spindle. Bars: (C and D) 10 µm; (H and I) 5 µm.
    Figure Legend Snippet: Overexpression of Ana2 drives centriole overduplication in spermatocytes. (A and B) Centriole number (A) and conformation (B) in G2 primary spermatocytes expressing either the centriole marker RFP-PACT alone or both RFP-PACT and GFP-Ana2. Centrioles were counted in a total of 109 RFP-PACT cells and 138 GFP-Ana2 RFP-PACT cells from seven testes per condition. (C and D) G2 primary spermatocytes expressing either RFP-PACT (red) alone (C) or both RFP-PACT and GFP-Ana2 (D). DNA is in blue. The cell in C has the normal two centriole pairs. Overexpression of GFP-Ana2 induces centriole triplets and quadruplets (D). (E–G) Magnified images of RFP-PACT–labeled doublet (E), triplet (F), and quadruplet (G) centriole groups. (H and I) Secondary spermatocytes in meiosis II expressing either RFP-PACT (red) alone (H) or both RFP-PACT and GFP-Ana2 (I). Tubulin is in green and DNA in blue. The cell in H has the normal two centrioles whereas the one in I has three centrioles forming a tripolar spindle. Bars: (C and D) 10 µm; (H and I) 5 µm.

    Techniques Used: Over Expression, Expressing, Marker, Labeling

    6) Product Images from "The accessory proteins REEP5 and REEP6 refine CXCR1-mediated cellular responses and lung cancer progression"

    Article Title: The accessory proteins REEP5 and REEP6 refine CXCR1-mediated cellular responses and lung cancer progression

    Journal: Scientific Reports

    doi: 10.1038/srep39041

    CXCR1 signaling in A549 cell lines was decreased by the depletion of REEP5 and REEP6. ( A ) Using RNAs from A549 cells, RT-PCR was performed with specific CXCR1, CXCR2, and REEP1–6 primers. The PCR products were resolved on a 1% agarose gel. SM, size markers (1 Kb Plus DNA ladder from Invitrogen). ( B ) qRT-PCR was performed for REEP5 and REEP6 mRNA in A549 cells infected with lentivirus containing shRNAs. Relative mRNA levels of REEP5 and REEP6 were normalized with β-actin mRNA and are shown as mean ± S.E (n = 4). The bar graphs are presented by relative value to sc control. ( C ) A549 cells containing shRNAs were treated with IL-8 for the indicated times (min) and analyzed by western blotting with anti-pERK1/2 antibodies. NT, not treated. ( D ) A549 cells containing shRNAs were treated with IL-8 for 20 min, fixed, and stained with phalloidin-TRITC. The scale bar denotes 10 μm. The results are from at least three independent experiments.
    Figure Legend Snippet: CXCR1 signaling in A549 cell lines was decreased by the depletion of REEP5 and REEP6. ( A ) Using RNAs from A549 cells, RT-PCR was performed with specific CXCR1, CXCR2, and REEP1–6 primers. The PCR products were resolved on a 1% agarose gel. SM, size markers (1 Kb Plus DNA ladder from Invitrogen). ( B ) qRT-PCR was performed for REEP5 and REEP6 mRNA in A549 cells infected with lentivirus containing shRNAs. Relative mRNA levels of REEP5 and REEP6 were normalized with β-actin mRNA and are shown as mean ± S.E (n = 4). The bar graphs are presented by relative value to sc control. ( C ) A549 cells containing shRNAs were treated with IL-8 for the indicated times (min) and analyzed by western blotting with anti-pERK1/2 antibodies. NT, not treated. ( D ) A549 cells containing shRNAs were treated with IL-8 for 20 min, fixed, and stained with phalloidin-TRITC. The scale bar denotes 10 μm. The results are from at least three independent experiments.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Quantitative RT-PCR, Infection, Western Blot, Staining

    7) Product Images from "Non-clinical Safety and Efficacy of an AAV2/8 Vector Administered Intravenously for Treatment of Mucopolysaccharidosis Type VI"

    Article Title: Non-clinical Safety and Efficacy of an AAV2/8 Vector Administered Intravenously for Treatment of Mucopolysaccharidosis Type VI

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1016/j.omtm.2017.07.004

    AAV2/8.TBG. hARSB Shedding in the Semen of Male Rabbits AAV2/8.TBG. hARSB DNA was analyzed by qPCR in the semen of adult New Zealand males rabbits injected with either AAV2/8.TBG. hARSB vector at a dose of 2 × 10 12 GC/kg (n = 3) or with the excipient as the control (n = 2). AAV DNA was undetectable in control rabbits receiving the excipient. Vector DNA is reported as genome copies (GC) per 100 μL of semen. The limit of quantification (LOQ) of qPCR was 30 GC/well; the limit of detection (LOD) was 9 GC/well. D, days post-injection.
    Figure Legend Snippet: AAV2/8.TBG. hARSB Shedding in the Semen of Male Rabbits AAV2/8.TBG. hARSB DNA was analyzed by qPCR in the semen of adult New Zealand males rabbits injected with either AAV2/8.TBG. hARSB vector at a dose of 2 × 10 12 GC/kg (n = 3) or with the excipient as the control (n = 2). AAV DNA was undetectable in control rabbits receiving the excipient. Vector DNA is reported as genome copies (GC) per 100 μL of semen. The limit of quantification (LOQ) of qPCR was 30 GC/well; the limit of detection (LOD) was 9 GC/well. D, days post-injection.

    Techniques Used: Real-time Polymerase Chain Reaction, Injection, Plasmid Preparation

    AAV2/8.TBG. hARSB Biodistribution in C57/BL6- TgARSBC91S Mice (A and B) AAV2/8.TBG. hARSB biodistribution in males (A) and females (B) was analyzed by qPCR. Tissues/organs were collected on D15 (dark gray bars) and D180 (light gray bars). Solid bars represent tissues/organs in which all samples were above the limit of quantification (LOQ) of the assay. Non-solid bars represent tissues/organs in which one or more samples were below the LOQ. The LOQ was 50 genome copies (GC)/μg total DNA and the limit of detection (LOD) was 15 GC/μg total DNA. Results are reported as means ± SD and in decreasing order on D15. Five animals were analyzed per each time point. One male mouse whose organs were collected on D15 was excluded from statistical analysis because the data deviate importantly from other animals, likely because of improper test administration. Statistical analysis was performed using the one-sided Wilcoxon-Mann-Whitney test, assuming LOQ and LOD values for analysis. *p
    Figure Legend Snippet: AAV2/8.TBG. hARSB Biodistribution in C57/BL6- TgARSBC91S Mice (A and B) AAV2/8.TBG. hARSB biodistribution in males (A) and females (B) was analyzed by qPCR. Tissues/organs were collected on D15 (dark gray bars) and D180 (light gray bars). Solid bars represent tissues/organs in which all samples were above the limit of quantification (LOQ) of the assay. Non-solid bars represent tissues/organs in which one or more samples were below the LOQ. The LOQ was 50 genome copies (GC)/μg total DNA and the limit of detection (LOD) was 15 GC/μg total DNA. Results are reported as means ± SD and in decreasing order on D15. Five animals were analyzed per each time point. One male mouse whose organs were collected on D15 was excluded from statistical analysis because the data deviate importantly from other animals, likely because of improper test administration. Statistical analysis was performed using the one-sided Wilcoxon-Mann-Whitney test, assuming LOQ and LOD values for analysis. *p

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction, MANN-WHITNEY

    8) Product Images from "Epigenetic programming of Dnmt3a mediated by AP2α is required for granting preadipocyte the ability to differentiate"

    Article Title: Epigenetic programming of Dnmt3a mediated by AP2α is required for granting preadipocyte the ability to differentiate

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2016.378

    AP2 α knockdown impairs both genome-wide DNA methylation and the promoter methylation of adipogenic TFs during the CI stage. ( a ) 5-methylcytosine immunofluorescence of 3T3-L1 preadipocytes at ci48 h. The cells were transiently transfected with either scramble siRNA (ctrl) or AP2 α siRNAs (si-1 and si-2) at ci0 h and fixed at ci48 h for 5-methylcytosine immunofluorescence. Scale bars: 10 μ m. ( b ) Quantification analyses of total nuclear 5-methylcytosine densities in AP2 α knockdown cells at ci48 h. Data were collected at the same voltage and were presented as mean±S.D. ( n =3). Statistical significance is indicated: *** P
    Figure Legend Snippet: AP2 α knockdown impairs both genome-wide DNA methylation and the promoter methylation of adipogenic TFs during the CI stage. ( a ) 5-methylcytosine immunofluorescence of 3T3-L1 preadipocytes at ci48 h. The cells were transiently transfected with either scramble siRNA (ctrl) or AP2 α siRNAs (si-1 and si-2) at ci0 h and fixed at ci48 h for 5-methylcytosine immunofluorescence. Scale bars: 10 μ m. ( b ) Quantification analyses of total nuclear 5-methylcytosine densities in AP2 α knockdown cells at ci48 h. Data were collected at the same voltage and were presented as mean±S.D. ( n =3). Statistical significance is indicated: *** P

    Techniques Used: Genome Wide, DNA Methylation Assay, Methylation, Immunofluorescence, Transfection

    9) Product Images from "A Novel Slug-containing Negative Feedback Loop regulates SCF/c-Kit-Mediated Hematopoietic Stem Cell Self-renewal"

    Article Title: A Novel Slug-containing Negative Feedback Loop regulates SCF/c-Kit-Mediated Hematopoietic Stem Cell Self-renewal

    Journal: Leukemia

    doi: 10.1038/leu.2016.201

    Key Role of c-Myc and FoxM1 in SCF/c-Kit-Slug Feedback Loop (A) Analysis of c-Myc and FoxM1 occupancies at the Slug promoter by ChIP analysis. Primary BM cells were transduced with retroviral particles containing c-Myc and FoxM1, respectively. The genomic DNA was pulled down by anti-Flag and IgG control antibodies, and amplified with primer pairs F1/R1 (−856 to −691bp), F2/R2 (−1389 to −1234bp), F3/R3 (−1772 to −1605bp), F4/R4 (−597 to −410bp) F5/R5 (−1203 to −1012bp), F6/R6 (−1522 to −1312bp). Hprt was included as a loading control. Data are representative of two independent experiments. (B) qPCR analysis of Slug transcripts in c-Myc-expressing HSPCs after treatment with SCF. HPSCs harboring c-Myc shRNA and control shRNA were left without treatment as a control or treated with SCF (100 ng/ml) for 12 hrs before qPCR analysis. Data are representative of two independent experiments. **p
    Figure Legend Snippet: Key Role of c-Myc and FoxM1 in SCF/c-Kit-Slug Feedback Loop (A) Analysis of c-Myc and FoxM1 occupancies at the Slug promoter by ChIP analysis. Primary BM cells were transduced with retroviral particles containing c-Myc and FoxM1, respectively. The genomic DNA was pulled down by anti-Flag and IgG control antibodies, and amplified with primer pairs F1/R1 (−856 to −691bp), F2/R2 (−1389 to −1234bp), F3/R3 (−1772 to −1605bp), F4/R4 (−597 to −410bp) F5/R5 (−1203 to −1012bp), F6/R6 (−1522 to −1312bp). Hprt was included as a loading control. Data are representative of two independent experiments. (B) qPCR analysis of Slug transcripts in c-Myc-expressing HSPCs after treatment with SCF. HPSCs harboring c-Myc shRNA and control shRNA were left without treatment as a control or treated with SCF (100 ng/ml) for 12 hrs before qPCR analysis. Data are representative of two independent experiments. **p

    Techniques Used: Chromatin Immunoprecipitation, Transduction, Amplification, Real-time Polymerase Chain Reaction, Expressing, shRNA

    10) Product Images from "Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro"

    Article Title: Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0337479100

    RT-PCR of total RNA isolated from rabbit ileal loops. PCR was performed as described in Materials and Methods by using primers specific for selected V. cholerae genes and either reverse-transcribed RNA (cDNA) or chromosomal DNA as template.
    Figure Legend Snippet: RT-PCR of total RNA isolated from rabbit ileal loops. PCR was performed as described in Materials and Methods by using primers specific for selected V. cholerae genes and either reverse-transcribed RNA (cDNA) or chromosomal DNA as template.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction

    11) Product Images from "Genetic Authentication of Gardenia jasminoides Ellis var. grandiflora Nakai by Improved RAPD-Derived DNA Markers"

    Article Title: Genetic Authentication of Gardenia jasminoides Ellis var. grandiflora Nakai by Improved RAPD-Derived DNA Markers

    Journal: Molecules

    doi: 10.3390/molecules201119687

    Genetic authentication of Gardenia jasminoides based on ZZH11 ( A ); ZZH31 ( B ); ZZH41 ( C ) and ZZH51 ( D ) SCAR markers. Lanes 1–6 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Jiangxi, Fujian, Guizhou, Sichuan, Hunan and Zhejiang respectively ( Table 1 ). Lane 7 is a sample of G. jasminoides from Luzhou in Sichuan (No. 7 in Table 1 ). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).
    Figure Legend Snippet: Genetic authentication of Gardenia jasminoides based on ZZH11 ( A ); ZZH31 ( B ); ZZH41 ( C ) and ZZH51 ( D ) SCAR markers. Lanes 1–6 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Jiangxi, Fujian, Guizhou, Sichuan, Hunan and Zhejiang respectively ( Table 1 ). Lane 7 is a sample of G. jasminoides from Luzhou in Sichuan (No. 7 in Table 1 ). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).

    Techniques Used: Molecular Weight, Marker

    Genetic authentication of more Gardenia jasminoides sample based on ZZH11 ( A ); ZZH31 ( B ); ZZH41 ( C ) and ZZH51 ( D ) SCAR markers. Lanes 6, 8, 9, 10 and 11 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Zhejiang, Guangdong, Fujian, Hunan and Anhui respectively ( Table 1 , Nos. 6, 8, 9, 10 and 11). Lane 7, 12, 13, 14 and 15 are samples of G. jasminoides from Luzhou in Sichuan, Jiangsu, Jiangxi, Hunan and Shanxi respectively ( Table 1 , Nos., 7, 12, 13, 14 and 15). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).
    Figure Legend Snippet: Genetic authentication of more Gardenia jasminoides sample based on ZZH11 ( A ); ZZH31 ( B ); ZZH41 ( C ) and ZZH51 ( D ) SCAR markers. Lanes 6, 8, 9, 10 and 11 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Zhejiang, Guangdong, Fujian, Hunan and Anhui respectively ( Table 1 , Nos. 6, 8, 9, 10 and 11). Lane 7, 12, 13, 14 and 15 are samples of G. jasminoides from Luzhou in Sichuan, Jiangsu, Jiangxi, Hunan and Shanxi respectively ( Table 1 , Nos., 7, 12, 13, 14 and 15). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).

    Techniques Used: Molecular Weight, Marker

    Development of stable RAPD-sequence-characterized amplified region (SCAR) markers for ZZH11, ZZH31, ZZH41 and ZZH51. ( A ) A SCAR marker ZZH11; ( B ) A SCAR marker ZZH31; ( C ) A SCAR marker ZZH41; ( D ) A SCAR marker ZZH51. Lanes 1~6 indicate the different samples of G. jasminoides Ellis var. grandiflora Nakai listed in Table 1 . Lanes 7 and 8 are two samples of Lonicera japonica from Hunan and Hubei; Lane 9 is one sample of Penthorum chinense ; Lane 10 is one sample of Ganoderma lucidum ; Lanes 11 and 12 are two samples of Litchi chinesis from Guangdong and Sichuan; Lanes 13 and 14 are two samples of Dimocarpus Longan from Fujian and Sichuan; Lane 15 is one sample of Dimocarpus confinis from Guangxi; Lanes 16 and 17 are two samples of Ginkgo Biloba from Sichuan and Hunan; Lanes 18 and 19 are two samples of Angelica sinensis from Sichuan and Gansu; Lane 20 is one sample of Gastrodia elata ; Lanes 21 and 22 are two samples of Canarium album Guangdong and Sichuan; Lane 23 is negative control without DNA. The blue arrows indicate expected PCR products in size. Lane M indicates the DNA molecular weight marker DL2000.
    Figure Legend Snippet: Development of stable RAPD-sequence-characterized amplified region (SCAR) markers for ZZH11, ZZH31, ZZH41 and ZZH51. ( A ) A SCAR marker ZZH11; ( B ) A SCAR marker ZZH31; ( C ) A SCAR marker ZZH41; ( D ) A SCAR marker ZZH51. Lanes 1~6 indicate the different samples of G. jasminoides Ellis var. grandiflora Nakai listed in Table 1 . Lanes 7 and 8 are two samples of Lonicera japonica from Hunan and Hubei; Lane 9 is one sample of Penthorum chinense ; Lane 10 is one sample of Ganoderma lucidum ; Lanes 11 and 12 are two samples of Litchi chinesis from Guangdong and Sichuan; Lanes 13 and 14 are two samples of Dimocarpus Longan from Fujian and Sichuan; Lane 15 is one sample of Dimocarpus confinis from Guangxi; Lanes 16 and 17 are two samples of Ginkgo Biloba from Sichuan and Hunan; Lanes 18 and 19 are two samples of Angelica sinensis from Sichuan and Gansu; Lane 20 is one sample of Gastrodia elata ; Lanes 21 and 22 are two samples of Canarium album Guangdong and Sichuan; Lane 23 is negative control without DNA. The blue arrows indicate expected PCR products in size. Lane M indicates the DNA molecular weight marker DL2000.

    Techniques Used: Sequencing, Amplification, Marker, Negative Control, Polymerase Chain Reaction, Molecular Weight

    12) Product Images from "Local chromatin environment of a Polycomb target gene instructs its own epigenetic inheritance"

    Article Title: Local chromatin environment of a Polycomb target gene instructs its own epigenetic inheritance

    Journal: eLife

    doi: 10.7554/eLife.07205

    COOLAIR expression in transgenic FLC lines. ( A ) Schematic of FLC genomic DNA with FLC mRNA and COOLAIR exons represented by black boxes. Dashed lines indicate splicing pattern. Coloured bars beneath COOLAIR transcripts represent the position of the qPCR amplicons used for quantification of transcripts (green = Total, blue = Class I, red = Class II). ( B ) NV COOLAIR expression measured by RT-qPCR. Data are normalized to UBC and are represented as mean ± s.e.m. (n = 3). ( C ) Cold induction of COOLAIR expression in FLC-Venus transgenic lines. NV indicates that plants were NV, while 4WT0 indicates that plants were harvested immediately after exposure to 4 weeks of cold. DOI: http://dx.doi.org/10.7554/eLife.07205.007
    Figure Legend Snippet: COOLAIR expression in transgenic FLC lines. ( A ) Schematic of FLC genomic DNA with FLC mRNA and COOLAIR exons represented by black boxes. Dashed lines indicate splicing pattern. Coloured bars beneath COOLAIR transcripts represent the position of the qPCR amplicons used for quantification of transcripts (green = Total, blue = Class I, red = Class II). ( B ) NV COOLAIR expression measured by RT-qPCR. Data are normalized to UBC and are represented as mean ± s.e.m. (n = 3). ( C ) Cold induction of COOLAIR expression in FLC-Venus transgenic lines. NV indicates that plants were NV, while 4WT0 indicates that plants were harvested immediately after exposure to 4 weeks of cold. DOI: http://dx.doi.org/10.7554/eLife.07205.007

    Techniques Used: Expressing, Transgenic Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    13) Product Images from "Identification of a Large Novel Imprinted Gene Cluster on Mouse Proximal Chromosome 6"

    Article Title: Identification of a Large Novel Imprinted Gene Cluster on Mouse Proximal Chromosome 6

    Journal: Genome Research

    doi: 10.1101/gr.906803

    Peg10 imprinted expression associated with primary DMR. ( A ) The genomic structure of Peg10 and bisulfite sequencing analyses of the Peg10 repeated sequence region. The full-length Peg10 sequence was determined by 5′-RACE analysis. The white boxes are untranslated regions and putative open reading frames are shown with black boxes. Two putative ORFs of Peg10 are shown in gray boxes below; ORF1 shares 30% amino acid identity with the gag protein, and ORF2 predicted from a -1 frameshift of ORF1 shares 25% identity with the pol protein of Sushi-ichi retrotransposon, respectively. The translational frameshifting of ORF1–ORF2 is commonly observed in retroviruses and gypsy-type LTR retrotransposons. The arrows indicate the 5′–3′ direction of Peg10 and Sgce . The DNA methylation status of Peg10 repeats in day 10 embryo, eggs, and sperm are shown. Differential methylation was observed in the day 10 embryo as well as the day 10 placenta (data not shown). DNA polymorphisms between JF1 and B6 were used to distinguish parental alleles. The entire Peg10-Sgce CpG island indicated by gray lollipops shows a differentially methylated status similar to that in the Peg10 repeats (data not shown). ( B ) Twelve Peg10 intronic 29-bp repeat sequences. Shaded boxes indicate homology with the most frequent sequence, GCGCTTCATGCGCTACAAAATACTCATAG (four times). ( C ) Northern blot profiles of Peg 10 in mouse adult tissues. Total RNA from mouse adult brain (lane 1 ), heart (lane 2 ), lung (lane 3 ), liver (lane 4 ), spleen (lane 5 ), kidney (lane 6 ), stomach (lane 7 ), small intestine (lane 8 ), skeletal muscle (lane 9 ), skin (lane 10 ), thymus (lane 11 ), testis (lane 12 ), uterus (lane 13 ), and placenta (lane 14 ) was analyzed. Ribosomal RNA detected by ethidium bromide (EtBr) staining was used as a marker. Strong Peg10 expression was observed only in placenta, and the major transcript was estimated to be -6.5 kb long. ( D ) Paternal expression of Peg10 . Paternal expression of Peg10 in day 10 embryo, placenta, yolk sac, and neonatal brain is demonstrated by direct sequencing of the RT-PCR products, by comparing the sequence profiles of genomic DNA containing B6 and JF1 alleles equally.
    Figure Legend Snippet: Peg10 imprinted expression associated with primary DMR. ( A ) The genomic structure of Peg10 and bisulfite sequencing analyses of the Peg10 repeated sequence region. The full-length Peg10 sequence was determined by 5′-RACE analysis. The white boxes are untranslated regions and putative open reading frames are shown with black boxes. Two putative ORFs of Peg10 are shown in gray boxes below; ORF1 shares 30% amino acid identity with the gag protein, and ORF2 predicted from a -1 frameshift of ORF1 shares 25% identity with the pol protein of Sushi-ichi retrotransposon, respectively. The translational frameshifting of ORF1–ORF2 is commonly observed in retroviruses and gypsy-type LTR retrotransposons. The arrows indicate the 5′–3′ direction of Peg10 and Sgce . The DNA methylation status of Peg10 repeats in day 10 embryo, eggs, and sperm are shown. Differential methylation was observed in the day 10 embryo as well as the day 10 placenta (data not shown). DNA polymorphisms between JF1 and B6 were used to distinguish parental alleles. The entire Peg10-Sgce CpG island indicated by gray lollipops shows a differentially methylated status similar to that in the Peg10 repeats (data not shown). ( B ) Twelve Peg10 intronic 29-bp repeat sequences. Shaded boxes indicate homology with the most frequent sequence, GCGCTTCATGCGCTACAAAATACTCATAG (four times). ( C ) Northern blot profiles of Peg 10 in mouse adult tissues. Total RNA from mouse adult brain (lane 1 ), heart (lane 2 ), lung (lane 3 ), liver (lane 4 ), spleen (lane 5 ), kidney (lane 6 ), stomach (lane 7 ), small intestine (lane 8 ), skeletal muscle (lane 9 ), skin (lane 10 ), thymus (lane 11 ), testis (lane 12 ), uterus (lane 13 ), and placenta (lane 14 ) was analyzed. Ribosomal RNA detected by ethidium bromide (EtBr) staining was used as a marker. Strong Peg10 expression was observed only in placenta, and the major transcript was estimated to be -6.5 kb long. ( D ) Paternal expression of Peg10 . Paternal expression of Peg10 in day 10 embryo, placenta, yolk sac, and neonatal brain is demonstrated by direct sequencing of the RT-PCR products, by comparing the sequence profiles of genomic DNA containing B6 and JF1 alleles equally.

    Techniques Used: Expressing, Methylation Sequencing, Sequencing, DNA Methylation Assay, Methylation, Northern Blot, Staining, Marker, Reverse Transcription Polymerase Chain Reaction

    14) Product Images from "Oxygen nanobubbles revert hypoxia by methylation programming"

    Article Title: Oxygen nanobubbles revert hypoxia by methylation programming

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-08988-7

    Quantitative real-time PCR, LC-MS, and gene-specific methylation analysis of in vivo tumors. ( a ) LC - MS/MS quantitation of 5mC levels in terms of ratios of 5-methyl-2′-deoxycytidine (5mdC) to that of deoxycytidine (dC) in nanobubble shell (CTRL) and oxygen nanobubble (Treatment) treated groups for HeLa (left) and MB49 (right) cells in mice models. ( b ) Transcription levels of HIF-1α, PDK-1, and MAT2A determined by qRT-PCR. (n = 16, p-value was calculated by ANOVA). ( c ) Changes in promoter methylation of the 22 selected tumor suppressor genes. ( d ) Oxygen nanobubble induced changes in DNA methylation at the CpG islands of Human BRCA1 promoter region. The extent of methylation was compared between in vivo tumors treated with either nanobubbles or saline. Methylation levels were measured by bisulfite treatment of the DNA followed by pyrosequencing and expressed as % change at the promoter region of chromosome 17. *** P
    Figure Legend Snippet: Quantitative real-time PCR, LC-MS, and gene-specific methylation analysis of in vivo tumors. ( a ) LC - MS/MS quantitation of 5mC levels in terms of ratios of 5-methyl-2′-deoxycytidine (5mdC) to that of deoxycytidine (dC) in nanobubble shell (CTRL) and oxygen nanobubble (Treatment) treated groups for HeLa (left) and MB49 (right) cells in mice models. ( b ) Transcription levels of HIF-1α, PDK-1, and MAT2A determined by qRT-PCR. (n = 16, p-value was calculated by ANOVA). ( c ) Changes in promoter methylation of the 22 selected tumor suppressor genes. ( d ) Oxygen nanobubble induced changes in DNA methylation at the CpG islands of Human BRCA1 promoter region. The extent of methylation was compared between in vivo tumors treated with either nanobubbles or saline. Methylation levels were measured by bisulfite treatment of the DNA followed by pyrosequencing and expressed as % change at the promoter region of chromosome 17. *** P

    Techniques Used: Real-time Polymerase Chain Reaction, Liquid Chromatography with Mass Spectroscopy, Methylation, In Vivo, Mass Spectrometry, Quantitation Assay, Mouse Assay, Quantitative RT-PCR, DNA Methylation Assay

    15) Product Images from "Characterization and diagnostic application of genomic NPM-ALK fusion sequences in anaplastic large-cell lymphoma"

    Article Title: Characterization and diagnostic application of genomic NPM-ALK fusion sequences in anaplastic large-cell lymphoma

    Journal: Oncotarget

    doi: 10.18632/oncotarget.25489

    NPM-ALK quantification after crizotinib treatment in vitro Parallel quantification of NPM-ALK fusion transcript (A) and fusion gene (B) copies and cell survival analyses (D) after treatment of ALK-positive ALCL cell lines (SR-786 or Karpas 299) mixed 1:100 with an ALK-negative lymphoma cell line (DG75) with crizotinib for 72 h. Transcripts per cell were calculated based on quantified RNA and DNA copies (C) . Experiments were repeated three or five times for SR-786 and Karpas 299, respectively. ( **** p
    Figure Legend Snippet: NPM-ALK quantification after crizotinib treatment in vitro Parallel quantification of NPM-ALK fusion transcript (A) and fusion gene (B) copies and cell survival analyses (D) after treatment of ALK-positive ALCL cell lines (SR-786 or Karpas 299) mixed 1:100 with an ALK-negative lymphoma cell line (DG75) with crizotinib for 72 h. Transcripts per cell were calculated based on quantified RNA and DNA copies (C) . Experiments were repeated three or five times for SR-786 and Karpas 299, respectively. ( **** p

    Techniques Used: In Vitro

    Comparison of quantitative NPM-ALK PCR results between cellular RNA, cellular DNA and cell free DNA Comparison of NPM-ALK copy numbers in blood or bone marrow samples from high risk ALCL-patients using the cellular RNA- and DNA-based and cell-free DNA-based methods. (A) Cell-based fusion transcripts (RNA) versus cellular fusion-sequence DNA-based (DNA), n=45. (B) Cell-based fusion transcripts (RNA) versus cell-free fusion-sequence DNA-based (ctDNA), n=37. (C) Cellular fusion-sequence DNA-based (DNA) versus cell-free fusion-sequence DNA-based (ctDNA), n=37.
    Figure Legend Snippet: Comparison of quantitative NPM-ALK PCR results between cellular RNA, cellular DNA and cell free DNA Comparison of NPM-ALK copy numbers in blood or bone marrow samples from high risk ALCL-patients using the cellular RNA- and DNA-based and cell-free DNA-based methods. (A) Cell-based fusion transcripts (RNA) versus cellular fusion-sequence DNA-based (DNA), n=45. (B) Cell-based fusion transcripts (RNA) versus cell-free fusion-sequence DNA-based (ctDNA), n=37. (C) Cellular fusion-sequence DNA-based (DNA) versus cell-free fusion-sequence DNA-based (ctDNA), n=37.

    Techniques Used: Polymerase Chain Reaction, Sequencing

    Quantification of NPM-ALK in ALCL patients NPM-ALK fusion RNA, DNA and ctDNA copies in 3 ALCL patients during their disease course. (AM… course of dexamethasone, methotrexate, ifosfamide, cytarabine and etoposide; BM… course of dexamethasone, methotrexate, cyclophosphamide and doxorubicine).
    Figure Legend Snippet: Quantification of NPM-ALK in ALCL patients NPM-ALK fusion RNA, DNA and ctDNA copies in 3 ALCL patients during their disease course. (AM… course of dexamethasone, methotrexate, ifosfamide, cytarabine and etoposide; BM… course of dexamethasone, methotrexate, cyclophosphamide and doxorubicine).

    Techniques Used:

    16) Product Images from "Mutations in the MAB_2299c TetR Regulator Confer Cross-Resistance to Clofazimine and Bedaquiline in Mycobacterium abscessus"

    Article Title: Mutations in the MAB_2299c TetR Regulator Confer Cross-Resistance to Clofazimine and Bedaquiline in Mycobacterium abscessus

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01316-18

    Binding activity of MAB_2299c to the intergenic region upstream of MAB_2300-MAB_2301 . (A) Schematic representation of the 64-bp DNA operator identified within IR 2300/01 corresponding to the sequence of probe A. The oligonucleotides recognized by MAB_2299c are composed of two palindromes (underlined by arrows) and two degenerated double repeats (underlined by dashed arrows). (B) EMSA and competition assays using probe A and purified MAB_2299c. Gel shifts were revealed by fluorescence emission using a 5′ fluorescein-labeled probe A. (C) Gel filtration profiles of free probe A, free MAB_2299c, and the TetR-DNA complex. Probe A (red dotted line) and MAB_2299c (green line) were isolated individually by size exclusion chromatography and displayed elution volumes ( V e ) of 12.35 ml and 13.64 ml, respectively. When mixed together, a stable MAB_2299c-probe A complex (red line) with an elution volume of 11.53 ml was observed. The MAB_4384-specific palindromic sequence (orange dotted line) eluted at 14.43 ml. However, when mixed together with MAB_2299c, no protein-DNA complex was formed and both the DNA and protein were eluted separately (orange line) as two distinct peaks, with the elution volumes corresponding exactly to those for the MAB_4384 palindrome and MAB_2299c protein alone. mAU, milli-absorbance units. (D) Expression of the various MAB_2299c variants in E. coli . Lanes 1, total crude extract; lanes 2, clarified/soluble extract. The theoretical molecular mass of MAB_2299c-6His-TrxA is 41,420 Da. MW, molecular weight. (E) Impaired DNA-binding activity of the MAB_2299c L40W mutant, as shown by EMSA using either the soluble MAB_2299c (WT) or MAB_2299c (L40W) protein. Gel shifts were revealed by the fluorescence emission thanks to fluorescein-labeled probe A.
    Figure Legend Snippet: Binding activity of MAB_2299c to the intergenic region upstream of MAB_2300-MAB_2301 . (A) Schematic representation of the 64-bp DNA operator identified within IR 2300/01 corresponding to the sequence of probe A. The oligonucleotides recognized by MAB_2299c are composed of two palindromes (underlined by arrows) and two degenerated double repeats (underlined by dashed arrows). (B) EMSA and competition assays using probe A and purified MAB_2299c. Gel shifts were revealed by fluorescence emission using a 5′ fluorescein-labeled probe A. (C) Gel filtration profiles of free probe A, free MAB_2299c, and the TetR-DNA complex. Probe A (red dotted line) and MAB_2299c (green line) were isolated individually by size exclusion chromatography and displayed elution volumes ( V e ) of 12.35 ml and 13.64 ml, respectively. When mixed together, a stable MAB_2299c-probe A complex (red line) with an elution volume of 11.53 ml was observed. The MAB_4384-specific palindromic sequence (orange dotted line) eluted at 14.43 ml. However, when mixed together with MAB_2299c, no protein-DNA complex was formed and both the DNA and protein were eluted separately (orange line) as two distinct peaks, with the elution volumes corresponding exactly to those for the MAB_4384 palindrome and MAB_2299c protein alone. mAU, milli-absorbance units. (D) Expression of the various MAB_2299c variants in E. coli . Lanes 1, total crude extract; lanes 2, clarified/soluble extract. The theoretical molecular mass of MAB_2299c-6His-TrxA is 41,420 Da. MW, molecular weight. (E) Impaired DNA-binding activity of the MAB_2299c L40W mutant, as shown by EMSA using either the soluble MAB_2299c (WT) or MAB_2299c (L40W) protein. Gel shifts were revealed by the fluorescence emission thanks to fluorescein-labeled probe A.

    Techniques Used: Binding Assay, Activity Assay, Sequencing, Purification, Fluorescence, Labeling, Filtration, Isolation, Size-exclusion Chromatography, Expressing, Molecular Weight, Mutagenesis

    17) Product Images from "A Portable, Shock-Proof, Surface-Heated Droplet PCR System for Escherichia coli Detection"

    Article Title: A Portable, Shock-Proof, Surface-Heated Droplet PCR System for Escherichia coli Detection

    Journal: Biosensors & bioelectronics

    doi: 10.1016/j.bios.2015.06.026

    (A) Gel electropherogram showing results from the positive control experiment using 2.6 ng of genomic DNA (equivalent to 5.2×10 5 genomic copies) extracted from E. coli K12 and thermocycled for 30 cycles, with thermal cycle times of 30 s, on the surface-heated droplet PCR device. The genomic DNA was quantified by a Qubit 2.0 fluorimeter. The 196 bp product band is at the expected location, and there is no band observed for the no template control (NTC) sample. (B) Gel electropherogram showing the result of the dilution test. Genomic DNA in the range of 2.6 ng to 5.2 pg (5.2×10 5 − 10 3 genomic copies) was thermocycled for 30 cycles, with thermocycle times of 30 s, on the surface-heated droplet PCR device. The PCR with the lowest DNA content (5.2 pg or approximately 10 3 genomic copies) produced a visible band.
    Figure Legend Snippet: (A) Gel electropherogram showing results from the positive control experiment using 2.6 ng of genomic DNA (equivalent to 5.2×10 5 genomic copies) extracted from E. coli K12 and thermocycled for 30 cycles, with thermal cycle times of 30 s, on the surface-heated droplet PCR device. The genomic DNA was quantified by a Qubit 2.0 fluorimeter. The 196 bp product band is at the expected location, and there is no band observed for the no template control (NTC) sample. (B) Gel electropherogram showing the result of the dilution test. Genomic DNA in the range of 2.6 ng to 5.2 pg (5.2×10 5 − 10 3 genomic copies) was thermocycled for 30 cycles, with thermocycle times of 30 s, on the surface-heated droplet PCR device. The PCR with the lowest DNA content (5.2 pg or approximately 10 3 genomic copies) produced a visible band.

    Techniques Used: Positive Control, Polymerase Chain Reaction, Produced

    18) Product Images from "Yeast histone H3 lysine 4 demethylase Jhd2 regulates mitotic ribosomal DNA condensation"

    Article Title: Yeast histone H3 lysine 4 demethylase Jhd2 regulates mitotic ribosomal DNA condensation

    Journal: BMC Biology

    doi: 10.1186/s12915-014-0075-3

    Changes in RENT component recruitment at NTS regions due to loss of H3 methylases or demethylases. (A) Schematic diagram of an rDNA unit embedded within a tandem array on chromosome XII. The 35S pre-rRNA encoding the 18S, 5.8S and 25S rRNAs is separated by NTS1 and NTS2. The locations of RFB (double triangle), replication origin ARS (oval), 5S rRNA gene (triangle), and 35S transcription start site (bent arrow) are shown. The bars and numbers below the NTS regions indicate the positions of the ChIP PCR products in (B) and (E) and those used in all subsequent ChIP experiments. (B) The association of Net1 and Sir2 with rDNA regions was analyzed by ChIP using immunoglobulin G (IgG)-Sepharose or a Sir2 antibody in WT or the indicated deletion strains carrying TAP-tagged NET1 . The upper bands in each pane indicate PCR products amplified by the primer sets shown in (A) and the lower bands marked by the asterisks are internal controls amplified from untranscribed regions on chromosome V. The bottom panels show PCR products from the input DNA. (C) Quantitation of the ChIP results in (B) . Error bars indicate the SD from three PCRs performed using two independent chromatin preparations, and asterisks indicate statistically significant differences compared with WT (*, P
    Figure Legend Snippet: Changes in RENT component recruitment at NTS regions due to loss of H3 methylases or demethylases. (A) Schematic diagram of an rDNA unit embedded within a tandem array on chromosome XII. The 35S pre-rRNA encoding the 18S, 5.8S and 25S rRNAs is separated by NTS1 and NTS2. The locations of RFB (double triangle), replication origin ARS (oval), 5S rRNA gene (triangle), and 35S transcription start site (bent arrow) are shown. The bars and numbers below the NTS regions indicate the positions of the ChIP PCR products in (B) and (E) and those used in all subsequent ChIP experiments. (B) The association of Net1 and Sir2 with rDNA regions was analyzed by ChIP using immunoglobulin G (IgG)-Sepharose or a Sir2 antibody in WT or the indicated deletion strains carrying TAP-tagged NET1 . The upper bands in each pane indicate PCR products amplified by the primer sets shown in (A) and the lower bands marked by the asterisks are internal controls amplified from untranscribed regions on chromosome V. The bottom panels show PCR products from the input DNA. (C) Quantitation of the ChIP results in (B) . Error bars indicate the SD from three PCRs performed using two independent chromatin preparations, and asterisks indicate statistically significant differences compared with WT (*, P

    Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Amplification, Quantitation Assay

    The demethylase activity of Jhd2 is required for the regulation of rDNA silencing. (A) Schematic diagram of the ADE2 reporter integrated at TEL05R. (B) ADE2 -based telomeric silencing assays were performed for the indicated strains. ADE2-TEL05R strains contain an ADE2 reporter as shown in (A) . (C) Schematic representation of the URA3 reporter integrated at TEL07L. The bars and numbers below the subtelomeric regions indicate the relative positions of the ChIP PCR products in (E) and the distances from telomeric DNA sequences (TG 1–3 ). (D) URA3 -based telomeric silencing assays for the indicated strains. (E) ChIP analyses were performed using antibodies against Sir2 or Rap1 for the indicated strains with a URA3 reporter. Cells grown to an A 600 of 0.1 in synthetic complete (SC) medium were transferred to SC medium containing 0.1% 5-fluoroorotic acid (FOA). Error bars indicate the standard deviation (SD) calculated from PCRs performed using three independent chromatin preparations. Asterisks indicate statistically significant differences determined by pairwise comparisons between wild type (WT) and each of the indicated mutants using a two-tailed Student’s t test (*, P
    Figure Legend Snippet: The demethylase activity of Jhd2 is required for the regulation of rDNA silencing. (A) Schematic diagram of the ADE2 reporter integrated at TEL05R. (B) ADE2 -based telomeric silencing assays were performed for the indicated strains. ADE2-TEL05R strains contain an ADE2 reporter as shown in (A) . (C) Schematic representation of the URA3 reporter integrated at TEL07L. The bars and numbers below the subtelomeric regions indicate the relative positions of the ChIP PCR products in (E) and the distances from telomeric DNA sequences (TG 1–3 ). (D) URA3 -based telomeric silencing assays for the indicated strains. (E) ChIP analyses were performed using antibodies against Sir2 or Rap1 for the indicated strains with a URA3 reporter. Cells grown to an A 600 of 0.1 in synthetic complete (SC) medium were transferred to SC medium containing 0.1% 5-fluoroorotic acid (FOA). Error bars indicate the standard deviation (SD) calculated from PCRs performed using three independent chromatin preparations. Asterisks indicate statistically significant differences determined by pairwise comparisons between wild type (WT) and each of the indicated mutants using a two-tailed Student’s t test (*, P

    Techniques Used: Activity Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Standard Deviation, Two Tailed Test

    19) Product Images from "Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study"

    Article Title: Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study

    Journal: Oncotarget

    doi: 10.18632/oncotarget.21256

    Specificity of the three Droplet Digital PCR (ddPCR) systems used (A) Determination of false-positive cases (mutated MT) detected using the three ddPCR systems described in Figure 3 and a commercial genomic wild-type DNA control provided in the Quantifiler Human DNA Kit (Applied Biosystems, PN4344790F, Foster City, CA, USA). The commercial WT DNA was diluted and tested for L858R substitutions (Ai) , various delEX19 deletions (Aii) and T790M substitutions (Aiii) using three detection assays: Seki's assay, an in house's system and LT's system (see Table 2 ); n indicates the number of independent experiments carried out for each conditions. WT and MT colums indicate the mean of absolute detected copies. The numbers and rates of false-positives (% FP) cases are reported. (B) Background of false-positive copies (%MT) for all of the ddPCR mutation systems used to detect L858R substitutions (Bi) , various delEX19 deletions (Bii) and T790M substitutions (Biii) from cfDNA of NSCLC patients with a negative or unknown biopsy status at diagnosis and with negative results in ddPCR. The absolute copy number was based on the maximum number of MT copies observed in tables Ai-Aiii (5 MT copies) over the minimum WT detection threshold (500 WT copies).
    Figure Legend Snippet: Specificity of the three Droplet Digital PCR (ddPCR) systems used (A) Determination of false-positive cases (mutated MT) detected using the three ddPCR systems described in Figure 3 and a commercial genomic wild-type DNA control provided in the Quantifiler Human DNA Kit (Applied Biosystems, PN4344790F, Foster City, CA, USA). The commercial WT DNA was diluted and tested for L858R substitutions (Ai) , various delEX19 deletions (Aii) and T790M substitutions (Aiii) using three detection assays: Seki's assay, an in house's system and LT's system (see Table 2 ); n indicates the number of independent experiments carried out for each conditions. WT and MT colums indicate the mean of absolute detected copies. The numbers and rates of false-positives (% FP) cases are reported. (B) Background of false-positive copies (%MT) for all of the ddPCR mutation systems used to detect L858R substitutions (Bi) , various delEX19 deletions (Bii) and T790M substitutions (Biii) from cfDNA of NSCLC patients with a negative or unknown biopsy status at diagnosis and with negative results in ddPCR. The absolute copy number was based on the maximum number of MT copies observed in tables Ai-Aiii (5 MT copies) over the minimum WT detection threshold (500 WT copies).

    Techniques Used: Digital PCR, Mutagenesis

    Accuracy of the three Droplet Digital PCR (ddPCR) systems used (A) Top, correlation between the theoretical expected number of wild-type (WT) copies and experimentally measured WT copies of commercial genomic DNA from the Quantifiler Human DNA Quantification Kit (Applied Biosystems, PN4344790F, Foster City, CA, USA) by ddPCR for the detection of (Ai) L858R substitutions, (Aii) delEX19 deletions and (Aiii) T790M substitutions, according to the detection assay used, namely Seki's assay, Life Technologies' (LT's) assay, or our in-house assay. Bottom, tables summarizing statistical data presented above. (B) Top, correlation between the number of WT copies for (Bi) L858R substitutions, (Bii) delEX19 deletions and (Biii) substitutions T790M and the concentration of cfDNA (in ng/μL) measured by Qubit (Life Technologies, Q32854, Carlsbad, CA, USA) in cfDNA samples. Bottom, equation used to estimate the concentration of cfDNA required to detect a threshold level of 1,000 mutated copies, for each plot presented above.
    Figure Legend Snippet: Accuracy of the three Droplet Digital PCR (ddPCR) systems used (A) Top, correlation between the theoretical expected number of wild-type (WT) copies and experimentally measured WT copies of commercial genomic DNA from the Quantifiler Human DNA Quantification Kit (Applied Biosystems, PN4344790F, Foster City, CA, USA) by ddPCR for the detection of (Ai) L858R substitutions, (Aii) delEX19 deletions and (Aiii) T790M substitutions, according to the detection assay used, namely Seki's assay, Life Technologies' (LT's) assay, or our in-house assay. Bottom, tables summarizing statistical data presented above. (B) Top, correlation between the number of WT copies for (Bi) L858R substitutions, (Bii) delEX19 deletions and (Biii) substitutions T790M and the concentration of cfDNA (in ng/μL) measured by Qubit (Life Technologies, Q32854, Carlsbad, CA, USA) in cfDNA samples. Bottom, equation used to estimate the concentration of cfDNA required to detect a threshold level of 1,000 mutated copies, for each plot presented above.

    Techniques Used: Digital PCR, Detection Assay, Concentration Assay

    20) Product Images from "Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia"

    Article Title: Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia

    Journal: Oncogene

    doi: 10.1038/sj.onc.1208307

    Doxycycline (dox) inducible KLF4 transgenic mouse lines. (a) A transgene composed of the keratin 14 ( K14 ) promoter and the reverse tetracycline-responsive transcriptional activator ( rtTA ) directs expression of tetracycline response element (TRE)-linked transgenes to K14 positive cell types. Other elements of the TRE-KLF4 transgene include the minimal cytomegalovirus promoter (PminCMV) and an intron (Int) and polyadenylation signal (poly A) from the SV40 genome. (b) Upper panel: Southern analysis of transgenic mouse lines was performed using a human KLF4 cDNA probe derived from the 3′ UTR. Lower panel: PCR analysis used conserved primers derived from different exons to co-amplify mouse genomic DNA and the human transgene. Control DNAs were mouse genomic DNA alone or else mouse DNA admixed with a molar excess of KLF4 cDNA. (c) RT-PCR analysis of KLF4 in mouse skin. The mouse and human PCR products differ in size by 20bp. Genotypes are indicated on the right. (d) Primary keratinocytes were prepared from K14-rtTA;TRE-KLF4 ). Dox was added to the culture media for the indicated interval, and total RNA was analyzed by Northern. Ethidium bromide-stained RNA was visualized by irradiation of the filter (below).
    Figure Legend Snippet: Doxycycline (dox) inducible KLF4 transgenic mouse lines. (a) A transgene composed of the keratin 14 ( K14 ) promoter and the reverse tetracycline-responsive transcriptional activator ( rtTA ) directs expression of tetracycline response element (TRE)-linked transgenes to K14 positive cell types. Other elements of the TRE-KLF4 transgene include the minimal cytomegalovirus promoter (PminCMV) and an intron (Int) and polyadenylation signal (poly A) from the SV40 genome. (b) Upper panel: Southern analysis of transgenic mouse lines was performed using a human KLF4 cDNA probe derived from the 3′ UTR. Lower panel: PCR analysis used conserved primers derived from different exons to co-amplify mouse genomic DNA and the human transgene. Control DNAs were mouse genomic DNA alone or else mouse DNA admixed with a molar excess of KLF4 cDNA. (c) RT-PCR analysis of KLF4 in mouse skin. The mouse and human PCR products differ in size by 20bp. Genotypes are indicated on the right. (d) Primary keratinocytes were prepared from K14-rtTA;TRE-KLF4 ). Dox was added to the culture media for the indicated interval, and total RNA was analyzed by Northern. Ethidium bromide-stained RNA was visualized by irradiation of the filter (below).

    Techniques Used: Transgenic Assay, Expressing, Derivative Assay, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Northern Blot, Staining, Irradiation

    21) Product Images from "Estrogen regulation of germline stem cell differentiation as a mechanism contributing to female reproductive aging"

    Article Title: Estrogen regulation of germline stem cell differentiation as a mechanism contributing to female reproductive aging

    Journal: Aging (Albany NY)

    doi: 10.18632/aging.103080

    Steroid receptor expression in purified OSCs. ( A , B ) Steroid receptor expression profile in OSCs from young adult (2-month-old) mouse ovaries by RT-PCR ( A ) and western blot analysis ( B ). Expression of β-actin is shown as a control for equality of sample loading; +RT and –RT represent PCR of RNA samples with and without reverse transcription, respectively (the latter used to rule out target gene amplification from potential genomic DNA contamination). Adult ovarian tissue was used as a positive control, as indicated, since all three steroid receptors under investigation (ERα, ERβ, PR) are widely known to be expressed in this tissue. ( C – G ) Flow cytometric analysis of ERα protein expression in extracellular Ddx4-positive OSCs. ( C ) ERα-negative control gate; ( D ) population shift for ERα-positive cells; ( E ) population shift for extracellular Ddx4-positive cells (see panel G for negative control gate); ( F ) extracellular Ddx4/ERα dual-positive cells, as shown in the upper right quadrant; ( G ) extracellular Ddx4-negative control gate. ( H ) Quantification of the percent of OSCs (extracellular Ddx4-expressing cells) dual-positive for ERα expression (93.8 ± 0.5%; mean ± SEM, n = 3 independent sorts).
    Figure Legend Snippet: Steroid receptor expression in purified OSCs. ( A , B ) Steroid receptor expression profile in OSCs from young adult (2-month-old) mouse ovaries by RT-PCR ( A ) and western blot analysis ( B ). Expression of β-actin is shown as a control for equality of sample loading; +RT and –RT represent PCR of RNA samples with and without reverse transcription, respectively (the latter used to rule out target gene amplification from potential genomic DNA contamination). Adult ovarian tissue was used as a positive control, as indicated, since all three steroid receptors under investigation (ERα, ERβ, PR) are widely known to be expressed in this tissue. ( C – G ) Flow cytometric analysis of ERα protein expression in extracellular Ddx4-positive OSCs. ( C ) ERα-negative control gate; ( D ) population shift for ERα-positive cells; ( E ) population shift for extracellular Ddx4-positive cells (see panel G for negative control gate); ( F ) extracellular Ddx4/ERα dual-positive cells, as shown in the upper right quadrant; ( G ) extracellular Ddx4-negative control gate. ( H ) Quantification of the percent of OSCs (extracellular Ddx4-expressing cells) dual-positive for ERα expression (93.8 ± 0.5%; mean ± SEM, n = 3 independent sorts).

    Techniques Used: Expressing, Purification, Reverse Transcription Polymerase Chain Reaction, Western Blot, Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    22) Product Images from "A Robust Approach to Identifying Tissue-Specific Gene Expression Regulatory Variants Using Personalized Human Induced Pluripotent Stem Cells"

    Article Title: A Robust Approach to Identifying Tissue-Specific Gene Expression Regulatory Variants Using Personalized Human Induced Pluripotent Stem Cells

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1000718

    Effect of the gene expression level on ASE. (A) We examined 1,124 genes in PGP1 fibroblast cDNA shared between Illumina's BeadChip Ref-8 V3 and our padlock probe set. To normalize for the probe-specific differences in capture, the cDNA capture reads were divided by the number of reads obtained from the genomic DNA. For those genes that were targeted by padlock probes more than once, we averaged the number of normalized reads from each probe. We generated a plot of the relative gene expression from BeadChip versus the normalized average capture counts, demonstrating only a weak correlation between the level of gene expression and the frequency of padlock capture. (B) We then examined the distribution of the gene expression level detected on BeadChip (green) versus those captured by padlock probes (red). Of the 18,630 genes, approximately 50% did not reach the detection criteria ( p -value
    Figure Legend Snippet: Effect of the gene expression level on ASE. (A) We examined 1,124 genes in PGP1 fibroblast cDNA shared between Illumina's BeadChip Ref-8 V3 and our padlock probe set. To normalize for the probe-specific differences in capture, the cDNA capture reads were divided by the number of reads obtained from the genomic DNA. For those genes that were targeted by padlock probes more than once, we averaged the number of normalized reads from each probe. We generated a plot of the relative gene expression from BeadChip versus the normalized average capture counts, demonstrating only a weak correlation between the level of gene expression and the frequency of padlock capture. (B) We then examined the distribution of the gene expression level detected on BeadChip (green) versus those captured by padlock probes (red). Of the 18,630 genes, approximately 50% did not reach the detection criteria ( p -value

    Techniques Used: Expressing, Generated

    Normalized tissue-specific variations in ASE. The 186 expression SNPs were then normalized to reduce both genotyping and probe-specific biases. First, direct allelic ratios from the cDNA were normalized by those from the genomic DNA. Second, we calculated the mean ASE ratio across all samples derived from each individual and used the distance from the mean for hierarchical clustering. The normalized ASE predicted the sample relationship and the tissue-specificity with high accuracy, confirming the presence of tissue-specific regulatory expression variants.
    Figure Legend Snippet: Normalized tissue-specific variations in ASE. The 186 expression SNPs were then normalized to reduce both genotyping and probe-specific biases. First, direct allelic ratios from the cDNA were normalized by those from the genomic DNA. Second, we calculated the mean ASE ratio across all samples derived from each individual and used the distance from the mean for hierarchical clustering. The normalized ASE predicted the sample relationship and the tissue-specificity with high accuracy, confirming the presence of tissue-specific regulatory expression variants.

    Techniques Used: Expressing, Derivative Assay

    23) Product Images from "Subtype-associated differences in HIV-1 reverse transcription affect the viral replication"

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication

    Journal: Retrovirology

    doi: 10.1186/1742-4690-7-85

    The presence of RT functional domains from HIV-1 subtype C leads to decreased cDNA accumulation . A - Endogenous reverse transcription (ERT) in permeabilized virions. Purified and p24 CA -normalized virus particles of either the backbone NL4-3 or NL-based chimeric viruses were subjected to ERT with addition of dNTPs and permeabilizing agent melittin. Samples without dNTPs were used as a control. DNA was harvested after the indicated time of incubation. The relative amounts of negative-strand strong-stop DNA were measured using quantitative real-time PCR. Data from the control samples were subtracted. Levels of cDNA are shown as percentages of the peak accumulation detected in virions of NL4-3 at 5 h after initiation of incubation. Error bars show the standard deviation from three independent viral preparations. B - Accumulation of early or strong-stop viral DNA in Sup-T1 cells at 24 h p.i. Untreated or treated with 10 μM nevirapine cells were infected with backbone NL4-3 or the chimeric viruses, containing pol fragments from subtype C 1084i isolate using spinoculation. Relative amounts of reverse transcription products were measured using quantitative real-time PCR analysis of DNA from infected cells after incubation with or without 10 μM nevirapine. Data from nevirapine-treated samples were subtracted. Levels of cDNA are shown as percentages of the maximal accumulation detected for cDNA in cells infected with NL4-3 virus strain. Error bars show the standard deviation from three independent viral preparations. C - Accumulation of early and late reverse transcription products in Sup-T1 cells infected with recombinant viruses carrying protease and RT polymerase domain from 1084i, 2669i, and 1984i isolates of subtype C at 24 h p.i. The cells were infected with the indicated viruses as described in B. Harvested DNA was measured using quantitative real-time PCR analysis. Levels of cDNA are shown as percentages of the maximal accumulation detected for negative strand strong-stop cDNA in cells infected with NL4-3. Error bars indicate the standard deviation from three independent viral preparations.
    Figure Legend Snippet: The presence of RT functional domains from HIV-1 subtype C leads to decreased cDNA accumulation . A - Endogenous reverse transcription (ERT) in permeabilized virions. Purified and p24 CA -normalized virus particles of either the backbone NL4-3 or NL-based chimeric viruses were subjected to ERT with addition of dNTPs and permeabilizing agent melittin. Samples without dNTPs were used as a control. DNA was harvested after the indicated time of incubation. The relative amounts of negative-strand strong-stop DNA were measured using quantitative real-time PCR. Data from the control samples were subtracted. Levels of cDNA are shown as percentages of the peak accumulation detected in virions of NL4-3 at 5 h after initiation of incubation. Error bars show the standard deviation from three independent viral preparations. B - Accumulation of early or strong-stop viral DNA in Sup-T1 cells at 24 h p.i. Untreated or treated with 10 μM nevirapine cells were infected with backbone NL4-3 or the chimeric viruses, containing pol fragments from subtype C 1084i isolate using spinoculation. Relative amounts of reverse transcription products were measured using quantitative real-time PCR analysis of DNA from infected cells after incubation with or without 10 μM nevirapine. Data from nevirapine-treated samples were subtracted. Levels of cDNA are shown as percentages of the maximal accumulation detected for cDNA in cells infected with NL4-3 virus strain. Error bars show the standard deviation from three independent viral preparations. C - Accumulation of early and late reverse transcription products in Sup-T1 cells infected with recombinant viruses carrying protease and RT polymerase domain from 1084i, 2669i, and 1984i isolates of subtype C at 24 h p.i. The cells were infected with the indicated viruses as described in B. Harvested DNA was measured using quantitative real-time PCR analysis. Levels of cDNA are shown as percentages of the maximal accumulation detected for negative strand strong-stop cDNA in cells infected with NL4-3. Error bars indicate the standard deviation from three independent viral preparations.

    Techniques Used: Functional Assay, Purification, Incubation, Real-time Polymerase Chain Reaction, Standard Deviation, Infection, Recombinant

    Presence of RT functional domains from HIV-1 subtype C isolates correlates with decreased level of viral DNA integration . A - Integration of cDNA of NL4-3 or NL-based viruses carrying protease and RT polymerase domains from subtype C isolates in Sup-T1 cell DNA at 24 h p.i. Cells were infected as described in the legend to Figure 5B. Total DNA was harvested and relative amounts of proviral DNA were measured using two-step Alu -based nested PCR assays as described in Materials and methods. Levels of provirus are shown as percentages of the maximum levels of integration detected in cells infected with NL4-3. Error bars show the standard deviation of three independent viral preparations. B -Integration of the backbone NL4-3 and chimeric viruses in Sup-T1 cells at 24 and 48 h p.i. DNA from the infected cells was harvested and subjected to quantitative real-time PCR as described in A. Levels of proviral DNA are shown as percentage of those detected in cells infected with NL4-3 at 48 h p.i. Results are mean ± SD of three independent experiments.
    Figure Legend Snippet: Presence of RT functional domains from HIV-1 subtype C isolates correlates with decreased level of viral DNA integration . A - Integration of cDNA of NL4-3 or NL-based viruses carrying protease and RT polymerase domains from subtype C isolates in Sup-T1 cell DNA at 24 h p.i. Cells were infected as described in the legend to Figure 5B. Total DNA was harvested and relative amounts of proviral DNA were measured using two-step Alu -based nested PCR assays as described in Materials and methods. Levels of provirus are shown as percentages of the maximum levels of integration detected in cells infected with NL4-3. Error bars show the standard deviation of three independent viral preparations. B -Integration of the backbone NL4-3 and chimeric viruses in Sup-T1 cells at 24 and 48 h p.i. DNA from the infected cells was harvested and subjected to quantitative real-time PCR as described in A. Levels of proviral DNA are shown as percentage of those detected in cells infected with NL4-3 at 48 h p.i. Results are mean ± SD of three independent experiments.

    Techniques Used: Functional Assay, Infection, Nested PCR, Standard Deviation, Real-time Polymerase Chain Reaction

    Generation of recombinant HIV-1 proviral clones comprising fragments of pol gene from subtype B and C isolates . Schematic presentation of the pol gene region of subtype B backbone NL4-3 (panel A) and subtype C backbone1084i (B) viruses, recombinant NL-based viruses (C-E and G), and recombinant 1084i-based construct (F). The indicated fragments of the gag-pol or pol genes from subtype B (isolates NL4-3 and YU-2) or subtype C (isolates 1084i, 1984i and 2669i) proviral DNA were PCR-amplified with primers containing sites of the indicated restriction endonucleases, and inserted into the linearized NL4-3 or HIV1084i proviral vectors to replace the homologous fragments. Selected molecular clones were used for transfection of 293T/17 cells to generate infectious recombinant virus strains.
    Figure Legend Snippet: Generation of recombinant HIV-1 proviral clones comprising fragments of pol gene from subtype B and C isolates . Schematic presentation of the pol gene region of subtype B backbone NL4-3 (panel A) and subtype C backbone1084i (B) viruses, recombinant NL-based viruses (C-E and G), and recombinant 1084i-based construct (F). The indicated fragments of the gag-pol or pol genes from subtype B (isolates NL4-3 and YU-2) or subtype C (isolates 1084i, 1984i and 2669i) proviral DNA were PCR-amplified with primers containing sites of the indicated restriction endonucleases, and inserted into the linearized NL4-3 or HIV1084i proviral vectors to replace the homologous fragments. Selected molecular clones were used for transfection of 293T/17 cells to generate infectious recombinant virus strains.

    Techniques Used: Recombinant, Clone Assay, Construct, Polymerase Chain Reaction, Amplification, Transfection

    Recombinant viruses containing the Gag and Pol domains from HIV-1 subtypes B and C do not have differences in RNA incorporation and GagPol processing . A - Quantitation of viral genomic RNA in virus particles. Virus particles were purified from the culture media of 293T/17 cells transfected with molecular clones of viruses at 48 h post-transfection, treated with DNase I RNase free for 2 h and concentrated by centrifugation through 30% sucrose. RNA was isolated from p24 CA -normalized virus particles, subjected to the reverse transcription with oligo-dT primer and then to quantitative real-time PCR with the primer set specific for positive-strand HIV-1 DNA. The data of analysis of three independent viral preparations were quantified. Each point represents mean RNA copy number ± SD per 1 ng of p24 CA in virus sample. B - Processing of Pr160 GagPol polyprotein-precursor in the virus particles. The virus particles harvested from culture media of transfected 293T/17 cells and purified as in A were analyzed by Western blotting using the antibodies indicated in Materials and Methods. C - Quantification of Western blotting results. Western blotting data from two independent experiments were quantified using ImageJ software. Results show mean grey values of the bands ± SE and are presented as percentage of p24 CA in each virus sample.
    Figure Legend Snippet: Recombinant viruses containing the Gag and Pol domains from HIV-1 subtypes B and C do not have differences in RNA incorporation and GagPol processing . A - Quantitation of viral genomic RNA in virus particles. Virus particles were purified from the culture media of 293T/17 cells transfected with molecular clones of viruses at 48 h post-transfection, treated with DNase I RNase free for 2 h and concentrated by centrifugation through 30% sucrose. RNA was isolated from p24 CA -normalized virus particles, subjected to the reverse transcription with oligo-dT primer and then to quantitative real-time PCR with the primer set specific for positive-strand HIV-1 DNA. The data of analysis of three independent viral preparations were quantified. Each point represents mean RNA copy number ± SD per 1 ng of p24 CA in virus sample. B - Processing of Pr160 GagPol polyprotein-precursor in the virus particles. The virus particles harvested from culture media of transfected 293T/17 cells and purified as in A were analyzed by Western blotting using the antibodies indicated in Materials and Methods. C - Quantification of Western blotting results. Western blotting data from two independent experiments were quantified using ImageJ software. Results show mean grey values of the bands ± SE and are presented as percentage of p24 CA in each virus sample.

    Techniques Used: Recombinant, Quantitation Assay, Purification, Transfection, Clone Assay, Centrifugation, Isolation, Real-time Polymerase Chain Reaction, Western Blot, Software

    The presence of RT polymerase domain from HIV-1 subtype C leads to decreased cDNA accumulation in reverse transcription complexes . Accumulation of strong-stop (A and C) and positive-strand (B and D) viral DNA in RTCs isolated at 1 and 5 h p.i. Sup-T1 cells were synchronously infected with MLV Env-pseudotyped backbone NL4-3 or chimeric NLpolL(1084) (A and B), and backbone HIV1084i or chimeric 1084polL(NL) viruses (C and D). RTCs were purified from cell lysates. DNA was isolated from RTCs and subjected to quantitative real-time PCR. Levels of cDNA are shown as percentages of the maximal accumulation detected for strong-stop cDNA in RTCs. Error bars show the standard deviation from three independent viral preparations.
    Figure Legend Snippet: The presence of RT polymerase domain from HIV-1 subtype C leads to decreased cDNA accumulation in reverse transcription complexes . Accumulation of strong-stop (A and C) and positive-strand (B and D) viral DNA in RTCs isolated at 1 and 5 h p.i. Sup-T1 cells were synchronously infected with MLV Env-pseudotyped backbone NL4-3 or chimeric NLpolL(1084) (A and B), and backbone HIV1084i or chimeric 1084polL(NL) viruses (C and D). RTCs were purified from cell lysates. DNA was isolated from RTCs and subjected to quantitative real-time PCR. Levels of cDNA are shown as percentages of the maximal accumulation detected for strong-stop cDNA in RTCs. Error bars show the standard deviation from three independent viral preparations.

    Techniques Used: Isolation, Infection, Purification, Real-time Polymerase Chain Reaction, Standard Deviation

    24) Product Images from "C57BL/6N Albino/Agouti Mutant Mice as Embryo Donors for Efficient Germline Transmission of C57BL/6 ES Cells"

    Article Title: C57BL/6N Albino/Agouti Mutant Mice as Embryo Donors for Efficient Germline Transmission of C57BL/6 ES Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0090570

    Restoration of the agouti locus in C57BL/6NTac ES cells and mice. (A) Gene targeting strategy. The Neomycin (NeoR)/Puromycin (PuroR) selection marker is displayed as a grey box (neoR and puroR). Numbered dashes indicate external probes used for Southern Blot analysis of ES cell clones, lettered arrows indicate oligos used for genotyping of mice. Deletion of the FRT flanked selection was obtained in vivo simultaneously with germline transmission. ( B ) Southern Blot validation with genomic DNA isolated from 6 ES cell clones and wildtype C57BL/6 genomic DNA as a control (W) using external probe 1 in combination with BglI restriction digest (upper panel, Probe 1, B) leading to a wildtype allele of 13,9 kb (Wt) and a targeted allele of 9,3 kb (tm) and confirmatory Southern Blot validation with external probe 2 in combination with PspOMI restriction digest (lower panel, Probe 2, P), leading to a wildtype allele of 16,2 kb (Wt) and a targeted allele of 14,8 kb (tm). ( C ) PCR verification. Clone B-B10 was selected for chimera generation and germline transmission. Primer combinations a + b (upper panel) resulted in amplification of a 290 bp wildtype A allele in BALB/c control mice (lane 1, BALB/c) and a 387 bp restored A tm1.1 allele in homozygous Albino A++ mice (lane 3,A++) and in chimeras generated with C57BL/6 ES cells injected in homozyogus A++ host embryos (lane 4, A++/B6 Ch). Primer combinations c + b (lower panel) amplified a 280 bp C57BL/6 wildtype a allele in C57BL/6 control mice (lane 2, C57BL/6) and in A++/B6 Ch (lane 4, A++/B6 Ch). Note: PCR amplicons are of different size for the BALB/c A and the A++ restored A tm1.1 alleles. Also, in contrast to homozygous A++ mice, A++/B6 Ch amplify both, the ES cell derived a and the A++ derived A tm1.1 alleles.
    Figure Legend Snippet: Restoration of the agouti locus in C57BL/6NTac ES cells and mice. (A) Gene targeting strategy. The Neomycin (NeoR)/Puromycin (PuroR) selection marker is displayed as a grey box (neoR and puroR). Numbered dashes indicate external probes used for Southern Blot analysis of ES cell clones, lettered arrows indicate oligos used for genotyping of mice. Deletion of the FRT flanked selection was obtained in vivo simultaneously with germline transmission. ( B ) Southern Blot validation with genomic DNA isolated from 6 ES cell clones and wildtype C57BL/6 genomic DNA as a control (W) using external probe 1 in combination with BglI restriction digest (upper panel, Probe 1, B) leading to a wildtype allele of 13,9 kb (Wt) and a targeted allele of 9,3 kb (tm) and confirmatory Southern Blot validation with external probe 2 in combination with PspOMI restriction digest (lower panel, Probe 2, P), leading to a wildtype allele of 16,2 kb (Wt) and a targeted allele of 14,8 kb (tm). ( C ) PCR verification. Clone B-B10 was selected for chimera generation and germline transmission. Primer combinations a + b (upper panel) resulted in amplification of a 290 bp wildtype A allele in BALB/c control mice (lane 1, BALB/c) and a 387 bp restored A tm1.1 allele in homozygous Albino A++ mice (lane 3,A++) and in chimeras generated with C57BL/6 ES cells injected in homozyogus A++ host embryos (lane 4, A++/B6 Ch). Primer combinations c + b (lower panel) amplified a 280 bp C57BL/6 wildtype a allele in C57BL/6 control mice (lane 2, C57BL/6) and in A++/B6 Ch (lane 4, A++/B6 Ch). Note: PCR amplicons are of different size for the BALB/c A and the A++ restored A tm1.1 alleles. Also, in contrast to homozygous A++ mice, A++/B6 Ch amplify both, the ES cell derived a and the A++ derived A tm1.1 alleles.

    Techniques Used: Mouse Assay, Selection, Marker, Southern Blot, Clone Assay, In Vivo, Transmission Assay, Isolation, Polymerase Chain Reaction, Amplification, Generated, Injection, Derivative Assay

    Inactivation of the tyrosinase locus in C57BL/6NTac ES cells and mice. (A) Gene targeting scheme for the tyrosinase locus. A point mutation was introduced in exon 1 (C103S) of the tyrosinase allele. The Puromycin selection marker (PuroR) is shown as a grey box. Numbered dashes indicate external probes used for Southern Blot analysis of ES cell clones, lettered arrows indicate oligos used for genotyping of mice. Deletion of the F3 flanked selection marker was achieved in vitro in targeted ES cell clone A-B6. ( B ) Southern Blot validation with genomic DNA isolated from 6 ES cell clones and wildtype C57BL/6 genomic DNA as a control (W) using external probe 1 in combination with EcoRI restriction digest (upper panel, Probe 1, E) leading to a wildtype allele of 4,8 kb (Wt) and a targeted allele of 7,7 kb (tm) and confirmatory Southern Blot validation with external probe 2 in combination with BglI restriction digest (lower panel, Probe 2, B), leading to a wildtype allele of 12,7 kb (Wt) and a targeted allele of 17,7 kb (tm). ( C ) PCR verification. Clone A-B6 was selected for chimera generation and germline transmission. Primer combinations f + g (upper panel) applied on genomic DNA displayed a 151 bp wildtype Tyr allele in BALB/c control mice (lane 1, Balb/c), C57BL/6 control mice (lane 2, C57BL/6) and in chimeras generated with C57BL/6 ES cells injected in homozyogus A++ host embryos (lane 4, A++/B6 Ch). In addition the modified Tyr tm1 Arte allele was detected in homozygous Albino A++ mice (lane 3, A++) and in chimeras generated with C57BL/6 ES cells injected in homozyogus A++ host embryos (lane 4, A++/B6 Ch). Lower panel: the introduced point mutation was verified by sequencing both strands of the PCR fragment amplified with primers d + e.
    Figure Legend Snippet: Inactivation of the tyrosinase locus in C57BL/6NTac ES cells and mice. (A) Gene targeting scheme for the tyrosinase locus. A point mutation was introduced in exon 1 (C103S) of the tyrosinase allele. The Puromycin selection marker (PuroR) is shown as a grey box. Numbered dashes indicate external probes used for Southern Blot analysis of ES cell clones, lettered arrows indicate oligos used for genotyping of mice. Deletion of the F3 flanked selection marker was achieved in vitro in targeted ES cell clone A-B6. ( B ) Southern Blot validation with genomic DNA isolated from 6 ES cell clones and wildtype C57BL/6 genomic DNA as a control (W) using external probe 1 in combination with EcoRI restriction digest (upper panel, Probe 1, E) leading to a wildtype allele of 4,8 kb (Wt) and a targeted allele of 7,7 kb (tm) and confirmatory Southern Blot validation with external probe 2 in combination with BglI restriction digest (lower panel, Probe 2, B), leading to a wildtype allele of 12,7 kb (Wt) and a targeted allele of 17,7 kb (tm). ( C ) PCR verification. Clone A-B6 was selected for chimera generation and germline transmission. Primer combinations f + g (upper panel) applied on genomic DNA displayed a 151 bp wildtype Tyr allele in BALB/c control mice (lane 1, Balb/c), C57BL/6 control mice (lane 2, C57BL/6) and in chimeras generated with C57BL/6 ES cells injected in homozyogus A++ host embryos (lane 4, A++/B6 Ch). In addition the modified Tyr tm1 Arte allele was detected in homozygous Albino A++ mice (lane 3, A++) and in chimeras generated with C57BL/6 ES cells injected in homozyogus A++ host embryos (lane 4, A++/B6 Ch). Lower panel: the introduced point mutation was verified by sequencing both strands of the PCR fragment amplified with primers d + e.

    Techniques Used: Mouse Assay, Mutagenesis, Selection, Marker, Southern Blot, Clone Assay, In Vitro, Isolation, Polymerase Chain Reaction, Transmission Assay, Generated, Injection, Modification, Sequencing, Amplification

    25) Product Images from "The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius"

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.00137

    Analysis of the DNA methylome of S. acidocaldarius DSM639 using SMRT sequencing
    Figure Legend Snippet: Analysis of the DNA methylome of S. acidocaldarius DSM639 using SMRT sequencing

    Techniques Used: Sequencing

    Adenine DNA methylation profiles during the cell cycle of S. acidocaldarius DSM639
    Figure Legend Snippet: Adenine DNA methylation profiles during the cell cycle of S. acidocaldarius DSM639

    Techniques Used: DNA Methylation Assay

    Identification of methylated recognition sequences in S. acidocaldarius genomic DNA by digestion assays. Restriction enzymes BsuRI (A) and BamHI, DpnI, and MboI (B) were used to highlight the presence/absence of methylated 5′-GGCC-3′ and 5′-GATC-3′ palindromes, respectively, in genomic DNA of S. acidocaldarius . Two types of substrates were digested: genomic DNA (gDNA) and a whole genome amplification of the genomic DNA (WGA). WGA is identical to gDNA in terms of nucleic sequence but it does not contain epigenetic marks (see material and methods). This negative control is only used in (A) . The addition of different restriction enzymes is symbolized by a positive sign “+” while reaction mix without restriction enzyme is represented by a negative sign “–”. Molecular size markers (GeneRuler DNA Ladder, Thermo Scientific) were loaded in both gels (M). Digestion patterns were obtained in 0.8% agarose gel stained with ethidium bromide and visualized under UV light.
    Figure Legend Snippet: Identification of methylated recognition sequences in S. acidocaldarius genomic DNA by digestion assays. Restriction enzymes BsuRI (A) and BamHI, DpnI, and MboI (B) were used to highlight the presence/absence of methylated 5′-GGCC-3′ and 5′-GATC-3′ palindromes, respectively, in genomic DNA of S. acidocaldarius . Two types of substrates were digested: genomic DNA (gDNA) and a whole genome amplification of the genomic DNA (WGA). WGA is identical to gDNA in terms of nucleic sequence but it does not contain epigenetic marks (see material and methods). This negative control is only used in (A) . The addition of different restriction enzymes is symbolized by a positive sign “+” while reaction mix without restriction enzyme is represented by a negative sign “–”. Molecular size markers (GeneRuler DNA Ladder, Thermo Scientific) were loaded in both gels (M). Digestion patterns were obtained in 0.8% agarose gel stained with ethidium bromide and visualized under UV light.

    Techniques Used: Methylation, Whole Genome Amplification, Sequencing, Negative Control, Agarose Gel Electrophoresis, Staining

    26) Product Images from "The Pseudomonas aeruginosa ExoY phenotype of high-copy-number recombinants is not detectable in natural isolates"

    Article Title: The Pseudomonas aeruginosa ExoY phenotype of high-copy-number recombinants is not detectable in natural isolates

    Journal: Open Biology

    doi: 10.1098/rsob.170250

    Copy number of exoY in P. aeruginosa B420, PT22 and the recombinant PA103 ExoY and K81M. Copy number of exoY (PA2191, PAO1 genome coordinates 2410344–2411480) was determined from three independent preparations of genomic DNA by real-time PCR and normalized to the signals of the first DNA preparation of strain PT22 and of the adjacent hcnB gene (PA2194, coordinates 2412857–2414251). For better discrimination of low and high copy numbers of exoY in natural and genetically engineered strains y -axis was interrupted.
    Figure Legend Snippet: Copy number of exoY in P. aeruginosa B420, PT22 and the recombinant PA103 ExoY and K81M. Copy number of exoY (PA2191, PAO1 genome coordinates 2410344–2411480) was determined from three independent preparations of genomic DNA by real-time PCR and normalized to the signals of the first DNA preparation of strain PT22 and of the adjacent hcnB gene (PA2194, coordinates 2412857–2414251). For better discrimination of low and high copy numbers of exoY in natural and genetically engineered strains y -axis was interrupted.

    Techniques Used: Recombinant, Real-time Polymerase Chain Reaction

    27) Product Images from "Arabidopsis PARG1 is the key factor promoting cell survival among the enzymes regulating post-translational poly(ADP-ribosyl)ation"

    Article Title: Arabidopsis PARG1 is the key factor promoting cell survival among the enzymes regulating post-translational poly(ADP-ribosyl)ation

    Journal: Scientific Reports

    doi: 10.1038/srep15892

    DNA damage level is higher in the parg1-4 mutant than that in Col-0 plants under genotoxic stress. ( A ) Expression level changes of genes involved in DNA double-strand break repair in roots of Col-0 and parg1-4 seedlings. The data represent the mean values of three replicates ± SD. ( C ) control; ( B ) bleomycin at 20 μg ml −1 . ( B ) Comet assay of the DNA damage levels of Col-0 and parg1-4 seedlings grown on plates with or without (control) 20 μg ml −1 bleomycin for 10 days. The percentage of DNA in comet tails was analyzed and quantified by CASP software ( http://sourceforge.net/projects/casp/ ) and used as an indicator of DNA damage level. 100 nuclei for each treatment were randomly selected and imaged. The bar size represents proportion of nuclei falling into the ranges of damage level indicated by different colors, and the images with percentages beside it indicate the examples of damaged nuclei. ( C ) DNA fragmentation assay showed that genomic DNA is more damaged in parg1-4 than in Col-0.
    Figure Legend Snippet: DNA damage level is higher in the parg1-4 mutant than that in Col-0 plants under genotoxic stress. ( A ) Expression level changes of genes involved in DNA double-strand break repair in roots of Col-0 and parg1-4 seedlings. The data represent the mean values of three replicates ± SD. ( C ) control; ( B ) bleomycin at 20 μg ml −1 . ( B ) Comet assay of the DNA damage levels of Col-0 and parg1-4 seedlings grown on plates with or without (control) 20 μg ml −1 bleomycin for 10 days. The percentage of DNA in comet tails was analyzed and quantified by CASP software ( http://sourceforge.net/projects/casp/ ) and used as an indicator of DNA damage level. 100 nuclei for each treatment were randomly selected and imaged. The bar size represents proportion of nuclei falling into the ranges of damage level indicated by different colors, and the images with percentages beside it indicate the examples of damaged nuclei. ( C ) DNA fragmentation assay showed that genomic DNA is more damaged in parg1-4 than in Col-0.

    Techniques Used: Mutagenesis, Expressing, Single Cell Gel Electrophoresis, Software, DNA Fragmentation Assay

    28) Product Images from "Proline utilization system is required for infection by the pathogenic α-proteobacterium Brucella abortus"

    Article Title: Proline utilization system is required for infection by the pathogenic α-proteobacterium Brucella abortus

    Journal: Microbiology

    doi: 10.1099/mic.0.000490

    PutR binds directly to the intergenic region between putR and putA . An electrophoretic mobility shift assay (EMSA) was used to assess the binding of a purified recombinant version of PutR (rPutR) to the putR–putA intergenic region. A 336 bp DNA probe corresponding to the putR–putA intergenic region and part of each coding region was amplified by PCR, and the fragment was radiolabelled with [γ- 32 P]ATP. Increasing nanomolar concentrations of rPutR were incubated with the radiolabelled DNA, and in some binding reactions, unlabelled specific ( putR–putA intergenic-region DNA) and non-specific ( abcR2 promoter-region DNA) competitor DNA fragments were included as controls. The binding reactions were resolved in 6 % native polyacrylamide gels and visualized by autoradiography.
    Figure Legend Snippet: PutR binds directly to the intergenic region between putR and putA . An electrophoretic mobility shift assay (EMSA) was used to assess the binding of a purified recombinant version of PutR (rPutR) to the putR–putA intergenic region. A 336 bp DNA probe corresponding to the putR–putA intergenic region and part of each coding region was amplified by PCR, and the fragment was radiolabelled with [γ- 32 P]ATP. Increasing nanomolar concentrations of rPutR were incubated with the radiolabelled DNA, and in some binding reactions, unlabelled specific ( putR–putA intergenic-region DNA) and non-specific ( abcR2 promoter-region DNA) competitor DNA fragments were included as controls. The binding reactions were resolved in 6 % native polyacrylamide gels and visualized by autoradiography.

    Techniques Used: Electrophoretic Mobility Shift Assay, Binding Assay, Purification, Recombinant, Amplification, Polymerase Chain Reaction, Incubation, Autoradiography

    29) Product Images from "Characterization of Immunostimulatory CpG-Rich Sequences from Different Bifidobacterium Species ▿"

    Article Title: Characterization of Immunostimulatory CpG-Rich Sequences from Different Bifidobacterium Species ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.01714-09

    (A) Secretion of cytokines and chemokines by RAW 264.7 macrophages after 12 h of stimulation with 10 μg/ml CpG-rich PCR products (H2, H3, N2, and N3), 250 ng/ml DNA from B. longum NCC2705, B. longum subsp. infantis ATCC 15697, and B. adolescentis
    Figure Legend Snippet: (A) Secretion of cytokines and chemokines by RAW 264.7 macrophages after 12 h of stimulation with 10 μg/ml CpG-rich PCR products (H2, H3, N2, and N3), 250 ng/ml DNA from B. longum NCC2705, B. longum subsp. infantis ATCC 15697, and B. adolescentis

    Techniques Used: Polymerase Chain Reaction

    30) Product Images from "Identification of two small regulatory RNAs linked to virulence in Brucella abortus 2308"

    Article Title: Identification of two small regulatory RNAs linked to virulence in Brucella abortus 2308

    Journal: Molecular Microbiology

    doi: 10.1111/j.1365-2958.2012.08117.x

    AbcR1 and AbcR2 perform redundant regulatory functions The 5′-untranslated regions and the first 10 codons of BAB1_0314, BAB2_0879, or BAB2_0612 were cloned in-framed with gfp into a low-copy plasmid, and abcR1 , abcR2 , or a DNA fragment encoding a nonsense sRNA (the abcR2 gene in reverse) were cloned into a high-copy plasmid (see Experimental procedures). E. coli strains carrying only a gfp fusion construct, or carrying both a gfp fusion construct and a sRNA-encoding construct, were grown in LB broth, and immunoblot analyses were performed on total protein lysates to detect levels of GFP or GroEL.
    Figure Legend Snippet: AbcR1 and AbcR2 perform redundant regulatory functions The 5′-untranslated regions and the first 10 codons of BAB1_0314, BAB2_0879, or BAB2_0612 were cloned in-framed with gfp into a low-copy plasmid, and abcR1 , abcR2 , or a DNA fragment encoding a nonsense sRNA (the abcR2 gene in reverse) were cloned into a high-copy plasmid (see Experimental procedures). E. coli strains carrying only a gfp fusion construct, or carrying both a gfp fusion construct and a sRNA-encoding construct, were grown in LB broth, and immunoblot analyses were performed on total protein lysates to detect levels of GFP or GroEL.

    Techniques Used: Clone Assay, Plasmid Preparation, Construct

    31) Product Images from "Molecular genetic diagnostic techniques in choroideremia"

    Article Title: Molecular genetic diagnostic techniques in choroideremia

    Journal: Molecular Vision

    doi:

    QiaXcel capillary electrophoresis (QIAxcel DNA Screening Kit, Qiagen) demonstrates the PCR products obtained using all the CHM genomic primers under the same conditions, increasing the efficiency of this analytic tool. The sample analysed is from a choroideremia patient with no detectable mutation in the exon sequences.
    Figure Legend Snippet: QiaXcel capillary electrophoresis (QIAxcel DNA Screening Kit, Qiagen) demonstrates the PCR products obtained using all the CHM genomic primers under the same conditions, increasing the efficiency of this analytic tool. The sample analysed is from a choroideremia patient with no detectable mutation in the exon sequences.

    Techniques Used: Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    The RT-PCR result with primers specific to the coding region of the CHM mRNA showing a 2.2 kb amplicon. Size marker (“M”): GeneRuler 1kb+ DNA Ladder (Thermo Fisher Scientific, Waltham, MA), water control (“N”), RNA used from healthy male control subject (“C”). This demonstrates the ability to detect the presence of CHM RNA when it is expected to be present by creating and amplifying cDNA.
    Figure Legend Snippet: The RT-PCR result with primers specific to the coding region of the CHM mRNA showing a 2.2 kb amplicon. Size marker (“M”): GeneRuler 1kb+ DNA Ladder (Thermo Fisher Scientific, Waltham, MA), water control (“N”), RNA used from healthy male control subject (“C”). This demonstrates the ability to detect the presence of CHM RNA when it is expected to be present by creating and amplifying cDNA.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Marker

    32) Product Images from "A Genome-Wide Analysis of Genetic Diversity in Trypanosoma cruzi Intergenic Regions"

    Article Title: A Genome-Wide Analysis of Genetic Diversity in Trypanosoma cruzi Intergenic Regions

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0002839

    PCR amplification of selected IGR regions in different strains of T. cruzi . Selected genomic regions were amplified to validate length and sequence polymorphisms, and resolved in a 2% TBE-agarose gel. Lanes in the gels correspond to: molecular size markers (lanes 1, 23), DNA from T. cruzi strains (lanes 2–21), and negative control (lane 22). Strains used (and the corresponding lanes) are: 92122102R (2); Dog Theis (3); CanIII (4); TU18 (5); Mas1 cl1 (6); IVV cl4 (7); Y9 IIB (8); X109-02 (9); M5631 cl5 (10); M6241 cl6 (11); LL051 (12); Mn cl2 (13); Sc43 cl9 (14); TEH53 (15); Tula cl2 (16); CL Brener (17); P63 cl1 (18); Sylvio X10/1 (19); Palv2 (20); Dm28c (21). Numbers in the leftmost column (1–6) correspond to the six selected cases mentioned in the text. All samples were analyzed in the same electrophoresis run, however for clarity purposes, groups of lanes were digitally re-ordered.
    Figure Legend Snippet: PCR amplification of selected IGR regions in different strains of T. cruzi . Selected genomic regions were amplified to validate length and sequence polymorphisms, and resolved in a 2% TBE-agarose gel. Lanes in the gels correspond to: molecular size markers (lanes 1, 23), DNA from T. cruzi strains (lanes 2–21), and negative control (lane 22). Strains used (and the corresponding lanes) are: 92122102R (2); Dog Theis (3); CanIII (4); TU18 (5); Mas1 cl1 (6); IVV cl4 (7); Y9 IIB (8); X109-02 (9); M5631 cl5 (10); M6241 cl6 (11); LL051 (12); Mn cl2 (13); Sc43 cl9 (14); TEH53 (15); Tula cl2 (16); CL Brener (17); P63 cl1 (18); Sylvio X10/1 (19); Palv2 (20); Dm28c (21). Numbers in the leftmost column (1–6) correspond to the six selected cases mentioned in the text. All samples were analyzed in the same electrophoresis run, however for clarity purposes, groups of lanes were digitally re-ordered.

    Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Agarose Gel Electrophoresis, Negative Control, Electrophoresis

    33) Product Images from "Glycine decarboxylase deficiency causes neural tube defects and features of non-ketotic hyperglycinemia in mice"

    Article Title: Glycine decarboxylase deficiency causes neural tube defects and features of non-ketotic hyperglycinemia in mice

    Journal: Nature Communications

    doi: 10.1038/ncomms7388

    Gene trap of Gldc ablates GCS activity. The GCS, comprising GLDC, GCSH, AMT and DLD (dihydrolipoamide dehydrogenase), functions in mitochondrial folate metabolism ( a ) to cleave glycine, donating a one-carbon unit to THF. The Gldc GT1 allele ( b ) carries a gene-trap construct in intron 2. Splicing of exon2 to the gene-trap splice acceptor, SA, generates a truncated mRNA. The primers used for genotyping by PCR of genomic DNA are indicated ( b ). F1 and R3 generate a band in wild-type and heterozygous mice that is not detectable in homozygous Gldc GT1/GT1 mice ( c ). No PCR product is generated in +/+ samples when one or both primers are located within the trap construct (F2.R1 or F3.R2; full image of gel is included in Supplementary Information ). ( d ) Quantitative real time RT–PCR analysis of liver and brain samples at 5 weeks of age. ( e ) Enzymatic activity of the GCS in liver (* indicates significant difference from Gldc +/+ , P
    Figure Legend Snippet: Gene trap of Gldc ablates GCS activity. The GCS, comprising GLDC, GCSH, AMT and DLD (dihydrolipoamide dehydrogenase), functions in mitochondrial folate metabolism ( a ) to cleave glycine, donating a one-carbon unit to THF. The Gldc GT1 allele ( b ) carries a gene-trap construct in intron 2. Splicing of exon2 to the gene-trap splice acceptor, SA, generates a truncated mRNA. The primers used for genotyping by PCR of genomic DNA are indicated ( b ). F1 and R3 generate a band in wild-type and heterozygous mice that is not detectable in homozygous Gldc GT1/GT1 mice ( c ). No PCR product is generated in +/+ samples when one or both primers are located within the trap construct (F2.R1 or F3.R2; full image of gel is included in Supplementary Information ). ( d ) Quantitative real time RT–PCR analysis of liver and brain samples at 5 weeks of age. ( e ) Enzymatic activity of the GCS in liver (* indicates significant difference from Gldc +/+ , P

    Techniques Used: Activity Assay, Construct, Polymerase Chain Reaction, Mouse Assay, Generated, Quantitative RT-PCR

    34) Product Images from "Optimization of a WGA-Free Molecular Tagging-Based NGS Protocol for CTCs Mutational Profiling"

    Article Title: Optimization of a WGA-Free Molecular Tagging-Based NGS Protocol for CTCs Mutational Profiling

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms21124364

    DNA integrity testing in sorted MDA/leukocytes cells. Multiplex PCR was performed and four PCR products of different lengths from four chromosomal regions were amplified. The number of bands obtained by each PCR product was visualized on a 3% agarose gel through ultraviolet light. Each lane represents a single/cellular pool.
    Figure Legend Snippet: DNA integrity testing in sorted MDA/leukocytes cells. Multiplex PCR was performed and four PCR products of different lengths from four chromosomal regions were amplified. The number of bands obtained by each PCR product was visualized on a 3% agarose gel through ultraviolet light. Each lane represents a single/cellular pool.

    Techniques Used: Multiple Displacement Amplification, Multiplex Assay, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Coverage metrics of KRAS Gly13Asp, TP53 Arg280Lys, and PIK3CA Glu545Lys variants. Scatter dot plots in ( a , b ) show the Allele Read Coverage and the Allele Molecular Coverage for KRAS Gly13Asp and TP53 Arg280Lys, respectively, as found in MDA pools, and in ( c ) for PIK3CA Glu545Lys in MCF-7. Each dot represents a single molecular DNA molecule on the x -axis (i.e., Allele Molecular Coverage) and the corresponding number of reads on the y -axis (i.e., Allele Read Coverage). The origin of the axes was set to 3, corresponding to the default minimum value of reads to enable a variant calling.
    Figure Legend Snippet: Coverage metrics of KRAS Gly13Asp, TP53 Arg280Lys, and PIK3CA Glu545Lys variants. Scatter dot plots in ( a , b ) show the Allele Read Coverage and the Allele Molecular Coverage for KRAS Gly13Asp and TP53 Arg280Lys, respectively, as found in MDA pools, and in ( c ) for PIK3CA Glu545Lys in MCF-7. Each dot represents a single molecular DNA molecule on the x -axis (i.e., Allele Molecular Coverage) and the corresponding number of reads on the y -axis (i.e., Allele Read Coverage). The origin of the axes was set to 3, corresponding to the default minimum value of reads to enable a variant calling.

    Techniques Used: Multiple Displacement Amplification, Variant Assay

    35) Product Images from "Tet-mediated DNA hydroxymethylation regulates retinal neurogenesis by modulating cell-extrinsic signaling pathways"

    Article Title: Tet-mediated DNA hydroxymethylation regulates retinal neurogenesis by modulating cell-extrinsic signaling pathways

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006987

    Gene expression and 5hmC levels are abnormal in tet2 -/- ;tet3 -/- mutant eyes at 72hpf. (A-B) GO analysis for biological pathways was performed using DAVID. Numbers in parentheses indicate number of genes enriched in each GO term. P-value cutoff = 0.001. In situ hybridization of (C-E) medium-wave sensitive ( opn1mw1 ) and (F-H) short-wave sensitive opsin ( opn1sw1 ). Transcripts of both genes are only detected in a few cells of the ventral retina in tet2 -/- ;tet3 -/- embryos (arrows in E,H; n > 8). natriuretic peptide a ( nppa ) is normally expressed in the heart (I), and is not detected in the retina of wild-type embryos (J; n > 8). (K) In tet2 -/- ;tet3 -/- embryos, ectopic nppa expressing cells were detected throughout the retina and brain (arrows) of all embryos examined (n = 16/16). (L) Bisulfite sequencing did not identify any changes in DNA methylation in any of the sixteen RNA-seq-identified target loci examined ( S4 Table ), including the nppa gene body. Bisulfite reads covering part of the first intron and second exon of nppa gene body are shown as black (methylated) or white (unmethylated). (M) Site-specific 5hmC quantification detected a significant, 20-fold reduction in 5hmC levels in the nppa gene body of 72hpf tet2 -/- ;tet3 -/- embryonic eye tissue, when compared to phenotypically wild-type siblings (p = 0.0038; two-tailed, unpaired t-test).
    Figure Legend Snippet: Gene expression and 5hmC levels are abnormal in tet2 -/- ;tet3 -/- mutant eyes at 72hpf. (A-B) GO analysis for biological pathways was performed using DAVID. Numbers in parentheses indicate number of genes enriched in each GO term. P-value cutoff = 0.001. In situ hybridization of (C-E) medium-wave sensitive ( opn1mw1 ) and (F-H) short-wave sensitive opsin ( opn1sw1 ). Transcripts of both genes are only detected in a few cells of the ventral retina in tet2 -/- ;tet3 -/- embryos (arrows in E,H; n > 8). natriuretic peptide a ( nppa ) is normally expressed in the heart (I), and is not detected in the retina of wild-type embryos (J; n > 8). (K) In tet2 -/- ;tet3 -/- embryos, ectopic nppa expressing cells were detected throughout the retina and brain (arrows) of all embryos examined (n = 16/16). (L) Bisulfite sequencing did not identify any changes in DNA methylation in any of the sixteen RNA-seq-identified target loci examined ( S4 Table ), including the nppa gene body. Bisulfite reads covering part of the first intron and second exon of nppa gene body are shown as black (methylated) or white (unmethylated). (M) Site-specific 5hmC quantification detected a significant, 20-fold reduction in 5hmC levels in the nppa gene body of 72hpf tet2 -/- ;tet3 -/- embryonic eye tissue, when compared to phenotypically wild-type siblings (p = 0.0038; two-tailed, unpaired t-test).

    Techniques Used: Expressing, Mutagenesis, In Situ Hybridization, Methylation Sequencing, DNA Methylation Assay, RNA Sequencing Assay, Methylation, Two Tailed Test

    36) Product Images from "Structural and developmental expression of Ss-riok-2, an RIO protein kinase encoding gene of Strongyloides stercoralis"

    Article Title: Structural and developmental expression of Ss-riok-2, an RIO protein kinase encoding gene of Strongyloides stercoralis

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07991-2

    Diagrammatic representation of the genomic organizations of the riok-2 from Strongyloides stercoralis ( Ss-riok-2 ) and orthologues from Chaetomium thermophilum ( Ct-riok-2 ), Caenorhabditis elegans ( Ce-riok-2 ) and Haemonchus contortus ( Hc-riok-2 ). The organization of each gene was determined by aligning the cDNA and genomic DNA sequences, with intron-exon boundaries being defined using the GT-AG rule. Black boxes represent exons, whilst horizontal lines represent introns. Numbers below the boxes indicate the sizes of exons (in nucleotides), whereas numbers above the lines indicate the intron sizes.
    Figure Legend Snippet: Diagrammatic representation of the genomic organizations of the riok-2 from Strongyloides stercoralis ( Ss-riok-2 ) and orthologues from Chaetomium thermophilum ( Ct-riok-2 ), Caenorhabditis elegans ( Ce-riok-2 ) and Haemonchus contortus ( Hc-riok-2 ). The organization of each gene was determined by aligning the cDNA and genomic DNA sequences, with intron-exon boundaries being defined using the GT-AG rule. Black boxes represent exons, whilst horizontal lines represent introns. Numbers below the boxes indicate the sizes of exons (in nucleotides), whereas numbers above the lines indicate the intron sizes.

    Techniques Used:

    37) Product Images from "Gene expression analysis of human induced pluripotent stem cell-derived neurons carrying copy number variants of chromosome 15q11-q13.1"

    Article Title: Gene expression analysis of human induced pluripotent stem cell-derived neurons carrying copy number variants of chromosome 15q11-q13.1

    Journal: Molecular Autism

    doi: 10.1186/2040-2392-5-44

    Characterization of chromosome 15q11-q13.1 duplication ( Dup15q) induced pluripotent stem cell (iPSCs) . (a) Map of the 15q11-q13.1 region. Boxes indicate genes (grey = biallelically expressed, red = maternally expressed, blue = paternally expressed) and lines indicate small nucleolar RNAs (snoRNAs). The striped boxes for ATP10A signify its variable imprinting status. The UBE3A anti-sense transcript is represented by the dotted line beginning at SNURF - SNRPN . Pink and blue shaded regions demarcate the Angelman Syndrome and Prader-Willi Syndrome imprinting centers (AS-IC and PWS-IC), respectively. Open circles represent unmethylated CpG islands, while the corresponding black circles on the maternal allele represent methylated CpG islands in silenced genes (black boxes). Breakpoints (BP1-BP5) are indicated. The regions deleted or duplicated in iPSC lines used in this study as well as their respective maternal (M) or paternal (P) allele copy numbers are indicated below the map. (b-d) Immunocytochemistry for the pluripotency markers TRA-1-60, Nanog, and SSEA-4 on idic(15) iPSC colonies (Idic1-8). Nuclei are counterstained with DAPI (blue). (e) Karyogram of idic(15) iPSCs shows a karyotype of 47,XX,+idic(15).ish15q12 SNRPN x 4, 15qter X2. Red box indicates the supernumerary isodicentric chromosome 15. (f, g) DNA FISH on metaphase idic(15) iPSCs (F) and interphase int dup(15) iPSCs (G) with a probe for SNRPN (red) and a control probe on the distal long arm of chromosome 15 (green). Two normal chromosomes 15 are indicated by white arrows (F). The isodicentric chromosome 15 (highlighted in white box and inset) shows four signals for SNRPN and no signal for the control probe (F). Three signals for SNRPN and two control signals indicate the presence of the interstitial duplication of 15q11-q13.1 on one chromosome 15 (G). Scale bars in (B) and (D) are 200 μm, in (C) is 100 μm, in (F) is 5 μm and in (G) is 10 μm.
    Figure Legend Snippet: Characterization of chromosome 15q11-q13.1 duplication ( Dup15q) induced pluripotent stem cell (iPSCs) . (a) Map of the 15q11-q13.1 region. Boxes indicate genes (grey = biallelically expressed, red = maternally expressed, blue = paternally expressed) and lines indicate small nucleolar RNAs (snoRNAs). The striped boxes for ATP10A signify its variable imprinting status. The UBE3A anti-sense transcript is represented by the dotted line beginning at SNURF - SNRPN . Pink and blue shaded regions demarcate the Angelman Syndrome and Prader-Willi Syndrome imprinting centers (AS-IC and PWS-IC), respectively. Open circles represent unmethylated CpG islands, while the corresponding black circles on the maternal allele represent methylated CpG islands in silenced genes (black boxes). Breakpoints (BP1-BP5) are indicated. The regions deleted or duplicated in iPSC lines used in this study as well as their respective maternal (M) or paternal (P) allele copy numbers are indicated below the map. (b-d) Immunocytochemistry for the pluripotency markers TRA-1-60, Nanog, and SSEA-4 on idic(15) iPSC colonies (Idic1-8). Nuclei are counterstained with DAPI (blue). (e) Karyogram of idic(15) iPSCs shows a karyotype of 47,XX,+idic(15).ish15q12 SNRPN x 4, 15qter X2. Red box indicates the supernumerary isodicentric chromosome 15. (f, g) DNA FISH on metaphase idic(15) iPSCs (F) and interphase int dup(15) iPSCs (G) with a probe for SNRPN (red) and a control probe on the distal long arm of chromosome 15 (green). Two normal chromosomes 15 are indicated by white arrows (F). The isodicentric chromosome 15 (highlighted in white box and inset) shows four signals for SNRPN and no signal for the control probe (F). Three signals for SNRPN and two control signals indicate the presence of the interstitial duplication of 15q11-q13.1 on one chromosome 15 (G). Scale bars in (B) and (D) are 200 μm, in (C) is 100 μm, in (F) is 5 μm and in (G) is 10 μm.

    Techniques Used: Methylation, Immunocytochemistry, Fluorescence In Situ Hybridization

    38) Product Images from "Non-referenced genome assembly from epigenomic short-read data "

    Article Title: Non-referenced genome assembly from epigenomic short-read data

    Journal: Epigenetics

    doi: 10.4161/15592294.2014.969610

    Coverage of assembled regions when mapped to their respective reference genomes. The percentage of genomic features covered by newly assembled contigs by ChIP-seq for H3K9Ac and ER-α, and DNA methylation enrichment. Gene features derived from Ensembl ver. 72 for D. melanogaster and M. musculus , and Ensembl ver. 54 for H. sapiens are composed of CpG islands, exons, introns, whole gene bodies, promoters (the region 3 kb upstream from the transcription start site) and the whole genome. Genomic regions were filtered by 36 bp read mappability. Coverage is shown for ( A ) D. melanogaster H3K9Ac (no CpG islands are annotated), ( B ) H. sapiens ER-α, ( C ) M. musculus DNA methylation.
    Figure Legend Snippet: Coverage of assembled regions when mapped to their respective reference genomes. The percentage of genomic features covered by newly assembled contigs by ChIP-seq for H3K9Ac and ER-α, and DNA methylation enrichment. Gene features derived from Ensembl ver. 72 for D. melanogaster and M. musculus , and Ensembl ver. 54 for H. sapiens are composed of CpG islands, exons, introns, whole gene bodies, promoters (the region 3 kb upstream from the transcription start site) and the whole genome. Genomic regions were filtered by 36 bp read mappability. Coverage is shown for ( A ) D. melanogaster H3K9Ac (no CpG islands are annotated), ( B ) H. sapiens ER-α, ( C ) M. musculus DNA methylation.

    Techniques Used: Chromatin Immunoprecipitation, DNA Methylation Assay, Derivative Assay

    39) Product Images from "Submillimolar levels of calcium regulates DNA structure at the dinucleotide repeat (TG/AC)n"

    Article Title: Submillimolar levels of calcium regulates DNA structure at the dinucleotide repeat (TG/AC)n

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Ca 2+ /CaM-PK II autophosphorylation assay. The activity of the Ca 2+ /CaM-PK II is indicated by its phosphorylated 50- and 60-kDa subunits (I and II) in the assay. Basal activities are shown in the absence of DNA (lanes 2 and 3). Addition of 300 μM exogenous calcium increased phosphorylation (lane 4). Plasmid DNA containing residual calcium (dialyzed but no BAPTA treatment) donated calcium as indicated by increased autophosphorylation (lane 5), whereas calcium-free DNA completely inhibited autophosphorylation (lane 6). Exogenous calcium prevented the inhibitory effect of calcium-free plasmid DNA (lane 7). The specific inhibitor of CaM [CaM kinase II(290–309) CaM antagonist] completely blocked autophosphorylation (band I) (lane 8); addition of BSA (lane B) did not alter basal activity (lane 9); addition of calcium-free rat genomic DNA (lane G) also inhibited autophosphorylation (lane 10). The first band from the top in lane 9 is the result of BSA phosphorylation. Bands I and II indicate the two subunits of the enzyme; numbers indicate the molecular mass of the protein standards in kDa.
    Figure Legend Snippet: Ca 2+ /CaM-PK II autophosphorylation assay. The activity of the Ca 2+ /CaM-PK II is indicated by its phosphorylated 50- and 60-kDa subunits (I and II) in the assay. Basal activities are shown in the absence of DNA (lanes 2 and 3). Addition of 300 μM exogenous calcium increased phosphorylation (lane 4). Plasmid DNA containing residual calcium (dialyzed but no BAPTA treatment) donated calcium as indicated by increased autophosphorylation (lane 5), whereas calcium-free DNA completely inhibited autophosphorylation (lane 6). Exogenous calcium prevented the inhibitory effect of calcium-free plasmid DNA (lane 7). The specific inhibitor of CaM [CaM kinase II(290–309) CaM antagonist] completely blocked autophosphorylation (band I) (lane 8); addition of BSA (lane B) did not alter basal activity (lane 9); addition of calcium-free rat genomic DNA (lane G) also inhibited autophosphorylation (lane 10). The first band from the top in lane 9 is the result of BSA phosphorylation. Bands I and II indicate the two subunits of the enzyme; numbers indicate the molecular mass of the protein standards in kDa.

    Techniques Used: Chick Chorioallantoic Membrane Assay, Activity Assay, Plasmid Preparation

    Calcium-binding assay. ( A ) Representative PhosphorImager pictures of Zeta-Probe membranes with immobilized identical slots of CaM, BSA, circular plasmid DNA [(TG) 28 DNAcir] and linearized [(TG) 28 DNAlin] plasmid DNA containing the (TG) 28 repeat, and circular plasmid DNA from which the (TG) 28 repeat was deleted (DNAcirc). All membranes were incubated with 45 CaCl 2 followed by the following treatments: basal binding (Basal), remaining binding after wash with 50 μM EDTA (+EDTA), remaining binding after wash with 1 mM BAPTA (+BAPTA), remaining binding after wash with 1 mM unlabeled CaCl 2 (+cold CaCl 2 ), binding after washing out unlabeled CaCl 2 followed by a reincubation with 50 μM 45 CaCl 2 (Reverse). ( B ) Graphic expression of 45 CaCl 2 binding. Data points are the mean ± SEM of relative activities of the different treatment groups normalized to nonspecific background binding ( n = 3).
    Figure Legend Snippet: Calcium-binding assay. ( A ) Representative PhosphorImager pictures of Zeta-Probe membranes with immobilized identical slots of CaM, BSA, circular plasmid DNA [(TG) 28 DNAcir] and linearized [(TG) 28 DNAlin] plasmid DNA containing the (TG) 28 repeat, and circular plasmid DNA from which the (TG) 28 repeat was deleted (DNAcirc). All membranes were incubated with 45 CaCl 2 followed by the following treatments: basal binding (Basal), remaining binding after wash with 50 μM EDTA (+EDTA), remaining binding after wash with 1 mM BAPTA (+BAPTA), remaining binding after wash with 1 mM unlabeled CaCl 2 (+cold CaCl 2 ), binding after washing out unlabeled CaCl 2 followed by a reincubation with 50 μM 45 CaCl 2 (Reverse). ( B ) Graphic expression of 45 CaCl 2 binding. Data points are the mean ± SEM of relative activities of the different treatment groups normalized to nonspecific background binding ( n = 3).

    Techniques Used: Binding Assay, Chick Chorioallantoic Membrane Assay, Plasmid Preparation, Incubation, Expressing

    40) Product Images from "A critical assessment of cross-species detection of gene duplicates using comparative genomic hybridization"

    Article Title: A critical assessment of cross-species detection of gene duplicates using comparative genomic hybridization

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-304

    Plot of D. melanogaster female vs. male genomic DNA . X chromosome features identified as being in genomic excess in the female sample (
    Figure Legend Snippet: Plot of D. melanogaster female vs. male genomic DNA . X chromosome features identified as being in genomic excess in the female sample ("X Detected") and not identified as being in genomic excess ("X not Detected"), and the autosomal features identified as being in genomic excess that also share sequence similarity to an X chromosome sequence ("X Sequence on Autosome").

    Techniques Used: Sequencing

    Related Articles

    Clone Assay:

    Article Title: KRAS genotyping by digital PCR combined with melting curve analysis
    Article Snippet: .. Preparation of DNA templates The KRAS gene was amplified using genomic DNA extracted from HCT116 p21 (+) as a template and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA). .. The G12D mutation was introduced by PCR-based site-directed mutagenesis using genomic DNA extracted from HCT116 p21 (+) as a template, and the mutant was cloned into the pCR2.1-TOPO vector.

    Transfection:

    Article Title: Partial DNA-guided Cas9 enables genome editing with reduced off-target activity
    Article Snippet: .. 48 h after transfection, genomic DNA was extracted with a PureLink Genomic DNA Mini Kit (Invitrogen) according to the manufacturer’s suggested protocol. ..

    Amplification:

    Article Title: The RNase R from Campylobacter jejuni Has Unique Features and Is Involved in the First Steps of Infection *
    Article Snippet: .. For rnr amplification by PCR, genomic DNA, 200 μ m of each primer, and 1 unit of Phusion high-fidelity DNA polymerase (Finnzymes) were used. .. The resulting product (1944 bp) was purified (QIAquick PCR purification kit, Qiagen) and cloned into the pGEM-T plasmid (Promega) to generate pGEMT- rnr .

    Article Title: KRAS genotyping by digital PCR combined with melting curve analysis
    Article Snippet: .. Preparation of DNA templates The KRAS gene was amplified using genomic DNA extracted from HCT116 p21 (+) as a template and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA). .. The G12D mutation was introduced by PCR-based site-directed mutagenesis using genomic DNA extracted from HCT116 p21 (+) as a template, and the mutant was cloned into the pCR2.1-TOPO vector.

    Isolation:

    Article Title: HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR/Cas9 Toxicity in Human Hematopoietic Stem Cells
    Article Snippet: .. qPCR for Ad Genome and Cas9 mRNA For absolute quantification of adenoviral genome copies per cell, genomic DNA was isolated from cells using PureLink Genomic DNA Mini Kit per provided protocol (Life Technologies) and used as template for qPCR performed using the power SYBR green PCR master mix (Thermo Fisher Scientific). ..

    Purification:

    Article Title: Gene expression analysis of human induced pluripotent stem cell-derived neurons carrying copy number variants of chromosome 15q11-q13.1
    Article Snippet: .. Copy number analysis The copy number of UBE3A in each iPSC line was analyzed by qPCR using genomic DNA purified from two biological replicates and TaqMan Copy Number Assays (Hs01665678_cn and Hs03908756_cn, Life Technologies, Grand Island, NY, USA). ..

    SYBR Green Assay:

    Article Title: HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR/Cas9 Toxicity in Human Hematopoietic Stem Cells
    Article Snippet: .. qPCR for Ad Genome and Cas9 mRNA For absolute quantification of adenoviral genome copies per cell, genomic DNA was isolated from cells using PureLink Genomic DNA Mini Kit per provided protocol (Life Technologies) and used as template for qPCR performed using the power SYBR green PCR master mix (Thermo Fisher Scientific). ..

    Polymerase Chain Reaction:

    Article Title: Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
    Article Snippet: .. PCR to generate sequencing templates was performed in 10–50 μl reactions using 200 nM of each PCR primer, 165 ng genomic DNA (Coriell, Camden, NJ) and 1.25 U AccuPrime Taq DNA polymerase with AccuPrime buffer II, which includes dNTPs (Invitrogen, Carlsbad, CA). ..

    Article Title: The RNase R from Campylobacter jejuni Has Unique Features and Is Involved in the First Steps of Infection *
    Article Snippet: .. For rnr amplification by PCR, genomic DNA, 200 μ m of each primer, and 1 unit of Phusion high-fidelity DNA polymerase (Finnzymes) were used. .. The resulting product (1944 bp) was purified (QIAquick PCR purification kit, Qiagen) and cloned into the pGEM-T plasmid (Promega) to generate pGEMT- rnr .

    Article Title: HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR/Cas9 Toxicity in Human Hematopoietic Stem Cells
    Article Snippet: .. qPCR for Ad Genome and Cas9 mRNA For absolute quantification of adenoviral genome copies per cell, genomic DNA was isolated from cells using PureLink Genomic DNA Mini Kit per provided protocol (Life Technologies) and used as template for qPCR performed using the power SYBR green PCR master mix (Thermo Fisher Scientific). ..

    Sequencing:

    Article Title: Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
    Article Snippet: .. PCR to generate sequencing templates was performed in 10–50 μl reactions using 200 nM of each PCR primer, 165 ng genomic DNA (Coriell, Camden, NJ) and 1.25 U AccuPrime Taq DNA polymerase with AccuPrime buffer II, which includes dNTPs (Invitrogen, Carlsbad, CA). ..

    Real-time Polymerase Chain Reaction:

    Article Title: HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR/Cas9 Toxicity in Human Hematopoietic Stem Cells
    Article Snippet: .. qPCR for Ad Genome and Cas9 mRNA For absolute quantification of adenoviral genome copies per cell, genomic DNA was isolated from cells using PureLink Genomic DNA Mini Kit per provided protocol (Life Technologies) and used as template for qPCR performed using the power SYBR green PCR master mix (Thermo Fisher Scientific). ..

    Article Title: Gene expression analysis of human induced pluripotent stem cell-derived neurons carrying copy number variants of chromosome 15q11-q13.1
    Article Snippet: .. Copy number analysis The copy number of UBE3A in each iPSC line was analyzed by qPCR using genomic DNA purified from two biological replicates and TaqMan Copy Number Assays (Hs01665678_cn and Hs03908756_cn, Life Technologies, Grand Island, NY, USA). ..

    Plasmid Preparation:

    Article Title: KRAS genotyping by digital PCR combined with melting curve analysis
    Article Snippet: .. Preparation of DNA templates The KRAS gene was amplified using genomic DNA extracted from HCT116 p21 (+) as a template and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA). .. The G12D mutation was introduced by PCR-based site-directed mutagenesis using genomic DNA extracted from HCT116 p21 (+) as a template, and the mutant was cloned into the pCR2.1-TOPO vector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Thermo Fisher gdna binding buffer
    CKAP4 binds directly to genomic DNA . (a) CKAP4 binds <t>gDNA</t> in an <t>APF-dependent</t> manner (lane 3) when compared to mock-treated control (lane 4). The CKAP4-gDNA binding is phosphorylation dependent as CKAP4 isolated from cells treated without phosphatase inhibitors prior to APF treatment failed to bind gDNA (lane 6). As controls, we loaded APF treated nuclear lysates in lane 1 and phosphatase/APF treated lysates in lane 5. Lane 2 is a no gDNA cellulose control. (b) The ability of transiently transfected V5-tagged, CKAP4 C100S/SΔE to bind gDNA in the absence of APF treatment (c) and the ability of purified rCKAP4 (residues 126–501, which includes the bZIP-like DNA-binding domain) to bind gDNA were also assessed by comparing the amount of CKAP4 captured relative to what remained in the cell lysate after binding (Sup).
    Gdna Binding Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna binding buffer/product/Thermo Fisher
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gdna binding buffer - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    94
    Thermo Fisher genomic dna gdna
    Comparison between ssDNA, plasmid and PCR donors. (A) Efficiency of GFP integration into RAB11A in HEK293T cells as measured by flow cytometry. (B) GFP knock-in efficiencies into RAB11A and CLTA in HEK293T cells. Average of n = 3 independent experiments (individual measurements shown as open circles). (C) Principle of ddPCR-based measurement of on-target GFP integration. (D) Validation of ddPCR on-target measurement using control plasmids spiked into wild-type HEK293T genomic <t>DNA.</t> Each set of experiments contains an “on-target” plasmid (GFP into the targeted locus, RAB11A or CLTA) and an “off-target” plasmid (GFP into the non-targeted SEC61B locus), mixed in different ratios. On-target ddPCR measurement as defined in is plotted against the ratio of on-target to off-target plasmid. Dotted line represents the y = x diagonal. (E) Measurement of on-target integration of GFP into RAB11A and CLTA in HEK293T cells (same samples as in (B), analysis performed on GFP-positive sorted populations). Average of n = 3 independent experiments (individual measurements shown as open circles). Positive controls: wild-type <t>gDNA</t> spiked with “on-target” control plasmids as in (D). (F) Measurement of on-target integration of GFP into RAB11A in U2OS and K562 cells (analysis performed on GFP-positive sorted populations). Average of n = 2 independent experiments (individual measurements shown as open circles). Positive controls: wild-type gDNA spiked with “on-target” control plasmids as in (D). (G) Non-template integration of CMV-mCherry devoid of homology arms in HEK293T cells. CMV-mCherry donors were electroporated without Cas9 or with RNP targeting EMX1 or RAB11A.
    Genomic Dna Gdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Thermo Fisher
    Average 94 stars, based on 85 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    90
    Thermo Fisher qpcr genomic dna
    ObTLP1 -expressing Arabidopsis plants are tolerant to S. sclerotiorum infection. ( A ) Leaves of four-week-old ObTLP1 -expressing transgenic lines (TH1 and TH2) and vector control plants were inoculated with equal amount of mycelial suspension of S. sclerotiorum as described in Methods. Disease assessment was carried out at different time intervals and photographs were taken. ( B ) Lesion size was measured at different time intervals in infected leaves. Data are mean ± s.d. from sixteen plants for each transgenic line. ( C ) Fungal biomass in infected leaves was quantified by <t>qPCR.</t> Relative level of S. sclerotiorum ITS genomic <t>DNA</t> was determined using Arabidopsis chloroplast-encoded ribulose-1,5-bis-phosphate carboxylase/oxygenase large subunit as reference gene. Data are mean ± s.d. from three biological replicates. Asterisks indicate statistically significant difference at **P
    Qpcr Genomic Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr genomic dna/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qpcr genomic dna - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    89
    Thermo Fisher female genomic dna
    Identification of the X chromosome in the Strigamia karyotype by FISH with a set of X-chromosome derived <t>DNA</t> probes. (A) The relative positions and sizes of the five <t>PCR</t> fragments, distributed on two different X-linked scaffolds, which were used to produce the X-probes. Two of the fragments are located on scf7180001248200 and three on scf7180001248049. The genomic distance between these scaffolds is not known. The black line depicts the scaffold. The numbers above the line indicate the number of bases, starting at 1 on the left hand side. Green boxes represent the length and relative position of the PCR products, numbered arbitrarily from 1 to 5. (B) A mitotic metaphase chromosome spread prepared from a single embryo. Hybridization signals of the X-probes identify a middle-sized element in the Strigamia karyotype as the X chromosome. As there are two chromosomes with the X-probe signals, we infer that this chromosome spread is derived from a female embryo (XX). (C) Two Strigamia karyotypes constructed from the mitotic metaphases of embryonic cells. They are derived from different embryos. Upper panel: karyotype derived from the female metaphase shown in (B). Lower panel: karyotype derived from an inverted image of a DAPI-stained metaphase of unknown sex. It is the same as that shown in Fig 1A . We infer that the pair of sex chromosomes represents the 4 th pair of chromosomes by size (asterisks). (D, E, F) Meiotic chromosome spreads, prepared from sub-adult male testes. (D) Late zygotene complement showing a clump of incompletely paired bivalents. The X-probes label the longer chromosome of a partially paired bivalent, as schematically illustrated in (D’). We thus infer that this is the X chromosome, and that the other shorter chromosome, without hybridization signals, is the Y chromosome. The X and Y chromosomes are only paired at the distal part of the X chromosome, with a large proximal part unpaired. (E) A particularly clear and well-spread XY bivalent at a similar stage to (D). It shows hybridization signals of X-probes on the unpaired proximal part of the X chromosome, while the Y chromosome is completely paired except for the DAPI-highlighted centromere (see schematic drawing below the XY bivalent). (F) Pachytene complement showing 8 bivalents, each with DAPI-highlighted centromeric chromatin. X-probe hybridization signals are visible on the unpaired segment of the longer chromosome, near the centromere (see schematic drawing on the right-hand side). The X and Y chromosomes now appear almost equal in length in the bivalent. Scale bar is equal to 5 μm in (B) and 10 μm in (D, E, F). Chromosomes were counterstained with DAPI (blue). Arrowheads indicate hybridization signals of the digoxigenin-labelled X-probes (green); arrows indicate a pair of the largest chromosomes (B) or the largest bivalent (F).
    Female Genomic Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/female genomic dna/product/Thermo Fisher
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    female genomic dna - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    Image Search Results


    CKAP4 binds directly to genomic DNA . (a) CKAP4 binds gDNA in an APF-dependent manner (lane 3) when compared to mock-treated control (lane 4). The CKAP4-gDNA binding is phosphorylation dependent as CKAP4 isolated from cells treated without phosphatase inhibitors prior to APF treatment failed to bind gDNA (lane 6). As controls, we loaded APF treated nuclear lysates in lane 1 and phosphatase/APF treated lysates in lane 5. Lane 2 is a no gDNA cellulose control. (b) The ability of transiently transfected V5-tagged, CKAP4 C100S/SΔE to bind gDNA in the absence of APF treatment (c) and the ability of purified rCKAP4 (residues 126–501, which includes the bZIP-like DNA-binding domain) to bind gDNA were also assessed by comparing the amount of CKAP4 captured relative to what remained in the cell lysate after binding (Sup).

    Journal: International Journal of Cell Biology

    Article Title: Antiproliferative Factor-Induced Changes in Phosphorylation and Palmitoylation of Cytoskeleton-Associated Protein-4 Regulate Its Nuclear Translocation and DNA Binding

    doi: 10.1155/2012/150918

    Figure Lengend Snippet: CKAP4 binds directly to genomic DNA . (a) CKAP4 binds gDNA in an APF-dependent manner (lane 3) when compared to mock-treated control (lane 4). The CKAP4-gDNA binding is phosphorylation dependent as CKAP4 isolated from cells treated without phosphatase inhibitors prior to APF treatment failed to bind gDNA (lane 6). As controls, we loaded APF treated nuclear lysates in lane 1 and phosphatase/APF treated lysates in lane 5. Lane 2 is a no gDNA cellulose control. (b) The ability of transiently transfected V5-tagged, CKAP4 C100S/SΔE to bind gDNA in the absence of APF treatment (c) and the ability of purified rCKAP4 (residues 126–501, which includes the bZIP-like DNA-binding domain) to bind gDNA were also assessed by comparing the amount of CKAP4 captured relative to what remained in the cell lysate after binding (Sup).

    Article Snippet: Genomic DNA Affinity Chromatography (GDAC) HeLa cells treated with APF (or control) or expressing CKAP4C100S/SΔE (for 24–48 hours) were scraped into gDNA binding buffer (20 mM Tris [pH 7.5], 100 mM KCl, 10% Glycerol, 1 mM EDTA, 1 mM DTT, 1 mg/mL BSA, 0.1% SDS) with 1X phosphatase inhibitor and 1X phosphatase inhibitor cocktail 1 (both from ThermoFisher Scientific).

    Techniques: Binding Assay, Isolation, Transfection, Purification

    Comparison between ssDNA, plasmid and PCR donors. (A) Efficiency of GFP integration into RAB11A in HEK293T cells as measured by flow cytometry. (B) GFP knock-in efficiencies into RAB11A and CLTA in HEK293T cells. Average of n = 3 independent experiments (individual measurements shown as open circles). (C) Principle of ddPCR-based measurement of on-target GFP integration. (D) Validation of ddPCR on-target measurement using control plasmids spiked into wild-type HEK293T genomic DNA. Each set of experiments contains an “on-target” plasmid (GFP into the targeted locus, RAB11A or CLTA) and an “off-target” plasmid (GFP into the non-targeted SEC61B locus), mixed in different ratios. On-target ddPCR measurement as defined in is plotted against the ratio of on-target to off-target plasmid. Dotted line represents the y = x diagonal. (E) Measurement of on-target integration of GFP into RAB11A and CLTA in HEK293T cells (same samples as in (B), analysis performed on GFP-positive sorted populations). Average of n = 3 independent experiments (individual measurements shown as open circles). Positive controls: wild-type gDNA spiked with “on-target” control plasmids as in (D). (F) Measurement of on-target integration of GFP into RAB11A in U2OS and K562 cells (analysis performed on GFP-positive sorted populations). Average of n = 2 independent experiments (individual measurements shown as open circles). Positive controls: wild-type gDNA spiked with “on-target” control plasmids as in (D). (G) Non-template integration of CMV-mCherry devoid of homology arms in HEK293T cells. CMV-mCherry donors were electroporated without Cas9 or with RNP targeting EMX1 or RAB11A.

    Journal: bioRxiv

    Article Title: Design and specificity of long ssDNA donors for CRISPR-based knock-in

    doi: 10.1101/178905

    Figure Lengend Snippet: Comparison between ssDNA, plasmid and PCR donors. (A) Efficiency of GFP integration into RAB11A in HEK293T cells as measured by flow cytometry. (B) GFP knock-in efficiencies into RAB11A and CLTA in HEK293T cells. Average of n = 3 independent experiments (individual measurements shown as open circles). (C) Principle of ddPCR-based measurement of on-target GFP integration. (D) Validation of ddPCR on-target measurement using control plasmids spiked into wild-type HEK293T genomic DNA. Each set of experiments contains an “on-target” plasmid (GFP into the targeted locus, RAB11A or CLTA) and an “off-target” plasmid (GFP into the non-targeted SEC61B locus), mixed in different ratios. On-target ddPCR measurement as defined in is plotted against the ratio of on-target to off-target plasmid. Dotted line represents the y = x diagonal. (E) Measurement of on-target integration of GFP into RAB11A and CLTA in HEK293T cells (same samples as in (B), analysis performed on GFP-positive sorted populations). Average of n = 3 independent experiments (individual measurements shown as open circles). Positive controls: wild-type gDNA spiked with “on-target” control plasmids as in (D). (F) Measurement of on-target integration of GFP into RAB11A in U2OS and K562 cells (analysis performed on GFP-positive sorted populations). Average of n = 2 independent experiments (individual measurements shown as open circles). Positive controls: wild-type gDNA spiked with “on-target” control plasmids as in (D). (G) Non-template integration of CMV-mCherry devoid of homology arms in HEK293T cells. CMV-mCherry donors were electroporated without Cas9 or with RNP targeting EMX1 or RAB11A.

    Article Snippet: Digital droplet PCR GFP-positive cells were isolated by FACS and genomic DNA (gDNA) from ~5×106 cells was prepared using PureLink Genomic DNA purification kits (Thermo #K182001) following manufacturer’s instructions.

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Flow Cytometry, Knock-In

    ObTLP1 -expressing Arabidopsis plants are tolerant to S. sclerotiorum infection. ( A ) Leaves of four-week-old ObTLP1 -expressing transgenic lines (TH1 and TH2) and vector control plants were inoculated with equal amount of mycelial suspension of S. sclerotiorum as described in Methods. Disease assessment was carried out at different time intervals and photographs were taken. ( B ) Lesion size was measured at different time intervals in infected leaves. Data are mean ± s.d. from sixteen plants for each transgenic line. ( C ) Fungal biomass in infected leaves was quantified by qPCR. Relative level of S. sclerotiorum ITS genomic DNA was determined using Arabidopsis chloroplast-encoded ribulose-1,5-bis-phosphate carboxylase/oxygenase large subunit as reference gene. Data are mean ± s.d. from three biological replicates. Asterisks indicate statistically significant difference at **P

    Journal: Scientific Reports

    Article Title: A thaumatin-like protein of Ocimum basilicum confers tolerance to fungal pathogen and abiotic stress in transgenic Arabidopsis

    doi: 10.1038/srep25340

    Figure Lengend Snippet: ObTLP1 -expressing Arabidopsis plants are tolerant to S. sclerotiorum infection. ( A ) Leaves of four-week-old ObTLP1 -expressing transgenic lines (TH1 and TH2) and vector control plants were inoculated with equal amount of mycelial suspension of S. sclerotiorum as described in Methods. Disease assessment was carried out at different time intervals and photographs were taken. ( B ) Lesion size was measured at different time intervals in infected leaves. Data are mean ± s.d. from sixteen plants for each transgenic line. ( C ) Fungal biomass in infected leaves was quantified by qPCR. Relative level of S. sclerotiorum ITS genomic DNA was determined using Arabidopsis chloroplast-encoded ribulose-1,5-bis-phosphate carboxylase/oxygenase large subunit as reference gene. Data are mean ± s.d. from three biological replicates. Asterisks indicate statistically significant difference at **P

    Article Snippet: Genomic DNA isolation, PCR and qPCR Genomic DNA was isolated following CTAB method and quantified using a nanodrop (Thermo Scientific).

    Techniques: Expressing, Infection, Transgenic Assay, Plasmid Preparation, Real-time Polymerase Chain Reaction

    ObTLP1 -expressing Arabidopsis plants are tolerant to B. cinerea infection. ( A ) Leaves of four-week-old ObTLP1 -expressing transgenic lines (TH1 and TH2) and vector control plants were inoculated with equal amount of spore suspension of B. cinerea as described in Methods. Disease assessment was carried out at different time intervals and photographs were taken. ( B ) Lesion size was measured at different time intervals in infected leaves. Data are mean ± s.d. from sixteen (vector control) or eight ( ObTLP1 -expressing lines) plants. ( C ) Fungal biomass in infected leaves was quantified by qPCR. Relative level of B. cinerea Actin genomic DNA was determined using Arabidopsis chloroplast-encoded ribulose-1,5-bis-phosphate carboxylase/oxygenase large subunit as reference gene. Data are mean ± s.d. from three biological replicates. Asterisks indicate statistically significant difference at **P

    Journal: Scientific Reports

    Article Title: A thaumatin-like protein of Ocimum basilicum confers tolerance to fungal pathogen and abiotic stress in transgenic Arabidopsis

    doi: 10.1038/srep25340

    Figure Lengend Snippet: ObTLP1 -expressing Arabidopsis plants are tolerant to B. cinerea infection. ( A ) Leaves of four-week-old ObTLP1 -expressing transgenic lines (TH1 and TH2) and vector control plants were inoculated with equal amount of spore suspension of B. cinerea as described in Methods. Disease assessment was carried out at different time intervals and photographs were taken. ( B ) Lesion size was measured at different time intervals in infected leaves. Data are mean ± s.d. from sixteen (vector control) or eight ( ObTLP1 -expressing lines) plants. ( C ) Fungal biomass in infected leaves was quantified by qPCR. Relative level of B. cinerea Actin genomic DNA was determined using Arabidopsis chloroplast-encoded ribulose-1,5-bis-phosphate carboxylase/oxygenase large subunit as reference gene. Data are mean ± s.d. from three biological replicates. Asterisks indicate statistically significant difference at **P

    Article Snippet: Genomic DNA isolation, PCR and qPCR Genomic DNA was isolated following CTAB method and quantified using a nanodrop (Thermo Scientific).

    Techniques: Expressing, Infection, Transgenic Assay, Plasmid Preparation, Real-time Polymerase Chain Reaction

    Identification of the X chromosome in the Strigamia karyotype by FISH with a set of X-chromosome derived DNA probes. (A) The relative positions and sizes of the five PCR fragments, distributed on two different X-linked scaffolds, which were used to produce the X-probes. Two of the fragments are located on scf7180001248200 and three on scf7180001248049. The genomic distance between these scaffolds is not known. The black line depicts the scaffold. The numbers above the line indicate the number of bases, starting at 1 on the left hand side. Green boxes represent the length and relative position of the PCR products, numbered arbitrarily from 1 to 5. (B) A mitotic metaphase chromosome spread prepared from a single embryo. Hybridization signals of the X-probes identify a middle-sized element in the Strigamia karyotype as the X chromosome. As there are two chromosomes with the X-probe signals, we infer that this chromosome spread is derived from a female embryo (XX). (C) Two Strigamia karyotypes constructed from the mitotic metaphases of embryonic cells. They are derived from different embryos. Upper panel: karyotype derived from the female metaphase shown in (B). Lower panel: karyotype derived from an inverted image of a DAPI-stained metaphase of unknown sex. It is the same as that shown in Fig 1A . We infer that the pair of sex chromosomes represents the 4 th pair of chromosomes by size (asterisks). (D, E, F) Meiotic chromosome spreads, prepared from sub-adult male testes. (D) Late zygotene complement showing a clump of incompletely paired bivalents. The X-probes label the longer chromosome of a partially paired bivalent, as schematically illustrated in (D’). We thus infer that this is the X chromosome, and that the other shorter chromosome, without hybridization signals, is the Y chromosome. The X and Y chromosomes are only paired at the distal part of the X chromosome, with a large proximal part unpaired. (E) A particularly clear and well-spread XY bivalent at a similar stage to (D). It shows hybridization signals of X-probes on the unpaired proximal part of the X chromosome, while the Y chromosome is completely paired except for the DAPI-highlighted centromere (see schematic drawing below the XY bivalent). (F) Pachytene complement showing 8 bivalents, each with DAPI-highlighted centromeric chromatin. X-probe hybridization signals are visible on the unpaired segment of the longer chromosome, near the centromere (see schematic drawing on the right-hand side). The X and Y chromosomes now appear almost equal in length in the bivalent. Scale bar is equal to 5 μm in (B) and 10 μm in (D, E, F). Chromosomes were counterstained with DAPI (blue). Arrowheads indicate hybridization signals of the digoxigenin-labelled X-probes (green); arrows indicate a pair of the largest chromosomes (B) or the largest bivalent (F).

    Journal: PLoS ONE

    Article Title: XX/XY System of Sex Determination in the Geophilomorph Centipede Strigamia maritima

    doi: 10.1371/journal.pone.0150292

    Figure Lengend Snippet: Identification of the X chromosome in the Strigamia karyotype by FISH with a set of X-chromosome derived DNA probes. (A) The relative positions and sizes of the five PCR fragments, distributed on two different X-linked scaffolds, which were used to produce the X-probes. Two of the fragments are located on scf7180001248200 and three on scf7180001248049. The genomic distance between these scaffolds is not known. The black line depicts the scaffold. The numbers above the line indicate the number of bases, starting at 1 on the left hand side. Green boxes represent the length and relative position of the PCR products, numbered arbitrarily from 1 to 5. (B) A mitotic metaphase chromosome spread prepared from a single embryo. Hybridization signals of the X-probes identify a middle-sized element in the Strigamia karyotype as the X chromosome. As there are two chromosomes with the X-probe signals, we infer that this chromosome spread is derived from a female embryo (XX). (C) Two Strigamia karyotypes constructed from the mitotic metaphases of embryonic cells. They are derived from different embryos. Upper panel: karyotype derived from the female metaphase shown in (B). Lower panel: karyotype derived from an inverted image of a DAPI-stained metaphase of unknown sex. It is the same as that shown in Fig 1A . We infer that the pair of sex chromosomes represents the 4 th pair of chromosomes by size (asterisks). (D, E, F) Meiotic chromosome spreads, prepared from sub-adult male testes. (D) Late zygotene complement showing a clump of incompletely paired bivalents. The X-probes label the longer chromosome of a partially paired bivalent, as schematically illustrated in (D’). We thus infer that this is the X chromosome, and that the other shorter chromosome, without hybridization signals, is the Y chromosome. The X and Y chromosomes are only paired at the distal part of the X chromosome, with a large proximal part unpaired. (E) A particularly clear and well-spread XY bivalent at a similar stage to (D). It shows hybridization signals of X-probes on the unpaired proximal part of the X chromosome, while the Y chromosome is completely paired except for the DAPI-highlighted centromere (see schematic drawing below the XY bivalent). (F) Pachytene complement showing 8 bivalents, each with DAPI-highlighted centromeric chromatin. X-probe hybridization signals are visible on the unpaired segment of the longer chromosome, near the centromere (see schematic drawing on the right-hand side). The X and Y chromosomes now appear almost equal in length in the bivalent. Scale bar is equal to 5 μm in (B) and 10 μm in (D, E, F). Chromosomes were counterstained with DAPI (blue). Arrowheads indicate hybridization signals of the digoxigenin-labelled X-probes (green); arrows indicate a pair of the largest chromosomes (B) or the largest bivalent (F).

    Article Snippet: Validation of Y-linked scaffolds Candidate Y-linked scaffolds were validated by PCR on male and female genomic DNA samples, using ThermoPrime Plus DNA polymerase (Thermo Scientific).

    Techniques: Fluorescence In Situ Hybridization, Derivative Assay, Polymerase Chain Reaction, Hybridization, Construct, Staining