genejet pcr purification kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher genejet pcr purification kit
    Genejet Pcr Purification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 600 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genejet pcr purification kit/product/Thermo Fisher
    Average 99 stars, based on 600 article reviews
    Price from $9.99 to $1999.99
    genejet pcr purification kit - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: Paragraph title: SlZRT2 Cloning and Heterologous Expression in Yeast ... The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The 6‐FAM dye labeled fragment was prepared by amplifying 200‐bp‐long fragment of SMAD4 promoter cloned into pGL4.10 vector using the following primers: 5′‐ATCTTTTCCCAAGTAGTCAG‐3′ and 5′‐6‐FAM‐TGTTCAAGTTTTTCCTTTTA‐3′. .. The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA).

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: PCR amplifications and DNA manipulations PCR amplification procedures were performed using either Taq DNA polymerase, for analytical purposes, or Pfu DNA polymerase, for cloning and sequencing (Fermentas, USA). .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. Purified PCR products were ligated into the pGEM® ‐T Easy cloning vector and transformed into RapidTrans™ chemically competent Escherichia coli cells as recommended by the manufacturer (pGEM‐T Easy Vector Systems; Promega, Madison, WI, USA).

    Centrifugation:

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression. .. The reaction was stopped by addition of 1:1 volume of 10% ice-cold TCA and the samples were incubated on ice for at least 30 min. After centrifugation at 20817 × g for 5 min at 4 °C, the supernatant was discarded and the pellet was resuspended in sample buffer at 37 °C for 15 min, under constant shaking at 900 rpm.

    Amplification:

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: .. Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing. .. The chromatograms obtained from Sanger sequencing were then analyzed for the presence of SNPs.

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: Reaction specificity and amplicon length were verified by visualization of 5-μl PCR product on a 1.5% agarose gel with GelRed® Nucleic Acid Gel Stain (Biotium, Fremont, CA, United States). .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. This produced ‘mini-barcodes’ of approximately 298 bp when amplified with LepF1/C_ANTMRID primers and 278 bp when amplified with MLepF1/LepR1 primers, which were then trimmed for analysis.

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: The ITS region was amplified with 6‐FAM‐labelled universal forward primer 1406f and bacteria‐specific reverse primer 23Sr (modified from Yannarell et al. ). .. After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard.

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The amplification was performed under the following conditions: initial denaturation at 94°C for 5 min, 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min, with the final elongation step at 72°C for 10 min. .. The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA).

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: PCR amplifications and DNA manipulations PCR amplification procedures were performed using either Taq DNA polymerase, for analytical purposes, or Pfu DNA polymerase, for cloning and sequencing (Fermentas, USA). .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: Agarose gel electrophoresis (1·2% agarose, 100V, 30–45 min) verified the success of PCR amplification based on the predicted amplicon size. .. PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions.

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: Paragraph title: DNA Extraction, 16S Amplification, and Sequencing. ... PCR products were purified using a GeneJet PCR purification kit (Thermo).

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: Amplification of CRISPR arrays present in sample population TIMING ~3 hrs 4| Using either the overnight culture from Step 1 directly, or the sample prepared in optional Steps 2 and 3 as a template, prepare a PCR reaction as follows: Then perform a PCR amplification under the following conditions: CRITICAL STEP If you are using an overnight culture as template for the initial PCR increasing your denaturation time to 5 mins at 98 ºC can help aid cell lysis making more genomic DNA available as a template in PCR the reaction tube. .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: Standard solution conditions for PCR amplification were used as follows to maximize double-stranded DNA (dsDNA) yield while reducing by-products after amplification: 2.5 U of Hot Start Taq DNA polymerase (New England BioLabs), 1× Hot Start Taq reaction buffer, 1 μM forward primer, 1 μM backward primer, 500 μM deoxynucleotide triphosphate, and ssDNA library template (~100 ng/ml) in a total 10-ml volumes for each of the 100-μl volume 96-well reaction plates. .. Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries.

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: Linear constructs were obtained by PCR amplification using oligonucleotides overlapping the T7 promoter and terminator on purified plasmids. .. After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression.

    Synthesized:

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: PCR primers were designed based on the known DNA sequences and relevant restriction enzymes (RE) were introduced via primers when needed (Table ) which were synthesized by Integrated DNA Technologies (Singapore). .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA).

    Construct:

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: SlZRT2 Cloning and Heterologous Expression in Yeast A cDNA library of the sequenced isolate UH-Slu-Lm8-n1 ( ) was constructed according to . .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. DNA sequences of primary parasitoids amplified with LepF1/C_ANTMRID primers were used to construct a phylogenetic tree in MEGAX [ ], with 8 reference sequences ( ) obtained from the NCBI Database [ ].

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: .. After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression. .. The NEB PURExpress In Vitro Protein Synthesis Kit was used for in vitro transcription and translation.

    Electrophoresis:

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: PCR products were visualized using electrophoresis on 1.2% agarose gels in 0.5 × TBE buffer stained with GelRed (Biotium, Fremont, California, USA). .. PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene.

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA). .. Activity of serum DNase was determined by incubation of the sera samples with VIC dye labeled PCR fragment (green), followed by detection of digestion products by capillary electrophoresis on 3130 Genetic Analyzer (Applied Biosystems Corporation, Carlsbad, CA).

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. After electrophoresis, the gel was stained with SYBR Gold, and DNA bands were observed under ultraviolet light.

    Incubation:

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA). .. Activity of serum DNase was determined by incubation of the sera samples with VIC dye labeled PCR fragment (green), followed by detection of digestion products by capillary electrophoresis on 3130 Genetic Analyzer (Applied Biosystems Corporation, Carlsbad, CA).

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The reaction mixture was incubated for 75 sec at room temperature, after which the reaction was stopped by incubation at 75°C for 10 min. .. The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. A volume of 50 and 100 μ l of each transformation culture was spread on duplicate MacConkey/ampicillin agar plates which were incubated overnight at 37°C.

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: Proteinase K was added to the mixture to a final concentration of 100 μ g/mL, and the mixture was incubated for 1 h in a water bath at 50 °C. .. PCR products were purified using a GeneJet PCR purification kit (Thermo).

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression. .. The reaction was stopped by addition of 1:1 volume of 10% ice-cold TCA and the samples were incubated on ice for at least 30 min. After centrifugation at 20817 × g for 5 min at 4 °C, the supernatant was discarded and the pellet was resuspended in sample buffer at 37 °C for 15 min, under constant shaking at 900 rpm.

    Activity Assay:

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA). .. Activity of serum DNase was determined by incubation of the sera samples with VIC dye labeled PCR fragment (green), followed by detection of digestion products by capillary electrophoresis on 3130 Genetic Analyzer (Applied Biosystems Corporation, Carlsbad, CA).

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The negative control contained only the fragment, with no source of DNase activity. .. The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific).

    Expressing:

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: Paragraph title: SlZRT2 Cloning and Heterologous Expression in Yeast ... The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: .. After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression. .. The NEB PURExpress In Vitro Protein Synthesis Kit was used for in vitro transcription and translation.

    Modification:

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: The ITS region was amplified with 6‐FAM‐labelled universal forward primer 1406f and bacteria‐specific reverse primer 23Sr (modified from Yannarell et al. ). .. After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard.

    Transformation Assay:

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. Purified PCR products were ligated into the pGEM® ‐T Easy cloning vector and transformed into RapidTrans™ chemically competent Escherichia coli cells as recommended by the manufacturer (pGEM‐T Easy Vector Systems; Promega, Madison, WI, USA).

    Generated:

    Article Title: Occurrence of Salmonella infection and antimicrobial susceptibility for local Salmonella isolates from different sources in a cross-sectional study
    Article Snippet: Invasive protein A (invA) gene products sequencing and bioinformatics analysis PCR products generated from the inv A gene in selected isolates of Salmonella were sent to be sequenced at the Animal Health Research Institute (AHRI) in Dokki, El- Giza. .. The PCR products were purified using the GeneJET PCR Purification Kit (Thermo) and sequenced on a DNA sequencer.

    Sequencing:

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: .. Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing. .. The chromatograms obtained from Sanger sequencing were then analyzed for the presence of SNPs.

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: A gene-specific primer pair was developed to amplify the full-length coding sequence of SlZRT2 (forward primer: 5′ TCAGCACTTCACCACAGGCTTACTATC 3′; reverse primer: 5′ CATCCCCACGAGCGCCAT 3′). .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: PCR amplifications and DNA manipulations PCR amplification procedures were performed using either Taq DNA polymerase, for analytical purposes, or Pfu DNA polymerase, for cloning and sequencing (Fermentas, USA). .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA).

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: Paragraph title: DNA Extraction, 16S Amplification, and Sequencing. ... PCR products were purified using a GeneJet PCR purification kit (Thermo).

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: .. Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. PCR products were confirmed by gel electrophoresis in a 4% agarose gel (low-range ultra agarose, Bio-Rad Laboratories) in 1× tris-borate-EDTA buffer (run for 18 min at 110 V).

    Article Title: Occurrence of Salmonella infection and antimicrobial susceptibility for local Salmonella isolates from different sources in a cross-sectional study
    Article Snippet: Paragraph title: Invasive protein A (invA) gene products sequencing and bioinformatics analysis ... The PCR products were purified using the GeneJET PCR Purification Kit (Thermo) and sequenced on a DNA sequencer.

    Binding Assay:

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: For Sanger sequencing, positive genomic regions for PHE1 binding containing SNPs that allowed distinction between parents were amplified by PCR using the Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific), in combination with the primers described above. .. Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing.

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions. .. CRITICAL STEP Add isopropanol in equal proportion to the DNA binding buffer when purifying fragments smaller than 500 bp.

    Staining:

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: Reaction specificity and amplicon length were verified by visualization of 5-μl PCR product on a 1.5% agarose gel with GelRed® Nucleic Acid Gel Stain (Biotium, Fremont, CA, United States). .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: PCR products were visualized using electrophoresis on 1.2% agarose gels in 0.5 × TBE buffer stained with GelRed (Biotium, Fremont, California, USA). .. PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene.

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: The gels were stained with GelRed™ (VWR) and visualized on a UV transilluminator (U:Genius3 ; Syngene, India). .. PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. After electrophoresis, the gel was stained with SYBR Gold, and DNA bands were observed under ultraviolet light.

    DNA Extraction:

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA). .. Plasmids were isolated using Favorpep™ Plasmid DNA Extraction Mini Kit (Favorgen, Taiwan).

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: Paragraph title: DNA Extraction, 16S Amplification, and Sequencing. ... PCR products were purified using a GeneJet PCR purification kit (Thermo).

    Nucleic Acid Electrophoresis:

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: .. After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard. .. Fragment sizes and relative peak areas were determined with GeneMarker V2.6.4 (SoftGenetics) using the local southern method for size calling.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. PCR products were confirmed by gel electrophoresis in a 4% agarose gel (low-range ultra agarose, Bio-Rad Laboratories) in 1× tris-borate-EDTA buffer (run for 18 min at 110 V).

    Fluorescence:

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard. .. We included peaks in the size range of 100 to 1000 bp with a relative fluorescence intensity over 0.2%.

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: Paragraph title: Fluorescence‐Based DNase Assay ... The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA).

    Isolation:

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA). .. Plasmids were isolated using Favorpep™ Plasmid DNA Extraction Mini Kit (Favorgen, Taiwan).

    Size-exclusion Chromatography:

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The reaction mixture was incubated for 75 sec at room temperature, after which the reaction was stopped by incubation at 75°C for 10 min. .. The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific).

    Labeling:

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The VIC dye labeled fragment (green) was used as a substrate for serum DNase, while the 6‐FAM dye labeled fragment (blue) was used as an internal size standard. .. The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA).

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The assay was performed in a reaction mixture containing in a total volume of 10 μl: 2.5 ng of VIC dye labeled fragment and 0.3 μL of serum sample. .. The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific).

    Purification:

    Article Title: Integration of a multi-step heterologous pathway in Saccharomyces cerevisiae for the production of abscisic acid
    Article Snippet: .. PCR products were digested with FastDigest DpnI (Thermo Fisher Scientific) for 2 h at 37 °C, before being purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific). .. For colony PCR, DreamTaq DNA polymerase (Thermo Fisher Scientific) was used (protocol according to Easyclone-MarkerFree manual, [ ]).

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: .. Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing. .. The chromatograms obtained from Sanger sequencing were then analyzed for the presence of SNPs.

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States). .. Subsequently, the purified amplicon was cloned into the gateway entry vector pCR8/GW/TOPO (Invitrogen, Carlsbad, CA, United States) and transferred to the destination vectors pAG426GAL-ccdB-EGFP ( ) and pYES-DEST52 (Invitrogen, Carlsbad, CA, United States) with the Gateway LR-clonase II Enzyme Mix (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions.

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: .. PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. This produced ‘mini-barcodes’ of approximately 298 bp when amplified with LepF1/C_ANTMRID primers and 278 bp when amplified with MLepF1/LepR1 primers, which were then trimmed for analysis.

    Article Title: Bromodomain inhibition of the coactivators CBP/EP300 facilitate cellular reprogramming
    Article Snippet: .. The samples were then purified using the GeneJET PCR purification kit and eluted with 20 μl of TE buffer. .. Samples were then validated on a Tapestation (Agilent) to determine library size and quantification prior to paired-end (2 × 41 bp) sequencing on a NextSeq 500 (Illumina) platform.

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: .. After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard. .. Fragment sizes and relative peak areas were determined with GeneMarker V2.6.4 (SoftGenetics) using the local southern method for size calling.

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: .. The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA). .. Activity of serum DNase was determined by incubation of the sera samples with VIC dye labeled PCR fragment (green), followed by detection of digestion products by capillary electrophoresis on 3130 Genetic Analyzer (Applied Biosystems Corporation, Carlsbad, CA).

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA). .. Plasmids were isolated using Favorpep™ Plasmid DNA Extraction Mini Kit (Favorgen, Taiwan).

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: .. The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific). .. Each sample subjected to fragment analysis contained 5 μl of the purified reaction mixture, 0.3 μl of GeneScan‐500 LIZ Size Standard (Applied Biosystems Corporation), 0.25 μl of the 6‐FAM dye labeled fragment (blue), and 15 μl of HiDi Formamide (Applied Biosystems Corporation).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: .. PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. Purified PCR products were ligated into the pGEM® ‐T Easy cloning vector and transformed into RapidTrans™ chemically competent Escherichia coli cells as recommended by the manufacturer (pGEM‐T Easy Vector Systems; Promega, Madison, WI, USA).

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: .. PCR products were purified using a GeneJet PCR purification kit (Thermo). .. Sanger sequencing was performed on the purified PCR product using 109F, 359F, and 1509R primers.

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions. .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: .. Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. PCR products were confirmed by gel electrophoresis in a 4% agarose gel (low-range ultra agarose, Bio-Rad Laboratories) in 1× tris-borate-EDTA buffer (run for 18 min at 110 V).

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: .. After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression. .. The NEB PURExpress In Vitro Protein Synthesis Kit was used for in vitro transcription and translation.

    Article Title: Occurrence of Salmonella infection and antimicrobial susceptibility for local Salmonella isolates from different sources in a cross-sectional study
    Article Snippet: .. The PCR products were purified using the GeneJET PCR Purification Kit (Thermo) and sequenced on a DNA sequencer. .. The sequencing step was conducted with the Big Dye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Integration of a multi-step heterologous pathway in Saccharomyces cerevisiae for the production of abscisic acid
    Article Snippet: .. PCR products were digested with FastDigest DpnI (Thermo Fisher Scientific) for 2 h at 37 °C, before being purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific). .. For colony PCR, DreamTaq DNA polymerase (Thermo Fisher Scientific) was used (protocol according to Easyclone-MarkerFree manual, [ ]).

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: .. Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing. .. The chromatograms obtained from Sanger sequencing were then analyzed for the presence of SNPs.

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States). .. Subsequently, the purified amplicon was cloned into the gateway entry vector pCR8/GW/TOPO (Invitrogen, Carlsbad, CA, United States) and transferred to the destination vectors pAG426GAL-ccdB-EGFP ( ) and pYES-DEST52 (Invitrogen, Carlsbad, CA, United States) with the Gateway LR-clonase II Enzyme Mix (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions.

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: .. PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. This produced ‘mini-barcodes’ of approximately 298 bp when amplified with LepF1/C_ANTMRID primers and 278 bp when amplified with MLepF1/LepR1 primers, which were then trimmed for analysis.

    Article Title: Bromodomain inhibition of the coactivators CBP/EP300 facilitate cellular reprogramming
    Article Snippet: .. The samples were then purified using the GeneJET PCR purification kit and eluted with 20 μl of TE buffer. .. Samples were then validated on a Tapestation (Agilent) to determine library size and quantification prior to paired-end (2 × 41 bp) sequencing on a NextSeq 500 (Illumina) platform.

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: .. After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard. .. Fragment sizes and relative peak areas were determined with GeneMarker V2.6.4 (SoftGenetics) using the local southern method for size calling.

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: .. The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA). .. Activity of serum DNase was determined by incubation of the sera samples with VIC dye labeled PCR fragment (green), followed by detection of digestion products by capillary electrophoresis on 3130 Genetic Analyzer (Applied Biosystems Corporation, Carlsbad, CA).

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA). .. Plasmids were isolated using Favorpep™ Plasmid DNA Extraction Mini Kit (Favorgen, Taiwan).

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: .. The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific). .. Each sample subjected to fragment analysis contained 5 μl of the purified reaction mixture, 0.3 μl of GeneScan‐500 LIZ Size Standard (Applied Biosystems Corporation), 0.25 μl of the 6‐FAM dye labeled fragment (blue), and 15 μl of HiDi Formamide (Applied Biosystems Corporation).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: .. PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. Purified PCR products were ligated into the pGEM® ‐T Easy cloning vector and transformed into RapidTrans™ chemically competent Escherichia coli cells as recommended by the manufacturer (pGEM‐T Easy Vector Systems; Promega, Madison, WI, USA).

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: .. PCR products were purified using a GeneJet PCR purification kit (Thermo). .. Sanger sequencing was performed on the purified PCR product using 109F, 359F, and 1509R primers.

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions. .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: .. Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. PCR products were confirmed by gel electrophoresis in a 4% agarose gel (low-range ultra agarose, Bio-Rad Laboratories) in 1× tris-borate-EDTA buffer (run for 18 min at 110 V).

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: .. After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression. .. The NEB PURExpress In Vitro Protein Synthesis Kit was used for in vitro transcription and translation.

    Article Title: Occurrence of Salmonella infection and antimicrobial susceptibility for local Salmonella isolates from different sources in a cross-sectional study
    Article Snippet: .. The PCR products were purified using the GeneJET PCR Purification Kit (Thermo) and sequenced on a DNA sequencer. .. The sequencing step was conducted with the Big Dye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems).

    CRISPR:

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: Amplification of CRISPR arrays present in sample population TIMING ~3 hrs 4| Using either the overnight culture from Step 1 directly, or the sample prepared in optional Steps 2 and 3 as a template, prepare a PCR reaction as follows: Then perform a PCR amplification under the following conditions: CRITICAL STEP If you are using an overnight culture as template for the initial PCR increasing your denaturation time to 5 mins at 98 ºC can help aid cell lysis making more genomic DNA available as a template in PCR the reaction tube. .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    cDNA Library Assay:

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: SlZRT2 Cloning and Heterologous Expression in Yeast A cDNA library of the sequenced isolate UH-Slu-Lm8-n1 ( ) was constructed according to . .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Agarose Gel Electrophoresis:

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: Reaction specificity and amplicon length were verified by visualization of 5-μl PCR product on a 1.5% agarose gel with GelRed® Nucleic Acid Gel Stain (Biotium, Fremont, CA, United States). .. The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: Agarose gel electrophoresis (1·2% agarose, 100V, 30–45 min) verified the success of PCR amplification based on the predicted amplicon size. .. PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions.

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: 5| Run the PCR products (5-10 μl) on a 2% (wt/vol) agarose gel containing SYBR safe (1 μl / 10 ml) at 100 V for ~30min to check for the presence of a single band of your desired size (gel extraction or PCR optimization is needed if more bands are present). .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. PCR products were confirmed by gel electrophoresis in a 4% agarose gel (low-range ultra agarose, Bio-Rad Laboratories) in 1× tris-borate-EDTA buffer (run for 18 min at 110 V).

    Chromatin Immunoprecipitation:

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: Paragraph title: qPCR and Sanger sequencing of parental-specific PHE1 ChIP ... Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing.

    Plasmid Preparation:

    Article Title: Integration of a multi-step heterologous pathway in Saccharomyces cerevisiae for the production of abscisic acid
    Article Snippet: Paragraph title: Plasmid and strain construction ... PCR products were digested with FastDigest DpnI (Thermo Fisher Scientific) for 2 h at 37 °C, before being purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific).

    Article Title: SlZRT2 Encodes a ZIP Family Zn Transporter With Dual Localization in the Ectomycorrhizal Fungus Suillus luteus
    Article Snippet: The remaining PCR product (25 μl) was processed with the GeneJet PCR purification kit (Thermo Scientific, Waltham, MA, United States). .. Subsequently, the purified amplicon was cloned into the gateway entry vector pCR8/GW/TOPO (Invitrogen, Carlsbad, CA, United States) and transferred to the destination vectors pAG426GAL-ccdB-EGFP ( ) and pYES-DEST52 (Invitrogen, Carlsbad, CA, United States) with the Gateway LR-clonase II Enzyme Mix (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions.

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: Amplification of both fragments was performed in a reaction mixture containing in a total volume of 100 μl: 50 ng of plasmid DNA, 2 U of FIREPol DNA Polymerase (Solis BioDyne, Tartu, Estonia), 1× Buffer B (Solis BioDyne), 2.5 mM MgCl2 , 0.2 mM of each of deoxynucleoside triphosphates (dNTPs), and 20 pmol of each primer. .. The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA).

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA). .. Plasmids were isolated using Favorpep™ Plasmid DNA Extraction Mini Kit (Favorgen, Taiwan).

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. Purified PCR products were ligated into the pGEM® ‐T Easy cloning vector and transformed into RapidTrans™ chemically competent Escherichia coli cells as recommended by the manufacturer (pGEM‐T Easy Vector Systems; Promega, Madison, WI, USA).

    Software:

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The obtained products were purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific). .. The results were analyzed using the GeneMapper Software, version 4.0 (Applied Biosystems Corporation).

    Real-time Polymerase Chain Reaction:

    Article Title: The MADS-box transcription factor PHERES1 controls imprinting in the endosperm by binding to domesticated transposons
    Article Snippet: Paragraph title: qPCR and Sanger sequencing of parental-specific PHE1 ChIP ... Amplified DNA was purified using the GeneJET PCR Purification kit (Thermo Fisher Scientific) and used for Sanger sequencing.

    Negative Control:

    Article Title: Assessment of Deoxyribonuclease Activity in Serum Samples of Patients With Systemic Lupus Erythematosus: Fluorescence‐Based Method Versus ELISA
    Article Snippet: The obtained PCR product was purified using the GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA). .. The negative control contained only the fragment, with no source of DNase activity.

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: A negative control well was prepared without ssDNA library template. .. Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries.

    Ribosomal Intergenic Spacer Analysis:

    Article Title: Spatial insurance in multi‐trophic metacommunities
    Article Snippet: Community composition of bacteria was quantified using amplified ribosomal intergenic spacer analysis (ARISA), a molecular fingerprinting technique based on size differences of the intergenic transcribed spacer (ITS) region. .. After purification of PCR products (GeneJET PCR purification kit, Thermo Scientific), samples were analysed with denaturing gel electrophoresis on a MegaBACE 1000 (GE Healthcare Biosciences, Pittsburgh, PA, USA), with ROX‐labelled MapMarker 1500 (BioVentures) used as internal size standard.

    In Vitro:

    Article Title: Effects of protein size, thermodynamic stability, and net charge on cotranslational folding on the ribosome
    Article Snippet: Paragraph title: In Vitro Transcription and Translation. ... After DpnI digestion and purification (GeneJET PCR Purification Kit; Thermo Scientific), the linear constructs were used as template for protein expression.

    Produced:

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. This produced ‘mini-barcodes’ of approximately 298 bp when amplified with LepF1/C_ANTMRID primers and 278 bp when amplified with MLepF1/LepR1 primers, which were then trimmed for analysis.

    Concentration Assay:

    Article Title: Hydrocarbon‐degrading bacteria in deep‐water subarctic sediments (Faroe‐Shetland Channel)
    Article Snippet: PCR products were purified using the Thermo Scientific GeneJET PCR Purification Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer's instructions. .. Successful cloning of inserts into the pGEM‐T Easy cloning vector was screened on MacConkey agar plates prepared with ampicillin at a final concentration of 100 mg l−1 .

    Article Title: Calothrixamides A and B from the Cultured Cyanobacterium Calothrix sp. UIC 10520
    Article Snippet: Proteinase K was added to the mixture to a final concentration of 100 μ g/mL, and the mixture was incubated for 1 h in a water bath at 50 °C. .. PCR products were purified using a GeneJet PCR purification kit (Thermo).

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: 3| (Optional) Measure the DNA concentration in ng/μl with a NanoPhotometer. .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    Lysis:

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: Amplification of CRISPR arrays present in sample population TIMING ~3 hrs 4| Using either the overnight culture from Step 1 directly, or the sample prepared in optional Steps 2 and 3 as a template, prepare a PCR reaction as follows: Then perform a PCR amplification under the following conditions: CRITICAL STEP If you are using an overnight culture as template for the initial PCR increasing your denaturation time to 5 mins at 98 ºC can help aid cell lysis making more genomic DNA available as a template in PCR the reaction tube. .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    High Throughput Screening Assay:

    Article Title: High-throughput evolution of near-infrared serotonin nanosensors
    Article Snippet: .. Next, 100 μl of the PCR products from each of the experimental and the control SELEC libraries was separately collected and purified with a GeneJET PCR Purification kit (Thermo Fisher Scientific) for preparation of high-throughput sequencing libraries. .. PCR products were confirmed by gel electrophoresis in a 4% agarose gel (low-range ultra agarose, Bio-Rad Laboratories) in 1× tris-borate-EDTA buffer (run for 18 min at 110 V).

    Gel Extraction:

    Article Title: Engineering integrative vectors based on phage site-specific recombination mechanism for Lactococcus lactis
    Article Snippet: .. DNA fragments were purified using GeneJET PCR purification Kit and GeneJET Gel Extraction Kit (Thermofisher, USA). .. Plasmids were isolated using Favorpep™ Plasmid DNA Extraction Mini Kit (Favorgen, Taiwan).

    Article Title: Using CAPTURE to detect spacer acquisition in native CRISPR arrays
    Article Snippet: 5| Run the PCR products (5-10 μl) on a 2% (wt/vol) agarose gel containing SYBR safe (1 μl / 10 ml) at 100 V for ~30min to check for the presence of a single band of your desired size (gel extraction or PCR optimization is needed if more bands are present). .. ?TROUBLESHOOTING 6| Clean and concentrate the PCR(s) using the ThermoFisher Scientific GeneJET PCR Purification kit, following the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher genejet pcr purification kit
    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and <t>PCR</t> Clean-Up System (Promega); Th, <t>GeneJET</t> PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Genejet Pcr Purification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 600 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genejet pcr purification kit/product/Thermo Fisher
    Average 90 stars, based on 600 article reviews
    Price from $9.99 to $1999.99
    genejet pcr purification kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Journal: BMC Genomics

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    doi: 10.1186/s12864-017-4371-5

    Figure Lengend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Article Snippet: Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ).

    Techniques: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction