genejet pcr purification kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    GeneJET PCR Purification Kit
    Description:
    Thermo Scientific GeneJET PCR Purification Kit utilizes a proprietary silica based membrane technology in the form of a convenient spin column eliminating the need for tedious resin manipulations or toxic phenol chloroform extractions It effectively removes primers dNTPs unincorporated labeled nucleotides enzymes and salts from PCR and other reaction mixtures The kit can be used for purification of DNA fragments from 25 bp to 20 kb with recovery rates up to 100 Each GeneJET purification column has a total binding capacity of up to 25 µg of DNA and the entire procedure takes 5 minutes The purified DNA can be used in common downstream applications such as sequencing restriction digestion labeling ligation cloning in vitro transcription blotting or in situ hybridization Highlights• Highly efficient 90 to 100 recoveries in the range of 100 bp to 10 kb• Fast procedure takes only 5 minutes• Convenient spin columns are capped and assembled with collection tubesApplications• Fast and efficient purification of DNA fragments ideal for use in all conventional molecular biology procedures including • FastDigest or conventional restriction digestion• Automated fluorescent or radioactive sequencing• PCR• In vitro transcription• In situ hybridization• Labeling• Cloning
    Catalog Number:
    k0701
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|DNA Extraction|PCR Product Clean-Up
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher genejet pcr purification kit
    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and <t>PCR</t> Clean-Up System (Promega); Th, <t>GeneJET</t> PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Thermo Scientific GeneJET PCR Purification Kit utilizes a proprietary silica based membrane technology in the form of a convenient spin column eliminating the need for tedious resin manipulations or toxic phenol chloroform extractions It effectively removes primers dNTPs unincorporated labeled nucleotides enzymes and salts from PCR and other reaction mixtures The kit can be used for purification of DNA fragments from 25 bp to 20 kb with recovery rates up to 100 Each GeneJET purification column has a total binding capacity of up to 25 µg of DNA and the entire procedure takes 5 minutes The purified DNA can be used in common downstream applications such as sequencing restriction digestion labeling ligation cloning in vitro transcription blotting or in situ hybridization Highlights• Highly efficient 90 to 100 recoveries in the range of 100 bp to 10 kb• Fast procedure takes only 5 minutes• Convenient spin columns are capped and assembled with collection tubesApplications• Fast and efficient purification of DNA fragments ideal for use in all conventional molecular biology procedures including • FastDigest or conventional restriction digestion• Automated fluorescent or radioactive sequencing• PCR• In vitro transcription• In situ hybridization• Labeling• Cloning
    https://www.bioz.com/result/genejet pcr purification kit/product/Thermo Fisher
    Average 99 stars, based on 743 article reviews
    Price from $9.99 to $1999.99
    genejet pcr purification kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    2) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: New silver nanoparticles induce apoptosis-like process in E. coli and interfere with mammalian copper metabolism
    Article Snippet: .. The purified fragment (GeneJET PCR Purification Kit; Thermo Fisher Scientific, Pittsburgh, PA, USA) was then digested with the restriction enzymes BamH I and Xho I (New England Biolabs, Beverly, MA, USA) and cloned into glutathione-S-transferase (GST) gene fusion plasmid vector pGEX-4T-1 (Addgene, Amersham Biosciences, Buckinghamshire, UK); the resulting plasmid was named pNdCTR1. .. E. coli strain BL21 (DE3)/pNdCTR1 was obtained by chemical transformation (TransformAid™; Thermo Scientific) of bacteria.

    Agarose Gel Electrophoresis:

    Article Title: Origins of the arctic fox variant rabies viruses responsible for recent cases of the disease in southern Ontario
    Article Snippet: .. Agarose gel electrophoresis was used to verify production of amplicons which were then purified using a Genejet PCR purification system (ThermoFisher) prior to sequencing. .. Sequencing and phylogenetic analysis Whole genome sequencing (WGS) of all RABV samples was achieved using Illumina technology as previously described [ ].

    Spectrophotometry:

    Article Title: Detection of Invertebrate Suppressive Soils, and Identification of a Possible Biological Control Agent for Meloidogyne Nematodes Using High Resolution Rhizosphere Microbial Community Analysis
    Article Snippet: .. For amplifying fungal ITS sequences, ITS3_KYO2F and ITS4R primers ( ) were used with appended Illumina sequences: ITS3_KYO2_miseqF TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG GATGAAGAACGYAGYRAA ITS4_miseqR GTCTCGTGGGCTCGGAGATGTGTATAAGA GACAG TCCTCCGCTTATTGATATGC PCR products were purified using a GeneJET PCR Purification Kit (ThermoScientific, Lithuania) and purified product was quantified using a NanoDrop 2000C spectrophotometer (Wilmington, DE, USA). ..

    Purification:

    Article Title: Detection of Invertebrate Suppressive Soils, and Identification of a Possible Biological Control Agent for Meloidogyne Nematodes Using High Resolution Rhizosphere Microbial Community Analysis
    Article Snippet: .. For amplifying fungal ITS sequences, ITS3_KYO2F and ITS4R primers ( ) were used with appended Illumina sequences: ITS3_KYO2_miseqF TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG GATGAAGAACGYAGYRAA ITS4_miseqR GTCTCGTGGGCTCGGAGATGTGTATAAGA GACAG TCCTCCGCTTATTGATATGC PCR products were purified using a GeneJET PCR Purification Kit (ThermoScientific, Lithuania) and purified product was quantified using a NanoDrop 2000C spectrophotometer (Wilmington, DE, USA). ..

    Article Title: Parallel shRNA and CRISPR-Cas9 screens enable antiviral drug target identification
    Article Snippet: .. The PCR-amplified CMPK1-encoding construct was double digested with NdeI and BamHI-HF (New England BioLabs) in CutSmart buffer for 4h at 37 °C and PCR-purified (Thermo GeneJet PCR Purification Kit). .. Similarly, vector pET28 was double digested with NdeI and BamHI-HF for 3 h at 37 °C and gel-purified.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: The gastropod shell has been co-opted to kill parasitic nematodes
    Article Snippet: .. PCR products were then purified using GeneJET PCR purification kit (Thermo Fisher Scientific). .. The PCR product was sequenced in forward and reverse directions using the same primers previously described and the sequence was compared with GenBank sequences using BLASTN searches.

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: .. PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. This produced ‘mini-barcodes’ of approximately 298 bp when amplified with LepF1/C_ANTMRID primers and 278 bp when amplified with MLepF1/LepR1 primers, which were then trimmed for analysis.

    Article Title: New silver nanoparticles induce apoptosis-like process in E. coli and interfere with mammalian copper metabolism
    Article Snippet: .. The purified fragment (GeneJET PCR Purification Kit; Thermo Fisher Scientific, Pittsburgh, PA, USA) was then digested with the restriction enzymes BamH I and Xho I (New England Biolabs, Beverly, MA, USA) and cloned into glutathione-S-transferase (GST) gene fusion plasmid vector pGEX-4T-1 (Addgene, Amersham Biosciences, Buckinghamshire, UK); the resulting plasmid was named pNdCTR1. .. E. coli strain BL21 (DE3)/pNdCTR1 was obtained by chemical transformation (TransformAid™; Thermo Scientific) of bacteria.

    Article Title: Origins of the arctic fox variant rabies viruses responsible for recent cases of the disease in southern Ontario
    Article Snippet: .. Agarose gel electrophoresis was used to verify production of amplicons which were then purified using a Genejet PCR purification system (ThermoFisher) prior to sequencing. .. Sequencing and phylogenetic analysis Whole genome sequencing (WGS) of all RABV samples was achieved using Illumina technology as previously described [ ].

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The Wizard® SV Gel and PCR Clean-Up System (Promega; Pr), the GeneJET PCR Purification Kit (Thermo Fisher Scientific; Th), the PureLink® PCR Purification Kit (Invitrogen; In) and the Chromatin IP DNA Purification Kit (Active Motif; Am) performed poorly with de-crosslinked chromatin. .. Consistently, these reagents recovered less than 50% of input DNA with purified DNA even when expected DNA amounts were relatively high (10–50 ng).

    Polymerase Chain Reaction:

    Article Title: Detection of Invertebrate Suppressive Soils, and Identification of a Possible Biological Control Agent for Meloidogyne Nematodes Using High Resolution Rhizosphere Microbial Community Analysis
    Article Snippet: .. For amplifying fungal ITS sequences, ITS3_KYO2F and ITS4R primers ( ) were used with appended Illumina sequences: ITS3_KYO2_miseqF TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG GATGAAGAACGYAGYRAA ITS4_miseqR GTCTCGTGGGCTCGGAGATGTGTATAAGA GACAG TCCTCCGCTTATTGATATGC PCR products were purified using a GeneJET PCR Purification Kit (ThermoScientific, Lithuania) and purified product was quantified using a NanoDrop 2000C spectrophotometer (Wilmington, DE, USA). ..

    Article Title: Parallel shRNA and CRISPR-Cas9 screens enable antiviral drug target identification
    Article Snippet: .. The PCR-amplified CMPK1-encoding construct was double digested with NdeI and BamHI-HF (New England BioLabs) in CutSmart buffer for 4h at 37 °C and PCR-purified (Thermo GeneJet PCR Purification Kit). .. Similarly, vector pET28 was double digested with NdeI and BamHI-HF for 3 h at 37 °C and gel-purified.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: The gastropod shell has been co-opted to kill parasitic nematodes
    Article Snippet: .. PCR products were then purified using GeneJET PCR purification kit (Thermo Fisher Scientific). .. The PCR product was sequenced in forward and reverse directions using the same primers previously described and the sequence was compared with GenBank sequences using BLASTN searches.

    Article Title: Characterization of Hymenopteran Parasitoids of Aphis fabae in An African Smallholder Bean Farming System Through Sequencing of COI ‘Mini-barcodes’
    Article Snippet: .. PCR products were purified using a GeneJET PCR Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions and sequenced by GATC Biotech (Eurofins Scientific, Luxembourg City, Luxembourg) using the forward primer (5 µM) for each gene. .. This produced ‘mini-barcodes’ of approximately 298 bp when amplified with LepF1/C_ANTMRID primers and 278 bp when amplified with MLepF1/LepR1 primers, which were then trimmed for analysis.

    Article Title: New silver nanoparticles induce apoptosis-like process in E. coli and interfere with mammalian copper metabolism
    Article Snippet: .. The purified fragment (GeneJET PCR Purification Kit; Thermo Fisher Scientific, Pittsburgh, PA, USA) was then digested with the restriction enzymes BamH I and Xho I (New England Biolabs, Beverly, MA, USA) and cloned into glutathione-S-transferase (GST) gene fusion plasmid vector pGEX-4T-1 (Addgene, Amersham Biosciences, Buckinghamshire, UK); the resulting plasmid was named pNdCTR1. .. E. coli strain BL21 (DE3)/pNdCTR1 was obtained by chemical transformation (TransformAid™; Thermo Scientific) of bacteria.

    Article Title: Origins of the arctic fox variant rabies viruses responsible for recent cases of the disease in southern Ontario
    Article Snippet: .. Agarose gel electrophoresis was used to verify production of amplicons which were then purified using a Genejet PCR purification system (ThermoFisher) prior to sequencing. .. Sequencing and phylogenetic analysis Whole genome sequencing (WGS) of all RABV samples was achieved using Illumina technology as previously described [ ].

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The Wizard® SV Gel and PCR Clean-Up System (Promega; Pr), the GeneJET PCR Purification Kit (Thermo Fisher Scientific; Th), the PureLink® PCR Purification Kit (Invitrogen; In) and the Chromatin IP DNA Purification Kit (Active Motif; Am) performed poorly with de-crosslinked chromatin. .. Consistently, these reagents recovered less than 50% of input DNA with purified DNA even when expected DNA amounts were relatively high (10–50 ng).

    Construct:

    Article Title: Parallel shRNA and CRISPR-Cas9 screens enable antiviral drug target identification
    Article Snippet: .. The PCR-amplified CMPK1-encoding construct was double digested with NdeI and BamHI-HF (New England BioLabs) in CutSmart buffer for 4h at 37 °C and PCR-purified (Thermo GeneJet PCR Purification Kit). .. Similarly, vector pET28 was double digested with NdeI and BamHI-HF for 3 h at 37 °C and gel-purified.

    DNA Purification:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The Wizard® SV Gel and PCR Clean-Up System (Promega; Pr), the GeneJET PCR Purification Kit (Thermo Fisher Scientific; Th), the PureLink® PCR Purification Kit (Invitrogen; In) and the Chromatin IP DNA Purification Kit (Active Motif; Am) performed poorly with de-crosslinked chromatin. .. Consistently, these reagents recovered less than 50% of input DNA with purified DNA even when expected DNA amounts were relatively high (10–50 ng).

    Sequencing:

    Article Title: Origins of the arctic fox variant rabies viruses responsible for recent cases of the disease in southern Ontario
    Article Snippet: .. Agarose gel electrophoresis was used to verify production of amplicons which were then purified using a Genejet PCR purification system (ThermoFisher) prior to sequencing. .. Sequencing and phylogenetic analysis Whole genome sequencing (WGS) of all RABV samples was achieved using Illumina technology as previously described [ ].

    Chromatin Immunoprecipitation:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The Wizard® SV Gel and PCR Clean-Up System (Promega; Pr), the GeneJET PCR Purification Kit (Thermo Fisher Scientific; Th), the PureLink® PCR Purification Kit (Invitrogen; In) and the Chromatin IP DNA Purification Kit (Active Motif; Am) performed poorly with de-crosslinked chromatin. .. Consistently, these reagents recovered less than 50% of input DNA with purified DNA even when expected DNA amounts were relatively high (10–50 ng).

    Plasmid Preparation:

    Article Title: New silver nanoparticles induce apoptosis-like process in E. coli and interfere with mammalian copper metabolism
    Article Snippet: .. The purified fragment (GeneJET PCR Purification Kit; Thermo Fisher Scientific, Pittsburgh, PA, USA) was then digested with the restriction enzymes BamH I and Xho I (New England Biolabs, Beverly, MA, USA) and cloned into glutathione-S-transferase (GST) gene fusion plasmid vector pGEX-4T-1 (Addgene, Amersham Biosciences, Buckinghamshire, UK); the resulting plasmid was named pNdCTR1. .. E. coli strain BL21 (DE3)/pNdCTR1 was obtained by chemical transformation (TransformAid™; Thermo Scientific) of bacteria.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher genejet pcr purification kit
    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and <t>PCR</t> Clean-Up System (Promega); Th, <t>GeneJET</t> PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Genejet Pcr Purification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 743 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genejet pcr purification kit/product/Thermo Fisher
    Average 99 stars, based on 743 article reviews
    Price from $9.99 to $1999.99
    genejet pcr purification kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Journal: BMC Genomics

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    doi: 10.1186/s12864-017-4371-5

    Figure Lengend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Article Snippet: Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ).

    Techniques: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction