genomic dna gdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    Monarch gDNA Wash Buffer
    Description:
    Monarch gDNA Wash Buffer is a component of the Monarch Genomic DNA Purification Kit It is an ethanol based low salt buffer that allows for complete removal of chaotropic salt and cell components in just 2 wash steps enabling the purification of highly pure gDNA
    Catalog Number:
    T3015L
    Price:
    32
    Category:
    Genomic DNA Purification Kit Components
    Size:
    60 ml
    Buy from Supplier


    Structured Review

    New England Biolabs genomic dna gdna
    Monarch gDNA Wash Buffer
    Monarch gDNA Wash Buffer is a component of the Monarch Genomic DNA Purification Kit It is an ethanol based low salt buffer that allows for complete removal of chaotropic salt and cell components in just 2 wash steps enabling the purification of highly pure gDNA
    https://www.bioz.com/result/genomic dna gdna/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2021-06
    86/100 stars

    Images

    1) Product Images from "RNase H2, mutated in Aicardi‐Goutières syndrome, promotes LINE‐1 retrotransposition"

    Article Title: RNase H2, mutated in Aicardi‐Goutières syndrome, promotes LINE‐1 retrotransposition

    Journal: The EMBO Journal

    doi: 10.15252/embj.201798506

    Complementation of RNASEH 2A‐ KO HeLa cells Schematic of substrates used in RNase H activity assays. These assays either use an 18‐bp RNA:DNA hybrid (left), or a short dsDNA containing a single‐embedded ribonucleotide (DRD:DNA). RNASEH2A‐WT can cleave both with high efficiency (++++), whereas RNASEH2A‐CD (with D34A and D169A mutations) cannot cleave either (−). The separation of function mutant (SoF, with P40D and Y210A mutations) retains some activity against RNA:DNA heteroduplexes (++), but has virtually no activity against single‐embedded ribonucleotides (−). RNase H2 SoF has reduced activity against RNA:DNA heteroduplexes and does not fully process the hybrid, even at high concentration and/or long incubation times. RNase H activity was measured using the 18‐bp RNA:DNA substrate, separating products by denaturing PAGE after cleavage with RNase H2. WT, SoF and CD RNase H2 were used at 0.25 nM for 4 h (left) or 2.0 nM for 2 h (right). Note the different pattern of products generated for SoF and WT. As expected, the high levels of genome‐embedded ribonucleotides in RNASEH2A‐KO cells are rescued only by complementation with wild‐type RNASEH2A (+WT), not by SoF RNASEH2A (+SoF), CD RNASEH2A‐A (+CD) or the empty vector (+EV). Genomic DNA was isolated from parental cells, a control clone (C1) and the four complemented cell lines (+EV, +WT, +SoF and +CD), RNase H2 treated and separated by alkaline gel electrophoresis. Smaller fragments indicate larger numbers of embedded ribonucleotides. Representative gels (used for quantifications in Figure 5 F and G) with results from RNase H activity against single‐embedded ribonucleotides (D and E) and activity against RNA:DNA heteroduplexes (F and G) assays conducted with lysates from the indicated cell lines. Because RNase H1 is expressed in all of these cells, activity measured against RNA:DNA heteroduplex substrate in RNASEH2A‐KO cell lysates is not completely absent. In addition, other nucleases present in the cell lysate act (non‐specifically) on the substrate, causing further background activity on both substrates. Wild‐type RNASEH2A rescues the LINE‐1 retrotransposition defect in RNASEH2A‐KO2 cells. Representative retrotransposition and toxicity assays conducted in RNASEH2A‐KO2 cells and RNASEH2A‐KO2 complemented with wild‐type RNASEH2A (+WT). Cells were transfected with an active human LINE‐1 (WT‐hL1, element L1.3), an RT‐mutant LINE‐1 (RTm‐hL1, D702A), or a toxicity control plasmid (CTRL, pcDNA6.1). Right panel, quantification of L1‐WT retrotransposition. For comparison, the retrotransposition level in KO2 cells was set at 100%. Mean ± SD for n = 3 technical replicates (representative of three independent experiments). RNase H2 SoF has reduced RNA:DNA heteroduplex substrate affinity. Initial substrate conversion rates (V i ) by 0.1 nM recombinant RNase H2 were measured at different 18‐mer RNA:DNA substrate concentrations. Mean ± SEM for n = 3 independent experiments. K m and k cat ± SEM were calculated in GraphPad Prism 5.04, using non‐linear regression. Change for SoF compared to WT indicated between brackets.
    Figure Legend Snippet: Complementation of RNASEH 2A‐ KO HeLa cells Schematic of substrates used in RNase H activity assays. These assays either use an 18‐bp RNA:DNA hybrid (left), or a short dsDNA containing a single‐embedded ribonucleotide (DRD:DNA). RNASEH2A‐WT can cleave both with high efficiency (++++), whereas RNASEH2A‐CD (with D34A and D169A mutations) cannot cleave either (−). The separation of function mutant (SoF, with P40D and Y210A mutations) retains some activity against RNA:DNA heteroduplexes (++), but has virtually no activity against single‐embedded ribonucleotides (−). RNase H2 SoF has reduced activity against RNA:DNA heteroduplexes and does not fully process the hybrid, even at high concentration and/or long incubation times. RNase H activity was measured using the 18‐bp RNA:DNA substrate, separating products by denaturing PAGE after cleavage with RNase H2. WT, SoF and CD RNase H2 were used at 0.25 nM for 4 h (left) or 2.0 nM for 2 h (right). Note the different pattern of products generated for SoF and WT. As expected, the high levels of genome‐embedded ribonucleotides in RNASEH2A‐KO cells are rescued only by complementation with wild‐type RNASEH2A (+WT), not by SoF RNASEH2A (+SoF), CD RNASEH2A‐A (+CD) or the empty vector (+EV). Genomic DNA was isolated from parental cells, a control clone (C1) and the four complemented cell lines (+EV, +WT, +SoF and +CD), RNase H2 treated and separated by alkaline gel electrophoresis. Smaller fragments indicate larger numbers of embedded ribonucleotides. Representative gels (used for quantifications in Figure 5 F and G) with results from RNase H activity against single‐embedded ribonucleotides (D and E) and activity against RNA:DNA heteroduplexes (F and G) assays conducted with lysates from the indicated cell lines. Because RNase H1 is expressed in all of these cells, activity measured against RNA:DNA heteroduplex substrate in RNASEH2A‐KO cell lysates is not completely absent. In addition, other nucleases present in the cell lysate act (non‐specifically) on the substrate, causing further background activity on both substrates. Wild‐type RNASEH2A rescues the LINE‐1 retrotransposition defect in RNASEH2A‐KO2 cells. Representative retrotransposition and toxicity assays conducted in RNASEH2A‐KO2 cells and RNASEH2A‐KO2 complemented with wild‐type RNASEH2A (+WT). Cells were transfected with an active human LINE‐1 (WT‐hL1, element L1.3), an RT‐mutant LINE‐1 (RTm‐hL1, D702A), or a toxicity control plasmid (CTRL, pcDNA6.1). Right panel, quantification of L1‐WT retrotransposition. For comparison, the retrotransposition level in KO2 cells was set at 100%. Mean ± SD for n = 3 technical replicates (representative of three independent experiments). RNase H2 SoF has reduced RNA:DNA heteroduplex substrate affinity. Initial substrate conversion rates (V i ) by 0.1 nM recombinant RNase H2 were measured at different 18‐mer RNA:DNA substrate concentrations. Mean ± SEM for n = 3 independent experiments. K m and k cat ± SEM were calculated in GraphPad Prism 5.04, using non‐linear regression. Change for SoF compared to WT indicated between brackets.

    Techniques Used: Activity Assay, Mutagenesis, Concentration Assay, Incubation, Polyacrylamide Gel Electrophoresis, Generated, Plasmid Preparation, Isolation, Nucleic Acid Electrophoresis, Transfection, Recombinant

    Reduced LINE ‐1 retrotransposition in RN ase H2 null U2 OS cells Western blot analysis shows absence of RNASEH2A and reduced RNASEH2B and C in RNASEH2A‐KO clones (KO1, KO2), compared to parental cells or a control clone (C1). Vinculin was used as a loading control. RNase H assay shows absence of activity against single‐embedded ribonucleotides in KO clones, compared to control cells. Activity in parental U2OS cells set at 100%. Mean ± SD for two independent experiments. High levels of genome‐embedded ribonucleotides in U2OS RNASEH2‐KO clones. Genomic DNA was isolated from parental cells, KO and control clones, RNase H2 treated and separated by alkaline gel electrophoresis. Smaller fragments indicate more genome‐embedded ribonucleotides. Schematic of plasmid JJ101/L1.3 and representative retrotransposition and toxicity assays conducted in parental U2OS cells, a control clone (C1), and two RNASEH2A‐KO clones (KO1 and KO2). Cells were transfected with vectors containing an active human LINE‐1 (WT‐hL1, element L1.3), an RT‐mutant (RTm‐hL1, L1.3 D702A), or a toxicity control vector (CTRL, pcDNA6.1). Quantification of L1‐WT retrotransposition, with the level in parental cells set to 100% for comparison. Plotted, mean ± SD for three technical replicates. Numbers indicate the average ± SD of n = 2 controls (parental, C1) and n = 2 (KO1, KO2) (representative of three independent experiments). Source data are available online for this figure.
    Figure Legend Snippet: Reduced LINE ‐1 retrotransposition in RN ase H2 null U2 OS cells Western blot analysis shows absence of RNASEH2A and reduced RNASEH2B and C in RNASEH2A‐KO clones (KO1, KO2), compared to parental cells or a control clone (C1). Vinculin was used as a loading control. RNase H assay shows absence of activity against single‐embedded ribonucleotides in KO clones, compared to control cells. Activity in parental U2OS cells set at 100%. Mean ± SD for two independent experiments. High levels of genome‐embedded ribonucleotides in U2OS RNASEH2‐KO clones. Genomic DNA was isolated from parental cells, KO and control clones, RNase H2 treated and separated by alkaline gel electrophoresis. Smaller fragments indicate more genome‐embedded ribonucleotides. Schematic of plasmid JJ101/L1.3 and representative retrotransposition and toxicity assays conducted in parental U2OS cells, a control clone (C1), and two RNASEH2A‐KO clones (KO1 and KO2). Cells were transfected with vectors containing an active human LINE‐1 (WT‐hL1, element L1.3), an RT‐mutant (RTm‐hL1, L1.3 D702A), or a toxicity control vector (CTRL, pcDNA6.1). Quantification of L1‐WT retrotransposition, with the level in parental cells set to 100% for comparison. Plotted, mean ± SD for three technical replicates. Numbers indicate the average ± SD of n = 2 controls (parental, C1) and n = 2 (KO1, KO2) (representative of three independent experiments). Source data are available online for this figure.

    Techniques Used: Western Blot, Clone Assay, Rnase H Assay, Activity Assay, Isolation, Nucleic Acid Electrophoresis, Plasmid Preparation, Transfection, Mutagenesis

    Reduced LINE ‐1 retrotransposition in RN ase H2 null HeLa cells Western blot analysis shows absence of RNASEH2A and reduced RNASEH2B and C in RNASEH2A‐KO clones (KO1‐6), compared to parental cells or control clones (C1‐5). Tubulin was used as a loading control. RNase H assay shows absence of activity against single‐embedded ribonucleotides in KO clones, with a smaller, but consistent reduction in all control clones. Activity in parental HeLa cells set at 100%. Data points represent the mean of three technical replicates for individual clones. Lines indicate the mean of six biological replicates (C1‐6 and KO1‐6) ± SEM. High levels of genome‐embedded ribonucleotides in KO clones. Genomic DNA isolated from parental cells, KO and control clones, was RNase H2 treated and separated by alkaline gel electrophoresis. Smaller fragments indicate larger numbers of embedded ribonucleotides. Schematic of retrotransposition vector JJ101/L1.3 (see also Fig EV1 A). Within L1‐ORF2p, relative positions of EN (endonuclease), RT (reverse transcriptase) and C (cysteine‐rich) domains are indicated. Orange box with backward BLAST label depicts the retrotransposition indicator cassette mblastI . Quantification of L1‐WT retrotransposition, normalised to the level in parental cells and normalised for transfection efficiency (TE), set to 100% for comparison. Data points represent the mean of three technical replicates for individual clones. Lines indicate the mean of six biological replicates (C1‐6 and KO1‐6) ± SEM (representative of six independent experiments). Mann–Whitney test; ** P
    Figure Legend Snippet: Reduced LINE ‐1 retrotransposition in RN ase H2 null HeLa cells Western blot analysis shows absence of RNASEH2A and reduced RNASEH2B and C in RNASEH2A‐KO clones (KO1‐6), compared to parental cells or control clones (C1‐5). Tubulin was used as a loading control. RNase H assay shows absence of activity against single‐embedded ribonucleotides in KO clones, with a smaller, but consistent reduction in all control clones. Activity in parental HeLa cells set at 100%. Data points represent the mean of three technical replicates for individual clones. Lines indicate the mean of six biological replicates (C1‐6 and KO1‐6) ± SEM. High levels of genome‐embedded ribonucleotides in KO clones. Genomic DNA isolated from parental cells, KO and control clones, was RNase H2 treated and separated by alkaline gel electrophoresis. Smaller fragments indicate larger numbers of embedded ribonucleotides. Schematic of retrotransposition vector JJ101/L1.3 (see also Fig EV1 A). Within L1‐ORF2p, relative positions of EN (endonuclease), RT (reverse transcriptase) and C (cysteine‐rich) domains are indicated. Orange box with backward BLAST label depicts the retrotransposition indicator cassette mblastI . Quantification of L1‐WT retrotransposition, normalised to the level in parental cells and normalised for transfection efficiency (TE), set to 100% for comparison. Data points represent the mean of three technical replicates for individual clones. Lines indicate the mean of six biological replicates (C1‐6 and KO1‐6) ± SEM (representative of six independent experiments). Mann–Whitney test; ** P

    Techniques Used: Western Blot, Clone Assay, Rnase H Assay, Activity Assay, Isolation, Nucleic Acid Electrophoresis, Plasmid Preparation, Transfection, MANN-WHITNEY

    2) Product Images from "Detection of CRISPR-Cas9-Mediated Mutations Using a Carbon Nanotube-Modified Electrochemical Genosensor"

    Article Title: Detection of CRISPR-Cas9-Mediated Mutations Using a Carbon Nanotube-Modified Electrochemical Genosensor

    Journal: Biosensors

    doi: 10.3390/bios11010017

    Clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) was designed with complementary nucleotides adjacent to the protospacer adjacent motif (PAM) to target CRISPR-associated protein 9 (Cas9) endonuclease to the correct DNA sequence within genomic DNA. HNH (an endonuclease domain named for characteristic histidine and asparagine residues) and RuvC-like nuclease domains cut the target DNA 3 nucleotides upstream of the PAM (NGG) sequence leading to the formation of a double-strand break. Mutations were inserted utilizing a homology-directed repair (HDR) pathway to repair the dsDNA breaks using 98 nt single-strand oligodeoxynucleotide (ODN) sequence as a template with 40–50 nucleotides flanking the dsDNA break site to introduce point mutations (PM).
    Figure Legend Snippet: Clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) was designed with complementary nucleotides adjacent to the protospacer adjacent motif (PAM) to target CRISPR-associated protein 9 (Cas9) endonuclease to the correct DNA sequence within genomic DNA. HNH (an endonuclease domain named for characteristic histidine and asparagine residues) and RuvC-like nuclease domains cut the target DNA 3 nucleotides upstream of the PAM (NGG) sequence leading to the formation of a double-strand break. Mutations were inserted utilizing a homology-directed repair (HDR) pathway to repair the dsDNA breaks using 98 nt single-strand oligodeoxynucleotide (ODN) sequence as a template with 40–50 nucleotides flanking the dsDNA break site to introduce point mutations (PM).

    Techniques Used: CRISPR, Sequencing, Introduce

    3) Product Images from "Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA"

    Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

    Journal: Nature

    doi: 10.1038/nature12905

    Activity of NgTet1 on various DNA substrates a–c , The time courses (lanes 5–13) of the reactions using 32-bp DNA substrates containing 5mC (panel a ), 5hmC (panel b ) or 5caC (panel c ). Lanes 1–4: antibody sensitivity against 10 pmol of control oligonucleotides and 2 fold serial dilutions. Lanes 5–13: the rate of conversion appears to be the fastest for the reaction of 5mC to 5hmC, and decreases with each subsequent reaction: 5mC to 5hmC > 5hmC to 5fC > 5fC to 5caC. d , Activities of NgTet1 (20 µM) on genomic DNA (gDNA) of Hela cells (2.5 µg). After 1 h reaction, 87% of the products are 5caC in gDNA with the remaining being 5fC and 5hmC. The percentages were estimated from integration of the peaks in LC-MS traces. The mean and standard deviation (±s.e.m.) were estimated from three repeated experiments. e , Human thymine DNA glycosylase (TDG) excises 5fC and 5caC (but not 5mC and 5hmC) when paired with a guanine in a CpG sequence (lanes 1–4) (He et al., 2011; Maiti and Drohat, 2011; Hashimoto et al., 2012). After NgTet1 reactions with DNA substrates containing 5mC, 5hmC or 5fC, in the presence of αKG, the product DNA containing 5fC and 5caC becomes a substrate for TDG (lanes 6, 8 and 10), but not with NOG (lanes 5 and 7), again demonstrating the production of 5fC and 5caC by NgTet1. f , Activities of NgTet1 on 56-bp double-stranded (ds) DNA-2 with methylation on both strands (M/M) or single strand (hemi-methylated either on top M/C or bottom C/M strand) or single-stranded (ss) DNA (Reaction time 1 h and ±s.e.m. estimated from three repeats). We note that an in vitro activity of the mouse Tet1 catalytic domain on single-stranded DNA has also been observed (Zhang et al., 2012). g , LC-MS traces of a sample reaction mix on the hemi-methylated 5mCpG dsDNA-1 (top panel), reaction control with no enzyme (middle panel), and the standard deoxyribonucleoside mix (bottom panel). Arrows indicate peaks of 5mC, 5hmC, 5fC and 5caC. Identities of the peaks are confirmed by comparing the retention time with the standard as well as by mass spectrometry. Hashimoto, H., Hong, S., Bhagwat, A. S., Zhang, X. Cheng, X. Excision of 5-hydroxymethyluracil and 5-carboxylcytosine by the thymine DNA glycosylase domain: its structural basis and implications for active DNA demethylation. Nucleic Acids Res 40 , 10203–10214 (2012). He, Y. F. et al . Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333 , 1303–1307 (2011). Maiti, A. Drohat, A. C. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J Biol Chem 286 , 35334–35338 (2011). Zhang, L., Yu, M. He, C. Mouse Tet1 protein can oxidize 5mC to 5hmC and 5caC on single-stranded DNA. Acta Chimica Sinica 70 , 2123–2126 (2012).
    Figure Legend Snippet: Activity of NgTet1 on various DNA substrates a–c , The time courses (lanes 5–13) of the reactions using 32-bp DNA substrates containing 5mC (panel a ), 5hmC (panel b ) or 5caC (panel c ). Lanes 1–4: antibody sensitivity against 10 pmol of control oligonucleotides and 2 fold serial dilutions. Lanes 5–13: the rate of conversion appears to be the fastest for the reaction of 5mC to 5hmC, and decreases with each subsequent reaction: 5mC to 5hmC > 5hmC to 5fC > 5fC to 5caC. d , Activities of NgTet1 (20 µM) on genomic DNA (gDNA) of Hela cells (2.5 µg). After 1 h reaction, 87% of the products are 5caC in gDNA with the remaining being 5fC and 5hmC. The percentages were estimated from integration of the peaks in LC-MS traces. The mean and standard deviation (±s.e.m.) were estimated from three repeated experiments. e , Human thymine DNA glycosylase (TDG) excises 5fC and 5caC (but not 5mC and 5hmC) when paired with a guanine in a CpG sequence (lanes 1–4) (He et al., 2011; Maiti and Drohat, 2011; Hashimoto et al., 2012). After NgTet1 reactions with DNA substrates containing 5mC, 5hmC or 5fC, in the presence of αKG, the product DNA containing 5fC and 5caC becomes a substrate for TDG (lanes 6, 8 and 10), but not with NOG (lanes 5 and 7), again demonstrating the production of 5fC and 5caC by NgTet1. f , Activities of NgTet1 on 56-bp double-stranded (ds) DNA-2 with methylation on both strands (M/M) or single strand (hemi-methylated either on top M/C or bottom C/M strand) or single-stranded (ss) DNA (Reaction time 1 h and ±s.e.m. estimated from three repeats). We note that an in vitro activity of the mouse Tet1 catalytic domain on single-stranded DNA has also been observed (Zhang et al., 2012). g , LC-MS traces of a sample reaction mix on the hemi-methylated 5mCpG dsDNA-1 (top panel), reaction control with no enzyme (middle panel), and the standard deoxyribonucleoside mix (bottom panel). Arrows indicate peaks of 5mC, 5hmC, 5fC and 5caC. Identities of the peaks are confirmed by comparing the retention time with the standard as well as by mass spectrometry. Hashimoto, H., Hong, S., Bhagwat, A. S., Zhang, X. Cheng, X. Excision of 5-hydroxymethyluracil and 5-carboxylcytosine by the thymine DNA glycosylase domain: its structural basis and implications for active DNA demethylation. Nucleic Acids Res 40 , 10203–10214 (2012). He, Y. F. et al . Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333 , 1303–1307 (2011). Maiti, A. Drohat, A. C. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J Biol Chem 286 , 35334–35338 (2011). Zhang, L., Yu, M. He, C. Mouse Tet1 protein can oxidize 5mC to 5hmC and 5caC on single-stranded DNA. Acta Chimica Sinica 70 , 2123–2126 (2012).

    Techniques Used: Activity Assay, Liquid Chromatography with Mass Spectroscopy, Standard Deviation, Sequencing, Methylation, In Vitro, Mass Spectrometry

    Pairwise comparison of NgTet1 and mammalian Tet1 a , Schematic representation of hTet1 C-terminal catalytic domain. b , Sequence alignment of NgTet1, hTet1 and mTet1. Labels above the sequences indicate that i for intra-molecular polar interaction; s for exposed surface residue; h for hydrophobic core; t for structural turn; α for αKG binding; m for metal ion coordination; P for DNA phosphate interaction; g for DNA base interaction with the orphaned guanine; G for DNA base interaction with the 3’ guanine to 5mC; C for 5mC interaction; a for active site residues (A212 and V293) near the methyl group of 5mC. c , Structure of NgTet1 with arrows indicating the two large insertions of mammalian Tet1. Highlighted is the charge-charge interaction between invariant K86 and E108. d , A kinked helix α4, owing to P172 (conserved among NgTet1, human and mouse Tet1, Tet2 and Tet3) located in the middle. f , Antibody detection of 5hmC in genomic DNA of HEK293T cells (top panel) expressing Flag tagged mouse Tet1 catalytic domain or its internal deletions (bottom panel). Top panel: Lane 1 is the 32-bp oligonucleotide containing a single 5hmC (20 pmol and 2 fold serial dilutions) and lanes 2–7 are the genomic DNA (500 ng and 2 fold serial dilutions). Bottom panel: Lane 1 is the molecular weight marker and Lanes 2 and 7 are the whole cell lysates with approximately equal amount of protein.
    Figure Legend Snippet: Pairwise comparison of NgTet1 and mammalian Tet1 a , Schematic representation of hTet1 C-terminal catalytic domain. b , Sequence alignment of NgTet1, hTet1 and mTet1. Labels above the sequences indicate that i for intra-molecular polar interaction; s for exposed surface residue; h for hydrophobic core; t for structural turn; α for αKG binding; m for metal ion coordination; P for DNA phosphate interaction; g for DNA base interaction with the orphaned guanine; G for DNA base interaction with the 3’ guanine to 5mC; C for 5mC interaction; a for active site residues (A212 and V293) near the methyl group of 5mC. c , Structure of NgTet1 with arrows indicating the two large insertions of mammalian Tet1. Highlighted is the charge-charge interaction between invariant K86 and E108. d , A kinked helix α4, owing to P172 (conserved among NgTet1, human and mouse Tet1, Tet2 and Tet3) located in the middle. f , Antibody detection of 5hmC in genomic DNA of HEK293T cells (top panel) expressing Flag tagged mouse Tet1 catalytic domain or its internal deletions (bottom panel). Top panel: Lane 1 is the 32-bp oligonucleotide containing a single 5hmC (20 pmol and 2 fold serial dilutions) and lanes 2–7 are the genomic DNA (500 ng and 2 fold serial dilutions). Bottom panel: Lane 1 is the molecular weight marker and Lanes 2 and 7 are the whole cell lysates with approximately equal amount of protein.

    Techniques Used: Sequencing, Binding Assay, Expressing, Molecular Weight, Marker

    4) Product Images from "LeishIF4E1 Deletion Affects the Promastigote Proteome, Morphology, and Infectivity"

    Article Title: LeishIF4E1 Deletion Affects the Promastigote Proteome, Morphology, and Infectivity

    Journal: mSphere

    doi: 10.1128/mSphere.00625-19

    CRISPR-Cas9-mediated deletion of LeishIF4E1. (A) A diagnostic PCR was carried out to confirm the deletion of LeishIF4E1 from the genome of L. mexicana . Genomic DNA extracted from the LeishIF4E1 –/– deletion mutant and from the control cell line of L. mexicana expressing Cas9/T7 was used as a template for PCR using primers derived from the LeishIF4E1 ORF and from the G418 resistance gene ORF. (B) Schematic design of the LeishIF4E1 locus and the primers (arrows) used to diagnose the presence or absence of theLeishIF4E1 and G418 resistance genes in the genome of the LeishIF4E1 –/– mutant. Primers derived from the LeishIF4E1 ORF are shown in blue. Primers derived from the G418 resistance (G418 r ) gene are shown in red. (C) Western blot using antibodies specific for LeishIF4E1, verifying the absence of LeishIF4E1 in the LeishIF4E1 –/– deletion cell line and its presence in the control Cas9/T7 cell line. Cell extracts from the respective cell lines were separated by 12% SDS-PAGE and subjected to Western blot analysis. The interaction with antibodies against LeishIF4A-1 served as a loading control.
    Figure Legend Snippet: CRISPR-Cas9-mediated deletion of LeishIF4E1. (A) A diagnostic PCR was carried out to confirm the deletion of LeishIF4E1 from the genome of L. mexicana . Genomic DNA extracted from the LeishIF4E1 –/– deletion mutant and from the control cell line of L. mexicana expressing Cas9/T7 was used as a template for PCR using primers derived from the LeishIF4E1 ORF and from the G418 resistance gene ORF. (B) Schematic design of the LeishIF4E1 locus and the primers (arrows) used to diagnose the presence or absence of theLeishIF4E1 and G418 resistance genes in the genome of the LeishIF4E1 –/– mutant. Primers derived from the LeishIF4E1 ORF are shown in blue. Primers derived from the G418 resistance (G418 r ) gene are shown in red. (C) Western blot using antibodies specific for LeishIF4E1, verifying the absence of LeishIF4E1 in the LeishIF4E1 –/– deletion cell line and its presence in the control Cas9/T7 cell line. Cell extracts from the respective cell lines were separated by 12% SDS-PAGE and subjected to Western blot analysis. The interaction with antibodies against LeishIF4A-1 served as a loading control.

    Techniques Used: CRISPR, Diagnostic Assay, Polymerase Chain Reaction, Mutagenesis, Expressing, Derivative Assay, Western Blot, SDS Page

    Related Articles

    Sampling:

    Article Title: Whole mitochondrial genome sequence and phylogenetic relationships of Williams’s jerboa (Scarturus williamsi) from Turkey
    Article Snippet: To rectify these limitations, the present study aimed to (i) generate and assemble the first mitogenome data of Turkish S. williamsi by using the next-generation sequencing platform, (ii) characterize the mitogenome of the species by comparing it with the available mitogenomes of other jerboa species, and (iii) reveal the phylogenetic relationships of S. williamsi based on previously published and available mitogenome data in GenBank of Dipodoidea/Myomorpha species. .. Sampling, gDNA extraction and long-range PCR amplification A tissue sample (muscle) was obtained from one female individual of S. williamsi collected from Yeşilli Village, Sulakyurt, Kırıkkale (road-killed individual; collection number: 484). .. Genomic DNA (gDNA) isolation was conducted using the QIAGEN DNeasy® Blood & Tissue Kit by following the manufacturer’s instructions.

    Polymerase Chain Reaction:

    Article Title: Whole mitochondrial genome sequence and phylogenetic relationships of Williams’s jerboa (Scarturus williamsi) from Turkey
    Article Snippet: To rectify these limitations, the present study aimed to (i) generate and assemble the first mitogenome data of Turkish S. williamsi by using the next-generation sequencing platform, (ii) characterize the mitogenome of the species by comparing it with the available mitogenomes of other jerboa species, and (iii) reveal the phylogenetic relationships of S. williamsi based on previously published and available mitogenome data in GenBank of Dipodoidea/Myomorpha species. .. Sampling, gDNA extraction and long-range PCR amplification A tissue sample (muscle) was obtained from one female individual of S. williamsi collected from Yeşilli Village, Sulakyurt, Kırıkkale (road-killed individual; collection number: 484). .. Genomic DNA (gDNA) isolation was conducted using the QIAGEN DNeasy® Blood & Tissue Kit by following the manufacturer’s instructions.

    Amplification:

    Article Title: Whole mitochondrial genome sequence and phylogenetic relationships of Williams’s jerboa (Scarturus williamsi) from Turkey
    Article Snippet: To rectify these limitations, the present study aimed to (i) generate and assemble the first mitogenome data of Turkish S. williamsi by using the next-generation sequencing platform, (ii) characterize the mitogenome of the species by comparing it with the available mitogenomes of other jerboa species, and (iii) reveal the phylogenetic relationships of S. williamsi based on previously published and available mitogenome data in GenBank of Dipodoidea/Myomorpha species. .. Sampling, gDNA extraction and long-range PCR amplification A tissue sample (muscle) was obtained from one female individual of S. williamsi collected from Yeşilli Village, Sulakyurt, Kırıkkale (road-killed individual; collection number: 484). .. Genomic DNA (gDNA) isolation was conducted using the QIAGEN DNeasy® Blood & Tissue Kit by following the manufacturer’s instructions.

    DNA Extraction:

    Article Title: Dissecting individual pathogen-commensal interactions within a complex gut microbiota community
    Article Snippet: .. Genomic DNA extraction DNA extraction was carried out using a phenol chloroform-based method. .. The cell pellets were re-suspended in 500 μl of 5 mg/ml lysozyme (VWR) and incubated for 20 min at 37°C.

    Article Title: Detection of CRISPR-Cas9-Mediated Mutations Using a Carbon Nanotube-Modified Electrochemical Genosensor
    Article Snippet: Single cells were cultured in a flat bottomed 96-well plate for 2 weeks, replacing media every 2–3 days and passaging cells on to 24 well plates. .. Genomic DNA (gDNA) was extracted using 50 μL of QuickExtract™ DNA extraction solution (Epicentre-Lucigen). .. The sequences of interest were screened after digestion with BanI (S331) restriction enzymes. gDNA was PCR amplified using One Taq Quick-Load 2× master mix (New England BioLabs, Ipswich, MA, USA), 94 °C-30 s, 30 cycles of 94 °C-30 s, 68 °C-30 s, 68 °C-60 s, the final extension was carried out at of 68 °C-5 min. PCR products were DNA sequenced to verify the presence of mutations.

    Purification:

    Article Title: The receptor PTPRU is a redox sensitive pseudophosphatase
    Article Snippet: Recombinant protein pull downs50 μg of biotinylated Avi-tag recombinant PTP domains were bound to 167 μl of streptavidin-coated magnetic beads (New England Biolabs) made up to a total volume of 500 μl in ice-cold purification buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5% [v/v] glycerol, 5 mM DTT) at 4 °C for 1.5 h with rotation. .. Beads were collected using a magnetic stand and washed 3 times in ice-cold purification buffer, followed by two washes with ice-cold 150 mM NaCl wash buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10% [v/v] glycerol, 1% [v/v] Triton X-100, 1 mM EDTA). ..

    Fluorescence In Situ Hybridization:

    Article Title: Her9/Hes4 is required for retinal photoreceptor development, maintenance, and survival
    Article Snippet: HRMA was performed using the LightCycler 480 High-Resolution Melting Master (Roche) kit according to the manufacturer's instructions on a LightCycler 96 Real-Time PCR System (Roche). .. Genomic DNA (gDNA) extraction and amplificationgDNA was extracted from whole embryos or from tail clips of adult fish. .. The embryos or tails were placed in 20 µl of 1 × Thermopol buffer (NEB, Ipswich, MA) and incubated at 95°C to soften the tissue.

    Isolation:

    Article Title: Reduced chlorhexidine and daptomycin susceptibility arises in vancomycin-resistant Enterococcus faecium after serial chlorhexidine exposure
    Article Snippet: .. Routine molecular biology techniques E. faecium genomic DNA (gDNA) was isolated using a previously published protocol ( ). .. DNA fragments were purified using the Purelink PCR purification kit (Thermo Fisher).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs monarch gdna blood lysis buffer
    SHK-1 cells were electroporated with 1.4 μM Cas9:gRNA RNP and transferred to 2 separate 96-well plates. (A) After 48h, cell survival (plate1) was calculated using CellTiter Glo 2.0. (B) genomic <t>DNA</t> (plate 2) was extracted at 7 dpt, and the target sequence amplified by PCR and editing efficiency estimated using Sanger sequencing. (C) Using 1.4 μM RNP, the editing efficiency after 7 and 14 ddpt was estimated for different electroporation settings. (D) All the sequencing data, obtained from ICE analysis of Sanger sequencing of the intergenic target region from optimisation experiments (n=55) were pooled and plotted according to edit pattern.
    Monarch Gdna Blood Lysis Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/monarch gdna blood lysis buffer/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    monarch gdna blood lysis buffer - by Bioz Stars, 2021-06
    93/100 stars
      Buy from Supplier

    99
    New England Biolabs ultra ii dna library prep kit procedure
    Agarose-gel electrophoresis of gDNA fragmented by the <t>FTP</t> method. gDNA of E . coli BL21 was incubated as described in Materials and Methods: without enzymes (lane 1), with SD polymerase (lane 2), with DNase I (lane 3), and with both DNase I and SD polymerase (lane 4 and 5). M1: 1 kb <t>DNA</t> Ladder; M2: 100 bp DNA Ladder.
    Ultra Ii Dna Library Prep Kit Procedure, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultra ii dna library prep kit procedure/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ultra ii dna library prep kit procedure - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs p atrosepticum scri1043 genomic dna
    P. <t>atrosepticum</t> produces molecular hydrogen gas. A. Anaerobic hydrogen production is optimal at lower temperatures. The P. atrosepticum SCRI1043 parent strain was incubated in M9 medium supplemented with 0.8% (w/v) glucose for 168 h at the temperatures indicated before gaseous H 2 accumulation was quantified. B. A time course of H 2 accumulation. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C and gaseous H 2 accumulation was measured every 24 h. C. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with either 0.5% (v/v) glycerol and 0.4% (w/v) nitrate (‘Gly Nit’); 0.5% (v/v) glycerol and 0.4% (w/v) fumarate (‘Gly Fum’); 0.5% (v/v) glycerol only (Gly); or 0.8% (w/v) glucose only (‘Glc’) at 24°C for 48 h. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).
    P Atrosepticum Scri1043 Genomic Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p atrosepticum scri1043 genomic dna/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    p atrosepticum scri1043 genomic dna - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    96
    New England Biolabs asi si genomic dna
    Cleavage analysis of <t>Asi</t> SI sites. ( A ) Genomic <t>DNA</t> was extracted before and after 4OHT treatment and assayed for cleavage at Asi SI sites as described in ‘Materials and methods' section. Pulled down DNA was analysed by Q–PCR amplification
    Asi Si Genomic Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/asi si genomic dna/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    asi si genomic dna - by Bioz Stars, 2021-06
    96/100 stars
      Buy from Supplier

    Image Search Results


    SHK-1 cells were electroporated with 1.4 μM Cas9:gRNA RNP and transferred to 2 separate 96-well plates. (A) After 48h, cell survival (plate1) was calculated using CellTiter Glo 2.0. (B) genomic DNA (plate 2) was extracted at 7 dpt, and the target sequence amplified by PCR and editing efficiency estimated using Sanger sequencing. (C) Using 1.4 μM RNP, the editing efficiency after 7 and 14 ddpt was estimated for different electroporation settings. (D) All the sequencing data, obtained from ICE analysis of Sanger sequencing of the intergenic target region from optimisation experiments (n=55) were pooled and plotted according to edit pattern.

    Journal: bioRxiv

    Article Title: Efficient genome editing in multiple salmonid cell lines using ribonucleoprotein complexes

    doi: 10.1101/2020.04.03.022038

    Figure Lengend Snippet: SHK-1 cells were electroporated with 1.4 μM Cas9:gRNA RNP and transferred to 2 separate 96-well plates. (A) After 48h, cell survival (plate1) was calculated using CellTiter Glo 2.0. (B) genomic DNA (plate 2) was extracted at 7 dpt, and the target sequence amplified by PCR and editing efficiency estimated using Sanger sequencing. (C) Using 1.4 μM RNP, the editing efficiency after 7 and 14 ddpt was estimated for different electroporation settings. (D) All the sequencing data, obtained from ICE analysis of Sanger sequencing of the intergenic target region from optimisation experiments (n=55) were pooled and plotted according to edit pattern.

    Article Snippet: Genomic DNA (gDNA) was extracted with QuickExtract buffer (Lucigen, Middleton, USA) by adding 30 μL to a well of a 96-well plate and incubating for 5 min.

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction, Electroporation

    Agarose-gel electrophoresis of gDNA fragmented by the FTP method. gDNA of E . coli BL21 was incubated as described in Materials and Methods: without enzymes (lane 1), with SD polymerase (lane 2), with DNase I (lane 3), and with both DNase I and SD polymerase (lane 4 and 5). M1: 1 kb DNA Ladder; M2: 100 bp DNA Ladder.

    Journal: PLoS ONE

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing

    doi: 10.1371/journal.pone.0210374

    Figure Lengend Snippet: Agarose-gel electrophoresis of gDNA fragmented by the FTP method. gDNA of E . coli BL21 was incubated as described in Materials and Methods: without enzymes (lane 1), with SD polymerase (lane 2), with DNase I (lane 3), and with both DNase I and SD polymerase (lane 4 and 5). M1: 1 kb DNA Ladder; M2: 100 bp DNA Ladder.

    Article Snippet: NGS libraries from FTP digested gDNA were constructed using the NEBNext Ultra II DNA Library Prep Kit procedure, excluding the DNA end repair stage.

    Techniques: Agarose Gel Electrophoresis, Incubation

    A general overview of the dsDNA Fragmentation Through Polymerization (FTP) method. The FTP method is based on two enzymatic reactions: a DNA nicking reaction with DNase I and a strand-displacement DNA polymerization with SD DNA polymerase. As a result, multiple double-stranded DNA fragments with overlapping sequences are generated. De novo synthesized DNA is indicated in grey, and SD polymerase is indicated in red.

    Journal: PLoS ONE

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing

    doi: 10.1371/journal.pone.0210374

    Figure Lengend Snippet: A general overview of the dsDNA Fragmentation Through Polymerization (FTP) method. The FTP method is based on two enzymatic reactions: a DNA nicking reaction with DNase I and a strand-displacement DNA polymerization with SD DNA polymerase. As a result, multiple double-stranded DNA fragments with overlapping sequences are generated. De novo synthesized DNA is indicated in grey, and SD polymerase is indicated in red.

    Article Snippet: NGS libraries from FTP digested gDNA were constructed using the NEBNext Ultra II DNA Library Prep Kit procedure, excluding the DNA end repair stage.

    Techniques: Generated, Synthesized

    P. atrosepticum produces molecular hydrogen gas. A. Anaerobic hydrogen production is optimal at lower temperatures. The P. atrosepticum SCRI1043 parent strain was incubated in M9 medium supplemented with 0.8% (w/v) glucose for 168 h at the temperatures indicated before gaseous H 2 accumulation was quantified. B. A time course of H 2 accumulation. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C and gaseous H 2 accumulation was measured every 24 h. C. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with either 0.5% (v/v) glycerol and 0.4% (w/v) nitrate (‘Gly Nit’); 0.5% (v/v) glycerol and 0.4% (w/v) fumarate (‘Gly Fum’); 0.5% (v/v) glycerol only (Gly); or 0.8% (w/v) glucose only (‘Glc’) at 24°C for 48 h. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Journal: Molecular Microbiology

    Article Title: The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase‐2 complex

    doi: 10.1111/mmi.14370

    Figure Lengend Snippet: P. atrosepticum produces molecular hydrogen gas. A. Anaerobic hydrogen production is optimal at lower temperatures. The P. atrosepticum SCRI1043 parent strain was incubated in M9 medium supplemented with 0.8% (w/v) glucose for 168 h at the temperatures indicated before gaseous H 2 accumulation was quantified. B. A time course of H 2 accumulation. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C and gaseous H 2 accumulation was measured every 24 h. C. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with either 0.5% (v/v) glycerol and 0.4% (w/v) nitrate (‘Gly Nit’); 0.5% (v/v) glycerol and 0.4% (w/v) fumarate (‘Gly Fum’); 0.5% (v/v) glycerol only (Gly); or 0.8% (w/v) glucose only (‘Glc’) at 24°C for 48 h. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Article Snippet: Plasmids and complementation All plasmids were cloned using Gibson assembly (HiFi Assembly, NEB) using DNA amplified from P. atrosepticum SCRI1043 genomic DNA (Table ).

    Techniques: Incubation

    Hydrogen gas is produced by the activity of a selenium‐free formate dehydrogenase. A. Addition of exogenous formate increases H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ) and PH002 (Δ hybC ) were incubated in low‐salt (5 g l –1 ) LB (LSLB) rich medium supplemented with 0.2% or 0.4% (w/v) formate at 24°C for 48 h. B. The formate dehydrogenase encoded within the gene cluster is responsible for FHL‐2 activity. Strains SCRI1043, PH004 (Δ fdhF ), PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. C. Alternative formate dehydrogenase homologues do not have a major role in H 2 production. Strains SCRI1043, PH002 (Δ hybC ), PH019 (Δ hybC Δ ECA1964 ), PH028 (Δ hybC Δ ECA1507 ) and PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. D. Complementation of the mutant phenotype in trans . Strains PH002 (Δ hybC ) and PH005 (Δ hybC Δ fdhF ) were separately transformed with plasmids encoding either FdhF, ECA1964 or ECA1507 under the control of constitutive promoters. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3). In panel (D) a one‐tailed t ‐test was used to determine statistical significance (* P

    Journal: Molecular Microbiology

    Article Title: The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase‐2 complex

    doi: 10.1111/mmi.14370

    Figure Lengend Snippet: Hydrogen gas is produced by the activity of a selenium‐free formate dehydrogenase. A. Addition of exogenous formate increases H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ) and PH002 (Δ hybC ) were incubated in low‐salt (5 g l –1 ) LB (LSLB) rich medium supplemented with 0.2% or 0.4% (w/v) formate at 24°C for 48 h. B. The formate dehydrogenase encoded within the gene cluster is responsible for FHL‐2 activity. Strains SCRI1043, PH004 (Δ fdhF ), PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. C. Alternative formate dehydrogenase homologues do not have a major role in H 2 production. Strains SCRI1043, PH002 (Δ hybC ), PH019 (Δ hybC Δ ECA1964 ), PH028 (Δ hybC Δ ECA1507 ) and PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. D. Complementation of the mutant phenotype in trans . Strains PH002 (Δ hybC ) and PH005 (Δ hybC Δ fdhF ) were separately transformed with plasmids encoding either FdhF, ECA1964 or ECA1507 under the control of constitutive promoters. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3). In panel (D) a one‐tailed t ‐test was used to determine statistical significance (* P

    Article Snippet: Plasmids and complementation All plasmids were cloned using Gibson assembly (HiFi Assembly, NEB) using DNA amplified from P. atrosepticum SCRI1043 genomic DNA (Table ).

    Techniques: Produced, Activity Assay, Incubation, Mutagenesis, Transformation Assay, One-tailed Test

    Hydrogen gas is produced by the activity of [NiFe]‐Hydrogenase‐4. A. Hyd‐4 is responsible for fermentative H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. B. Complementation of the mutant phenotype in trans . Strains PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were separately transformed with plasmids encoding either HyfG or HybC under the control of constitutive promoters. Levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Journal: Molecular Microbiology

    Article Title: The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase‐2 complex

    doi: 10.1111/mmi.14370

    Figure Lengend Snippet: Hydrogen gas is produced by the activity of [NiFe]‐Hydrogenase‐4. A. Hyd‐4 is responsible for fermentative H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. B. Complementation of the mutant phenotype in trans . Strains PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were separately transformed with plasmids encoding either HyfG or HybC under the control of constitutive promoters. Levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Article Snippet: Plasmids and complementation All plasmids were cloned using Gibson assembly (HiFi Assembly, NEB) using DNA amplified from P. atrosepticum SCRI1043 genomic DNA (Table ).

    Techniques: Produced, Activity Assay, Incubation, Mutagenesis, Transformation Assay

    Cleavage analysis of Asi SI sites. ( A ) Genomic DNA was extracted before and after 4OHT treatment and assayed for cleavage at Asi SI sites as described in ‘Materials and methods' section. Pulled down DNA was analysed by Q–PCR amplification

    Journal: The EMBO Journal

    Article Title: High-resolution profiling of ?H2AX around DNA double strand breaks in the mammalian genome

    doi: 10.1038/emboj.2010.38

    Figure Lengend Snippet: Cleavage analysis of Asi SI sites. ( A ) Genomic DNA was extracted before and after 4OHT treatment and assayed for cleavage at Asi SI sites as described in ‘Materials and methods' section. Pulled down DNA was analysed by Q–PCR amplification

    Article Snippet: Asi SI genomic DNA, kindly provided by New England Biolabs (NEB), was amplified using the following primer pair (FW: ATAGATCTCATGGGCGAGTCTATTGATCA, REV: CTCGTCGACTCACAACATCACCTGGTC).

    Techniques: Polymerase Chain Reaction, Amplification

    4OHT treatment induces sequence-specific DSB induction in the Asi SI–ER U20S cell line. ( A ) U20S cells, which stably express Asi SI–ER–HA, were co-stained with DAPI (DNA) after incubation with antibodies against the HA tag, and γH2AX,

    Journal: The EMBO Journal

    Article Title: High-resolution profiling of ?H2AX around DNA double strand breaks in the mammalian genome

    doi: 10.1038/emboj.2010.38

    Figure Lengend Snippet: 4OHT treatment induces sequence-specific DSB induction in the Asi SI–ER U20S cell line. ( A ) U20S cells, which stably express Asi SI–ER–HA, were co-stained with DAPI (DNA) after incubation with antibodies against the HA tag, and γH2AX,

    Article Snippet: Asi SI genomic DNA, kindly provided by New England Biolabs (NEB), was amplified using the following primer pair (FW: ATAGATCTCATGGGCGAGTCTATTGATCA, REV: CTCGTCGACTCACAACATCACCTGGTC).

    Techniques: Sequencing, Stable Transfection, Staining, Incubation