generacer kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher generacer kit
    Generacer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 564 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/generacer kit/product/Thermo Fisher
    Average 99 stars, based on 564 article reviews
    Price from $9.99 to $1999.99
    generacer kit - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: LEUNIG_HOMOLOG and LEUNIG Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] [W] Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] [W] [OA]
    Article Snippet: 5′ RACE was performed to verify the LUH transcript using the Generacer kit (version F; Invitrogen) and total RNA from Arabidopsis flowers. .. The 5′ nested primer 5′-GGACACTGACATGGACTGAAGGAGTA-3′ was used, and the RACE products were cloned in pCRII TOPO (Invitrogen) and sequenced.

    Article Title: Isolation of a Protein Interacting with Vfphot1a in Guard Cells of Vicia faba 1
    Article Snippet: The 5′ RACE was performed using a GeneRacer kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. .. PCR products were cloned into a pCR4-TOPO vector (Invitrogen).

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: .. Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: A rabbit brain 5′-stretch plus cDNA library (Clontech, Palo Alto, CA) was used to obtain longer sequences from DDRT-PCR gene fragments cloned into a pT7Blue vector. .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Article Title: Multiple combinations of RDL subunits diversify the repertoire of GABA receptors in the honey bee parasite Varroa destructor
    Article Snippet: The 5′ and 3′ end regions of the different cDNAs were obtained by rapid amplification of cDNA ends–PCR using the GeneRacer kit (Thermo Fisher) and primers designed based on the sequences deposited in BeeBase, with the exception of VdesRDL2 for which we designed specific primers to obtain the 5′-end based on the predicted sequence obtained from transcriptomic data deposited in GenBankTM . .. The cDNA of amRDL ( ) was cloned in the pBS-SK vector (Agilent).

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Capped mRNA (5’RACE) and native mRNA (3’RACE) were reverse transcribed using SuperScript™ IV RT kit (Invitrogen, Fisher Scientific) with 5′-gene specific primer (Additional file : Table S8) or GeneRacer™ Oligo dT primer (GeneRacer™ kit, Invitrogen), respectively. .. PCR products were cloned into pCR4®-TOPO vector (TOPO™-TA cloning™ kit, Invitrogen), then amplified into Escherichia coli One Shot™ Top10 chemically competent cells (Invitrogen).

    Amplification:

    Article Title: Regulated Fox-2 isoform expression mediates protein 4.1R splicing during erythroid differentiation
    Article Snippet: 5′ rapid amplification of cDNA ends (RACE) was performed following the instruction of GeneRacer Kit (Invitrogen); mEx3-RT was used for reverse transcription, and sense (GeneRace 5′ Primer and 5′ Nested Primer) and antisense primers (5′Race-1-As and 5′Race-2-As; ; mFox-2 5′ RACE) were used for nested PCR. .. Amplification of exon 16 products was performed with Ex13-S and Ex17-As ( ; exon 16 splicing analysis), respectively.

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: Paragraph title: Amplification of Ov-apr-1 and sequence analysis ... Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen).

    Article Title: LEUNIG_HOMOLOG and LEUNIG Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] [W] Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] [W] [OA]
    Article Snippet: 5′ RACE was performed to verify the LUH transcript using the Generacer kit (version F; Invitrogen) and total RNA from Arabidopsis flowers. .. To generate 35S ∷ LUH , the full-length LUH cDNA from RIKEN was amplified by PCR with primers 35SLUH-F (5′-ATTACCCGGGGATGGCTCAGAGTAATTGGGAAG-3′) and 35SLUH-R (5′-TCCCCCGGGCTACTTCCAAATCTTTACGGA-3′) containing engineered Xma I sites with the high-fidelity Taq polymerase (Roche).

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: .. Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    Article Title: Multiple combinations of RDL subunits diversify the repertoire of GABA receptors in the honey bee parasite Varroa destructor
    Article Snippet: .. The 5′ and 3′ end regions of the different cDNAs were obtained by rapid amplification of cDNA ends–PCR using the GeneRacer kit (Thermo Fisher) and primers designed based on the sequences deposited in BeeBase, with the exception of VdesRDL2 for which we designed specific primers to obtain the 5′-end based on the predicted sequence obtained from transcriptomic data deposited in GenBankTM . .. The cDNA of amRDL ( ) was cloned in the pBS-SK vector (Agilent).

    Article Title: Binding of RBP-J? (CSL) Protein to the Promoter of the Kaposi's Sarcoma-Associated Herpesvirus ORF47 (gL) Gene Is a Critical but Not Sufficient Determinant of Trans-activation by ORF50 Protein
    Article Snippet: Paragraph title: Rapid amplification of 5’ cDNA ends ... To map the transcriptional initiation site of the ORF47 gene, the GeneRacer kit (Invitrogen) was used.

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Paragraph title: Amplification of the full-length nucleotide sequences of OBPs by rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR) ... Cap structures were removed with 5 U of RppH (5′ Pyrophosphohydrolase, New England BioLabs®), then mRNA was ligated to GeneRacer™RNA Oligo (GeneRacer™ kit, Invitrogen, 5′-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3′) with 5 U of T4 RNA ligase 1 (New England BioLabs®).

    Article Title: The Blast Resistance Gene Pi37 Encodes a Nucleotide Binding Site-Leucine-Rich Repeat Protein and Is a Member of a Resistance Gene Cluster on Rice Chromosome 1
    Article Snippet: Rapid amplification of cDNA ends (RACE) was conducted using the GeneRacer kit (Invitrogen, Groningen, The Netherlands), following the manufacturer's instructions. .. Primers for the first round of amplification of the 5′ RACE were GS1 and the GeneRacer 5′ primer.

    Reporter Assay:

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: .. Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    Synthesized:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: A series of oligonucleotides corresponding to this cDNA sequence were synthesized and used to amplify an orthologous cDNA fragment from an O. viverrini adult worm cDNA library ( ). .. Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen).

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: .. Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    cDNA Library Assay:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: A series of oligonucleotides corresponding to this cDNA sequence were synthesized and used to amplify an orthologous cDNA fragment from an O. viverrini adult worm cDNA library ( ). .. Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen).

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: A rabbit brain 5′-stretch plus cDNA library (Clontech, Palo Alto, CA) was used to obtain longer sequences from DDRT-PCR gene fragments cloned into a pT7Blue vector. .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Random Hexamer Labeling:

    Article Title: Immunogenetic factors driving formation of ultralong VH CDR3 in Bos taurus antibodies
    Article Snippet: Isolated RNA was used as the template for synthesis of 5′ RACE libraries with the GeneRacer kit (Invitrogen, Carlsbad, CA, USA) performed as previously described. .. An equal mix of oligoDT and random hexamer primers was used to prime the reaction.

    Luciferase:

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: .. Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    Activity Assay:

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. 24 h later, cells were harvested and the relative luciferase (Luc) activity was measured using the Dual-Luciferase® Reporter (DLR™) System from Promega.

    In Silico:

    Article Title: Conservation of Notochord Gene Expression Across Chordates: Insights From the Leprecan Gene Family
    Article Snippet: Paragraph title: In Silico Identification of Leprecan Sequences ... A full-length C. intestinalis Leprecan cDNA sequence was obtained via a 5′-RACE reaction on total RNA extracted from mid-tailbud embryos, using the GeneRacer kit (Invitrogen, Carlsbad, CA) and following the manufacturer's instructions.

    Touchdown PCR:

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Cap structures were removed with 5 U of RppH (5′ Pyrophosphohydrolase, New England BioLabs®), then mRNA was ligated to GeneRacer™RNA Oligo (GeneRacer™ kit, Invitrogen, 5′-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3′) with 5 U of T4 RNA ligase 1 (New England BioLabs®). .. Amplifications were performed from 5 μL of RT template using Platinum™ Taq DNA Polymerase High Fidelity (Invitrogen) by touchdown PCR as follow: 94 °C for 2 min, followed by 5 cycles of 15 s at 94 °C and 30 s at 72 °C; 5 cycles of 15 s at 94 °C and 30 s at 70 °C; 25 cycles of 15 s at 94 °C, 30 s at 65 °C and 1 min at 68 °C.

    Derivative Assay:

    Article Title: Immunogenetic factors driving formation of ultralong VH CDR3 in Bos taurus antibodies
    Article Snippet: Tissue—blood, Peyer’s patch, spleen, and bone marrow—were derived from two adult cows housed at Texas A & M University Veterinary Medical Park under approved Animal Use Protocol 2015-0078. .. Isolated RNA was used as the template for synthesis of 5′ RACE libraries with the GeneRacer kit (Invitrogen, Carlsbad, CA, USA) performed as previously described.

    Ligation:

    Article Title: Dynamic UTR Usage Regulates Alternative Translation to Modulate Gap Junction Formation during Stress and Aging
    Article Snippet: RLM-RACE RLM-RACE was performed with the GeneRacer Kit (Thermo Fisher Scientific) according to manufacturer instructions. .. 4 μg of RNA from each sample was dephosphorylated to prevent ligation of the RNA oligo adaptor to truncated mRNA and other non-mRNA.

    Library Screening:

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: DNA sequencing: library screening and extension of DDRT-PCR gene fragments. .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Northern Blot:

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: Plasmid DNA was prepared, and the insert was used as a probe for Northern blots and for cDNA library screening. .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Infection:

    Article Title: The Blast Resistance Gene Pi37 Encodes a Nucleotide Binding Site-Leucine-Rich Repeat Protein and Is a Member of a Resistance Gene Cluster on Rice Chromosome 1
    Article Snippet: Rapid amplification of cDNA ends (RACE) was conducted using the GeneRacer kit (Invitrogen, Groningen, The Netherlands), following the manufacturer's instructions. .. Total leaf RNA was extracted 24 hr after infection from both St. No. 1 and the highly blast-susceptible Lijiangxintuanheigu (LTH).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Regulated Fox-2 isoform expression mediates protein 4.1R splicing during erythroid differentiation
    Article Snippet: Paragraph title: 5′ RACE and RT-PCR analyses ... 5′ rapid amplification of cDNA ends (RACE) was performed following the instruction of GeneRacer Kit (Invitrogen); mEx3-RT was used for reverse transcription, and sense (GeneRace 5′ Primer and 5′ Nested Primer) and antisense primers (5′Race-1-As and 5′Race-2-As; ; mFox-2 5′ RACE) were used for nested PCR.

    Generated:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: The forward primer (Ov-apr-f1: 5′ - CGGATTCAAAAATGTGAGACGC - 3′) spanned nt 88–109 of C. sinensis , and generated a band of the expected size when coupled with two different reverse primers, Ov-apr-r4 (5′ - TTGCCAAACCAGGTCATTCG - 3′) spanning nt 998–1017 and Ov-apr-r2 (5′ - TCCCGCTTATGCTGAACTGGAC - 3′) spanning nt 941–962. .. Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen).

    DNA Sequencing:

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: DNA sequencing: library screening and extension of DDRT-PCR gene fragments. .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Sequencing:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: Paragraph title: Amplification of Ov-apr-1 and sequence analysis ... Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen).

    Article Title: Conservation of Notochord Gene Expression Across Chordates: Insights From the Leprecan Gene Family
    Article Snippet: .. A full-length C. intestinalis Leprecan cDNA sequence was obtained via a 5′-RACE reaction on total RNA extracted from mid-tailbud embryos, using the GeneRacer kit (Invitrogen, Carlsbad, CA) and following the manufacturer's instructions. .. Leprecan sequences for Nematostella and Branchiostoma were obtained from the JGI web site ( ) via BLAST searches ( ) using the C. intestinalis Leprecan sequence, whereas the Helobdella gene was identified using the Apis mellifera Leprecan sequence.

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: The inserts were sequenced using a thermosequenase radiolabeled terminator cycle sequencing kit (United States Biochemicals, Cleveland, OH). .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Article Title: Multiple combinations of RDL subunits diversify the repertoire of GABA receptors in the honey bee parasite Varroa destructor
    Article Snippet: .. The 5′ and 3′ end regions of the different cDNAs were obtained by rapid amplification of cDNA ends–PCR using the GeneRacer kit (Thermo Fisher) and primers designed based on the sequences deposited in BeeBase, with the exception of VdesRDL2 for which we designed specific primers to obtain the 5′-end based on the predicted sequence obtained from transcriptomic data deposited in GenBankTM . .. The cDNA of amRDL ( ) was cloned in the pBS-SK vector (Agilent).

    Article Title: The Blast Resistance Gene Pi37 Encodes a Nucleotide Binding Site-Leucine-Rich Repeat Protein and Is a Member of a Resistance Gene Cluster on Rice Chromosome 1
    Article Snippet: Paragraph title: Sequence analysis: ... Rapid amplification of cDNA ends (RACE) was conducted using the GeneRacer kit (Invitrogen, Groningen, The Netherlands), following the manufacturer's instructions.

    Recombinant:

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Capped mRNA (5’RACE) and native mRNA (3’RACE) were reverse transcribed using SuperScript™ IV RT kit (Invitrogen, Fisher Scientific) with 5′-gene specific primer (Additional file : Table S8) or GeneRacer™ Oligo dT primer (GeneRacer™ kit, Invitrogen), respectively. .. Recombinant plasmids were purified with QIAprep Spin Miniprep kit (Qiagen) and sequenced in both senses (Eurofins Genomics).

    Nucleic Acid Electrophoresis:

    Article Title: Dynamic UTR Usage Regulates Alternative Translation to Modulate Gap Junction Formation during Stress and Aging
    Article Snippet: RLM-RACE RLM-RACE was performed with the GeneRacer Kit (Thermo Fisher Scientific) according to manufacturer instructions. .. Briefly, RNA was isolated from NMUMG cells untreated or treated with TGF-β for 48 h. RNA integrity was verified by denaturing gel electrophoresis.

    Mutagenesis:

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    Isolation:

    Article Title: Immunogenetic factors driving formation of ultralong VH CDR3 in Bos taurus antibodies
    Article Snippet: .. Isolated RNA was used as the template for synthesis of 5′ RACE libraries with the GeneRacer kit (Invitrogen, Carlsbad, CA, USA) performed as previously described. .. An equal mix of oligoDT and random hexamer primers was used to prime the reaction.

    Article Title: Isolation of a Protein Interacting with Vfphot1a in Guard Cells of Vicia faba 1
    Article Snippet: Paragraph title: Full-Length VfPIP cDNA Isolation ... The 5′ RACE was performed using a GeneRacer kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions.

    Article Title: Dynamic UTR Usage Regulates Alternative Translation to Modulate Gap Junction Formation during Stress and Aging
    Article Snippet: RLM-RACE RLM-RACE was performed with the GeneRacer Kit (Thermo Fisher Scientific) according to manufacturer instructions. .. Briefly, RNA was isolated from NMUMG cells untreated or treated with TGF-β for 48 h. RNA integrity was verified by denaturing gel electrophoresis.

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences. .. Total RNA was isolated with Trizol (Invitrogen) from retinal tissue samples weighing 15–20 mg.

    Article Title: Multiple combinations of RDL subunits diversify the repertoire of GABA receptors in the honey bee parasite Varroa destructor
    Article Snippet: Total RNA was isolated from whole V. destructor specimens or from honey bee brain, and first strand cDNAs were obtained as previously described ( ). .. The 5′ and 3′ end regions of the different cDNAs were obtained by rapid amplification of cDNA ends–PCR using the GeneRacer kit (Thermo Fisher) and primers designed based on the sequences deposited in BeeBase, with the exception of VdesRDL2 for which we designed specific primers to obtain the 5′-end based on the predicted sequence obtained from transcriptomic data deposited in GenBankTM .

    Purification:

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Capped mRNA (5’RACE) and native mRNA (3’RACE) were reverse transcribed using SuperScript™ IV RT kit (Invitrogen, Fisher Scientific) with 5′-gene specific primer (Additional file : Table S8) or GeneRacer™ Oligo dT primer (GeneRacer™ kit, Invitrogen), respectively. .. Recombinant plasmids were purified with QIAprep Spin Miniprep kit (Qiagen) and sequenced in both senses (Eurofins Genomics).

    Polymerase Chain Reaction:

    Article Title: LEUNIG_HOMOLOG and LEUNIG Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] [W] Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development 1 [C] [W] [OA]
    Article Snippet: 5′ RACE was performed to verify the LUH transcript using the Generacer kit (version F; Invitrogen) and total RNA from Arabidopsis flowers. .. To generate 35S ∷ LUH , the full-length LUH cDNA from RIKEN was amplified by PCR with primers 35SLUH-F (5′-ATTACCCGGGGATGGCTCAGAGTAATTGGGAAG-3′) and 35SLUH-R (5′-TCCCCCGGGCTACTTCCAAATCTTTACGGA-3′) containing engineered Xma I sites with the high-fidelity Taq polymerase (Roche).

    Article Title: Isolation of a Protein Interacting with Vfphot1a in Guard Cells of Vicia faba 1
    Article Snippet: The 5′ RACE was performed using a GeneRacer kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. .. PCR products were cloned into a pCR4-TOPO vector (Invitrogen).

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Capped mRNA (5’RACE) and native mRNA (3’RACE) were reverse transcribed using SuperScript™ IV RT kit (Invitrogen, Fisher Scientific) with 5′-gene specific primer (Additional file : Table S8) or GeneRacer™ Oligo dT primer (GeneRacer™ kit, Invitrogen), respectively. .. PCR products were cloned into pCR4®-TOPO vector (TOPO™-TA cloning™ kit, Invitrogen), then amplified into Escherichia coli One Shot™ Top10 chemically competent cells (Invitrogen).

    Article Title: The Blast Resistance Gene Pi37 Encodes a Nucleotide Binding Site-Leucine-Rich Repeat Protein and Is a Member of a Resistance Gene Cluster on Rice Chromosome 1
    Article Snippet: Rapid amplification of cDNA ends (RACE) was conducted using the GeneRacer kit (Invitrogen, Groningen, The Netherlands), following the manufacturer's instructions. .. A 50-fold dilution of the resulting PCR product served as template for the second round of amplification, using as primers GS2 and GeneRacer 5′.

    Nested PCR:

    Article Title: Regulated Fox-2 isoform expression mediates protein 4.1R splicing during erythroid differentiation
    Article Snippet: .. 5′ rapid amplification of cDNA ends (RACE) was performed following the instruction of GeneRacer Kit (Invitrogen); mEx3-RT was used for reverse transcription, and sense (GeneRace 5′ Primer and 5′ Nested Primer) and antisense primers (5′Race-1-As and 5′Race-2-As; ; mFox-2 5′ RACE) were used for nested PCR. .. Semiquantitative reverse transcription (RT)–PCR analysis of splicing products were performed as described.

    Rapid Amplification of cDNA Ends:

    Article Title: Regulated Fox-2 isoform expression mediates protein 4.1R splicing during erythroid differentiation
    Article Snippet: .. 5′ rapid amplification of cDNA ends (RACE) was performed following the instruction of GeneRacer Kit (Invitrogen); mEx3-RT was used for reverse transcription, and sense (GeneRace 5′ Primer and 5′ Nested Primer) and antisense primers (5′Race-1-As and 5′Race-2-As; ; mFox-2 5′ RACE) were used for nested PCR. .. Semiquantitative reverse transcription (RT)–PCR analysis of splicing products were performed as described.

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: .. Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen). .. Sequences were edited and analyzed with assistance from the MacVector software package.

    Article Title: A developmental program truncates long transcripts to temporally regulate cell signaling
    Article Snippet: .. Rapid amplification of cDNA ends (RACE) libraries were created using the GeneRacer kit (ThermoFisher) for the purpose of mapping 3’ ends of transcripts. .. Standard protocol was followed, consisting of RNA extraction as described above, dephosphorylating mRNA using Calf Intestinal Alkaline Phosphatase (CIP), decapping mRNA using Tobacco Acid Pyrophosphatase (TAP), serial ligations of a 5’ RNA oligo adapter and a 3’ oligo dT adapter, and reverse transcription using Protoscript II (NEB).

    Article Title: The Blast Resistance Gene Pi37 Encodes a Nucleotide Binding Site-Leucine-Rich Repeat Protein and Is a Member of a Resistance Gene Cluster on Rice Chromosome 1
    Article Snippet: .. Rapid amplification of cDNA ends (RACE) was conducted using the GeneRacer kit (Invitrogen, Groningen, The Netherlands), following the manufacturer's instructions. .. Total leaf RNA was extracted 24 hr after infection from both St. No. 1 and the highly blast-susceptible Lijiangxintuanheigu (LTH).

    Plasmid Preparation:

    Article Title: Isolation of a Protein Interacting with Vfphot1a in Guard Cells of Vicia faba 1
    Article Snippet: The 5′ RACE was performed using a GeneRacer kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. .. PCR products were cloned into a pCR4-TOPO vector (Invitrogen).

    Article Title: miR-762 activation confers acquired resistance to gefitinib in non-small cell lung cancer
    Article Snippet: .. Luciferase reporter assay We amplified the full-length 3’UTR of human ABR gene from cDNA synthesized from total RNA of A549 cells using a GeneRacer Kit (Thermo Fisher Scientific), and cloned it into pGL3-Basic Vector using In-Fusion® HD Cloning Kit (Takara, Beijing, China). .. The site-directed mutagenesis was achieved with the aid of the QuikChange II site-directed mutagenesis kit (Agilent, Beijing, China).

    Article Title: Activity-Dependent Expression of Acyl-Coenzyme A-Binding Protein in Retinal Muller Glial Cells Evoked by Optokinetic Stimulation
    Article Snippet: Positive plaques were rescued into the plasmid vector Bluescript SK– . .. A GeneRacer Kit (Invitrogen) was also used to obtain complete gene sequences.

    Article Title: Multiple combinations of RDL subunits diversify the repertoire of GABA receptors in the honey bee parasite Varroa destructor
    Article Snippet: The 5′ and 3′ end regions of the different cDNAs were obtained by rapid amplification of cDNA ends–PCR using the GeneRacer kit (Thermo Fisher) and primers designed based on the sequences deposited in BeeBase, with the exception of VdesRDL2 for which we designed specific primers to obtain the 5′-end based on the predicted sequence obtained from transcriptomic data deposited in GenBankTM . .. The cDNA of amRDL ( ) was cloned in the pBS-SK vector (Agilent).

    Article Title: The olfactory secretome varies according to season in female sheep and goat
    Article Snippet: Capped mRNA (5’RACE) and native mRNA (3’RACE) were reverse transcribed using SuperScript™ IV RT kit (Invitrogen, Fisher Scientific) with 5′-gene specific primer (Additional file : Table S8) or GeneRacer™ Oligo dT primer (GeneRacer™ kit, Invitrogen), respectively. .. PCR products were cloned into pCR4®-TOPO vector (TOPO™-TA cloning™ kit, Invitrogen), then amplified into Escherichia coli One Shot™ Top10 chemically competent cells (Invitrogen).

    Software:

    Article Title: Ov-APR-1, an aspartic protease from the carcinogenic liver fluke, Opisthorchis viverrini: functional expression, immunolocalization and subsite specificity
    Article Snippet: Full length 5′ and 3′ends were obtained for Ov-apr-1 by 5′ and 3′ rapid amplification of cDNA ends (RACE) using a Generacer kit (Invitrogen). .. Sequences were edited and analyzed with assistance from the MacVector software package.

    RNA Extraction:

    Article Title: Immunogenetic factors driving formation of ultralong VH CDR3 in Bos taurus antibodies
    Article Snippet: Peripheral blood mononuclear cells (PBMC) were isolated from blood with lymphocyte separation media (Mediatech Inc, Tewksbury, MA, USA) and total RNA extraction was performed on the isolated PBMC with the RNeasy mini kit (Qiagen Valencia, CA, USA) as previously described. .. Isolated RNA was used as the template for synthesis of 5′ RACE libraries with the GeneRacer kit (Invitrogen, Carlsbad, CA, USA) performed as previously described.

    Article Title: A developmental program truncates long transcripts to temporally regulate cell signaling
    Article Snippet: Rapid amplification of cDNA ends (RACE) libraries were created using the GeneRacer kit (ThermoFisher) for the purpose of mapping 3’ ends of transcripts. .. Standard protocol was followed, consisting of RNA extraction as described above, dephosphorylating mRNA using Calf Intestinal Alkaline Phosphatase (CIP), decapping mRNA using Tobacco Acid Pyrophosphatase (TAP), serial ligations of a 5’ RNA oligo adapter and a 3’ oligo dT adapter, and reverse transcription using Protoscript II (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher generacer kit
    Generacer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 564 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/generacer kit/product/Thermo Fisher
    Average 90 stars, based on 564 article reviews
    Price from $9.99 to $1999.99
    generacer kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    Run your ion chromatography IC gradient separations as easily as isocratic applications with stable electrolytic generation of high purity eluent to your Thermo Scientific Dionex ICS 6000 Reagent Free HPIC
      Buy from Supplier

    N/A
    Run gradient separations as easily as isocratic applications Add stable electrolytic generation of high purity eluent to your Thermo Scientific Dionex ICS 5000 Reagent Free HPIC System with the Dionex
      Buy from Supplier

    Image Search Results