Structured Review

Illumina Inc genome analyzer iix
Ago HITS-CLIP analysis of stromal and endothelial cells. (A): Basic experimental scheme of Ago HITS-CLIP as adapted from Chi et al. UV cross-linked cells are lyzed and treated with RNase to reduce the length of mRNA fragments. Ago is immune-precipitated with monoclonal anti-Ago antibody 2A8, P32-labeled 3′ RNA linker ligated (on-bead), and resolved by SDS-PAGE electrophoresis. The protein-RNA-complex is transferred to nitrocellulose and visualized by autoradiography. In the representative autoradiograph shown, a major band is seen ~110 kD and a more diffuse band at ~130 kD. The RNA-protein complex in the 110–130 kD region is isolated and a 5′ RNA linker is ligated. The isolated RNA is reverse transcribed and PCR amplified with <t>Illumina-compatible</t> primers to generate a cDNA library (typical agarose gel shown). The cDNA libraries are then gel purified and sequenced on Illumina GA <t>IIx</t> and resultant bioinformatically analyzed. (B): Distribution of aligned reads from HS27A samples to different gene annotations. (C): Correlation of consensus peaks between HS5 and HS27A. Coefficient of determination ( R 2 determined by corrplot [R-package]). (D): Correlation of consensus peaks between HS5 and hMSC. (E): Correlation of consensus peaks between HS27A and hMSC. (F): Correlation of consensus peaks between TrHBMEC and HUVEC. (G): Overlap of genes enriched by consensus peaks between stromal cells (HS5, HS27A, and hMSC). (H): Overlap of genes enriched by consensus peaks between endothelial cells (TrHBMEC and HUVEC). Abbreviations: hMSC, human mesenchymal stromal cell; HUVEC, human umbilical vein endothelial cell; TrHBMEC, transformed human bone marrow endothelial cells; UV, ultraviolet.
Genome Analyzer Iix, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1548 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/genome analyzer iix/product/Illumina Inc
Average 99 stars, based on 1548 article reviews
Price from $9.99 to $1999.99
genome analyzer iix - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells"

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells

Journal: Stem cells (Dayton, Ohio)

doi: 10.1002/stem.1531

Ago HITS-CLIP analysis of stromal and endothelial cells. (A): Basic experimental scheme of Ago HITS-CLIP as adapted from Chi et al. UV cross-linked cells are lyzed and treated with RNase to reduce the length of mRNA fragments. Ago is immune-precipitated with monoclonal anti-Ago antibody 2A8, P32-labeled 3′ RNA linker ligated (on-bead), and resolved by SDS-PAGE electrophoresis. The protein-RNA-complex is transferred to nitrocellulose and visualized by autoradiography. In the representative autoradiograph shown, a major band is seen ~110 kD and a more diffuse band at ~130 kD. The RNA-protein complex in the 110–130 kD region is isolated and a 5′ RNA linker is ligated. The isolated RNA is reverse transcribed and PCR amplified with Illumina-compatible primers to generate a cDNA library (typical agarose gel shown). The cDNA libraries are then gel purified and sequenced on Illumina GA IIx and resultant bioinformatically analyzed. (B): Distribution of aligned reads from HS27A samples to different gene annotations. (C): Correlation of consensus peaks between HS5 and HS27A. Coefficient of determination ( R 2 determined by corrplot [R-package]). (D): Correlation of consensus peaks between HS5 and hMSC. (E): Correlation of consensus peaks between HS27A and hMSC. (F): Correlation of consensus peaks between TrHBMEC and HUVEC. (G): Overlap of genes enriched by consensus peaks between stromal cells (HS5, HS27A, and hMSC). (H): Overlap of genes enriched by consensus peaks between endothelial cells (TrHBMEC and HUVEC). Abbreviations: hMSC, human mesenchymal stromal cell; HUVEC, human umbilical vein endothelial cell; TrHBMEC, transformed human bone marrow endothelial cells; UV, ultraviolet.
Figure Legend Snippet: Ago HITS-CLIP analysis of stromal and endothelial cells. (A): Basic experimental scheme of Ago HITS-CLIP as adapted from Chi et al. UV cross-linked cells are lyzed and treated with RNase to reduce the length of mRNA fragments. Ago is immune-precipitated with monoclonal anti-Ago antibody 2A8, P32-labeled 3′ RNA linker ligated (on-bead), and resolved by SDS-PAGE electrophoresis. The protein-RNA-complex is transferred to nitrocellulose and visualized by autoradiography. In the representative autoradiograph shown, a major band is seen ~110 kD and a more diffuse band at ~130 kD. The RNA-protein complex in the 110–130 kD region is isolated and a 5′ RNA linker is ligated. The isolated RNA is reverse transcribed and PCR amplified with Illumina-compatible primers to generate a cDNA library (typical agarose gel shown). The cDNA libraries are then gel purified and sequenced on Illumina GA IIx and resultant bioinformatically analyzed. (B): Distribution of aligned reads from HS27A samples to different gene annotations. (C): Correlation of consensus peaks between HS5 and HS27A. Coefficient of determination ( R 2 determined by corrplot [R-package]). (D): Correlation of consensus peaks between HS5 and hMSC. (E): Correlation of consensus peaks between HS27A and hMSC. (F): Correlation of consensus peaks between TrHBMEC and HUVEC. (G): Overlap of genes enriched by consensus peaks between stromal cells (HS5, HS27A, and hMSC). (H): Overlap of genes enriched by consensus peaks between endothelial cells (TrHBMEC and HUVEC). Abbreviations: hMSC, human mesenchymal stromal cell; HUVEC, human umbilical vein endothelial cell; TrHBMEC, transformed human bone marrow endothelial cells; UV, ultraviolet.

Techniques Used: Cross-linking Immunoprecipitation, Labeling, SDS Page, Electrophoresis, Autoradiography, Isolation, Polymerase Chain Reaction, Amplification, cDNA Library Assay, Agarose Gel Electrophoresis, Purification, Transformation Assay

2) Product Images from "Astrovirus MLB2 Viremia in Febrile Child"

Article Title: Astrovirus MLB2 Viremia in Febrile Child

Journal: Emerging Infectious Diseases

doi: 10.3201/eid1711.110496

Map of 10 plasma-derived astrovirus MLB2 strain contigs generated by high-throughput sequencing (Genome Analyzer IIX; Illumina Inc., San Diego, CA, USA). ORF, open reading frame.
Figure Legend Snippet: Map of 10 plasma-derived astrovirus MLB2 strain contigs generated by high-throughput sequencing (Genome Analyzer IIX; Illumina Inc., San Diego, CA, USA). ORF, open reading frame.

Techniques Used: Derivative Assay, Generated, Next-Generation Sequencing

3) Product Images from "Whole-transcriptome RNAseq analysis from minute amount of total RNA"

Article Title: Whole-transcriptome RNAseq analysis from minute amount of total RNA

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkr547

( A ) Comparison of average mapping statistics of transcriptomic content among three datasets using 50 bp reads from Genome Analyzer IIx (Illumina, Inc.): cDNA libraries made from single RNA samples of mouse testis tissue in which mRNA was enriched from total RNA either by (i) TruSeq™ poly-A selection or by (ii) RiboMinus™ rRNA depletion and (iii) cDNA library in which cDNA was synthesized directly from total RNA (DNase treated and left untreated) using the Ovation® RNA-Seq system. ( B ) Complexity of libraries (percent of unique start sites, unique pairs out of total mapped reads): cDNA libraries of TruSeq™ poly-A selection, RiboMinus™ rRNA depletion and Ovation® RNA-seq amplification system (different input amounts of total RNA). The sample prepared using the Ovation® RNA-Seq system provided slightly higher percentage of unique start sites.
Figure Legend Snippet: ( A ) Comparison of average mapping statistics of transcriptomic content among three datasets using 50 bp reads from Genome Analyzer IIx (Illumina, Inc.): cDNA libraries made from single RNA samples of mouse testis tissue in which mRNA was enriched from total RNA either by (i) TruSeq™ poly-A selection or by (ii) RiboMinus™ rRNA depletion and (iii) cDNA library in which cDNA was synthesized directly from total RNA (DNase treated and left untreated) using the Ovation® RNA-Seq system. ( B ) Complexity of libraries (percent of unique start sites, unique pairs out of total mapped reads): cDNA libraries of TruSeq™ poly-A selection, RiboMinus™ rRNA depletion and Ovation® RNA-seq amplification system (different input amounts of total RNA). The sample prepared using the Ovation® RNA-Seq system provided slightly higher percentage of unique start sites.

Techniques Used: Selection, cDNA Library Assay, Synthesized, RNA Sequencing Assay, Amplification

Related Articles

Centrifugation:

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: In one experiment, Lingulodinium polyedrum cells grown in f/2 seawater medium at 18°C under a 12:12 light:dark cycle [ ] were isolated by centrifugation (500 g for one minute) at two times (ZT 6, ZT 18) and two times under constant light (CT 6, CT 18). .. For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center.

Amplification:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: .. The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx. .. HDAC3-KO muscles were included in ChIP-seq as negative input for peak calling.

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A cDNA library suitable for sequencing on the Illumina platform was then constructed with serial amplification by PCR. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Article Title: Size does matter: 18 amino acids at the N-terminal tip of an amino acid transporter in Leishmania determine substrate specificity
Article Snippet: PolyA RNA-seq libraries, which are enriched for the 3′ end of mRNAs, were prepared in a similar fashion, expect that an oligo(dT) primer (TCCGATCTCTTTTTTV) was used for first strand synthesis, a random hexamer primer (TCCGATCTGANNNNNNN) for second strand synthesis and PCR amplification was carried out using seq-primer-CT (AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCTCT) and R-primer-GA (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGA). .. The libraries were sequenced using the Genome Analyzer IIx (Illumina) at the High Throughput Genomics Unit at the University of Washington to generate 36-nt long single-end reads.

Article Title: Astrovirus MLB2 Viremia in Febrile Child
Article Snippet: Total nucleic acid was extracted from 100 μL of the patient’s plasma by using the Roche (Indianapolis, IN, USA) MagNa Pure System and randomly amplified by using a sequence-independent PCR strategy as described ( ). .. Amplicons were sheared and, following standard library construction, were sequenced by using the Genome Analyzer IIX (Illumina Inc.) according to the manufacturer’s protocol.

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Amplified products were validated and quantified using an Agilent 2100 Bioanalyzer and a DNA 1000 Nano Chip Kit (Agilent Technologies, Santa Clara, CA, USA). .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina). .. 2.5 Data processing, assembly and functional annotation Raw data generated by Illumina sequencing were preprocessed to remove the adaptor sequences and any ambiguous or low-quality reads.

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: Since the PCR primers could potentially introduce false mutations into the amplicon pool due to non-specific binding, primer regions were masked out for the downstream analysis. .. To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx.

Synthesized:

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Subsequently, cDNA was synthesized from small RNAs by reverse transcription and amplified with 15 PCR cycles to produce libraries. .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

Autoradiography:

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A P-32 labeled 3′ RNA linker was ligated to the RNA of the IP Ago-RNA complexes “in-bead.” The Ago-RNA complexes were resolved by SDS-PAGE, transferred to nitrocellulose, and visualized by autoradiography to determine localization of the Ago-RNA complexes. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Construct:

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A cDNA library suitable for sequencing on the Illumina platform was then constructed with serial amplification by PCR. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Real-time Polymerase Chain Reaction:

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: Briefly, the relative amplifiable concentration of each library was estimated by real-time PCR analyses (Roche Light Cycler 480) using the KAPA NGS Library kit by regression to the curve generated using the included standard of known concentration. .. The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained.

Random Hexamer Labeling:

Article Title: Size does matter: 18 amino acids at the N-terminal tip of an amino acid transporter in Leishmania determine substrate specificity
Article Snippet: PolyA RNA-seq libraries, which are enriched for the 3′ end of mRNAs, were prepared in a similar fashion, expect that an oligo(dT) primer (TCCGATCTCTTTTTTV) was used for first strand synthesis, a random hexamer primer (TCCGATCTGANNNNNNN) for second strand synthesis and PCR amplification was carried out using seq-primer-CT (AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCTCT) and R-primer-GA (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGA). .. The libraries were sequenced using the Genome Analyzer IIx (Illumina) at the High Throughput Genomics Unit at the University of Washington to generate 36-nt long single-end reads.

Transformation Assay:

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center. .. Reads were mapped to both a Velvet assembly (accession numbers JO692619 to JO767447) [ ] and to a Trinity assembly (accession numbers GABP01000001 to GABP01114492) [ ] using BWA (Burrows-Wheeler transformation) [ ].

Derivative Assay:

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: Correlations between output clusters and concentrations were derived by plotting the relative concentrations of previously sequenced PhiX control and libraries against the output cluster numbers. .. The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained.

Ligation:

Article Title: The Transcriptome of Utricle Hair Cell Regeneration in the Avian Inner Ear
Article Snippet: Second-strand synthesis, end repair, addition of a single A base, and adaptor ligation were then performed. .. Each RNA-seq library was DNA sequenced using either the Illumina Genome Analyzer IIx or HiSeq 2000.

Northern Blot:

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: .. For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center. .. For the second experiment, RNA pellets were dissolved in 50 μL diethylpyrocarbonate (DEPC) treated H2 O, and a Bioanalyzer (Agilent, Santa Clara, CA, USA) test performed to assess the quality of the extracted RNA samples.

Introduce:

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: Since the PCR primers could potentially introduce false mutations into the amplicon pool due to non-specific binding, primer regions were masked out for the downstream analysis. .. To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx.

Generated:

Article Title: The Transcriptome of Utricle Hair Cell Regeneration in the Avian Inner Ear
Article Snippet: First-strand cDNA was generated using random primers. .. Each RNA-seq library was DNA sequenced using either the Illumina Genome Analyzer IIx or HiSeq 2000.

Article Title: Whole-transcriptome RNAseq analysis from minute amount of total RNA
Article Snippet: .. Basic sequencing data for comparison of RNA-seq methods We generated a total of 245 million reads from single sample cDNA libraries using Genome Analyzer IIx (Illumina, Inc.) in which cDNA was prepared from mRNA enriched either by TruSeq™ poly-A selection (128.2 million reads) or by RiboMinus™ (99.6 million reads) as well as from total RNA using NuGEN-Ovation® RNA-Seq System (17.1 million reads). ..

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: Briefly, the relative amplifiable concentration of each library was estimated by real-time PCR analyses (Roche Light Cycler 480) using the KAPA NGS Library kit by regression to the curve generated using the included standard of known concentration. .. The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained.

Article Title: Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men
Article Snippet: .. For the sequencing data, 36 bp reads were generated using Illumina's Genome Analyser IIx and processed according to their standard software pipeline. .. Reads were mapped to the March 2006 NCBI Build 36.1 human genome and analyzed using the USeq ChIP-Seq application where a q -value threshold of 20 [false discovery rate (FDR) < 0.01] and log2 ratio 1 was used to select regions for analysis.

DNA Sequencing:

Article Title: Assembling Flagella in Salmonella Mutant Strains Producing a Type III Export Apparatus without FliO
Article Snippet: A Genome Analyzer IIx (Illumina, San Diego, CA) instrument was used for parallel sequencing of the 4.9-Mbp whole genome of the wild-type strain SJW1103, the fliO deletion mutant strain CB187, and five suppressor mutant strains (CB190, CB191, CB228, CB229, and CB230) with rescued motility produced by CB187. .. A multiplexed 76-bp, single-end-read genomic DNA sequencing run was used.

Polymerase Chain Reaction:

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A cDNA library suitable for sequencing on the Illumina platform was then constructed with serial amplification by PCR. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Article Title: Size does matter: 18 amino acids at the N-terminal tip of an amino acid transporter in Leishmania determine substrate specificity
Article Snippet: PolyA RNA-seq libraries, which are enriched for the 3′ end of mRNAs, were prepared in a similar fashion, expect that an oligo(dT) primer (TCCGATCTCTTTTTTV) was used for first strand synthesis, a random hexamer primer (TCCGATCTGANNNNNNN) for second strand synthesis and PCR amplification was carried out using seq-primer-CT (AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCTCT) and R-primer-GA (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGA). .. The libraries were sequenced using the Genome Analyzer IIx (Illumina) at the High Throughput Genomics Unit at the University of Washington to generate 36-nt long single-end reads.

Article Title: Astrovirus MLB2 Viremia in Febrile Child
Article Snippet: Total nucleic acid was extracted from 100 μL of the patient’s plasma by using the Roche (Indianapolis, IN, USA) MagNa Pure System and randomly amplified by using a sequence-independent PCR strategy as described ( ). .. Amplicons were sheared and, following standard library construction, were sequenced by using the Genome Analyzer IIX (Illumina Inc.) according to the manufacturer’s protocol.

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Subsequently, cDNA was synthesized from small RNAs by reverse transcription and amplified with 15 PCR cycles to produce libraries. .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina). .. 2.5 Data processing, assembly and functional annotation Raw data generated by Illumina sequencing were preprocessed to remove the adaptor sequences and any ambiguous or low-quality reads.

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: Since the PCR primers could potentially introduce false mutations into the amplicon pool due to non-specific binding, primer regions were masked out for the downstream analysis. .. To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx.

Sonication:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: Whole cell extracts were sonicated followed by immunoprecipitation with antibodies for HDAC3 (Abcam). .. The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx.

Binding Assay:

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: Since the PCR primers could potentially introduce false mutations into the amplicon pool due to non-specific binding, primer regions were masked out for the downstream analysis. .. To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx.

ChIP-sequencing:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: Paragraph title: RNA-seq, ChIP-seq, and GRO-seq ... The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx.

Article Title: Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men
Article Snippet: For the sequencing data, 36 bp reads were generated using Illumina's Genome Analyser IIx and processed according to their standard software pipeline. .. Reads were mapped to the March 2006 NCBI Build 36.1 human genome and analyzed using the USeq ChIP-Seq application where a q -value threshold of 20 [false discovery rate (FDR) < 0.01] and log2 ratio 1 was used to select regions for analysis.

RNA Sequencing Assay:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: Paragraph title: RNA-seq, ChIP-seq, and GRO-seq ... The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx.

Article Title: The Transcriptome of Utricle Hair Cell Regeneration in the Avian Inner Ear
Article Snippet: .. Each RNA-seq library was DNA sequenced using either the Illumina Genome Analyzer IIx or HiSeq 2000. ..

Article Title: Whole-transcriptome RNAseq analysis from minute amount of total RNA
Article Snippet: .. Basic sequencing data for comparison of RNA-seq methods We generated a total of 245 million reads from single sample cDNA libraries using Genome Analyzer IIx (Illumina, Inc.) in which cDNA was prepared from mRNA enriched either by TruSeq™ poly-A selection (128.2 million reads) or by RiboMinus™ (99.6 million reads) as well as from total RNA using NuGEN-Ovation® RNA-Seq System (17.1 million reads). ..

Article Title: Size does matter: 18 amino acids at the N-terminal tip of an amino acid transporter in Leishmania determine substrate specificity
Article Snippet: Paragraph title: RNA-sequencing ... The libraries were sequenced using the Genome Analyzer IIx (Illumina) at the High Throughput Genomics Unit at the University of Washington to generate 36-nt long single-end reads.

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: Paragraph title: RNA extraction and RNA-Seq ... For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center.

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina). .. 2.5 Data processing, assembly and functional annotation Raw data generated by Illumina sequencing were preprocessed to remove the adaptor sequences and any ambiguous or low-quality reads.

Magnetic Beads:

Article Title: The Transcriptome of Utricle Hair Cell Regeneration in the Avian Inner Ear
Article Snippet: In brief, mRNA was selected by oligo-dT magnetic beads from 1 μg of total RNA and fragmented. .. Each RNA-seq library was DNA sequenced using either the Illumina Genome Analyzer IIx or HiSeq 2000.

Mutagenesis:

Article Title: Assembling Flagella in Salmonella Mutant Strains Producing a Type III Export Apparatus without FliO
Article Snippet: .. A Genome Analyzer IIx (Illumina, San Diego, CA) instrument was used for parallel sequencing of the 4.9-Mbp whole genome of the wild-type strain SJW1103, the fliO deletion mutant strain CB187, and five suppressor mutant strains (CB190, CB191, CB228, CB229, and CB230) with rescued motility produced by CB187. .. A multiplexed 76-bp, single-end-read genomic DNA sequencing run was used.

Isolation:

Article Title: Draft Genome Sequences of Four Virulent Aeromonas hydrophila Strains from Catfish Aquaculture
Article Snippet: Here, we report four draft genomes of VAh strains isolated from farm-raised catfish in 2009 and 2010 (strains AL10-121, AL09-79, ML09-121, and ML09-122). .. A. hydrophila AL10-121, AL09-79, ML09-121, and ML09-122 genomes were sequenced using an Illumina Genome Analyzer IIx.

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: .. For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center. .. For the second experiment, RNA pellets were dissolved in 50 μL diethylpyrocarbonate (DEPC) treated H2 O, and a Bioanalyzer (Agilent, Santa Clara, CA, USA) test performed to assess the quality of the extracted RNA samples.

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Paragraph title: Total RNA isolation, small RNA library construction and Solexa sequencing. ... Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

Labeling:

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A P-32 labeled 3′ RNA linker was ligated to the RNA of the IP Ago-RNA complexes “in-bead.” The Ago-RNA complexes were resolved by SDS-PAGE, transferred to nitrocellulose, and visualized by autoradiography to determine localization of the Ago-RNA complexes. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Mouse Assay:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: For ChIP-seq, ChIP was performed independently on muscles from 5 WT mice harvested at ZT10 and ZT22. .. The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx.

Sequencing:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: .. The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx. .. HDAC3-KO muscles were included in ChIP-seq as negative input for peak calling.

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads). ..

Article Title: Draft Genome Sequences of Four Virulent Aeromonas hydrophila Strains from Catfish Aquaculture
Article Snippet: For comparative analysis, our research group released the complete genome sequence of a VAh strain from septicemic catfish (ML09-119, GenBank accession no. NC_021290) ( ) and two other A. hydrophila strains from diseased fish (AL06-06, NZ_CP010947; and TN97-08, NZ_LNUR01000001) ( , ). .. A. hydrophila AL10-121, AL09-79, ML09-121, and ML09-122 genomes were sequenced using an Illumina Genome Analyzer IIx.

Article Title: Whole-transcriptome RNAseq analysis from minute amount of total RNA
Article Snippet: .. Basic sequencing data for comparison of RNA-seq methods We generated a total of 245 million reads from single sample cDNA libraries using Genome Analyzer IIx (Illumina, Inc.) in which cDNA was prepared from mRNA enriched either by TruSeq™ poly-A selection (128.2 million reads) or by RiboMinus™ (99.6 million reads) as well as from total RNA using NuGEN-Ovation® RNA-Seq System (17.1 million reads). ..

Article Title: Astrovirus MLB2 Viremia in Febrile Child
Article Snippet: Total nucleic acid was extracted from 100 μL of the patient’s plasma by using the Roche (Indianapolis, IN, USA) MagNa Pure System and randomly amplified by using a sequence-independent PCR strategy as described ( ). .. Amplicons were sheared and, following standard library construction, were sequenced by using the Genome Analyzer IIX (Illumina Inc.) according to the manufacturer’s protocol.

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center. .. An mRNA-Seq Sample Preparation Kit (Illumina) was used prior to sequencing of the mRNAs using a HiSeq platform (Illumina) at the Institut de Recherche en Immunologie et Cancérologie (Université de Montréal).

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: .. The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained. .. Base calling and demultiplexing were performed using CASAVA and bclfastq1.6. values were calculated using the RackJ software package ( ) with reads mapped to The Arabidopsis Information Resource 10 genome using BLAT ( ). values of control and treatment samples were compared using Z statistics as described by . enrichment was computed using the TopGO elim method ( ) using GOBU with its MultiView plugin ( ).

Article Title: Detection of Novel QTLs Regulating Grain Size in Extra-Large Grain Rice (Oryza sativa L.) Lines
Article Snippet: .. Resequencing Analysis of the Extra-Large Grain Lines Construction of the shotgun library and sequencing were conducted with a Genome Analyzer-IIx (GA-IIx; Illumina, USA). .. Rice genomic DNA was fragmented by Covaris (Woburn, MA, USA).

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China). ..

Article Title: Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men
Article Snippet: .. For the sequencing data, 36 bp reads were generated using Illumina's Genome Analyser IIx and processed according to their standard software pipeline. .. Reads were mapped to the March 2006 NCBI Build 36.1 human genome and analyzed using the USeq ChIP-Seq application where a q -value threshold of 20 [false discovery rate (FDR) < 0.01] and log2 ratio 1 was used to select regions for analysis.

Article Title: Assembling Flagella in Salmonella Mutant Strains Producing a Type III Export Apparatus without FliO
Article Snippet: .. A Genome Analyzer IIx (Illumina, San Diego, CA) instrument was used for parallel sequencing of the 4.9-Mbp whole genome of the wild-type strain SJW1103, the fliO deletion mutant strain CB187, and five suppressor mutant strains (CB190, CB191, CB228, CB229, and CB230) with rescued motility produced by CB187. .. A multiplexed 76-bp, single-end-read genomic DNA sequencing run was used.

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina). .. 2.5 Data processing, assembly and functional annotation Raw data generated by Illumina sequencing were preprocessed to remove the adaptor sequences and any ambiguous or low-quality reads.

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: Paragraph title: Illumina sequencing ... To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx.

Immunoprecipitation:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: Whole cell extracts were sonicated followed by immunoprecipitation with antibodies for HDAC3 (Abcam). .. The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx.

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: Cells were lysed and argonaute proteins (AGO1–4) along with the cross-linked RNA were immunoprecipitated (IP) with a murine monoclonal antibody that recognizes all human argonaute proteins (2A8 [ ], a kind gift from Dr. Zissimos Mourelatos [University of Pennsylvania, Philadelphia, PA]). .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Polyacrylamide Gel Electrophoresis:

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Twenty micrograms of total RNA was purified by denaturing 15% PAGE for small-RNA enrichment (16 to 32 nt) and then ligated with sequencing adapters (Illumina, San Diego, CA, USA). .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

cDNA Library Assay:

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A cDNA library suitable for sequencing on the Illumina platform was then constructed with serial amplification by PCR. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: Paragraph title: cDNA library construction and sequencing ... The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina).

Purification:

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: .. For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center. .. For the second experiment, RNA pellets were dissolved in 50 μL diethylpyrocarbonate (DEPC) treated H2 O, and a Bioanalyzer (Agilent, Santa Clara, CA, USA) test performed to assess the quality of the extracted RNA samples.

Article Title: Detection of Novel QTLs Regulating Grain Size in Extra-Large Grain Rice (Oryza sativa L.) Lines
Article Snippet: Resequencing Analysis of the Extra-Large Grain Lines Construction of the shotgun library and sequencing were conducted with a Genome Analyzer-IIx (GA-IIx; Illumina, USA). .. The size-selected DNA (average length 300 bp) was purified with an AmpureXP (Beckman Coulter, Inc., Fullerton, CA, USA) and gel extraction.

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Twenty micrograms of total RNA was purified by denaturing 15% PAGE for small-RNA enrichment (16 to 32 nt) and then ligated with sequencing adapters (Illumina, San Diego, CA, USA). .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: Purified mRNAs were then fragmented using divalent cations under elevated temperatures, and then converted to dsDNA by two rounds of cDNA synthesis using reverse transcriptase and DNA polymerase I. .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina).

Chromatin Immunoprecipitation:

Article Title: Dissociation of muscle insulin sensitivity from exercise endurance in mice by HDAC3
Article Snippet: For ChIP-seq, ChIP was performed independently on muscles from 5 WT mice harvested at ZT10 and ZT22. .. The precipitated DNA were then pooled and amplified according to the guide of Illumina, followed by deep sequencing on Illumina Genome Analyzer IIx.

Article Title: Novel MicroRNA Involved in Host Response to Avian Pathogenic Escherichia coli Identified by Deep Sequencing and Integration Analysis
Article Snippet: Amplified products were validated and quantified using an Agilent 2100 Bioanalyzer and a DNA 1000 Nano Chip Kit (Agilent Technologies, Santa Clara, CA, USA). .. Deep sequencing was performed on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) by Shanghai Majorbio Bio-Pharm Biotechnology Co., Ltd. (Shanghai, China).

SDS Page:

Article Title: Genome-Wide Analysis of miRNA-mRNA Interactions in Marrow Stromal Cells
Article Snippet: A P-32 labeled 3′ RNA linker was ligated to the RNA of the IP Ago-RNA complexes “in-bead.” The Ago-RNA complexes were resolved by SDS-PAGE, transferred to nitrocellulose, and visualized by autoradiography to determine localization of the Ago-RNA complexes. .. Sequencing was performed on an Illumina Genome Analyzer IIx (single end 50 base pair reads).

Plasmid Preparation:

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: .. To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx. ..

Software:

Article Title: Astrovirus MLB2 Viremia in Febrile Child
Article Snippet: Amplicons were sheared and, following standard library construction, were sequenced by using the Genome Analyzer IIX (Illumina Inc.) according to the manufacturer’s protocol. .. From all reads, 238 had > 80% nt identity to the partial MLB2 sequence in GenBank (GQ502192.1) when aligned by using Cross_match software ( www.phrap.org/phredphrapconsed.html#block_phrap ).

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained. .. Base calling and demultiplexing were performed using CASAVA and bclfastq1.6. values were calculated using the RackJ software package ( ) with reads mapped to The Arabidopsis Information Resource 10 genome using BLAT ( ). values of control and treatment samples were compared using Z statistics as described by . enrichment was computed using the TopGO elim method ( ) using GOBU with its MultiView plugin ( ).

Article Title: Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men
Article Snippet: .. For the sequencing data, 36 bp reads were generated using Illumina's Genome Analyser IIx and processed according to their standard software pipeline. .. Reads were mapped to the March 2006 NCBI Build 36.1 human genome and analyzed using the USeq ChIP-Seq application where a q -value threshold of 20 [false discovery rate (FDR) < 0.01] and log2 ratio 1 was used to select regions for analysis.

RNA Extraction:

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: Paragraph title: RNA extraction and RNA-Seq ... For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center.

Selection:

Article Title: Whole-transcriptome RNAseq analysis from minute amount of total RNA
Article Snippet: .. Basic sequencing data for comparison of RNA-seq methods We generated a total of 245 million reads from single sample cDNA libraries using Genome Analyzer IIx (Illumina, Inc.) in which cDNA was prepared from mRNA enriched either by TruSeq™ poly-A selection (128.2 million reads) or by RiboMinus™ (99.6 million reads) as well as from total RNA using NuGEN-Ovation® RNA-Seq System (17.1 million reads). ..

Sample Prep:

Article Title: The Lingulodinium circadian system lacks rhythmic changes in transcript abundance
Article Snippet: For the first experiment, RNA quality was assessed by Northern blots before and after purification of poly(A) RNA using the poly(A) tract mRNA isolation kit (Promega, Madison, WI, USA) and sequenced using a Genome Analyzer IIX (Illumina) at the McGill University and Génome Québec Innovation Center. .. An mRNA-Seq Sample Preparation Kit (Illumina) was used prior to sequencing of the mRNAs using a HiSeq platform (Illumina) at the Institut de Recherche en Immunologie et Cancérologie (Université de Montréal).

Article Title: Detection of Novel QTLs Regulating Grain Size in Extra-Large Grain Rice (Oryza sativa L.) Lines
Article Snippet: Resequencing Analysis of the Extra-Large Grain Lines Construction of the shotgun library and sequencing were conducted with a Genome Analyzer-IIx (GA-IIx; Illumina, USA). .. The standard short-read library was built using a TruSeq DNA Sample Prep Kit v2-SetA (Illumina, USA) and TruSeq SBS v5 (Illumina, USA) according to manufacturer’s instructions for sequencing runs at 2 × 100 bp total.

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: 2.4 cDNA library construction and sequencing Total RNA was obtained from the fish gills using a total RNA purification kit (LC Sciences, Houston, TX, USA) and was further purified using the TruSeq RNA LT Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol. .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina).

Next-Generation Sequencing:

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: .. The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained. .. Base calling and demultiplexing were performed using CASAVA and bclfastq1.6. values were calculated using the RackJ software package ( ) with reads mapped to The Arabidopsis Information Resource 10 genome using BLAT ( ). values of control and treatment samples were compared using Z statistics as described by . enrichment was computed using the TopGO elim method ( ) using GOBU with its MultiView plugin ( ).

Produced:

Article Title: Assembling Flagella in Salmonella Mutant Strains Producing a Type III Export Apparatus without FliO
Article Snippet: .. A Genome Analyzer IIx (Illumina, San Diego, CA) instrument was used for parallel sequencing of the 4.9-Mbp whole genome of the wild-type strain SJW1103, the fliO deletion mutant strain CB187, and five suppressor mutant strains (CB190, CB191, CB228, CB229, and CB230) with rescued motility produced by CB187. .. A multiplexed 76-bp, single-end-read genomic DNA sequencing run was used.

Concentration Assay:

Article Title: Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria 1 [OPEN]
Article Snippet: Briefly, the relative amplifiable concentration of each library was estimated by real-time PCR analyses (Roche Light Cycler 480) using the KAPA NGS Library kit by regression to the curve generated using the included standard of known concentration. .. The sequencing was performed on an Illumina Genome Analyzer IIx in the High Throughput Sequencing Core Facility of Academia Sinica, and 73-nucleotide reads were obtained.

Article Title: Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs
Article Snippet: The clonal controls were mixed in a single sample with an approximate concentration ratio of 10:1 (rabies:BCV) and sequenced on a separate lane. .. To compare error rates between different sequencers, rabies control plasmid was sequenced a second time at Elim Biopharm (Hayward, CA) using Illumina Genome Analyzer IIx.

High Throughput Screening Assay:

Article Title: Size does matter: 18 amino acids at the N-terminal tip of an amino acid transporter in Leishmania determine substrate specificity
Article Snippet: .. The libraries were sequenced using the Genome Analyzer IIx (Illumina) at the High Throughput Genomics Unit at the University of Washington to generate 36-nt long single-end reads. ..

Gel Extraction:

Article Title: Detection of Novel QTLs Regulating Grain Size in Extra-Large Grain Rice (Oryza sativa L.) Lines
Article Snippet: Resequencing Analysis of the Extra-Large Grain Lines Construction of the shotgun library and sequencing were conducted with a Genome Analyzer-IIx (GA-IIx; Illumina, USA). .. The size-selected DNA (average length 300 bp) was purified with an AmpureXP (Beckman Coulter, Inc., Fullerton, CA, USA) and gel extraction.

Fluorescence In Situ Hybridization:

Article Title: Draft Genome Sequences of Four Virulent Aeromonas hydrophila Strains from Catfish Aquaculture
Article Snippet: For comparative analysis, our research group released the complete genome sequence of a VAh strain from septicemic catfish (ML09-119, GenBank accession no. NC_021290) ( ) and two other A. hydrophila strains from diseased fish (AL06-06, NZ_CP010947; and TN97-08, NZ_LNUR01000001) ( , ). .. A. hydrophila AL10-121, AL09-79, ML09-121, and ML09-122 genomes were sequenced using an Illumina Genome Analyzer IIx.

Article Title: De novo assembly of the blunt snout bream (Megalobrama amblycephala) gill transcriptome to identify ammonia exposure associated microRNAs and their targets
Article Snippet: 2.4 cDNA library construction and sequencing Total RNA was obtained from the fish gills using a total RNA purification kit (LC Sciences, Houston, TX, USA) and was further purified using the TruSeq RNA LT Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol. .. The ligated products were amplified (15 PCR cycles) to generate an RNA-seq library. cDNA sequencing was performed using a Genome Analyzer IIx (Illumina).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Illumina Inc illumina gaiix sequencer
    The performance of assembly as increasing coverage depths . The performance of assembled contigs (A), N50 size (B) and total bases (C) for the three NGS technologies at increasing depths in simulation. The red line, green line and blue line show the performance of Roche 454, <t>Illumina</t> <t>GAIIx,</t> and ABI SOLiD platform, respectively. Reads from each platform were simulated by random subsampling. Summary of performance of each platform, 25×, 240× and 300× sequencing data generating from 454, GAIIx and SOLiD platforms was sufficient for de novo assembly.
    Illumina Gaiix Sequencer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina gaiix sequencer/product/Illumina Inc
    Average 99 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    illumina gaiix sequencer - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc illumina gaiix
    The performance of assembly as increasing coverage depths . The performance of assembled contigs (A), N50 size (B) and total bases (C) for the three NGS technologies at increasing depths in simulation. The red line, green line and blue line show the performance of Roche 454, <t>Illumina</t> <t>GAIIx,</t> and ABI SOLiD platform, respectively. Reads from each platform were simulated by random subsampling. Summary of performance of each platform, 25×, 240× and 300× sequencing data generating from 454, GAIIx and SOLiD platforms was sufficient for de novo assembly.
    Illumina Gaiix, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 197 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina gaiix/product/Illumina Inc
    Average 99 stars, based on 197 article reviews
    Price from $9.99 to $1999.99
    illumina gaiix - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    The performance of assembly as increasing coverage depths . The performance of assembled contigs (A), N50 size (B) and total bases (C) for the three NGS technologies at increasing depths in simulation. The red line, green line and blue line show the performance of Roche 454, Illumina GAIIx, and ABI SOLiD platform, respectively. Reads from each platform were simulated by random subsampling. Summary of performance of each platform, 25×, 240× and 300× sequencing data generating from 454, GAIIx and SOLiD platforms was sufficient for de novo assembly.

    Journal: BMC Systems Biology

    Article Title: Optimizing hybrid assembly of next-generation sequence data from Enterococcus faecium: a microbe with highly divergent genome

    doi: 10.1186/1752-0509-6-S3-S21

    Figure Lengend Snippet: The performance of assembly as increasing coverage depths . The performance of assembled contigs (A), N50 size (B) and total bases (C) for the three NGS technologies at increasing depths in simulation. The red line, green line and blue line show the performance of Roche 454, Illumina GAIIx, and ABI SOLiD platform, respectively. Reads from each platform were simulated by random subsampling. Summary of performance of each platform, 25×, 240× and 300× sequencing data generating from 454, GAIIx and SOLiD platforms was sufficient for de novo assembly.

    Article Snippet: The preparing the PE library and sequencing on the Illumina GAIIx sequencer were performed according to the standard Illumina protocols (Illumina, San Diego, CA, USA).

    Techniques: Next-Generation Sequencing, Sequencing

    The influence of sequence quality scores and read depth on the identification of true-positive and false-positive SNVs. ( a ) False-positive calls with respect to read depth and quality score, shown for a single exome dataset generated from the G3 nimbus mouse (technical replicate 1 from figure 3 ). Variant calls on this dataset were compared with the PCR-validated true-positive and false-positive SNVs called in the technical replicate exome datasets of the G3 nimbus proband. Green and red points are true- and false-positive SNV calls, respectively. The distribution of read depth frequencies over all exonic bases is indicated by the red line in the top graph. The red bars in the right-hand graph indicate the distribution of quality scores also ascertained for all exonic bases. ( b ) Results of simulation experiment performed to generate random subsets of a single exome dataset, being one of the triplicate exome runs for the nimbus proband (technical replicate 1). The panel shows tallies of true-positive heterozygous (green), false-positive heterozygous (red), true-positive homozygous (blue) and false-positive homozygous (grey) SNV calls plotted against the number of input reads, which are incremental proportions of an Illumina GAIIx lane. Numbers alongside the green dots indicate the median read depth determined for each true-positive data point. Plotted above are the proportions of the exome covered at 20× depth or better for each proportion of the input read set.

    Journal: Open Biology

    Article Title: Massively parallel sequencing of the mouse exome to accurately identify rare, induced mutations: an immediate source for thousands of new mouse models

    doi: 10.1098/rsob.120061

    Figure Lengend Snippet: The influence of sequence quality scores and read depth on the identification of true-positive and false-positive SNVs. ( a ) False-positive calls with respect to read depth and quality score, shown for a single exome dataset generated from the G3 nimbus mouse (technical replicate 1 from figure 3 ). Variant calls on this dataset were compared with the PCR-validated true-positive and false-positive SNVs called in the technical replicate exome datasets of the G3 nimbus proband. Green and red points are true- and false-positive SNV calls, respectively. The distribution of read depth frequencies over all exonic bases is indicated by the red line in the top graph. The red bars in the right-hand graph indicate the distribution of quality scores also ascertained for all exonic bases. ( b ) Results of simulation experiment performed to generate random subsets of a single exome dataset, being one of the triplicate exome runs for the nimbus proband (technical replicate 1). The panel shows tallies of true-positive heterozygous (green), false-positive heterozygous (red), true-positive homozygous (blue) and false-positive homozygous (grey) SNV calls plotted against the number of input reads, which are incremental proportions of an Illumina GAIIx lane. Numbers alongside the green dots indicate the median read depth determined for each true-positive data point. Plotted above are the proportions of the exome covered at 20× depth or better for each proportion of the input read set.

    Article Snippet: Each exome sample was then sequenced as paired-end reads in a full lane of an Illumina GAIIx sequencer or as a multiplexed, bar-coded sample in an Illumina HiSeq sequencer, and the resultant reads aligned to the C57BL/6 mouse reference genome using the BWA aligner [ ].

    Techniques: Sequencing, Generated, Variant Assay, Polymerase Chain Reaction

    The performance of assembly as increasing coverage depths . The performance of assembled contigs (A), N50 size (B) and total bases (C) for the three NGS technologies at increasing depths in simulation. The red line, green line and blue line show the performance of Roche 454, Illumina GAIIx, and ABI SOLiD platform, respectively. Reads from each platform were simulated by random subsampling. Summary of performance of each platform, 25×, 240× and 300× sequencing data generating from 454, GAIIx and SOLiD platforms was sufficient for de novo assembly.

    Journal: BMC Systems Biology

    Article Title: Optimizing hybrid assembly of next-generation sequence data from Enterococcus faecium: a microbe with highly divergent genome

    doi: 10.1186/1752-0509-6-S3-S21

    Figure Lengend Snippet: The performance of assembly as increasing coverage depths . The performance of assembled contigs (A), N50 size (B) and total bases (C) for the three NGS technologies at increasing depths in simulation. The red line, green line and blue line show the performance of Roche 454, Illumina GAIIx, and ABI SOLiD platform, respectively. Reads from each platform were simulated by random subsampling. Summary of performance of each platform, 25×, 240× and 300× sequencing data generating from 454, GAIIx and SOLiD platforms was sufficient for de novo assembly.

    Article Snippet: If cost allowed, the optimal outcome can be achieved with the combinations of 454 GS-FLX, Illumina GAIIx, and SOLiD4 sequencing data at abovementioned coverage depths.

    Techniques: Next-Generation Sequencing, Sequencing

    The influence of sequence quality scores and read depth on the identification of true-positive and false-positive SNVs. ( a ) False-positive calls with respect to read depth and quality score, shown for a single exome dataset generated from the G3 nimbus mouse (technical replicate 1 from figure 3 ). Variant calls on this dataset were compared with the PCR-validated true-positive and false-positive SNVs called in the technical replicate exome datasets of the G3 nimbus proband. Green and red points are true- and false-positive SNV calls, respectively. The distribution of read depth frequencies over all exonic bases is indicated by the red line in the top graph. The red bars in the right-hand graph indicate the distribution of quality scores also ascertained for all exonic bases. ( b ) Results of simulation experiment performed to generate random subsets of a single exome dataset, being one of the triplicate exome runs for the nimbus proband (technical replicate 1). The panel shows tallies of true-positive heterozygous (green), false-positive heterozygous (red), true-positive homozygous (blue) and false-positive homozygous (grey) SNV calls plotted against the number of input reads, which are incremental proportions of an Illumina GAIIx lane. Numbers alongside the green dots indicate the median read depth determined for each true-positive data point. Plotted above are the proportions of the exome covered at 20× depth or better for each proportion of the input read set.

    Journal: Open Biology

    Article Title: Massively parallel sequencing of the mouse exome to accurately identify rare, induced mutations: an immediate source for thousands of new mouse models

    doi: 10.1098/rsob.120061

    Figure Lengend Snippet: The influence of sequence quality scores and read depth on the identification of true-positive and false-positive SNVs. ( a ) False-positive calls with respect to read depth and quality score, shown for a single exome dataset generated from the G3 nimbus mouse (technical replicate 1 from figure 3 ). Variant calls on this dataset were compared with the PCR-validated true-positive and false-positive SNVs called in the technical replicate exome datasets of the G3 nimbus proband. Green and red points are true- and false-positive SNV calls, respectively. The distribution of read depth frequencies over all exonic bases is indicated by the red line in the top graph. The red bars in the right-hand graph indicate the distribution of quality scores also ascertained for all exonic bases. ( b ) Results of simulation experiment performed to generate random subsets of a single exome dataset, being one of the triplicate exome runs for the nimbus proband (technical replicate 1). The panel shows tallies of true-positive heterozygous (green), false-positive heterozygous (red), true-positive homozygous (blue) and false-positive homozygous (grey) SNV calls plotted against the number of input reads, which are incremental proportions of an Illumina GAIIx lane. Numbers alongside the green dots indicate the median read depth determined for each true-positive data point. Plotted above are the proportions of the exome covered at 20× depth or better for each proportion of the input read set.

    Article Snippet: Each library sequenced on an Illumina GAIIx was sequenced on a single lane of an eight-lane flow-cell, whereas libraries sequenced on the Illumina HiSeq were multiplexed in a pool of 10 samples and sequenced together, and disambiguated using sample bar-coding.

    Techniques: Sequencing, Generated, Variant Assay, Polymerase Chain Reaction