gene exp gapdh hs02786624 g1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher gene exp gapdh hs02786624 g1
    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and <t>GAPDH.</t> (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P
    Gene Exp Gapdh Hs02786624 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02786624 g1/product/Thermo Fisher
    Average 99 stars, based on 123 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02786624 g1 - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling"

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    Journal: Clinical and Molecular Hepatology

    doi: 10.3350/cmh.2017.0074

    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P
    Figure Legend Snippet: Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P

    Techniques Used: Isolation, Infection, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P
    Figure Legend Snippet: STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P

    Techniques Used: Infection, Isolation, Real-time Polymerase Chain Reaction, Expressing

    Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.
    Figure Legend Snippet: Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.

    Techniques Used: Expressing, Isolation, Infection, Real-time Polymerase Chain Reaction

    2) Product Images from "Angiopoietin Level Trajectories in Toddlers with Severe Sepsis and Septic Shock and Their Effect on Capillary Endothelium"

    Article Title: Angiopoietin Level Trajectories in Toddlers with Severe Sepsis and Septic Shock and Their Effect on Capillary Endothelium

    Journal: Shock (Augusta, Ga.)

    doi: 10.1097/SHK.0000000000001172

    Expression and secretion of angpt-2 in cultured cells Cultured endothelial cell angiopoietin-2 expression. (A) ANGPT2 expression relative to the house-keeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) comparing human dermal microvascular endothelial cells (HDMEC), human pulmonary microvascular endothelial cells (HPMEC) and human umbilical venous endothelial cells (HUVEC). (B) Angiopoietin-2 secretion across the three compared cell lines. (C) Angiopoietin-2 secretion in HDMEC after siRNA knock-down.
    Figure Legend Snippet: Expression and secretion of angpt-2 in cultured cells Cultured endothelial cell angiopoietin-2 expression. (A) ANGPT2 expression relative to the house-keeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) comparing human dermal microvascular endothelial cells (HDMEC), human pulmonary microvascular endothelial cells (HPMEC) and human umbilical venous endothelial cells (HUVEC). (B) Angiopoietin-2 secretion across the three compared cell lines. (C) Angiopoietin-2 secretion in HDMEC after siRNA knock-down.

    Techniques Used: Expressing, Cell Culture

    3) Product Images from "Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i"

    Article Title: Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.1102689

    siRNA-induced inhibition of CD23 mRNA expression Human tonsillar B cells were transfected with either control siRNA (■) or CD23 siRNA (□) and cultured for up to 5 days with IL-4 (200IU/ml) and anti-CD40 (1μg/ml). Cells were harvested at the times indicated and qPCR was performed to quantify mRNA expression levels for (A) CD23 and (B) GAPDH. Expression levels were calculated by ΔΔCt analysis, normalized against the endogenous reference gene β 2 -microglobulin and expressed relative to control siRNA-transfected cells at each timepoint (n=11).
    Figure Legend Snippet: siRNA-induced inhibition of CD23 mRNA expression Human tonsillar B cells were transfected with either control siRNA (■) or CD23 siRNA (□) and cultured for up to 5 days with IL-4 (200IU/ml) and anti-CD40 (1μg/ml). Cells were harvested at the times indicated and qPCR was performed to quantify mRNA expression levels for (A) CD23 and (B) GAPDH. Expression levels were calculated by ΔΔCt analysis, normalized against the endogenous reference gene β 2 -microglobulin and expressed relative to control siRNA-transfected cells at each timepoint (n=11).

    Techniques Used: Inhibition, Expressing, Transfection, Cell Culture, Real-time Polymerase Chain Reaction

    4) Product Images from "SPOP Deregulation Improves the Radiation Response of Prostate Cancer Models by Impairing DNA Damage Repair"

    Article Title: SPOP Deregulation Improves the Radiation Response of Prostate Cancer Models by Impairing DNA Damage Repair

    Journal: Cancers

    doi: 10.3390/cancers12061462

    SPOP knockdown, through siRNA-SPOP (siSPOP) or miR-145 transfection, enhances cell response to radiation. ( A ) qRT-PCR detection of SPOP transcript levels in DU145 (upper panel) or PC-3 (lower panel) at 48 h upon transfection with siSPOP, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of SPOP protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as endogenous control. ( C ) Cell proliferation curves of siNeg and siSPOP at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values ( n = 3). ( D ) Clonogenic cell survival of DU145 and PC-3 cells upon transfection with siNeg or siSPOP. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as the dose (Gy) for the radiation plus siSPOP divided by the dose (Gy) for radiation plus siNeg at a surviving fraction of 0.1. ( E ) qRT-PCR detection of SPOP transcript levels in DU145 cells at 48 h upon transfection with miR-145, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to Neg cells. ( F ) Western blot analysis and relative quantification of SPOP protein levels in DU145 cells at 48 h upon miR-145 transfection. Vinculin was used as control. ( G ) Cell proliferation curves of Neg and miR-145 at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values from three independent experiments. ( H ) Clonogenic cell survival of Neg or miR-145-transfected DU145 cells. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as described above. The level of significance was represented as * p
    Figure Legend Snippet: SPOP knockdown, through siRNA-SPOP (siSPOP) or miR-145 transfection, enhances cell response to radiation. ( A ) qRT-PCR detection of SPOP transcript levels in DU145 (upper panel) or PC-3 (lower panel) at 48 h upon transfection with siSPOP, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of SPOP protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as endogenous control. ( C ) Cell proliferation curves of siNeg and siSPOP at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values ( n = 3). ( D ) Clonogenic cell survival of DU145 and PC-3 cells upon transfection with siNeg or siSPOP. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as the dose (Gy) for the radiation plus siSPOP divided by the dose (Gy) for radiation plus siNeg at a surviving fraction of 0.1. ( E ) qRT-PCR detection of SPOP transcript levels in DU145 cells at 48 h upon transfection with miR-145, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to Neg cells. ( F ) Western blot analysis and relative quantification of SPOP protein levels in DU145 cells at 48 h upon miR-145 transfection. Vinculin was used as control. ( G ) Cell proliferation curves of Neg and miR-145 at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values from three independent experiments. ( H ) Clonogenic cell survival of Neg or miR-145-transfected DU145 cells. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as described above. The level of significance was represented as * p

    Techniques Used: Transfection, Quantitative RT-PCR, Western Blot

    SPOP knockdown impairs HR via RAD51 and CHK1 downregulation. ( A ) qRT-PCR detection of RAD51 and CHEK1 transcript levels in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon siSPOP transfection, compared to controls, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of RAD51 and CHK1 protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as equal protein loading control. ( C ) Representative immunofluorescence microphotographs of nuclear RAD51 foci (cell nuclei: blue; RAD51 foci: green) in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon transfection with siSPOP at 0, 0.5 and 6 h after exposure to 6 Gy irradiation and relative quantification, expressed as mean percentage of cells containing > 10 RAD51 foci at 0, 0.5 and 6 h after exposure to 6 Gy irradiation. Data are reported as mean ± SD values from three independent experiments. The level of significance was represented as ** p
    Figure Legend Snippet: SPOP knockdown impairs HR via RAD51 and CHK1 downregulation. ( A ) qRT-PCR detection of RAD51 and CHEK1 transcript levels in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon siSPOP transfection, compared to controls, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of RAD51 and CHK1 protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as equal protein loading control. ( C ) Representative immunofluorescence microphotographs of nuclear RAD51 foci (cell nuclei: blue; RAD51 foci: green) in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon transfection with siSPOP at 0, 0.5 and 6 h after exposure to 6 Gy irradiation and relative quantification, expressed as mean percentage of cells containing > 10 RAD51 foci at 0, 0.5 and 6 h after exposure to 6 Gy irradiation. Data are reported as mean ± SD values from three independent experiments. The level of significance was represented as ** p

    Techniques Used: Quantitative RT-PCR, Transfection, Western Blot, Immunofluorescence, Irradiation

    5) Product Images from "Anti-metastatic and anti-proliferative activity of eugenol against triple negative and HER2 positive breast cancer cells"

    Article Title: Anti-metastatic and anti-proliferative activity of eugenol against triple negative and HER2 positive breast cancer cells

    Journal: BMC Complementary and Alternative Medicine

    doi: 10.1186/s12906-018-2392-5

    Effect of eugenol treatment on the expression levels of caspases in MDA-MB-231 and SK-BR-3 cell lines. MDA-MB-231 and SK-BR-3 cells were treated for 48 h with eugenol (4 and 8 μM, and 5 and 10 μM, respectively). The mRNA levels of caspase-3 ( a ), caspase-7 ( c ), and caspase-9 ( e ) genes were quantified by RT-PCR and normalized to GAPDH . Protein expression levels of total and cleaved caspase-3 ( b ), cleaved caspase-7 ( d ) and total and cleaved caspase-9 ( f ) were determined by western blotting. Data are presented as mean ± SD ( n = 3). * and # indicate a significant change from untreated, 4, and 5 μM eugenol respectively, at p
    Figure Legend Snippet: Effect of eugenol treatment on the expression levels of caspases in MDA-MB-231 and SK-BR-3 cell lines. MDA-MB-231 and SK-BR-3 cells were treated for 48 h with eugenol (4 and 8 μM, and 5 and 10 μM, respectively). The mRNA levels of caspase-3 ( a ), caspase-7 ( c ), and caspase-9 ( e ) genes were quantified by RT-PCR and normalized to GAPDH . Protein expression levels of total and cleaved caspase-3 ( b ), cleaved caspase-7 ( d ) and total and cleaved caspase-9 ( f ) were determined by western blotting. Data are presented as mean ± SD ( n = 3). * and # indicate a significant change from untreated, 4, and 5 μM eugenol respectively, at p

    Techniques Used: Expressing, Multiple Displacement Amplification, Reverse Transcription Polymerase Chain Reaction, Western Blot

    6) Product Images from "Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling"

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    Journal: Clinical and Molecular Hepatology

    doi: 10.3350/cmh.2017.0074

    STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P
    Figure Legend Snippet: STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P

    Techniques Used: Infection, Isolation, Real-time Polymerase Chain Reaction, Expressing

    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P
    Figure Legend Snippet: Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P

    Techniques Used: Isolation, Infection, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.
    Figure Legend Snippet: Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.

    Techniques Used: Expressing, Isolation, Infection, Real-time Polymerase Chain Reaction

    7) Product Images from "Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution"

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution

    Journal: Arteriosclerosis, thrombosis, and vascular biology

    doi: 10.1161/ATVBAHA.118.310908

    Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p
    Figure Legend Snippet: Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p

    Techniques Used: Expressing, Immunostaining, Staining, Negative Control, Fluorescence, Quantitative RT-PCR

    LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p
    Figure Legend Snippet: LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Generated, Positive Control, Transfection, Plasmid Preparation, Quantitative RT-PCR, Sensitive Assay

    8) Product Images from "Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract"

    Article Title: Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20632-6

    Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p
    Figure Legend Snippet: Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p

    Techniques Used: Cell Culture, Concentration Assay, Expressing

    Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p
    Figure Legend Snippet: Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p

    Techniques Used: Activity Assay, Incubation, Transfection

    LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).
    Figure Legend Snippet: LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction

    Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p
    Figure Legend Snippet: Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p

    Techniques Used: Incubation, Concentration Assay, Expressing

    9) Product Images from "RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity"

    Article Title: RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-26651-7

    Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p
    Figure Legend Snippet: Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p

    Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Expressing

    10) Product Images from "Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution"

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution

    Journal: Arteriosclerosis, thrombosis, and vascular biology

    doi: 10.1161/ATVBAHA.118.310908

    Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p
    Figure Legend Snippet: Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p

    Techniques Used: Expressing, Immunostaining, Staining, Negative Control, Fluorescence, Quantitative RT-PCR

    LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p
    Figure Legend Snippet: LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Generated, Positive Control, Transfection, Plasmid Preparation, Quantitative RT-PCR, Sensitive Assay

    11) Product Images from "Gremlin Regulates Tubular Epithelial to Mesenchymal Transition via VEGFR2: Potential Role in Renal Fibrosis"

    Article Title: Gremlin Regulates Tubular Epithelial to Mesenchymal Transition via VEGFR2: Potential Role in Renal Fibrosis

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.01195

    Gremlin via Notch pathway induces EMT in cultured human tubular epithelial cells. Cells (HK2 cell line) were preincubated with DAPT (30 nM) before stimulation with Gremlin (10 ng/ml). Changes in EMT-related markers were assessed by confocal microscopy (A) or western blot (B) . Please, note that the pictures of e-cadherin, α-sma and their corresponding loading control (GAPDH) are the same images as shown in the Figure 2B but, in this case, Gremlin + DAPT point is included in the fourth lane . Results are expressed as mean ± SEM of five independent experiments. All changes induced by Gremlin were prevented by Notch inhibition. Figure (A) shows a representative experiment out of two performed by confocal microscopy and (B) shows representative images of western blot and quantification. (C) Gene expression levels were evaluated 24 h after Gremlin stimulation. Total cell RNA was isolated to assess mRNA levels by RT-qPCR. Data are expressed as mean ± SEM of six independent experiments. ∗ p
    Figure Legend Snippet: Gremlin via Notch pathway induces EMT in cultured human tubular epithelial cells. Cells (HK2 cell line) were preincubated with DAPT (30 nM) before stimulation with Gremlin (10 ng/ml). Changes in EMT-related markers were assessed by confocal microscopy (A) or western blot (B) . Please, note that the pictures of e-cadherin, α-sma and their corresponding loading control (GAPDH) are the same images as shown in the Figure 2B but, in this case, Gremlin + DAPT point is included in the fourth lane . Results are expressed as mean ± SEM of five independent experiments. All changes induced by Gremlin were prevented by Notch inhibition. Figure (A) shows a representative experiment out of two performed by confocal microscopy and (B) shows representative images of western blot and quantification. (C) Gene expression levels were evaluated 24 h after Gremlin stimulation. Total cell RNA was isolated to assess mRNA levels by RT-qPCR. Data are expressed as mean ± SEM of six independent experiments. ∗ p

    Techniques Used: Cell Culture, Confocal Microscopy, Western Blot, Inhibition, Expressing, Isolation, Quantitative RT-PCR

    12) Product Images from "Characterization of TRKA signaling in acute myeloid leukemia"

    Article Title: Characterization of TRKA signaling in acute myeloid leukemia

    Journal: Oncotarget

    doi: 10.18632/oncotarget.25723

    TRKA is not essential for the growth or survival of AML cell lines in vitro CMK, K562, and TF-1 cells were stably transfected with shRNA against TRKA or a scrambled control (ctrl) and monitored for changes in growth and viability. (A) qRT-PCR analysis of the NTRK1 mRNA levels in the transduced cell lines 7 days after transduction. Values were normalized to GAPDH and results are displayed as the mean mRNA (+s.d.) relative to the cells transfected with the control vector. There is a consistent knockdown of approximately 70% at the mRNA level across the 3 lines. (B) Western blot of total TRKA protein 7 days after transduction with either a nontargeting or TRKA shRNA. (C) 48 hours after transduction, cells were plated at a density of 5×10 4 cells/mL and cultured for 5 days. Cell growth and viability were stained with Trypan Blue and assessed using the ViCell. (D) Apoptosis was tracked in both control and knockdown cells using Annexin V staining via flow cytometry.
    Figure Legend Snippet: TRKA is not essential for the growth or survival of AML cell lines in vitro CMK, K562, and TF-1 cells were stably transfected with shRNA against TRKA or a scrambled control (ctrl) and monitored for changes in growth and viability. (A) qRT-PCR analysis of the NTRK1 mRNA levels in the transduced cell lines 7 days after transduction. Values were normalized to GAPDH and results are displayed as the mean mRNA (+s.d.) relative to the cells transfected with the control vector. There is a consistent knockdown of approximately 70% at the mRNA level across the 3 lines. (B) Western blot of total TRKA protein 7 days after transduction with either a nontargeting or TRKA shRNA. (C) 48 hours after transduction, cells were plated at a density of 5×10 4 cells/mL and cultured for 5 days. Cell growth and viability were stained with Trypan Blue and assessed using the ViCell. (D) Apoptosis was tracked in both control and knockdown cells using Annexin V staining via flow cytometry.

    Techniques Used: In Vitro, Stable Transfection, Transfection, shRNA, Quantitative RT-PCR, Transduction, Plasmid Preparation, Western Blot, Cell Culture, Staining, Flow Cytometry, Cytometry

    Normal and leukemic human myeloid cells express NTRK1 mRNA (A) NTRK1 mRNA expression in the context of the myeloid compartment extracted from the Novershtern et al gene expression dataset [ 24 ]. Each block represents the average of approximately 6 cell cultures. Cell populations are described in the original manuscript. (B) Expression levels of NTRK1 mRNA from normal CD34+ bone marrow cells (gray) and blasts from AML patient samples (red) profiled by the Microarray Initiative in Leukemia Expression (MILE) study. (C) Expression of NTRK1 from the MILE database further stratified by AML subtype. The highest levels of expression are observed in in t(8;21) and inv(16)/t(16;16) translocated tumors. (D) NTRK1 mRNA collected as part of Bourquin et al microarray gene expression study where M4/M5 leukemia was used as a reference for AMKL in both normal and Down syndrome individuals. (E) Quantitative RT-PCR (qRT-PCR) analysis of NTRK1 mRNA expression of a panel of 12 AML cell lines representing a variety of AML subsets. Results are represented as a relative fold-change after normalizing with GAPDH mRNA. Each value corresponds to the mean ± SEM of three independent experiments. TRKA mRNA is detectable in 92% (11/12) of cell lines with a range of expression approximately 15-fold. HSC= hematopoietic stem cell, CMP= common myeloid progenitor, MEP= megakaryocytic erythroid progenitor, GMP= granulocytic myeloid progenitor. AMKL=acute megakaryoblastic leukemia, DS= Down syndrome.
    Figure Legend Snippet: Normal and leukemic human myeloid cells express NTRK1 mRNA (A) NTRK1 mRNA expression in the context of the myeloid compartment extracted from the Novershtern et al gene expression dataset [ 24 ]. Each block represents the average of approximately 6 cell cultures. Cell populations are described in the original manuscript. (B) Expression levels of NTRK1 mRNA from normal CD34+ bone marrow cells (gray) and blasts from AML patient samples (red) profiled by the Microarray Initiative in Leukemia Expression (MILE) study. (C) Expression of NTRK1 from the MILE database further stratified by AML subtype. The highest levels of expression are observed in in t(8;21) and inv(16)/t(16;16) translocated tumors. (D) NTRK1 mRNA collected as part of Bourquin et al microarray gene expression study where M4/M5 leukemia was used as a reference for AMKL in both normal and Down syndrome individuals. (E) Quantitative RT-PCR (qRT-PCR) analysis of NTRK1 mRNA expression of a panel of 12 AML cell lines representing a variety of AML subsets. Results are represented as a relative fold-change after normalizing with GAPDH mRNA. Each value corresponds to the mean ± SEM of three independent experiments. TRKA mRNA is detectable in 92% (11/12) of cell lines with a range of expression approximately 15-fold. HSC= hematopoietic stem cell, CMP= common myeloid progenitor, MEP= megakaryocytic erythroid progenitor, GMP= granulocytic myeloid progenitor. AMKL=acute megakaryoblastic leukemia, DS= Down syndrome.

    Techniques Used: Expressing, Blocking Assay, Microarray, Quantitative RT-PCR

    13) Product Images from "RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity"

    Article Title: RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-26651-7

    Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p
    Figure Legend Snippet: Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p

    Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Expressing

    14) Product Images from "Impaired Gastric Hormone Regulation of Osteoblasts and Lysyl Oxidase Drives Bone Disease in Diabetes Mellitus"

    Article Title: Impaired Gastric Hormone Regulation of Osteoblasts and Lysyl Oxidase Drives Bone Disease in Diabetes Mellitus

    Journal: JBMR Plus

    doi: 10.1002/jbm4.10212

    LOX paralogs regulation by GIP ( A ) MC3T3‐E1 cells were treated for 24 hours with a range of GIP concentrations followed by RNA isolation and qPCR. Data were calculated using the 2 –(ΔΔCT) method and are provided as fold change relative to GAPDH. Data are means ± SD, * p
    Figure Legend Snippet: LOX paralogs regulation by GIP ( A ) MC3T3‐E1 cells were treated for 24 hours with a range of GIP concentrations followed by RNA isolation and qPCR. Data were calculated using the 2 –(ΔΔCT) method and are provided as fold change relative to GAPDH. Data are means ± SD, * p

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction

    Diabetic primary bone cells. ( A ) LOX is the highest expressed paralog in nondiabetic primary osteoblasts. Absolute quantification of LOX isoforms in nondiabetic primary osteoblasts. Data were calculated based on a standard curve of known transcript copy numbers and normalized to the amount of cDNA added ( n = 5). ( B ) LOX is the most highly inhibited paralog in primary diabetic osteoblasts. Data represent percent of nondiabetic controls calculated using the ΔΔCT method using GAPDH internal control. Data are pooled from three independent experiments (data are means ± SE, * p
    Figure Legend Snippet: Diabetic primary bone cells. ( A ) LOX is the highest expressed paralog in nondiabetic primary osteoblasts. Absolute quantification of LOX isoforms in nondiabetic primary osteoblasts. Data were calculated based on a standard curve of known transcript copy numbers and normalized to the amount of cDNA added ( n = 5). ( B ) LOX is the most highly inhibited paralog in primary diabetic osteoblasts. Data represent percent of nondiabetic controls calculated using the ΔΔCT method using GAPDH internal control. Data are pooled from three independent experiments (data are means ± SE, * p

    Techniques Used:

    ( A ) LOX mRNA regulation by GIP depends on PKA. MC3T3 cells were treated with GIP for 4 hours in the presence and absence of PKA pathway activators and inhibitors, and RNA was analyzed for LOX levels. LOX RNA levels were increased by GIP, which was prevented when cells were treated with the adenylyl cyclase inhibitor SQ22536 or the PKA inhibitor PKI 14‐22. Data were calculated using the 2 –(ΔΔCT) method and are represented as fold change relative to GAPDH. Data are means ± SE, *** p
    Figure Legend Snippet: ( A ) LOX mRNA regulation by GIP depends on PKA. MC3T3 cells were treated with GIP for 4 hours in the presence and absence of PKA pathway activators and inhibitors, and RNA was analyzed for LOX levels. LOX RNA levels were increased by GIP, which was prevented when cells were treated with the adenylyl cyclase inhibitor SQ22536 or the PKA inhibitor PKI 14‐22. Data were calculated using the 2 –(ΔΔCT) method and are represented as fold change relative to GAPDH. Data are means ± SE, *** p

    Techniques Used:

    15) Product Images from "Mannosylerythritol lipids ameliorate ultraviolet A-induced aquaporin-3 downregulation by suppressing c-Jun N-terminal kinase phosphorylation in cultured human keratinocytes"

    Article Title: Mannosylerythritol lipids ameliorate ultraviolet A-induced aquaporin-3 downregulation by suppressing c-Jun N-terminal kinase phosphorylation in cultured human keratinocytes

    Journal: The Korean Journal of Physiology & Pharmacology : Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology

    doi: 10.4196/kjpp.2019.23.2.113

    Involvement of JNK phosphorylation in the UVA-induced downregulation of AQP3. (A) Cells were irradiated with UVA 3 J/cm 2 and harvested at the indicated time points. Protein samples were subjected to Western blotting for phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH. (B) Cells pretreated with 100 nM SP600125 (a JNK inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. (C) The mRNA expression of AQP3 was examined by qRT-PCR. (D) Cells pretreated with 10 µM PD98059 (an ERK inhibitor) or 5 µM SB203580 (a p38 inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. Values represent the mean expression level ± SD (n = 3, * p
    Figure Legend Snippet: Involvement of JNK phosphorylation in the UVA-induced downregulation of AQP3. (A) Cells were irradiated with UVA 3 J/cm 2 and harvested at the indicated time points. Protein samples were subjected to Western blotting for phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH. (B) Cells pretreated with 100 nM SP600125 (a JNK inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. (C) The mRNA expression of AQP3 was examined by qRT-PCR. (D) Cells pretreated with 10 µM PD98059 (an ERK inhibitor) or 5 µM SB203580 (a p38 inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. Values represent the mean expression level ± SD (n = 3, * p

    Techniques Used: Irradiation, Western Blot, Software, Expressing, Quantitative RT-PCR

    MELs ameliorate the UVA-induced downregulation of AQP3 expression in HaCaT keratinocytes. (A) A structure of MELs. Two fatty acids were attached to −OH groups on mannosylerythritol as an ester bond. The fatty acid contains mainly 6–18 carbon atoms and the major is 8 carbon atoms. (B) HaCaT keratinocytes were treated with the indicated concentrations of MELs for 24 h and cell viability was determined using a CCK-8 kit (Dojindo, Kumamoto, Japan). DMSO was used as the vehicle control. (C) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs for 24 h were subjected to Western blot analysis of AQP3 proteins. (D) The protein levels of AQP3 were quantified relative to that of GAPDH using the Image J software. (E) The mRNA expression of AQP3 was analyzed by qRT-PCR. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p
    Figure Legend Snippet: MELs ameliorate the UVA-induced downregulation of AQP3 expression in HaCaT keratinocytes. (A) A structure of MELs. Two fatty acids were attached to −OH groups on mannosylerythritol as an ester bond. The fatty acid contains mainly 6–18 carbon atoms and the major is 8 carbon atoms. (B) HaCaT keratinocytes were treated with the indicated concentrations of MELs for 24 h and cell viability was determined using a CCK-8 kit (Dojindo, Kumamoto, Japan). DMSO was used as the vehicle control. (C) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs for 24 h were subjected to Western blot analysis of AQP3 proteins. (D) The protein levels of AQP3 were quantified relative to that of GAPDH using the Image J software. (E) The mRNA expression of AQP3 was analyzed by qRT-PCR. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p

    Techniques Used: Expressing, CCK-8 Assay, Western Blot, Software, Quantitative RT-PCR

    AQP3 expression is downregulated by UVA irradiation. (A) HaCaT keratinocytes were irradiated with the indicated doses of UVA or left non-irradiated (control) and harvested after 24 h for Western blot analysis. (B) The protein level of AQP3 was quantified relative to that of GAPDH using the Image J software from National Institutes of Health. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p
    Figure Legend Snippet: AQP3 expression is downregulated by UVA irradiation. (A) HaCaT keratinocytes were irradiated with the indicated doses of UVA or left non-irradiated (control) and harvested after 24 h for Western blot analysis. (B) The protein level of AQP3 was quantified relative to that of GAPDH using the Image J software from National Institutes of Health. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p

    Techniques Used: Expressing, Irradiation, Western Blot, Software

    The effects of MELs on JNK phosphorylation and PPAR-γ expression in UVA-irradiated HaCaT keratinocytes. (A) Cells pretreated with the indicated concentrations of MELs for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 15 min. The protein levels of phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH were evaluated by Western blot analysis. (B) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs or a JNK inhibitor for 16 h were prepared for qRT-PCR analysis of PPAR-γ mRNA expression. Values represent the mean expression level obtained from three independent experiments ± SD ( * p
    Figure Legend Snippet: The effects of MELs on JNK phosphorylation and PPAR-γ expression in UVA-irradiated HaCaT keratinocytes. (A) Cells pretreated with the indicated concentrations of MELs for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 15 min. The protein levels of phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH were evaluated by Western blot analysis. (B) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs or a JNK inhibitor for 16 h were prepared for qRT-PCR analysis of PPAR-γ mRNA expression. Values represent the mean expression level obtained from three independent experiments ± SD ( * p

    Techniques Used: Expressing, Irradiation, Western Blot, Quantitative RT-PCR

    16) Product Images from "Lipid nanoparticle siRNA cocktails for the treatment of mantle cell lymphoma"

    Article Title: Lipid nanoparticle siRNA cocktails for the treatment of mantle cell lymphoma

    Journal: Bioengineering & Translational Medicine

    doi: 10.1002/btm2.10088

    LNPs mediated durable gene silencing in JeKo‐1 cells. (a) Three lipidoid chemistries—303O 13 , 304O 13 , and 306O 13 —were formulated into siRNA‐loaded LNPs. (b) Treatment with each LNP resulted in dose‐dependent silencing of GAPDH in JeKo‐1 mantle cell lymphoma cells 24 hr post‐transfection. PBS and LNPs (siCntrl) at the maximum dose of 100 nM served as negative controls. (c) Following a single dose of 100 nM siGAPDH, 306O 13 LNPs mediated near‐complete GAPDH knockdown for at least 3 days with maximal silencing achieved by 36 hr (blue circles). In each panel, error bars represent standard deviation ( n = 3). Statistically significant differences compared to cells given PBS were determined using two‐tailed Welch's t tests. *, **, and **** indicate p ≤ .05, 0.01, and .0001, respectively
    Figure Legend Snippet: LNPs mediated durable gene silencing in JeKo‐1 cells. (a) Three lipidoid chemistries—303O 13 , 304O 13 , and 306O 13 —were formulated into siRNA‐loaded LNPs. (b) Treatment with each LNP resulted in dose‐dependent silencing of GAPDH in JeKo‐1 mantle cell lymphoma cells 24 hr post‐transfection. PBS and LNPs (siCntrl) at the maximum dose of 100 nM served as negative controls. (c) Following a single dose of 100 nM siGAPDH, 306O 13 LNPs mediated near‐complete GAPDH knockdown for at least 3 days with maximal silencing achieved by 36 hr (blue circles). In each panel, error bars represent standard deviation ( n = 3). Statistically significant differences compared to cells given PBS were determined using two‐tailed Welch's t tests. *, **, and **** indicate p ≤ .05, 0.01, and .0001, respectively

    Techniques Used: Transfection, Standard Deviation, Two Tailed Test

    17) Product Images from "Distinct Signaling Pathways Between Human Macrophages and Primary Gingival Epithelial Cells by Aggregatibacter actinomycetemcomitans"

    Article Title: Distinct Signaling Pathways Between Human Macrophages and Primary Gingival Epithelial Cells by Aggregatibacter actinomycetemcomitans

    Journal: Pathogens

    doi: 10.3390/pathogens9040248

    Different pathways are activated by A. actinomycetemcomitans in macrophages and HGECs. Western blot was used to evaluate the phosphorylation of ERK1/2, 4EBP-1, cFos and AKT in U937 macrophages ( A ) and in HGECs ( B ) after infection with A. actinomycetemcomitans strain Y4 (MOI 1:100) at different time points. GAPDH was used as the control. The data shown are representative of three independent experiments.
    Figure Legend Snippet: Different pathways are activated by A. actinomycetemcomitans in macrophages and HGECs. Western blot was used to evaluate the phosphorylation of ERK1/2, 4EBP-1, cFos and AKT in U937 macrophages ( A ) and in HGECs ( B ) after infection with A. actinomycetemcomitans strain Y4 (MOI 1:100) at different time points. GAPDH was used as the control. The data shown are representative of three independent experiments.

    Techniques Used: Western Blot, Infection

    Western blot image showing increased levels of phosphorylated IκB (plkB-α), (indicative of NF-κB activation), decreased levels of procaspase-1 and increased levels of cleaved caspase-1 (indicative of inflammasome activation in U937 macrophages) after co-culture of A. actinomycetemcomitans strain Y4 (MOI 1:100) at different time points. GAPDH was used as the control. The data shown are representative of three independent experiments.
    Figure Legend Snippet: Western blot image showing increased levels of phosphorylated IκB (plkB-α), (indicative of NF-κB activation), decreased levels of procaspase-1 and increased levels of cleaved caspase-1 (indicative of inflammasome activation in U937 macrophages) after co-culture of A. actinomycetemcomitans strain Y4 (MOI 1:100) at different time points. GAPDH was used as the control. The data shown are representative of three independent experiments.

    Techniques Used: Western Blot, Activation Assay, Co-Culture Assay

    18) Product Images from "A potent small-molecule inhibitor of the DCN1-UBC12 interaction that selectively blocks cullin 3 neddylation"

    Article Title: A potent small-molecule inhibitor of the DCN1-UBC12 interaction that selectively blocks cullin 3 neddylation

    Journal: Nature Communications

    doi: 10.1038/s41467-017-01243-7

    DI-591 selectively and rapidly inhibits neddylation of cullin 3. a Western blotting of neddylated and un-neddylated cullin family members and several representative well-known substrates of cullin CRLs in KYSE70 esophageal cancer cells and THLE2 immortalized liver cells. Cells were treated with DCN1 inhibitor DI-591 or NAE E1 inhibitor MLN4924 at indicated concentrations, or DI-591DD at 10 µM for 24 h. Protein levels of neddylated and un-neddylated cullin family members and several known substrates of cullin CRLs were examined by western blotting analysis. GAPDH was used as a loading control. b Inhibition kinetics of neddylation of cullin 1 and 3 by DI-591 and MLN4924 in THLE2 liver cells. Cells were treated with DI-591 at 10 µM or MLN4924 at 0.3 µM at indicated time points. Protein levels of neddylated and un-neddylated cullin 1 and 3 were examined by western blotting analysis. GAPDH was used as a loading control. c qRT-PCR analysis of mRNA levels of NRF2 and NRF2-reguated genes in THLE2 cells. Cells were treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for indicated time points. The relative mRNA levels of NRF2, NQO1 and HO-1 were examined by quantitative real-time RT-PCR assay. GAPDH was used as an internal control. The averages and standard deviations for each column were calculated from total nine samples obtained from three independent experiments (each experiment with triplicates). P -value from t-test: * P
    Figure Legend Snippet: DI-591 selectively and rapidly inhibits neddylation of cullin 3. a Western blotting of neddylated and un-neddylated cullin family members and several representative well-known substrates of cullin CRLs in KYSE70 esophageal cancer cells and THLE2 immortalized liver cells. Cells were treated with DCN1 inhibitor DI-591 or NAE E1 inhibitor MLN4924 at indicated concentrations, or DI-591DD at 10 µM for 24 h. Protein levels of neddylated and un-neddylated cullin family members and several known substrates of cullin CRLs were examined by western blotting analysis. GAPDH was used as a loading control. b Inhibition kinetics of neddylation of cullin 1 and 3 by DI-591 and MLN4924 in THLE2 liver cells. Cells were treated with DI-591 at 10 µM or MLN4924 at 0.3 µM at indicated time points. Protein levels of neddylated and un-neddylated cullin 1 and 3 were examined by western blotting analysis. GAPDH was used as a loading control. c qRT-PCR analysis of mRNA levels of NRF2 and NRF2-reguated genes in THLE2 cells. Cells were treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for indicated time points. The relative mRNA levels of NRF2, NQO1 and HO-1 were examined by quantitative real-time RT-PCR assay. GAPDH was used as an internal control. The averages and standard deviations for each column were calculated from total nine samples obtained from three independent experiments (each experiment with triplicates). P -value from t-test: * P

    Techniques Used: Western Blot, Inhibition, Quantitative RT-PCR

    Cellular engagement of DCN proteins by DI-591. a Chemical structure of biotinylated compound 47 and its binding affinities to DCN1-5 proteins. b Pull-down of DCN1 and DCN2 protein by compound 47 and competition by DI-591 in KYSE70 cell lysates. Protein levels of DCN1, DCN2, cullin 1 and cullin 3 pulled down from KYSE70 cell lysates with 47 alone or in combination with DI-591 or DI-591DD were examined by western blotting analysis and specific antibodies. c Enhancement of thermal stability of DCN1 protein by DI-591 but not by DI-591DD in KYSE70 cells. Protein levels of DCN1 in KYSE70 cells treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperatures for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. d Enhancement of thermal stability of DCN1 and DCN2 proteins by DI-591 but not by DI-591DD treatment in KYSE70 cells. Protein levels of DCN1 and DCN2 in KYSE70 cells treated with DI-591 and DI-591DD at the indicated concentrations for 1 h and then heated at 53 °C (DCN1) and 45 °C (DCN2) for 3 min were analyzed by western blot. GAPDH was used as a loading control. e Enhancement of thermal stability of DCN2 by DI-591 but not DI-591DD in KYSE70 cells. Protein levels of DCN2 in KYSE70 cells treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperature for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. f Blockage of the association of DCN1 and UBC12 in cells by DI-591 but not by DI-591DD. KYSE70 cells were treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h. The basal protein levels of DCN1 and UBC12 in the cell lysates were examined by western blotting analysis. Protein levels of DCN1 and UBC12 in the cell lysates pulled down by an UBC12 antibody were examined by western blotting analysis
    Figure Legend Snippet: Cellular engagement of DCN proteins by DI-591. a Chemical structure of biotinylated compound 47 and its binding affinities to DCN1-5 proteins. b Pull-down of DCN1 and DCN2 protein by compound 47 and competition by DI-591 in KYSE70 cell lysates. Protein levels of DCN1, DCN2, cullin 1 and cullin 3 pulled down from KYSE70 cell lysates with 47 alone or in combination with DI-591 or DI-591DD were examined by western blotting analysis and specific antibodies. c Enhancement of thermal stability of DCN1 protein by DI-591 but not by DI-591DD in KYSE70 cells. Protein levels of DCN1 in KYSE70 cells treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperatures for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. d Enhancement of thermal stability of DCN1 and DCN2 proteins by DI-591 but not by DI-591DD treatment in KYSE70 cells. Protein levels of DCN1 and DCN2 in KYSE70 cells treated with DI-591 and DI-591DD at the indicated concentrations for 1 h and then heated at 53 °C (DCN1) and 45 °C (DCN2) for 3 min were analyzed by western blot. GAPDH was used as a loading control. e Enhancement of thermal stability of DCN2 by DI-591 but not DI-591DD in KYSE70 cells. Protein levels of DCN2 in KYSE70 cells treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperature for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. f Blockage of the association of DCN1 and UBC12 in cells by DI-591 but not by DI-591DD. KYSE70 cells were treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h. The basal protein levels of DCN1 and UBC12 in the cell lysates were examined by western blotting analysis. Protein levels of DCN1 and UBC12 in the cell lysates pulled down by an UBC12 antibody were examined by western blotting analysis

    Techniques Used: Binding Assay, Western Blot

    19) Product Images from "NOP53 as A Candidate Modifier Locus for Familial Non-Medullary Thyroid Cancer"

    Article Title: NOP53 as A Candidate Modifier Locus for Familial Non-Medullary Thyroid Cancer

    Journal: Genes

    doi: 10.3390/genes10110899

    Effects of stable overexpression of NOP53 in three cell lines (TPC1, FTC133, BCPAP): ( a ) Validation of stable overexpression of wild type (WT) and D31H mutant NOP53 in three cell lines by qPCR; ( b ) Validation by Western blot. The lower band corresponds to the endogenous protein expression, whereas the upper band represents the exogenous overexpressed protein. The total protein lysates used were 25 µg for TPC1 cell line, and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell proliferation in thyroid cancer cell lines compared to the vector control; ( d ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell clonogenicity in thyroid cancer cell lines compared to the vector control. * indicates adjusted p value
    Figure Legend Snippet: Effects of stable overexpression of NOP53 in three cell lines (TPC1, FTC133, BCPAP): ( a ) Validation of stable overexpression of wild type (WT) and D31H mutant NOP53 in three cell lines by qPCR; ( b ) Validation by Western blot. The lower band corresponds to the endogenous protein expression, whereas the upper band represents the exogenous overexpressed protein. The total protein lysates used were 25 µg for TPC1 cell line, and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell proliferation in thyroid cancer cell lines compared to the vector control; ( d ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell clonogenicity in thyroid cancer cell lines compared to the vector control. * indicates adjusted p value

    Techniques Used: Over Expression, Mutagenesis, Real-time Polymerase Chain Reaction, Western Blot, Expressing, Plasmid Preparation

    Knockdown of wild-type NOP53 reduces cell proliferation and clonogenicity: ( a ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 gene expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using qPCR; ( b ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 protein expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using Western blots. The total protein lysates used were 25 µg for TPC1 cell line; and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell proliferation compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 ; ( d ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell clonogenicity compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 . * indicates adjusted p value
    Figure Legend Snippet: Knockdown of wild-type NOP53 reduces cell proliferation and clonogenicity: ( a ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 gene expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using qPCR; ( b ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 protein expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using Western blots. The total protein lysates used were 25 µg for TPC1 cell line; and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell proliferation compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 ; ( d ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell clonogenicity compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 . * indicates adjusted p value

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Negative Control

    20) Product Images from "Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract"

    Article Title: Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20632-6

    Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p
    Figure Legend Snippet: Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p

    Techniques Used: Cell Culture, Concentration Assay, Expressing

    Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p
    Figure Legend Snippet: Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p

    Techniques Used: Activity Assay, Incubation, Transfection

    LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).
    Figure Legend Snippet: LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction

    Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p
    Figure Legend Snippet: Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p

    Techniques Used: Incubation, Concentration Assay, Expressing

    21) Product Images from "The aryl hydrocarbon receptor and interferon gamma generate antiviral states via transcriptional repression"

    Article Title: The aryl hydrocarbon receptor and interferon gamma generate antiviral states via transcriptional repression

    Journal: eLife

    doi: 10.7554/eLife.38867

    CDK1 mRNA stability is not affected by AhR and IFN-γ. ( A ) Decay of CDK1, TNFα and IL-1β following transcriptional blockage with actinomycin D, monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( B ) Decay rate of CDK1 mRNA following transcriptional blockage with actinomycin D in the presence of AhR agonist, antagonist or IFN-γ. CDK1 mRNA was monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( C ) Mean CDK1 mRNA half-life (t 1/2 )±SEM for three different macrophage donors.
    Figure Legend Snippet: CDK1 mRNA stability is not affected by AhR and IFN-γ. ( A ) Decay of CDK1, TNFα and IL-1β following transcriptional blockage with actinomycin D, monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( B ) Decay rate of CDK1 mRNA following transcriptional blockage with actinomycin D in the presence of AhR agonist, antagonist or IFN-γ. CDK1 mRNA was monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( C ) Mean CDK1 mRNA half-life (t 1/2 )±SEM for three different macrophage donors.

    Techniques Used: Real-time Polymerase Chain Reaction

    22) Product Images from "Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma"

    Article Title: Kaiso is required for MTG16-dependent effects on colitis-associated carcinoma

    Journal: Oncogene

    doi: 10.1038/s41388-019-0777-7

    MTG16:Kaiso double knockout alters immune and metabolism-associated genes. A, Adjacent normal colon samples were analyzed by RNA-sequencing. Table shows numbers of statistically differentially expressed genes of at least 1.5-fold change between each genotype. B, Gene set overlap against Gene Ontology (GO) curated data sets was performed using the Molecular Signature Database v6.1 software available from the Broad Institute. Graph illustrates 25 of the most statistically enriched datasets in the genes downregulated in DKO mice as compared to Mtg16 −/− . Significance is represented as the −Log10 of FDR q-values. Dotted line indicates FDR q-value of 0.05. C, Venn diagram showing the numbers of genes altered in Mtg16 −/− samples as compared to WT and whether these genes are downregulated in the DKO samples as compared to Mtg16 −/− . D, Gene set overlap showing genes in metabolism and cell growth GO datasets are preferentially downregulated in the 266 genes that were upregulated in Mtg16 −/− and downregulated in DKO mice.
    Figure Legend Snippet: MTG16:Kaiso double knockout alters immune and metabolism-associated genes. A, Adjacent normal colon samples were analyzed by RNA-sequencing. Table shows numbers of statistically differentially expressed genes of at least 1.5-fold change between each genotype. B, Gene set overlap against Gene Ontology (GO) curated data sets was performed using the Molecular Signature Database v6.1 software available from the Broad Institute. Graph illustrates 25 of the most statistically enriched datasets in the genes downregulated in DKO mice as compared to Mtg16 −/− . Significance is represented as the −Log10 of FDR q-values. Dotted line indicates FDR q-value of 0.05. C, Venn diagram showing the numbers of genes altered in Mtg16 −/− samples as compared to WT and whether these genes are downregulated in the DKO samples as compared to Mtg16 −/− . D, Gene set overlap showing genes in metabolism and cell growth GO datasets are preferentially downregulated in the 266 genes that were upregulated in Mtg16 −/− and downregulated in DKO mice.

    Techniques Used: Double Knockout, RNA Sequencing Assay, Software, Mouse Assay

    Kaiso loss decreases stemness and WNT tone in WT and Mtg16 −/− enteroids. A, A nontargeted or Kaiso-targeted shRNA was transduced into enteroids established from WT and Mtg16 −/− mice. Spheroid morphology was assessed at one day post passage and normalized to total enteroid number (left). Representative images (right) show spheroid morphology marked by arrowhead. n=4 wells/genotype per 2 independently infected enteroid lines. Scale bar = 200μM. B, Control and knockdown enteroid lines were collected for RNA and analyzed for Kaiso (left), Axin2 (middle), and Pcna (right) expression by qRT-PCR analysis. n= 2 independently infected enteroid lines, samples run in triplicate. * P
    Figure Legend Snippet: Kaiso loss decreases stemness and WNT tone in WT and Mtg16 −/− enteroids. A, A nontargeted or Kaiso-targeted shRNA was transduced into enteroids established from WT and Mtg16 −/− mice. Spheroid morphology was assessed at one day post passage and normalized to total enteroid number (left). Representative images (right) show spheroid morphology marked by arrowhead. n=4 wells/genotype per 2 independently infected enteroid lines. Scale bar = 200μM. B, Control and knockdown enteroid lines were collected for RNA and analyzed for Kaiso (left), Axin2 (middle), and Pcna (right) expression by qRT-PCR analysis. n= 2 independently infected enteroid lines, samples run in triplicate. * P

    Techniques Used: shRNA, Mouse Assay, Infection, Expressing, Quantitative RT-PCR

    23) Product Images from "Reduced migration of MLH1 deficient colon cancer cells depends on SPTAN1"

    Article Title: Reduced migration of MLH1 deficient colon cancer cells depends on SPTAN1

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-13-11

    Influence of MLH1 knock down by siRNA treatment. Direct connection of MLH1 on SPTAN1 was studied in detail by comparison of untreated with transiently MLH1-specific siRNA1 (A) and siRNA2 (B) and control siRNA transfected different MLH1 proficient cell lines. Western blot analysis of MLH1 and SPTAN1 protein levels was performed after 48 h, controlled by beta-Actin detection after. In parallel, mRNA levels of MLH1 and SPTAN1 were determined by TaqMan-analysis with pairs of MLH1-, SPTAN1- or GAPDH-specific primers and MLH1-, SPTAN1- or GAPDH-specific probes, respectively, after treatment with MLH1-specific siRNA1 (C) and siRNA2 (D) . The data show that siRNA knock down of MLH1 led to impaired SPTAN1 expression and partly to reduced mRNA level of SPTAN1. Graphs indicate the results (mean ± S.D.) of at least three independent experiments.
    Figure Legend Snippet: Influence of MLH1 knock down by siRNA treatment. Direct connection of MLH1 on SPTAN1 was studied in detail by comparison of untreated with transiently MLH1-specific siRNA1 (A) and siRNA2 (B) and control siRNA transfected different MLH1 proficient cell lines. Western blot analysis of MLH1 and SPTAN1 protein levels was performed after 48 h, controlled by beta-Actin detection after. In parallel, mRNA levels of MLH1 and SPTAN1 were determined by TaqMan-analysis with pairs of MLH1-, SPTAN1- or GAPDH-specific primers and MLH1-, SPTAN1- or GAPDH-specific probes, respectively, after treatment with MLH1-specific siRNA1 (C) and siRNA2 (D) . The data show that siRNA knock down of MLH1 led to impaired SPTAN1 expression and partly to reduced mRNA level of SPTAN1. Graphs indicate the results (mean ± S.D.) of at least three independent experiments.

    Techniques Used: Transfection, Western Blot, Expressing

    24) Product Images from "Differentiation of Langerhans Cells from Monocytes and Their Specific Function in Inducing IL-22–Specific Th Cells"

    Article Title: Differentiation of Langerhans Cells from Monocytes and Their Specific Function in Inducing IL-22–Specific Th Cells

    Journal: The Journal of Immunology Author Choice

    doi: 10.4049/jimmunol.1701402

    Analysis and comparison of the moDCs, moLCs established by various methods, and primary LC. ( A . PCR products are shown in the figure. GAPDH was used as a control. IL-4 was washed out from culture medium at day 2 (+*). ( B ) moDCs and Dex–TNF-α–induced moLCs were resuspended in 24-well culture plates or test tubes at a concentration of 5 × 10 5 cells/ml. Squalene, MA, or α-GalCer was added, and the cells were incubated for 48 h. Subsequently, the cells were stained with anti-CD86 mAb and analyzed by flow cytometry compared with DMSO, n -hexane, or ethanol control, respectively. Gray histograms indicate the isotype-matched negative control. Results are representative of four independent experiments. ( C ) moDCs and Dex–TNF-α–induced moLCs were stimulated for 48 h with 500 μM squalene, 500 μg/ml MA, or 2.0 μg/ml α-GalCer. Levels of cytokines TNF-α, IL-10, IL-12p40, and IL-22 in the cell supernatants were examined by ELISA. Data are shown as the mean + SEM of results pooled from four independent experiments. * p
    Figure Legend Snippet: Analysis and comparison of the moDCs, moLCs established by various methods, and primary LC. ( A . PCR products are shown in the figure. GAPDH was used as a control. IL-4 was washed out from culture medium at day 2 (+*). ( B ) moDCs and Dex–TNF-α–induced moLCs were resuspended in 24-well culture plates or test tubes at a concentration of 5 × 10 5 cells/ml. Squalene, MA, or α-GalCer was added, and the cells were incubated for 48 h. Subsequently, the cells were stained with anti-CD86 mAb and analyzed by flow cytometry compared with DMSO, n -hexane, or ethanol control, respectively. Gray histograms indicate the isotype-matched negative control. Results are representative of four independent experiments. ( C ) moDCs and Dex–TNF-α–induced moLCs were stimulated for 48 h with 500 μM squalene, 500 μg/ml MA, or 2.0 μg/ml α-GalCer. Levels of cytokines TNF-α, IL-10, IL-12p40, and IL-22 in the cell supernatants were examined by ELISA. Data are shown as the mean + SEM of results pooled from four independent experiments. * p

    Techniques Used: Polymerase Chain Reaction, Concentration Assay, Incubation, Staining, Flow Cytometry, Cytometry, Negative Control, Enzyme-linked Immunosorbent Assay

    25) Product Images from "Antisense regulation of atrial natriuretic peptide expression"

    Article Title: Antisense regulation of atrial natriuretic peptide expression

    Journal: JCI Insight

    doi: 10.1172/jci.insight.130978

    NPPA-AS1 facilitates binding of the repressive transcription factor REST to the NPPA promoter. ( A ) Schematic overview of the genomic region 1 kb upstream of the NPPA transcription start site (GRCh37/hg19 assembly). Indicated are the positions of the ChIRP primer pairs A–F. ENCODE ChIP-Seq transcription factor binding sites and DNase I hypersensitivity clusters are also indicated. The darkness of gray boxes is proportional to the maximum signal strength in the ENCODE v3 database. ( B ) qRT-PCR analysis of human atrial DNA coprecipitated with 2 independent ChIRP probe sets specific for NPPA-AS1 (“Even” and “Odd”). N/D, not detected. ( C ) Dot blots for protein coprecipitated with probes specific for NPPA-AS1 . See complete unedited blots in the supplemental material. ( D ) Depiction of the noncanonical REST motif in the NPPA ). ( E ) REST ChIP-qPCR in iPS-CMs across the NPPA promoter. The GAPDH promoter was included as a negative control. The ChIP signal is expressed normalized to the negative control IgG ChIP for each region. The Kruskal-Wallis test was used to compare the ChIP signal for each individual region with the signal for the negative control ( GAPDH ) region. * P
    Figure Legend Snippet: NPPA-AS1 facilitates binding of the repressive transcription factor REST to the NPPA promoter. ( A ) Schematic overview of the genomic region 1 kb upstream of the NPPA transcription start site (GRCh37/hg19 assembly). Indicated are the positions of the ChIRP primer pairs A–F. ENCODE ChIP-Seq transcription factor binding sites and DNase I hypersensitivity clusters are also indicated. The darkness of gray boxes is proportional to the maximum signal strength in the ENCODE v3 database. ( B ) qRT-PCR analysis of human atrial DNA coprecipitated with 2 independent ChIRP probe sets specific for NPPA-AS1 (“Even” and “Odd”). N/D, not detected. ( C ) Dot blots for protein coprecipitated with probes specific for NPPA-AS1 . See complete unedited blots in the supplemental material. ( D ) Depiction of the noncanonical REST motif in the NPPA ). ( E ) REST ChIP-qPCR in iPS-CMs across the NPPA promoter. The GAPDH promoter was included as a negative control. The ChIP signal is expressed normalized to the negative control IgG ChIP for each region. The Kruskal-Wallis test was used to compare the ChIP signal for each individual region with the signal for the negative control ( GAPDH ) region. * P

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Negative Control

    Knockdown of Nppa-as increases Nppa levels in vitro and in vivo. ( A ) Schematic overview of the Nppa locus, including the natural antisense transcript Gm13054 on chromosome 4 (GRCm38/mm10 assembly). Arrows indicate direction of transcription. ( B ) Nppa-as and ( C ) Nppa expression in HL-1 cells transfected with different GapmeR designs and negative control, as measured by qRT-PCR. Expression is presented relative to Gapdh and normalized to the mean of the control group. Results are based on 3 separate experiments with 3 replicates in each group. Kruskal-Wallis was used to test the effect of each GapmeR design compared to the negative control. *** P
    Figure Legend Snippet: Knockdown of Nppa-as increases Nppa levels in vitro and in vivo. ( A ) Schematic overview of the Nppa locus, including the natural antisense transcript Gm13054 on chromosome 4 (GRCm38/mm10 assembly). Arrows indicate direction of transcription. ( B ) Nppa-as and ( C ) Nppa expression in HL-1 cells transfected with different GapmeR designs and negative control, as measured by qRT-PCR. Expression is presented relative to Gapdh and normalized to the mean of the control group. Results are based on 3 separate experiments with 3 replicates in each group. Kruskal-Wallis was used to test the effect of each GapmeR design compared to the negative control. *** P

    Techniques Used: In Vitro, In Vivo, Expressing, Transfection, Negative Control, Quantitative RT-PCR

    Mechanical strain increases NPPA and NPPA-AS1 expression in cardiomyocytes. ( A ) Overview of the setup and design of the strain experiment. ( B ) NPPA and NPPA-AS1 expression during the time course of the experiment quantified by qRT-PCR. Expression is presented relative to GAPDH and normalized to the mean of the cells at time point 0 hours. Results are based on 3 separate experiments with 3 replicates in each group. Mean and standard deviation are shown. The Kruskal-Wallis test was used to test the difference in expression between baseline and each time point. * P
    Figure Legend Snippet: Mechanical strain increases NPPA and NPPA-AS1 expression in cardiomyocytes. ( A ) Overview of the setup and design of the strain experiment. ( B ) NPPA and NPPA-AS1 expression during the time course of the experiment quantified by qRT-PCR. Expression is presented relative to GAPDH and normalized to the mean of the cells at time point 0 hours. Results are based on 3 separate experiments with 3 replicates in each group. Mean and standard deviation are shown. The Kruskal-Wallis test was used to test the difference in expression between baseline and each time point. * P

    Techniques Used: Expressing, Quantitative RT-PCR, Standard Deviation

    Cellular and subcellular localization of NPPA-AS1 . ( A ) NPPA-AS1 and NPPA expression in cardiac cells assessed with qRT-PCR. Results are expressed relative to GAPDH. hCM, human primary cardiomyocytes, n = 3; hcFB, human cardiac fibroblasts, n = 3; hcMVEC, human cardiac microvascular endothelial cells, n = 2. N/D, not detected. ( B ) NPPA-AS1 and NPPA mRNA levels in nuclear (NUC) and cytoplasmic (CYT) RNA extracts from iPS-CMs measured by qRT-PCR. Results are expressed relative to GAPDH in each fraction. ( C ) Fluorescence in situ hybridization of NPPA-AS1 (red) in iPS-CMs. Cells were stained with Alexa Fluor 488–conjugated phalloidin (green) and nuclei were counterstained with DAPI (blue). Original magnification, ×20. The proportion of cells with nuclear and cytoplasmic FISH foci was quantified in cells transfected with siRNA specific for NPPA-AS1 or negative control siRNA. A total of 41 random cell-containing visual fields were analyzed. *** P
    Figure Legend Snippet: Cellular and subcellular localization of NPPA-AS1 . ( A ) NPPA-AS1 and NPPA expression in cardiac cells assessed with qRT-PCR. Results are expressed relative to GAPDH. hCM, human primary cardiomyocytes, n = 3; hcFB, human cardiac fibroblasts, n = 3; hcMVEC, human cardiac microvascular endothelial cells, n = 2. N/D, not detected. ( B ) NPPA-AS1 and NPPA mRNA levels in nuclear (NUC) and cytoplasmic (CYT) RNA extracts from iPS-CMs measured by qRT-PCR. Results are expressed relative to GAPDH in each fraction. ( C ) Fluorescence in situ hybridization of NPPA-AS1 (red) in iPS-CMs. Cells were stained with Alexa Fluor 488–conjugated phalloidin (green) and nuclei were counterstained with DAPI (blue). Original magnification, ×20. The proportion of cells with nuclear and cytoplasmic FISH foci was quantified in cells transfected with siRNA specific for NPPA-AS1 or negative control siRNA. A total of 41 random cell-containing visual fields were analyzed. *** P

    Techniques Used: Expressing, Quantitative RT-PCR, Fluorescence, In Situ Hybridization, Staining, Fluorescence In Situ Hybridization, Transfection, Negative Control

    NPPA-AS1 inhibits NPPA expression. iPS-CMs were transfected with scrambled negative control siRNA (siScr) or siRNA targeting NPPA-AS1 (siNPPA-AS1) for 48 hours. NPPA-AS1 and NPPA mRNA expression relative to GAPDH and normalized to the mean of the control cells in iPS-CMs was measured by qRT-PCR. Results are based on 3 separate experiments with 3–4 replicates per group. Mean and standard deviation are shown. *** P
    Figure Legend Snippet: NPPA-AS1 inhibits NPPA expression. iPS-CMs were transfected with scrambled negative control siRNA (siScr) or siRNA targeting NPPA-AS1 (siNPPA-AS1) for 48 hours. NPPA-AS1 and NPPA mRNA expression relative to GAPDH and normalized to the mean of the control cells in iPS-CMs was measured by qRT-PCR. Results are based on 3 separate experiments with 3–4 replicates per group. Mean and standard deviation are shown. *** P

    Techniques Used: Expressing, Transfection, Negative Control, Quantitative RT-PCR, Standard Deviation

    NPPA-AS1 does not form a duplex with NPPA mRNA. Chromatin isolation by RNA purification (ChIRP) in human cardiac tissue ( n = 2). qRT-PCR quantification of NPPA in RNA coprecipitated with 2 independent ChIRP probe sets specific for NPPA-AS1 (“Even” and “Odd”). NPPA-AS1 and GAPDH mRNA was quantified as positive and negative controls, respectively. Results are expressed relative to input RNA.
    Figure Legend Snippet: NPPA-AS1 does not form a duplex with NPPA mRNA. Chromatin isolation by RNA purification (ChIRP) in human cardiac tissue ( n = 2). qRT-PCR quantification of NPPA in RNA coprecipitated with 2 independent ChIRP probe sets specific for NPPA-AS1 (“Even” and “Odd”). NPPA-AS1 and GAPDH mRNA was quantified as positive and negative controls, respectively. Results are expressed relative to input RNA.

    Techniques Used: Isolation, Purification, Quantitative RT-PCR

    26) Product Images from "Hypertonicity‐induced cation channels in HepG2 cells: architecture and role in proliferation vs. apoptosis"

    Article Title: Hypertonicity‐induced cation channels in HepG2 cells: architecture and role in proliferation vs. apoptosis

    Journal: The Journal of Physiology

    doi: 10.1113/JP275827

    RT‐PCR on the proposed HICC elements The expression of αENaC, βENaC, γENaC, δENaC, TRPM2 and TRPM5 were tested in untransfected HepG2 cells, with GAPDH as the internal reference.
    Figure Legend Snippet: RT‐PCR on the proposed HICC elements The expression of αENaC, βENaC, γENaC, δENaC, TRPM2 and TRPM5 were tested in untransfected HepG2 cells, with GAPDH as the internal reference.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

    27) Product Images from "VGF-derived peptide TLQP-21 modulates microglial function through C3aR1 signaling pathways and reduces neuropathology in 5xFAD mice"

    Article Title: VGF-derived peptide TLQP-21 modulates microglial function through C3aR1 signaling pathways and reduces neuropathology in 5xFAD mice

    Journal: Molecular Neurodegeneration

    doi: 10.1186/s13024-020-0357-x

    Human TLQP-21 and C3aSA similarly activate human microglia. a , Left: The sequence of the human TLQP-21 (hTLQP-21) peptide and a photomicrograph of the human microglial clone 3 cell line (HMC3) immunostained with the microglial marker anti-Iba1, are shown. Right: RT-qPCR quantification of human c-Fos expression after treatment (0 to 180 min) of HMC3 cells with 1 μM of hTLQP-21 or C3aSA, n = 3 per group. b , Representative images (Left) and quantification (Right) of latex bead phagocytosis assay on HMC3 microglia treated with or without 1 μM of hTLQP-21 for 1 h. Scale bar = 50 μm. c , RT-qPCR analysis for the human forms of the top 6 targets identified by the murine primary microglia RNA sequencing after treatment with the murine form of TLQP-21 or C3aSA (see Fig. 4 ) in HMC3 treated with or without hTLQP-21 or C3aSA for 24 h, n = 4 treated wells per group from 2 independent experiments A Kruskal-Wallis test was used for A, a Student-t-test for B and a One-Way ANOVA followed by a Tukey’s post-hoc for C, * p
    Figure Legend Snippet: Human TLQP-21 and C3aSA similarly activate human microglia. a , Left: The sequence of the human TLQP-21 (hTLQP-21) peptide and a photomicrograph of the human microglial clone 3 cell line (HMC3) immunostained with the microglial marker anti-Iba1, are shown. Right: RT-qPCR quantification of human c-Fos expression after treatment (0 to 180 min) of HMC3 cells with 1 μM of hTLQP-21 or C3aSA, n = 3 per group. b , Representative images (Left) and quantification (Right) of latex bead phagocytosis assay on HMC3 microglia treated with or without 1 μM of hTLQP-21 for 1 h. Scale bar = 50 μm. c , RT-qPCR analysis for the human forms of the top 6 targets identified by the murine primary microglia RNA sequencing after treatment with the murine form of TLQP-21 or C3aSA (see Fig. 4 ) in HMC3 treated with or without hTLQP-21 or C3aSA for 24 h, n = 4 treated wells per group from 2 independent experiments A Kruskal-Wallis test was used for A, a Student-t-test for B and a One-Way ANOVA followed by a Tukey’s post-hoc for C, * p

    Techniques Used: Sequencing, Marker, Quantitative RT-PCR, Expressing, Phagocytosis Assay, RNA Sequencing Assay

    28) Product Images from "Topical Application of Human Wharton’s Jelly Mesenchymal Stem Cells Accelerates Mouse Sciatic Nerve Recovery and is Associated with Upregulated Neurotrophic Factor Expression"

    Article Title: Topical Application of Human Wharton’s Jelly Mesenchymal Stem Cells Accelerates Mouse Sciatic Nerve Recovery and is Associated with Upregulated Neurotrophic Factor Expression

    Journal: Cell Transplantation

    doi: 10.1177/0963689719880543

    Quantification of hWJ-MSC-derived neurotrophic factor expression. The expression of mRNA for neurotrophic factors such as neurotrophic factor 3 (NT-3), brain-derived neurotrophic factor (BDNF), neurotrophic growth factor (NGF), and glial-derived neurotrophic factor (GDNF) in hWJ-MSC and hADSC was quantified using qPCR. The neurotrophic factor expression was normalized to that of GAPDH. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 161.9 ± 13.3 and 1.0 ± 0.1, respectively, for NT-3 expression. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 14.2 ± 0.5 and 1.0 ± 0.1, respectively, for BDNF expression. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 0.4 ± 0.1 and 1.0 ± 0.1, respectively, for NGF expression. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 7.7 ± 0.7 and 1.0 ± 0.1, respectively, for GDNF expression. The difference between mean ± SD of the hWJ-MSC and hADSC groups was significant ( p
    Figure Legend Snippet: Quantification of hWJ-MSC-derived neurotrophic factor expression. The expression of mRNA for neurotrophic factors such as neurotrophic factor 3 (NT-3), brain-derived neurotrophic factor (BDNF), neurotrophic growth factor (NGF), and glial-derived neurotrophic factor (GDNF) in hWJ-MSC and hADSC was quantified using qPCR. The neurotrophic factor expression was normalized to that of GAPDH. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 161.9 ± 13.3 and 1.0 ± 0.1, respectively, for NT-3 expression. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 14.2 ± 0.5 and 1.0 ± 0.1, respectively, for BDNF expression. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 0.4 ± 0.1 and 1.0 ± 0.1, respectively, for NGF expression. The relative fold changes (mean ± SD) of hWJ-MSC and hADSC groups were 7.7 ± 0.7 and 1.0 ± 0.1, respectively, for GDNF expression. The difference between mean ± SD of the hWJ-MSC and hADSC groups was significant ( p

    Techniques Used: Derivative Assay, Expressing, Real-time Polymerase Chain Reaction

    29) Product Images from "The aryl hydrocarbon receptor and interferon gamma generate antiviral states via transcriptional repression"

    Article Title: The aryl hydrocarbon receptor and interferon gamma generate antiviral states via transcriptional repression

    Journal: eLife

    doi: 10.7554/eLife.38867

    CDK1 mRNA stability is not affected by AhR and IFN-γ. ( A ) Decay of CDK1, TNFα and IL-1β following transcriptional blockage with actinomycin D, monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( B ) Decay rate of CDK1 mRNA following transcriptional blockage with actinomycin D in the presence of AhR agonist, antagonist or IFN-γ. CDK1 mRNA was monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( C ) Mean CDK1 mRNA half-life (t 1/2 )±SEM for three different macrophage donors.
    Figure Legend Snippet: CDK1 mRNA stability is not affected by AhR and IFN-γ. ( A ) Decay of CDK1, TNFα and IL-1β following transcriptional blockage with actinomycin D, monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( B ) Decay rate of CDK1 mRNA following transcriptional blockage with actinomycin D in the presence of AhR agonist, antagonist or IFN-γ. CDK1 mRNA was monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( C ) Mean CDK1 mRNA half-life (t 1/2 )±SEM for three different macrophage donors.

    Techniques Used: Real-time Polymerase Chain Reaction

    30) Product Images from "The PARK10 gene USP24 is a negative regulator of autophagy and ULK1 protein stability"

    Article Title: The PARK10 gene USP24 is a negative regulator of autophagy and ULK1 protein stability

    Journal: Autophagy

    doi: 10.1080/15548627.2019.1598754

    USP24 is differentially expressed in PD patient substantia nigra . (a) q-PCR quantification of USP24:GAPDH mRNA expression in PD patient SN versus unaffected control substantia nigra . All data points correspond to individuals (n = 4); group means are indicated with horizontal lines; error bars are SE; red circle marks a major statistical outlier (defined as a value above Q1-Q3 outer fence) with significantly increased expression of USP24 mRNA (z-score = 4.6). (b) Western blot illustrating USP24 protein levels in 4 PD patient and 4 unaffected age matched control human substantia nigra . (c) Quantification of USP24:ACTB levels from figure (b). Red circles mark major statistical outliers with significantly increased USP24 protein expression (z-scores = 4.5 and 11.0).
    Figure Legend Snippet: USP24 is differentially expressed in PD patient substantia nigra . (a) q-PCR quantification of USP24:GAPDH mRNA expression in PD patient SN versus unaffected control substantia nigra . All data points correspond to individuals (n = 4); group means are indicated with horizontal lines; error bars are SE; red circle marks a major statistical outlier (defined as a value above Q1-Q3 outer fence) with significantly increased expression of USP24 mRNA (z-score = 4.6). (b) Western blot illustrating USP24 protein levels in 4 PD patient and 4 unaffected age matched control human substantia nigra . (c) Quantification of USP24:ACTB levels from figure (b). Red circles mark major statistical outliers with significantly increased USP24 protein expression (z-scores = 4.5 and 11.0).

    Techniques Used: Polymerase Chain Reaction, Expressing, Western Blot

    USP24 regulates protein stability of ULK1. (a) Western blot demonstrating increased levels of ULK1 and phospho-ATG13 (P-ATG13) in cells with USP24 knockdown. (b) Quantification of ULK1:ACTB from figure (a). (c) Quantification of P-ATG13:ACTB from figure (a). (d) Real time q-PCR quantification of ULK1:GAPDH mRNA expression following USP24 knockdown (e) Protein stability assay illustrating that USP24 knockdown decreases the rate of ULK1 degradation. Cells were treated with cycloheximide (50μg/μL) to inhibit protein synthesis. (f) Quantification of ULK1:ACTB from figure (e) at 0 and 3-hour time points. (g) IP demonstrating increased ubiquitination of ULK1 after USP24 knockdown. (h) Quantification of the ubiquitin (HA):ULK1 in figure (g). (i) Western blot demonstrating decreased levels of LC3-II in H4 cells with USP24 knockdown treated with ULK1 inhibitor MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h), as compared to BafA treatment alone. (j) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (i). (k) Western blot demonstrating decreased levels of LC3-II in Hela cells with USP24 knockdown treated with MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h) as compared to BafA treatment alone. (l) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (k). (m) Representative fluorescent images demonstrating attenuated accumulation of autophagosomes in H4 GFP-LC3 cells with USP24 knockdown after MRT68921 treatment. All images were acquired at 20X; bar: 25 μm. (n) Quantification of autophagosome intensity from figure (m). All data are presented as ±SEM. *p
    Figure Legend Snippet: USP24 regulates protein stability of ULK1. (a) Western blot demonstrating increased levels of ULK1 and phospho-ATG13 (P-ATG13) in cells with USP24 knockdown. (b) Quantification of ULK1:ACTB from figure (a). (c) Quantification of P-ATG13:ACTB from figure (a). (d) Real time q-PCR quantification of ULK1:GAPDH mRNA expression following USP24 knockdown (e) Protein stability assay illustrating that USP24 knockdown decreases the rate of ULK1 degradation. Cells were treated with cycloheximide (50μg/μL) to inhibit protein synthesis. (f) Quantification of ULK1:ACTB from figure (e) at 0 and 3-hour time points. (g) IP demonstrating increased ubiquitination of ULK1 after USP24 knockdown. (h) Quantification of the ubiquitin (HA):ULK1 in figure (g). (i) Western blot demonstrating decreased levels of LC3-II in H4 cells with USP24 knockdown treated with ULK1 inhibitor MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h), as compared to BafA treatment alone. (j) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (i). (k) Western blot demonstrating decreased levels of LC3-II in Hela cells with USP24 knockdown treated with MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h) as compared to BafA treatment alone. (l) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (k). (m) Representative fluorescent images demonstrating attenuated accumulation of autophagosomes in H4 GFP-LC3 cells with USP24 knockdown after MRT68921 treatment. All images were acquired at 20X; bar: 25 μm. (n) Quantification of autophagosome intensity from figure (m). All data are presented as ±SEM. *p

    Techniques Used: Western Blot, Polymerase Chain Reaction, Expressing, Stability Assay

    31) Product Images from "Lipid nanoparticle-targeted mRNA therapy as a treatment for the inherited metabolic liver disorder arginase deficiency"

    Article Title: Lipid nanoparticle-targeted mRNA therapy as a treatment for the inherited metabolic liver disorder arginase deficiency

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1906182116

    LNP-h ARG1 administration results in restoration of hepatic arginase mRNA and protein. The h ARG1 mRNA hepatic levels relative to the murine Gapdh housekeeping gene were assessed by qRT-PCR (A), and functional hepatic ARG1 activity was assessed by a biochemical functional arginase assay ( B ) q3D in LNP-h ARG1 mice on day 77 (1 d post-LD) and compared with q3D LNP- luc at the time of euthanasia and in WT controls ( n = 6 per group). ( C ) Western blot analysis of hepatic ARG1 transgene expression in q3D LNP-h ARG1 mice on day 77 (1 d post-LD) was compared with q3D LNP- luc at the time of euthanasia and in WT control liver. P values were obtained from 1-way ANOVA with Tukey’s multiple comparison test. Data are presented as mean ± SEM. D, day.
    Figure Legend Snippet: LNP-h ARG1 administration results in restoration of hepatic arginase mRNA and protein. The h ARG1 mRNA hepatic levels relative to the murine Gapdh housekeeping gene were assessed by qRT-PCR (A), and functional hepatic ARG1 activity was assessed by a biochemical functional arginase assay ( B ) q3D in LNP-h ARG1 mice on day 77 (1 d post-LD) and compared with q3D LNP- luc at the time of euthanasia and in WT controls ( n = 6 per group). ( C ) Western blot analysis of hepatic ARG1 transgene expression in q3D LNP-h ARG1 mice on day 77 (1 d post-LD) was compared with q3D LNP- luc at the time of euthanasia and in WT control liver. P values were obtained from 1-way ANOVA with Tukey’s multiple comparison test. Data are presented as mean ± SEM. D, day.

    Techniques Used: Quantitative RT-PCR, Functional Assay, Activity Assay, Arginase Assay, Mouse Assay, Western Blot, Expressing

    32) Product Images from "Overexpression and Selective Anticancer Efficacy of ENO3 in STK11 Mutant Lung Cancers"

    Article Title: Overexpression and Selective Anticancer Efficacy of ENO3 in STK11 Mutant Lung Cancers

    Journal: Molecules and Cells

    doi: 10.14348/molcells.2019.0099

    Expression of ENO gene family in DNA microarray data and qPCR experiment using LUAD cell lines (A) Comparison of ENO family gene expression (ENO1: 201231_s_at, ENO2: 201313_at, and ENO3: 204483_at) between nine STK11 -mutant and 38 STK11 wild-type cell lines in the CCLE dataset. Wilcoxon rank-sum test for ENO3 and Student’s t -test for others were used to test statistical significance. (B) Experimental validation (qPCR) of ENO family gene expression in STK11 wide-type cell lines (H322M, HCC827, and H1975), STK11 -mutant parental cell lines (A549, H23, and H1993) and STK11 -restored cell lines. The expression level of GAPDH was observed to be varied within SD
    Figure Legend Snippet: Expression of ENO gene family in DNA microarray data and qPCR experiment using LUAD cell lines (A) Comparison of ENO family gene expression (ENO1: 201231_s_at, ENO2: 201313_at, and ENO3: 204483_at) between nine STK11 -mutant and 38 STK11 wild-type cell lines in the CCLE dataset. Wilcoxon rank-sum test for ENO3 and Student’s t -test for others were used to test statistical significance. (B) Experimental validation (qPCR) of ENO family gene expression in STK11 wide-type cell lines (H322M, HCC827, and H1975), STK11 -mutant parental cell lines (A549, H23, and H1993) and STK11 -restored cell lines. The expression level of GAPDH was observed to be varied within SD

    Techniques Used: Expressing, Microarray, Real-time Polymerase Chain Reaction, Mutagenesis

    33) Product Images from "Identification of recurrent FHL2-GLI2 oncogenic fusion in sclerosing stromal tumors of the ovary"

    Article Title: Identification of recurrent FHL2-GLI2 oncogenic fusion in sclerosing stromal tumors of the ovary

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13806-x

    FHL2-GLI2 expression results in the expression of sex cord markers in vitro. a Quantitative assessment of CALB2 transcripts in immortalized mesenchymal stem cells (MSCs) and HEK-293 cells stably expressing empty vector (control), wild-type FHL2 (FHL2), wild-type GLI2 (GLI2), truncated GLI2 (tGLI2), or the FHL2-GLI2 fusion. Expression levels were normalized to GAPDH expression, and comparisons of mRNA expression levels were performed relative to control. b Representative western blot analysis of calretinin protein levels in MSCs and HEK-293 cells stably expressing control, FHL2, GLI2, tGLI2, or FHL2-GLI2. Tubulin was used as protein loading control. Quantification (bottom) of protein levels as compared to control. c Representative confocal micrographs of immunofluorescence analysis of calretinin (green) and 4–6-diamidino-2-phenylindole (DAPI, blue) in MSCs and HEK-293 cells stably expressing control, FHL2, GLI2, tGLI2, or FHL2-GLI2 (scale bars, 50 μm). Quantification (bottom) of calretinin intensity/cell relative to control. d Quantitative assessment of FOXL2 transcripts in MSCs and HEK-293 cells stably expressing control, FHL2, GLI2, tGLI2, or FHL2-GLI2. Expression levels were normalized to GAPDH expression, and comparisons of mRNA expression levels were performed relative to control. In a – d , data are representative of at least three independent experiments. Error bars, s.d. of mean; n.s., not significant; * P
    Figure Legend Snippet: FHL2-GLI2 expression results in the expression of sex cord markers in vitro. a Quantitative assessment of CALB2 transcripts in immortalized mesenchymal stem cells (MSCs) and HEK-293 cells stably expressing empty vector (control), wild-type FHL2 (FHL2), wild-type GLI2 (GLI2), truncated GLI2 (tGLI2), or the FHL2-GLI2 fusion. Expression levels were normalized to GAPDH expression, and comparisons of mRNA expression levels were performed relative to control. b Representative western blot analysis of calretinin protein levels in MSCs and HEK-293 cells stably expressing control, FHL2, GLI2, tGLI2, or FHL2-GLI2. Tubulin was used as protein loading control. Quantification (bottom) of protein levels as compared to control. c Representative confocal micrographs of immunofluorescence analysis of calretinin (green) and 4–6-diamidino-2-phenylindole (DAPI, blue) in MSCs and HEK-293 cells stably expressing control, FHL2, GLI2, tGLI2, or FHL2-GLI2 (scale bars, 50 μm). Quantification (bottom) of calretinin intensity/cell relative to control. d Quantitative assessment of FOXL2 transcripts in MSCs and HEK-293 cells stably expressing control, FHL2, GLI2, tGLI2, or FHL2-GLI2. Expression levels were normalized to GAPDH expression, and comparisons of mRNA expression levels were performed relative to control. In a – d , data are representative of at least three independent experiments. Error bars, s.d. of mean; n.s., not significant; * P

    Techniques Used: Expressing, In Vitro, Stable Transfection, Plasmid Preparation, Western Blot, Immunofluorescence

    34) Product Images from "Regulation of SOX11 expression through CCND1 and STAT3 in mantle cell lymphoma"

    Article Title: Regulation of SOX11 expression through CCND1 and STAT3 in mantle cell lymphoma

    Journal: Blood

    doi: 10.1182/blood-2018-05-851667

    CCND1 upregulates SOX11 expression. (A) Immunoblot analysis of Z-138 and JEKO-1 cells stably transduced with empty vector (EV), WT, or Y44D mutant CCND1-HA constructs. Cell lysates (30 μg per lane) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis gel and immunoblotted with indicated antibodies. Arrow indicates a mobility shift of the CCND1-HA protein. Arrowhead indicates endogenous CCND1. (B) qPCR analysis of SOX11 mRNA expression. Cell lines generated as described in panel A, and mRNAs were harvested for SOX11 qPCR. Shown are the means of mRNA expression levels after normalization to GAPDH signals from 4 independent amplification experiments. Error bars, standard deviation (supplemental Figure 1A-B). (C) CCND1 is required for SOX11 expression. Z-138 and JEKO-1 cells were stably transduced with control or CCND1 shRNA, and protein expression was analyzed by immunoblotting with indicated antibodies 2 days after transduction. (D) Effect of CCND1 knockdown on cell survival. Z-138 and JEKO-1 cells were stably transduced with control or CCND1 shRNA, and propidium iodide (PI)–negative (viable) cells were assessed by flow cytometry over time. Shown are the means of PI − fractions compared with day-2 samples from at least 2 independent experiments. (E) Effect of SOX11 knockdown on MCL survival. Indicated MCL cell lines were transduced with control or SOX11 shRNA lentiviral vector that coexpresses GFP. Shown are the means of GFP + fractions compared with day 2 from 2 independent experiments. (F) Z-138 cells expressing EV, WT, or Y44D CCND1-HA were treated with 10 μM of cyclohexamide (CHX) for indicated times, and cell lysates were prepared for immunoblot analysis with indicated antibodies. Numbers below immunoblots are relative densitometric values of corresponding bands after normalization to ACTIN or GAPDH and respective control signals. *** P
    Figure Legend Snippet: CCND1 upregulates SOX11 expression. (A) Immunoblot analysis of Z-138 and JEKO-1 cells stably transduced with empty vector (EV), WT, or Y44D mutant CCND1-HA constructs. Cell lysates (30 μg per lane) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis gel and immunoblotted with indicated antibodies. Arrow indicates a mobility shift of the CCND1-HA protein. Arrowhead indicates endogenous CCND1. (B) qPCR analysis of SOX11 mRNA expression. Cell lines generated as described in panel A, and mRNAs were harvested for SOX11 qPCR. Shown are the means of mRNA expression levels after normalization to GAPDH signals from 4 independent amplification experiments. Error bars, standard deviation (supplemental Figure 1A-B). (C) CCND1 is required for SOX11 expression. Z-138 and JEKO-1 cells were stably transduced with control or CCND1 shRNA, and protein expression was analyzed by immunoblotting with indicated antibodies 2 days after transduction. (D) Effect of CCND1 knockdown on cell survival. Z-138 and JEKO-1 cells were stably transduced with control or CCND1 shRNA, and propidium iodide (PI)–negative (viable) cells were assessed by flow cytometry over time. Shown are the means of PI − fractions compared with day-2 samples from at least 2 independent experiments. (E) Effect of SOX11 knockdown on MCL survival. Indicated MCL cell lines were transduced with control or SOX11 shRNA lentiviral vector that coexpresses GFP. Shown are the means of GFP + fractions compared with day 2 from 2 independent experiments. (F) Z-138 cells expressing EV, WT, or Y44D CCND1-HA were treated with 10 μM of cyclohexamide (CHX) for indicated times, and cell lysates were prepared for immunoblot analysis with indicated antibodies. Numbers below immunoblots are relative densitometric values of corresponding bands after normalization to ACTIN or GAPDH and respective control signals. *** P

    Techniques Used: Expressing, Stable Transfection, Transduction, Plasmid Preparation, Mutagenesis, Construct, Polyacrylamide Gel Electrophoresis, Mobility Shift, Real-time Polymerase Chain Reaction, Generated, Amplification, Standard Deviation, shRNA, Flow Cytometry, Cytometry, Western Blot

    Effects of IL-21 on STAT3 activity, SOX11 expression, and cell viability in MCL cells. (A) Indicated MCL cell lines were treated with 50 ng/mL of IL-21 for 96 hours, and SOX11 mRNA was analyzed by qPCR. Shown are the means of mRNA expression levels after normalization to GAPDH signals from 4 independent amplification experiments. (B) Immunoblot analysis of indicated MCL cell lines treated as described in panel A. (C) Immunoblot analysis of MCL PDX models treated with 50 ng/mL of IL-21 for 72 hours. (D) Indicated MCL cell lines were treated with 50 ng/mL of IL-21, and viable cells (propidium iodide (PI) negative) were assessed by flow cytometry at indicated times. Shown are the means of PI − fractions compared with untreated samples from at least 2 independent experiments. (E) MCL PDX cells were treated with IL-21, and viable cells were analyzed as in panel D for the indicated times. Shown are the means of PI − fractions compared with untreated samples from at least 2 independent experiments. Error bars, standard deviation. ** P
    Figure Legend Snippet: Effects of IL-21 on STAT3 activity, SOX11 expression, and cell viability in MCL cells. (A) Indicated MCL cell lines were treated with 50 ng/mL of IL-21 for 96 hours, and SOX11 mRNA was analyzed by qPCR. Shown are the means of mRNA expression levels after normalization to GAPDH signals from 4 independent amplification experiments. (B) Immunoblot analysis of indicated MCL cell lines treated as described in panel A. (C) Immunoblot analysis of MCL PDX models treated with 50 ng/mL of IL-21 for 72 hours. (D) Indicated MCL cell lines were treated with 50 ng/mL of IL-21, and viable cells (propidium iodide (PI) negative) were assessed by flow cytometry at indicated times. Shown are the means of PI − fractions compared with untreated samples from at least 2 independent experiments. (E) MCL PDX cells were treated with IL-21, and viable cells were analyzed as in panel D for the indicated times. Shown are the means of PI − fractions compared with untreated samples from at least 2 independent experiments. Error bars, standard deviation. ** P

    Techniques Used: Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Amplification, Flow Cytometry, Cytometry, Standard Deviation

    35) Product Images from "UBE2C promotes rectal carcinoma via miR-381"

    Article Title: UBE2C promotes rectal carcinoma via miR-381

    Journal: Cancer Biology & Therapy

    doi: 10.1080/15384047.2017.1416939

    siRNA of UBE2C down-regulated the expression level of UBE2C in HR-8348 cells. A) Western blot showed the protein level of UBE2C after the treatment of siRNA. B) Q-PCR showed the expression level of UBE2C in the cells with different treatments as indicated. *** indicated p
    Figure Legend Snippet: siRNA of UBE2C down-regulated the expression level of UBE2C in HR-8348 cells. A) Western blot showed the protein level of UBE2C after the treatment of siRNA. B) Q-PCR showed the expression level of UBE2C in the cells with different treatments as indicated. *** indicated p

    Techniques Used: Expressing, Western Blot, Polymerase Chain Reaction

    miR-381 regulated the expression level of UBE2C. A) Schema showed the complimentary domain between miR-381 and UBE2C. B) Western blot showed the protein level of UBE2C after the treatment of miRNA. C) The viability of HR-8348 cells with different treatments were determined by cck-8 kit. ** indicated p
    Figure Legend Snippet: miR-381 regulated the expression level of UBE2C. A) Schema showed the complimentary domain between miR-381 and UBE2C. B) Western blot showed the protein level of UBE2C after the treatment of miRNA. C) The viability of HR-8348 cells with different treatments were determined by cck-8 kit. ** indicated p

    Techniques Used: Expressing, Western Blot, CCK-8 Assay

    UBE2C inhibited apoptosis and promoted the tumor invasion. A) The apoptosis of the HR-8348 cells with different treatment as indicated was determined by using the Annexin-V-FITC PI Apoptosis Kit and assessed by flow cytometry. n = 3 independent experiments and this panel presented one of these repeats. B) Statistic of percentage of the apoptosis cells performed in panel (A). Data showed the Annexin-V and PI double positive cells. Data were represented as mean ± s.d.; n = 3 independent experiments. ***indicated p
    Figure Legend Snippet: UBE2C inhibited apoptosis and promoted the tumor invasion. A) The apoptosis of the HR-8348 cells with different treatment as indicated was determined by using the Annexin-V-FITC PI Apoptosis Kit and assessed by flow cytometry. n = 3 independent experiments and this panel presented one of these repeats. B) Statistic of percentage of the apoptosis cells performed in panel (A). Data showed the Annexin-V and PI double positive cells. Data were represented as mean ± s.d.; n = 3 independent experiments. ***indicated p

    Techniques Used: Flow Cytometry

    UBE2C up-regulated in rectal carcinoma. A) Western bolt showed protein levels of UBE2C in 5 rectal carcinomas compare to their para-carcinoma tissues. B) Q-PCR showed the expression level of UBE2C in another 13 rectal carcinoma tissue samples. ** indicated p
    Figure Legend Snippet: UBE2C up-regulated in rectal carcinoma. A) Western bolt showed protein levels of UBE2C in 5 rectal carcinomas compare to their para-carcinoma tissues. B) Q-PCR showed the expression level of UBE2C in another 13 rectal carcinoma tissue samples. ** indicated p

    Techniques Used: Western Blot, Polymerase Chain Reaction, Expressing

    UBE2C promoted the cell proliferation in HR-8348 cells. A) Cell counting assay showed the cell proliferation with the different treatments as indicated. B) The viability of HR-8348 cells with different treatments were determined by cck-8 kit. *** indicated p
    Figure Legend Snippet: UBE2C promoted the cell proliferation in HR-8348 cells. A) Cell counting assay showed the cell proliferation with the different treatments as indicated. B) The viability of HR-8348 cells with different treatments were determined by cck-8 kit. *** indicated p

    Techniques Used: Cell Counting, CCK-8 Assay

    UBE2C promoted rectal carcinoma in vivo. A) Tumor generated by HR-8348 with different treatment as indicated was measured in diameters and calculated to volume according to the time point. B) Survival curve of the mice injected with different cells. Each group contains 20 mice.
    Figure Legend Snippet: UBE2C promoted rectal carcinoma in vivo. A) Tumor generated by HR-8348 with different treatment as indicated was measured in diameters and calculated to volume according to the time point. B) Survival curve of the mice injected with different cells. Each group contains 20 mice.

    Techniques Used: In Vivo, Generated, Mouse Assay, Injection

    36) Product Images from "Abundance, fatty acid composition and saturation index of neutral lipids are significantly different between isogenic primary and metastatic colon cancer cell lines"

    Article Title: Abundance, fatty acid composition and saturation index of neutral lipids are significantly different between isogenic primary and metastatic colon cancer cell lines

    Journal: bioRxiv

    doi: 10.1101/690685

    Expression of selected genes from de novo lipid synthesis or lipid uptake/degradation pathways in SW480 and SW620 cell lines. Box plots showing log2 transformed and median normalized values of FASN, HMGCR and MGLL. LPL and CD36 expressions were not detected. The levels of the different transcripts were measured in 3 to 6 samples by qPCR. The results show the distribution of corresponding transcripts relative to GAPDH, with the box indicating the 25th–75th percentiles, with the median indicated. line. The whiskers show the range.
    Figure Legend Snippet: Expression of selected genes from de novo lipid synthesis or lipid uptake/degradation pathways in SW480 and SW620 cell lines. Box plots showing log2 transformed and median normalized values of FASN, HMGCR and MGLL. LPL and CD36 expressions were not detected. The levels of the different transcripts were measured in 3 to 6 samples by qPCR. The results show the distribution of corresponding transcripts relative to GAPDH, with the box indicating the 25th–75th percentiles, with the median indicated. line. The whiskers show the range.

    Techniques Used: Expressing, Transformation Assay, Real-time Polymerase Chain Reaction

    37) Product Images from "Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution"

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution

    Journal: Arteriosclerosis, thrombosis, and vascular biology

    doi: 10.1161/ATVBAHA.118.310908

    Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p
    Figure Legend Snippet: Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p

    Techniques Used: Expressing, Immunostaining, Staining, Negative Control, Fluorescence, Quantitative RT-PCR

    LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p
    Figure Legend Snippet: LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Generated, Positive Control, Transfection, Plasmid Preparation, Quantitative RT-PCR, Sensitive Assay

    38) Product Images from "ANXA10 induction by interaction with tumor‐associated macrophages promotes the growth of esophageal squamous cell carcinoma"

    Article Title: ANXA10 induction by interaction with tumor‐associated macrophages promotes the growth of esophageal squamous cell carcinoma

    Journal: Pathology International

    doi: 10.1111/pin.12771

    The mRNA levels of up‐regulated or down‐regulated genes in ESCC cell lines monocultured and co‐cultured with TAM‐like PBMo‐derived macrophages by quantitative RT‐PCR. ( a–e ) The mRNA levels of CYP1A1 , DHRS3 , ANXA10 , KLK6 and CYP1B1 were up‐regulated and ( f, g ) AMTN and IGFL1 were down‐regulated in co‐cultured TE‐8 and TE‐9 cells compared to the respective monocultured ESCC cell lines. GAPDH was used as a control. Data are mean ± SEM in triplicate. ** P
    Figure Legend Snippet: The mRNA levels of up‐regulated or down‐regulated genes in ESCC cell lines monocultured and co‐cultured with TAM‐like PBMo‐derived macrophages by quantitative RT‐PCR. ( a–e ) The mRNA levels of CYP1A1 , DHRS3 , ANXA10 , KLK6 and CYP1B1 were up‐regulated and ( f, g ) AMTN and IGFL1 were down‐regulated in co‐cultured TE‐8 and TE‐9 cells compared to the respective monocultured ESCC cell lines. GAPDH was used as a control. Data are mean ± SEM in triplicate. ** P

    Techniques Used: Cell Culture, Derivative Assay, Quantitative RT-PCR

    Effects of ANXA10 overexpression in TE‐15 cells. ( a, b ) The expression of ANXA10 in ESCC cell lines (TE‐8, TE‐9 and TE‐15) were confirmed by RT‐PCR ( a ) and western blotting ( b ). The expression of ANXA10 in the TE‐15 cells was significantly lower than that of TE‐8 and TE‐9 cells. ( c, d ) The effects of ANXA10 vector transfection in ANXA10 expression in TE‐15 cells (three clones: A1, A2, A3) were evaluated. Increased ANXA10 mRNA expression in the transfected cells compared to control cells (two clones: C1, C2) was confirmed by RT‐PCR ( c ) and qRT‐PCR ( d ). GAPDH was used as an internal control. Data are mean ± SEM in triplicate. ** P
    Figure Legend Snippet: Effects of ANXA10 overexpression in TE‐15 cells. ( a, b ) The expression of ANXA10 in ESCC cell lines (TE‐8, TE‐9 and TE‐15) were confirmed by RT‐PCR ( a ) and western blotting ( b ). The expression of ANXA10 in the TE‐15 cells was significantly lower than that of TE‐8 and TE‐9 cells. ( c, d ) The effects of ANXA10 vector transfection in ANXA10 expression in TE‐15 cells (three clones: A1, A2, A3) were evaluated. Increased ANXA10 mRNA expression in the transfected cells compared to control cells (two clones: C1, C2) was confirmed by RT‐PCR ( c ) and qRT‐PCR ( d ). GAPDH was used as an internal control. Data are mean ± SEM in triplicate. ** P

    Techniques Used: Over Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Plasmid Preparation, Transfection, Quantitative RT-PCR

    Effects of ANXA10 knockdown on TE‐8 and TE‐9 cells. ( a ) The mRNA levels of ANXA10 in monocultured and co‐cultured TE‐8 and TE‐9 cells with TAM‐like PBMo‐derived macrophages were analyzed by RT‐PCR. GAPDH was used as a control. ( b ) The protein levels of ANXA10 in monocultured and co‐cultured TE‐8 and TE‐9 cells with TAM‐like PBMo‐derived macrophages were confirmed by western blotting. β‐actin was used as a control. ( c, d ) The effects of the knockdown of ANXA10 expression in TE‐8 and TE‐9 transfected cells were confirmed. The mRNA level of the knockdown of ANXA10 was confirmed by RT‐PCR and qRT‐PCR. GAPDH was used as a control. Data are mean ± SEM in triplicate. ** P
    Figure Legend Snippet: Effects of ANXA10 knockdown on TE‐8 and TE‐9 cells. ( a ) The mRNA levels of ANXA10 in monocultured and co‐cultured TE‐8 and TE‐9 cells with TAM‐like PBMo‐derived macrophages were analyzed by RT‐PCR. GAPDH was used as a control. ( b ) The protein levels of ANXA10 in monocultured and co‐cultured TE‐8 and TE‐9 cells with TAM‐like PBMo‐derived macrophages were confirmed by western blotting. β‐actin was used as a control. ( c, d ) The effects of the knockdown of ANXA10 expression in TE‐8 and TE‐9 transfected cells were confirmed. The mRNA level of the knockdown of ANXA10 was confirmed by RT‐PCR and qRT‐PCR. GAPDH was used as a control. Data are mean ± SEM in triplicate. ** P

    Techniques Used: Cell Culture, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing, Transfection, Quantitative RT-PCR

    39) Product Images from "CaMK4 compromises podocyte function in autoimmune and nonautoimmune kidney disease"

    Article Title: CaMK4 compromises podocyte function in autoimmune and nonautoimmune kidney disease

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI99507

    CaMK4 expression is increased in podocytes from lupus-prone and LPS- or adriamycin-treated mice. ( A ) Representative images of immunofluorescence for synaptopodin or CaMK4 in PBS-, LPS-, and adriamycin-treated mice. Scale bar: 50 μm. ( B ) Representative images of immunofluorescence for synaptopodin or CaMK4 in MRL/MpJ and MRL. lpr mice (8, 12, 16 weeks old). Scale bar: 50 μm. ( C – F ) Camk4 mRNA expression in glomeruli ( C and E ) or sorted podocytes by flow cytometry ( D and F ) from PBS-, LPS-, and adriamycin- treated mice and MRL/MpJ and MRL. lpr mice (16 weeks old). Results were normalized to the expression of GAPDH ( n = 5 in each group). * P
    Figure Legend Snippet: CaMK4 expression is increased in podocytes from lupus-prone and LPS- or adriamycin-treated mice. ( A ) Representative images of immunofluorescence for synaptopodin or CaMK4 in PBS-, LPS-, and adriamycin-treated mice. Scale bar: 50 μm. ( B ) Representative images of immunofluorescence for synaptopodin or CaMK4 in MRL/MpJ and MRL. lpr mice (8, 12, 16 weeks old). Scale bar: 50 μm. ( C – F ) Camk4 mRNA expression in glomeruli ( C and E ) or sorted podocytes by flow cytometry ( D and F ) from PBS-, LPS-, and adriamycin- treated mice and MRL/MpJ and MRL. lpr mice (16 weeks old). Results were normalized to the expression of GAPDH ( n = 5 in each group). * P

    Techniques Used: Expressing, Mouse Assay, Immunofluorescence, Flow Cytometry, Cytometry

    40) Product Images from "Cathepsin S Alters the Expression of Pro-Inflammatory Cytokines and MMP-9, Partially through Protease—Activated Receptor-2, in Human Corneal Epithelial Cells"

    Article Title: Cathepsin S Alters the Expression of Pro-Inflammatory Cytokines and MMP-9, Partially through Protease—Activated Receptor-2, in Human Corneal Epithelial Cells

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19113530

    CTSS increases PAR-2 gene and protein expression after 24 h in human corneal epithelial cells. ( A ) PAR-2 gene expression in HCE-T cells without and with CTSS. PAR-2 gene expression was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells); ( B ) PAR-2 protein expression measured by using the human PAR-2 ELISA assay in HCE-T cell lysates without and with CTSS. PAR-2 protein expression was normalized to total protein in lysates ( n = 4 samples/group and a two-tailed, unpaired Student’s t -test was used to compare treated to untreated cells); ( C ) HCE-T cells treated without and with CTSS for 24 h and fixed and processed using primary and secondary antibodies to detect PAR-2 by indirect immunofluorescence. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . (* p ≤ 0.05, ** p ≤ 0.01 and data are represented as mean ± SEM).
    Figure Legend Snippet: CTSS increases PAR-2 gene and protein expression after 24 h in human corneal epithelial cells. ( A ) PAR-2 gene expression in HCE-T cells without and with CTSS. PAR-2 gene expression was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells); ( B ) PAR-2 protein expression measured by using the human PAR-2 ELISA assay in HCE-T cell lysates without and with CTSS. PAR-2 protein expression was normalized to total protein in lysates ( n = 4 samples/group and a two-tailed, unpaired Student’s t -test was used to compare treated to untreated cells); ( C ) HCE-T cells treated without and with CTSS for 24 h and fixed and processed using primary and secondary antibodies to detect PAR-2 by indirect immunofluorescence. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . (* p ≤ 0.05, ** p ≤ 0.01 and data are represented as mean ± SEM).

    Techniques Used: Expressing, Enzyme-linked Immunosorbent Assay, Two Tailed Test, Immunofluorescence, Activity Assay

    CTSS exposure in human corneal epithelial cells increases cellular CTSS gene and protein expression after 8- and 24-h ( A ) CTSS gene expression in HCE-T cells without and with CTSS. CTSS gene expression was normalized to expression of the endogenous gene, GAPDH . One-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells; ( B ) CTSS protein expression measured by using the human CTSS human ELISA assay in HCE-T cell lysates without and with CTSS treatment at different time points. CTSS protein expression was normalized to total protein in lysates and a one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells; ( C ) Enzymatic CTSS activity after 24 h in HCE-T cells without and with CTSS. Enzymatic CTSS activity was normalized to total protein in lysates and a two-tailed, unpaired Student’s t -test was used to compare treated to untreated cells. ( n = 3 samples/group, * p ≤ 0.05, ** p ≤ 0.01, data are represented as mean ± SEM). The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods .
    Figure Legend Snippet: CTSS exposure in human corneal epithelial cells increases cellular CTSS gene and protein expression after 8- and 24-h ( A ) CTSS gene expression in HCE-T cells without and with CTSS. CTSS gene expression was normalized to expression of the endogenous gene, GAPDH . One-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells; ( B ) CTSS protein expression measured by using the human CTSS human ELISA assay in HCE-T cell lysates without and with CTSS treatment at different time points. CTSS protein expression was normalized to total protein in lysates and a one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells; ( C ) Enzymatic CTSS activity after 24 h in HCE-T cells without and with CTSS. Enzymatic CTSS activity was normalized to total protein in lysates and a two-tailed, unpaired Student’s t -test was used to compare treated to untreated cells. ( n = 3 samples/group, * p ≤ 0.05, ** p ≤ 0.01, data are represented as mean ± SEM). The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods .

    Techniques Used: Expressing, Enzyme-linked Immunosorbent Assay, Activity Assay, Two Tailed Test

    CTSS activity is required for early induction of pro-inflammatory cytokines in human corneal epithelial cells. ( A ) IL-8 gene expression in HCE-T cells without (untreated), with heat-inactivated CTSS, and with active CTSS; ( B ) IL-6 gene expression in HCE-T cells without (untreated), with heat-inactivated CTSS, and with active CTSS. IL-8 and IL-6 gene expression were normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, * p ≤ 0.05, ** p ≤ 0.01, data are represented as mean ± SEM, and one-way ANOVA with Tukey’s multiple comparison was used to compare cells within different CTSS treatments. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . Heat inactivation was by heating at 90 °C for 30 min.
    Figure Legend Snippet: CTSS activity is required for early induction of pro-inflammatory cytokines in human corneal epithelial cells. ( A ) IL-8 gene expression in HCE-T cells without (untreated), with heat-inactivated CTSS, and with active CTSS; ( B ) IL-6 gene expression in HCE-T cells without (untreated), with heat-inactivated CTSS, and with active CTSS. IL-8 and IL-6 gene expression were normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, * p ≤ 0.05, ** p ≤ 0.01, data are represented as mean ± SEM, and one-way ANOVA with Tukey’s multiple comparison was used to compare cells within different CTSS treatments. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . Heat inactivation was by heating at 90 °C for 30 min.

    Techniques Used: Activity Assay, Expressing

    CTSS increases IL-1β , IL-8 , IL-6 , and TNF-α gene expression after 2- and 4-hours of treatment in a human corneal epithelial cell line (HCE-T cells) ( A ) IL-1β gene expression without and with CTSS treatment in HCE-T cells; ( B ) IL-8 gene expression without and with CTSS treatment in HCE-T cells; ( C ) IL-6 gene expression without and with CTSS treatment in HCE-T cells; ( D ) TNF-α gene expression without and with CTSS treatment in HCE-T cells. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . Expression of genes of interest were normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, data are represented as mean ± SEM and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells).
    Figure Legend Snippet: CTSS increases IL-1β , IL-8 , IL-6 , and TNF-α gene expression after 2- and 4-hours of treatment in a human corneal epithelial cell line (HCE-T cells) ( A ) IL-1β gene expression without and with CTSS treatment in HCE-T cells; ( B ) IL-8 gene expression without and with CTSS treatment in HCE-T cells; ( C ) IL-6 gene expression without and with CTSS treatment in HCE-T cells; ( D ) TNF-α gene expression without and with CTSS treatment in HCE-T cells. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . Expression of genes of interest were normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, data are represented as mean ± SEM and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells).

    Techniques Used: Expressing, Activity Assay

    CTSS increases MMP-9 gene expression after 24 h in human corneal epithelial cells. MMP-9 gene expression in HCE-T cells without and with CTSS. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . MMP-9 gene expression was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, ** p ≤ 0.01, data are represented as mean ± SEM and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells).
    Figure Legend Snippet: CTSS increases MMP-9 gene expression after 24 h in human corneal epithelial cells. MMP-9 gene expression in HCE-T cells without and with CTSS. The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . MMP-9 gene expression was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, ** p ≤ 0.01, data are represented as mean ± SEM and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells).

    Techniques Used: Expressing, Activity Assay

    Gene expression of pro-inflammatory cytokines ( IL-8 , IL-6 , TNF-α , and IL-1β ) after 15 min, 1 h, and 2 h of CTSS treatment in human corneal epithelial cells (HCE-T cells). The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . Expression of genes of interest was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, * p ≤ 0.05, data are represented as mean ± SEM and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells).
    Figure Legend Snippet: Gene expression of pro-inflammatory cytokines ( IL-8 , IL-6 , TNF-α , and IL-1β ) after 15 min, 1 h, and 2 h of CTSS treatment in human corneal epithelial cells (HCE-T cells). The amount of CTSS added corresponded to an activity level found in the 90th–95th percentile of SS patients (18,000 RFU, added to 500 µL of cell medium), as described in detail in Methods . Expression of genes of interest was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group, * p ≤ 0.05, data are represented as mean ± SEM and one-way ANOVA with Dunnett’s multiple comparison was used to compare treated to untreated cells).

    Techniques Used: Expressing, Activity Assay

    PAR-2 gene and protein expression after 48 h of PAR-2 or scrambled siRNA transfection in human corneal epithelial cells. ( A ) PAR-2 gene expression in HCE-T cells transfected with PAR-2 or scrambled siRNA. PAR-2 gene expression was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group; ( B ) PAR-2 bands measured by Western Blotting in lysates from human corneal epithelial cells transfected with PAR-2 or scrambled siRNA; ( C ) PAR-2 band intensity in human corneal epithelial cells transfected with PAR-2 or scrambled siRNA. The intensity signal of PAR-2 band was normalized to the band intensity of GAPDH and designated as 100% for scrambled siRNA-treated cells ( n = 5 samples/group); ( D ) PAR-2 protein expression in HCE-T cells transfected with PAR-2 or scrambled siRNA as determined by ELISA. PAR-2 protein expression was normalized to total protein in lysates ( n = 3 samples in PAR-2 siRNA transfected and n = 2 in scrambled siRNA transfected, * p ≤ 0.05, *** p ≤ 0.001 data are represented as mean ± SEM, and a two-tailed, unpaired Student’s t -test was used to compare PAR-2 siRNA transfected to scrambled siRNA transfected cells).
    Figure Legend Snippet: PAR-2 gene and protein expression after 48 h of PAR-2 or scrambled siRNA transfection in human corneal epithelial cells. ( A ) PAR-2 gene expression in HCE-T cells transfected with PAR-2 or scrambled siRNA. PAR-2 gene expression was normalized to expression of the endogenous gene, GAPDH ( n = 3 samples/group; ( B ) PAR-2 bands measured by Western Blotting in lysates from human corneal epithelial cells transfected with PAR-2 or scrambled siRNA; ( C ) PAR-2 band intensity in human corneal epithelial cells transfected with PAR-2 or scrambled siRNA. The intensity signal of PAR-2 band was normalized to the band intensity of GAPDH and designated as 100% for scrambled siRNA-treated cells ( n = 5 samples/group); ( D ) PAR-2 protein expression in HCE-T cells transfected with PAR-2 or scrambled siRNA as determined by ELISA. PAR-2 protein expression was normalized to total protein in lysates ( n = 3 samples in PAR-2 siRNA transfected and n = 2 in scrambled siRNA transfected, * p ≤ 0.05, *** p ≤ 0.001 data are represented as mean ± SEM, and a two-tailed, unpaired Student’s t -test was used to compare PAR-2 siRNA transfected to scrambled siRNA transfected cells).

    Techniques Used: Expressing, Transfection, Western Blot, Enzyme-linked Immunosorbent Assay, Two Tailed Test

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Human Brain Endothelial CXCR2 is Inflammation-Inducible and Mediates CXCL5- and CXCL8-Triggered Paraendothelial Barrier Breakdown
    Article Snippet: .. Afterwards, cDNA was synthetized with the TaqMan® Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA) and subjected in triplicates to quantitative real-time PCR using TaqMan® reagents and the FAM-MBG inventoried primers Hs01891184_s1 (CXCR2) and Hs02786624_g1 (GAPDH) in a StepOne plus system (all from Applied Biosystems, Carlsbad, CA, USA). .. Relative changes in gene expression were normalized to GAPDH as an internal control.

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution
    Article Snippet: .. To assess relative mRNA and miRNA expression levels, quantitative PCR (qRT-PCR) of cDNA products was performed using the following ThermoFisher TaqMan qRT-PCR probes: LIN28A (Hs00702808_s1), LIN28B (Hs01013729_m1), SERPINE1 (Hs00167155_m1), TWIST1 (Hs01675818_s1), GAPDH (Hs02786624_g1) miR-515-5p (001112), miR-516a-5p (002416), miR-516b (001150), miR-517a (002402), miR-518c (002401), miR-519d (002403), let-7a (000377), let-7c (000379), U18 (001204). .. Taqman probes were used according to manufacturer’s instructions with TaqMan Fast Advanced Master Mix and QuantStudio 3 instrument (Life Technologies) as previously described .

    other:

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling
    Article Snippet: The assay ID of each gene is as follows: IFI44 (Hs00197427_m1), CXCL10 (Hs00171042_m1), IFN-β (Hs01077958_s1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Hs02786624_g1).

    Article Title: Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i
    Article Snippet: GAPDH: Hs02786624_g1; β2microglobulin: 4310886E; CD23: Hs00233627_m1; εGLT: Forward 5′ CTGTCCAGGAACCCGACAGA 3′, Reverse 5′ TGCAGCAGCGGGTCAAG 3′ with MGB probe 6FAM-AG GCACCAAATG-MGB.

    Quantitative RT-PCR:

    Article Title: Angiopoietin Level Trajectories in Toddlers with Severe Sepsis and Septic Shock and Their Effect on Capillary Endothelium
    Article Snippet: .. All quantitative real-time RT-PCR (qRT-PCR) reactions were assembled with TaqMan gene expression master mix and predeveloped TaqMan gene expression probes (ThermoFisher, Hs02786624_g1 and Hs00169867_m1). .. Reactions were analyzed on a CFX96 real-time system using CFX Manager software (BioRad Laboratories).

    Article Title: Anti-metastatic and anti-proliferative activity of eugenol against triple negative and HER2 positive breast cancer cells
    Article Snippet: .. Glyceraldehyde-3-phosphate dehydrogenase (Hs02786624_g1) was used as an internal control for qRT-PCR. ..

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution
    Article Snippet: .. To assess relative mRNA and miRNA expression levels, quantitative PCR (qRT-PCR) of cDNA products was performed using the following ThermoFisher TaqMan qRT-PCR probes: LIN28A (Hs00702808_s1), LIN28B (Hs01013729_m1), SERPINE1 (Hs00167155_m1), TWIST1 (Hs01675818_s1), GAPDH (Hs02786624_g1) miR-515-5p (001112), miR-516a-5p (002416), miR-516b (001150), miR-517a (002402), miR-518c (002401), miR-519d (002403), let-7a (000377), let-7c (000379), U18 (001204). .. Taqman probes were used according to manufacturer’s instructions with TaqMan Fast Advanced Master Mix and QuantStudio 3 instrument (Life Technologies) as previously described .

    Expressing:

    Article Title: Angiopoietin Level Trajectories in Toddlers with Severe Sepsis and Septic Shock and Their Effect on Capillary Endothelium
    Article Snippet: .. All quantitative real-time RT-PCR (qRT-PCR) reactions were assembled with TaqMan gene expression master mix and predeveloped TaqMan gene expression probes (ThermoFisher, Hs02786624_g1 and Hs00169867_m1). .. Reactions were analyzed on a CFX96 real-time system using CFX Manager software (BioRad Laboratories).

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution
    Article Snippet: .. To assess relative mRNA and miRNA expression levels, quantitative PCR (qRT-PCR) of cDNA products was performed using the following ThermoFisher TaqMan qRT-PCR probes: LIN28A (Hs00702808_s1), LIN28B (Hs01013729_m1), SERPINE1 (Hs00167155_m1), TWIST1 (Hs01675818_s1), GAPDH (Hs02786624_g1) miR-515-5p (001112), miR-516a-5p (002416), miR-516b (001150), miR-517a (002402), miR-518c (002401), miR-519d (002403), let-7a (000377), let-7c (000379), U18 (001204). .. Taqman probes were used according to manufacturer’s instructions with TaqMan Fast Advanced Master Mix and QuantStudio 3 instrument (Life Technologies) as previously described .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gene exp gapdh hs02786624 g1
    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and <t>GAPDH.</t> (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P
    Gene Exp Gapdh Hs02786624 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02786624 g1/product/Thermo Fisher
    Average 99 stars, based on 123 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02786624 g1 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P

    Journal: Clinical and Molecular Hepatology

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    doi: 10.3350/cmh.2017.0074

    Figure Lengend Snippet: Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P

    Article Snippet: The assay ID of each gene is as follows: IFI44 (Hs00197427_m1), CXCL10 (Hs00171042_m1), IFN-β (Hs01077958_s1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Hs02786624_g1).

    Techniques: Isolation, Infection, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P

    Journal: Clinical and Molecular Hepatology

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    doi: 10.3350/cmh.2017.0074

    Figure Lengend Snippet: STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P

    Article Snippet: The assay ID of each gene is as follows: IFI44 (Hs00197427_m1), CXCL10 (Hs00171042_m1), IFN-β (Hs01077958_s1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Hs02786624_g1).

    Techniques: Infection, Isolation, Real-time Polymerase Chain Reaction, Expressing

    Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.

    Journal: Clinical and Molecular Hepatology

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    doi: 10.3350/cmh.2017.0074

    Figure Lengend Snippet: Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.

    Article Snippet: The assay ID of each gene is as follows: IFI44 (Hs00197427_m1), CXCL10 (Hs00171042_m1), IFN-β (Hs01077958_s1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Hs02786624_g1).

    Techniques: Expressing, Isolation, Infection, Real-time Polymerase Chain Reaction

    Expression and secretion of angpt-2 in cultured cells Cultured endothelial cell angiopoietin-2 expression. (A) ANGPT2 expression relative to the house-keeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) comparing human dermal microvascular endothelial cells (HDMEC), human pulmonary microvascular endothelial cells (HPMEC) and human umbilical venous endothelial cells (HUVEC). (B) Angiopoietin-2 secretion across the three compared cell lines. (C) Angiopoietin-2 secretion in HDMEC after siRNA knock-down.

    Journal: Shock (Augusta, Ga.)

    Article Title: Angiopoietin Level Trajectories in Toddlers with Severe Sepsis and Septic Shock and Their Effect on Capillary Endothelium

    doi: 10.1097/SHK.0000000000001172

    Figure Lengend Snippet: Expression and secretion of angpt-2 in cultured cells Cultured endothelial cell angiopoietin-2 expression. (A) ANGPT2 expression relative to the house-keeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) comparing human dermal microvascular endothelial cells (HDMEC), human pulmonary microvascular endothelial cells (HPMEC) and human umbilical venous endothelial cells (HUVEC). (B) Angiopoietin-2 secretion across the three compared cell lines. (C) Angiopoietin-2 secretion in HDMEC after siRNA knock-down.

    Article Snippet: All quantitative real-time RT-PCR (qRT-PCR) reactions were assembled with TaqMan gene expression master mix and predeveloped TaqMan gene expression probes (ThermoFisher, Hs02786624_g1 and Hs00169867_m1).

    Techniques: Expressing, Cell Culture

    siRNA-induced inhibition of CD23 mRNA expression Human tonsillar B cells were transfected with either control siRNA (■) or CD23 siRNA (□) and cultured for up to 5 days with IL-4 (200IU/ml) and anti-CD40 (1μg/ml). Cells were harvested at the times indicated and qPCR was performed to quantify mRNA expression levels for (A) CD23 and (B) GAPDH. Expression levels were calculated by ΔΔCt analysis, normalized against the endogenous reference gene β 2 -microglobulin and expressed relative to control siRNA-transfected cells at each timepoint (n=11).

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i

    doi: 10.4049/jimmunol.1102689

    Figure Lengend Snippet: siRNA-induced inhibition of CD23 mRNA expression Human tonsillar B cells were transfected with either control siRNA (■) or CD23 siRNA (□) and cultured for up to 5 days with IL-4 (200IU/ml) and anti-CD40 (1μg/ml). Cells were harvested at the times indicated and qPCR was performed to quantify mRNA expression levels for (A) CD23 and (B) GAPDH. Expression levels were calculated by ΔΔCt analysis, normalized against the endogenous reference gene β 2 -microglobulin and expressed relative to control siRNA-transfected cells at each timepoint (n=11).

    Article Snippet: GAPDH: Hs02786624_g1; β2microglobulin: 4310886E; CD23: Hs00233627_m1; εGLT: Forward 5′ CTGTCCAGGAACCCGACAGA 3′, Reverse 5′ TGCAGCAGCGGGTCAAG 3′ with MGB probe 6FAM-AG GCACCAAATG-MGB.

    Techniques: Inhibition, Expressing, Transfection, Cell Culture, Real-time Polymerase Chain Reaction

    SPOP knockdown, through siRNA-SPOP (siSPOP) or miR-145 transfection, enhances cell response to radiation. ( A ) qRT-PCR detection of SPOP transcript levels in DU145 (upper panel) or PC-3 (lower panel) at 48 h upon transfection with siSPOP, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of SPOP protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as endogenous control. ( C ) Cell proliferation curves of siNeg and siSPOP at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values ( n = 3). ( D ) Clonogenic cell survival of DU145 and PC-3 cells upon transfection with siNeg or siSPOP. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as the dose (Gy) for the radiation plus siSPOP divided by the dose (Gy) for radiation plus siNeg at a surviving fraction of 0.1. ( E ) qRT-PCR detection of SPOP transcript levels in DU145 cells at 48 h upon transfection with miR-145, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to Neg cells. ( F ) Western blot analysis and relative quantification of SPOP protein levels in DU145 cells at 48 h upon miR-145 transfection. Vinculin was used as control. ( G ) Cell proliferation curves of Neg and miR-145 at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values from three independent experiments. ( H ) Clonogenic cell survival of Neg or miR-145-transfected DU145 cells. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as described above. The level of significance was represented as * p

    Journal: Cancers

    Article Title: SPOP Deregulation Improves the Radiation Response of Prostate Cancer Models by Impairing DNA Damage Repair

    doi: 10.3390/cancers12061462

    Figure Lengend Snippet: SPOP knockdown, through siRNA-SPOP (siSPOP) or miR-145 transfection, enhances cell response to radiation. ( A ) qRT-PCR detection of SPOP transcript levels in DU145 (upper panel) or PC-3 (lower panel) at 48 h upon transfection with siSPOP, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of SPOP protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as endogenous control. ( C ) Cell proliferation curves of siNeg and siSPOP at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values ( n = 3). ( D ) Clonogenic cell survival of DU145 and PC-3 cells upon transfection with siNeg or siSPOP. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as the dose (Gy) for the radiation plus siSPOP divided by the dose (Gy) for radiation plus siNeg at a surviving fraction of 0.1. ( E ) qRT-PCR detection of SPOP transcript levels in DU145 cells at 48 h upon transfection with miR-145, compared to control cells, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to Neg cells. ( F ) Western blot analysis and relative quantification of SPOP protein levels in DU145 cells at 48 h upon miR-145 transfection. Vinculin was used as control. ( G ) Cell proliferation curves of Neg and miR-145 at 24, 48, 72 and 96 h upon transfection. Data are indicated as number of cells ×10 3 and are reported as mean ± SD values from three independent experiments. ( H ) Clonogenic cell survival of Neg or miR-145-transfected DU145 cells. The surviving fractions are reported as mean ± SD values from three independent experiments. The dose enhancement ratio (DER) was calculated as described above. The level of significance was represented as * p

    Article Snippet: For comparative analyses, GAPDH (TaqMan Gene Expression Assay, Hs02786624_g1) and SNORD (TaqMan non coding RNA assay, Hs04931161_g1) were used as endogenous controls for genes and miRNA, respectively.

    Techniques: Transfection, Quantitative RT-PCR, Western Blot

    SPOP knockdown impairs HR via RAD51 and CHK1 downregulation. ( A ) qRT-PCR detection of RAD51 and CHEK1 transcript levels in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon siSPOP transfection, compared to controls, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of RAD51 and CHK1 protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as equal protein loading control. ( C ) Representative immunofluorescence microphotographs of nuclear RAD51 foci (cell nuclei: blue; RAD51 foci: green) in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon transfection with siSPOP at 0, 0.5 and 6 h after exposure to 6 Gy irradiation and relative quantification, expressed as mean percentage of cells containing > 10 RAD51 foci at 0, 0.5 and 6 h after exposure to 6 Gy irradiation. Data are reported as mean ± SD values from three independent experiments. The level of significance was represented as ** p

    Journal: Cancers

    Article Title: SPOP Deregulation Improves the Radiation Response of Prostate Cancer Models by Impairing DNA Damage Repair

    doi: 10.3390/cancers12061462

    Figure Lengend Snippet: SPOP knockdown impairs HR via RAD51 and CHK1 downregulation. ( A ) qRT-PCR detection of RAD51 and CHEK1 transcript levels in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon siSPOP transfection, compared to controls, normalized to GAPDH. Data are reported as relative quantity (RQ) ± SD with respect to siNeg transfectants. ( B ) Western blot analysis and relative quantification of RAD51 and CHK1 protein levels in DU145 and PC-3 cells at 48 h upon siSPOP transfection. Vinculin was used as equal protein loading control. ( C ) Representative immunofluorescence microphotographs of nuclear RAD51 foci (cell nuclei: blue; RAD51 foci: green) in DU145 (upper panel) or PC-3 (lower panel) cells at 48 h upon transfection with siSPOP at 0, 0.5 and 6 h after exposure to 6 Gy irradiation and relative quantification, expressed as mean percentage of cells containing > 10 RAD51 foci at 0, 0.5 and 6 h after exposure to 6 Gy irradiation. Data are reported as mean ± SD values from three independent experiments. The level of significance was represented as ** p

    Article Snippet: For comparative analyses, GAPDH (TaqMan Gene Expression Assay, Hs02786624_g1) and SNORD (TaqMan non coding RNA assay, Hs04931161_g1) were used as endogenous controls for genes and miRNA, respectively.

    Techniques: Quantitative RT-PCR, Transfection, Western Blot, Immunofluorescence, Irradiation