gene exp gapdh hs02786624 g1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher gene exp gapdh hs02786624 g1
    DI-591 selectively and rapidly inhibits neddylation of cullin 3. a Western blotting of neddylated and un-neddylated cullin family members and several representative well-known substrates of cullin CRLs in KYSE70 esophageal cancer cells and THLE2 immortalized liver cells. Cells were treated with DCN1 inhibitor DI-591 or NAE E1 inhibitor MLN4924 at indicated concentrations, or DI-591DD at 10 µM for 24 h. Protein levels of neddylated and un-neddylated cullin family members and several known substrates of cullin CRLs were examined by western blotting analysis. <t>GAPDH</t> was used as a loading control. b Inhibition kinetics of neddylation of cullin 1 and 3 by DI-591 and MLN4924 in THLE2 liver cells. Cells were treated with DI-591 at 10 µM or MLN4924 at 0.3 µM at indicated time points. Protein levels of neddylated and un-neddylated cullin 1 and 3 were examined by western blotting analysis. GAPDH was used as a loading control. c qRT-PCR analysis of mRNA levels of NRF2 and NRF2-reguated genes in THLE2 cells. Cells were treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for indicated time points. The relative mRNA levels of NRF2, NQO1 and HO-1 were examined by quantitative real-time RT-PCR assay. GAPDH was used as an internal control. The averages and standard deviations for each column were calculated from total nine samples obtained from three independent experiments (each experiment with triplicates). P -value from t-test: * P
    Gene Exp Gapdh Hs02786624 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02786624 g1/product/Thermo Fisher
    Average 99 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02786624 g1 - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "A potent small-molecule inhibitor of the DCN1-UBC12 interaction that selectively blocks cullin 3 neddylation"

    Article Title: A potent small-molecule inhibitor of the DCN1-UBC12 interaction that selectively blocks cullin 3 neddylation

    Journal: Nature Communications

    doi: 10.1038/s41467-017-01243-7

    DI-591 selectively and rapidly inhibits neddylation of cullin 3. a Western blotting of neddylated and un-neddylated cullin family members and several representative well-known substrates of cullin CRLs in KYSE70 esophageal cancer cells and THLE2 immortalized liver cells. Cells were treated with DCN1 inhibitor DI-591 or NAE E1 inhibitor MLN4924 at indicated concentrations, or DI-591DD at 10 µM for 24 h. Protein levels of neddylated and un-neddylated cullin family members and several known substrates of cullin CRLs were examined by western blotting analysis. GAPDH was used as a loading control. b Inhibition kinetics of neddylation of cullin 1 and 3 by DI-591 and MLN4924 in THLE2 liver cells. Cells were treated with DI-591 at 10 µM or MLN4924 at 0.3 µM at indicated time points. Protein levels of neddylated and un-neddylated cullin 1 and 3 were examined by western blotting analysis. GAPDH was used as a loading control. c qRT-PCR analysis of mRNA levels of NRF2 and NRF2-reguated genes in THLE2 cells. Cells were treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for indicated time points. The relative mRNA levels of NRF2, NQO1 and HO-1 were examined by quantitative real-time RT-PCR assay. GAPDH was used as an internal control. The averages and standard deviations for each column were calculated from total nine samples obtained from three independent experiments (each experiment with triplicates). P -value from t-test: * P
    Figure Legend Snippet: DI-591 selectively and rapidly inhibits neddylation of cullin 3. a Western blotting of neddylated and un-neddylated cullin family members and several representative well-known substrates of cullin CRLs in KYSE70 esophageal cancer cells and THLE2 immortalized liver cells. Cells were treated with DCN1 inhibitor DI-591 or NAE E1 inhibitor MLN4924 at indicated concentrations, or DI-591DD at 10 µM for 24 h. Protein levels of neddylated and un-neddylated cullin family members and several known substrates of cullin CRLs were examined by western blotting analysis. GAPDH was used as a loading control. b Inhibition kinetics of neddylation of cullin 1 and 3 by DI-591 and MLN4924 in THLE2 liver cells. Cells were treated with DI-591 at 10 µM or MLN4924 at 0.3 µM at indicated time points. Protein levels of neddylated and un-neddylated cullin 1 and 3 were examined by western blotting analysis. GAPDH was used as a loading control. c qRT-PCR analysis of mRNA levels of NRF2 and NRF2-reguated genes in THLE2 cells. Cells were treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for indicated time points. The relative mRNA levels of NRF2, NQO1 and HO-1 were examined by quantitative real-time RT-PCR assay. GAPDH was used as an internal control. The averages and standard deviations for each column were calculated from total nine samples obtained from three independent experiments (each experiment with triplicates). P -value from t-test: * P

    Techniques Used: Western Blot, Inhibition, Quantitative RT-PCR

    Cellular engagement of DCN proteins by DI-591. a Chemical structure of biotinylated compound 47 and its binding affinities to DCN1-5 proteins. b Pull-down of DCN1 and DCN2 protein by compound 47 and competition by DI-591 in KYSE70 cell lysates. Protein levels of DCN1, DCN2, cullin 1 and cullin 3 pulled down from KYSE70 cell lysates with 47 alone or in combination with DI-591 or DI-591DD were examined by western blotting analysis and specific antibodies. c Enhancement of thermal stability of DCN1 protein by DI-591 but not by DI-591DD in KYSE70 cells. Protein levels of DCN1 in KYSE70 cells treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperatures for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. d Enhancement of thermal stability of DCN1 and DCN2 proteins by DI-591 but not by DI-591DD treatment in KYSE70 cells. Protein levels of DCN1 and DCN2 in KYSE70 cells treated with DI-591 and DI-591DD at the indicated concentrations for 1 h and then heated at 53 °C (DCN1) and 45 °C (DCN2) for 3 min were analyzed by western blot. GAPDH was used as a loading control. e Enhancement of thermal stability of DCN2 by DI-591 but not DI-591DD in KYSE70 cells. Protein levels of DCN2 in KYSE70 cells treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperature for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. f Blockage of the association of DCN1 and UBC12 in cells by DI-591 but not by DI-591DD. KYSE70 cells were treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h. The basal protein levels of DCN1 and UBC12 in the cell lysates were examined by western blotting analysis. Protein levels of DCN1 and UBC12 in the cell lysates pulled down by an UBC12 antibody were examined by western blotting analysis
    Figure Legend Snippet: Cellular engagement of DCN proteins by DI-591. a Chemical structure of biotinylated compound 47 and its binding affinities to DCN1-5 proteins. b Pull-down of DCN1 and DCN2 protein by compound 47 and competition by DI-591 in KYSE70 cell lysates. Protein levels of DCN1, DCN2, cullin 1 and cullin 3 pulled down from KYSE70 cell lysates with 47 alone or in combination with DI-591 or DI-591DD were examined by western blotting analysis and specific antibodies. c Enhancement of thermal stability of DCN1 protein by DI-591 but not by DI-591DD in KYSE70 cells. Protein levels of DCN1 in KYSE70 cells treated with DI-591 at 10 µM, DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperatures for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. d Enhancement of thermal stability of DCN1 and DCN2 proteins by DI-591 but not by DI-591DD treatment in KYSE70 cells. Protein levels of DCN1 and DCN2 in KYSE70 cells treated with DI-591 and DI-591DD at the indicated concentrations for 1 h and then heated at 53 °C (DCN1) and 45 °C (DCN2) for 3 min were analyzed by western blot. GAPDH was used as a loading control. e Enhancement of thermal stability of DCN2 by DI-591 but not DI-591DD in KYSE70 cells. Protein levels of DCN2 in KYSE70 cells treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h, followed by heating at different temperature for 3 min were examined by western blotting analysis. GAPDH was used as a loading control. f Blockage of the association of DCN1 and UBC12 in cells by DI-591 but not by DI-591DD. KYSE70 cells were treated with DI-591 at 10 µM or DI-591DD at 10 µM or DMSO for 1 h. The basal protein levels of DCN1 and UBC12 in the cell lysates were examined by western blotting analysis. Protein levels of DCN1 and UBC12 in the cell lysates pulled down by an UBC12 antibody were examined by western blotting analysis

    Techniques Used: Binding Assay, Western Blot

    2) Product Images from "Characterization of TRKA signaling in acute myeloid leukemia"

    Article Title: Characterization of TRKA signaling in acute myeloid leukemia

    Journal: Oncotarget

    doi: 10.18632/oncotarget.25723

    TRKA is not essential for the growth or survival of AML cell lines in vitro CMK, K562, and TF-1 cells were stably transfected with shRNA against TRKA or a scrambled control (ctrl) and monitored for changes in growth and viability. (A) qRT-PCR analysis of the NTRK1 mRNA levels in the transduced cell lines 7 days after transduction. Values were normalized to GAPDH and results are displayed as the mean mRNA (+s.d.) relative to the cells transfected with the control vector. There is a consistent knockdown of approximately 70% at the mRNA level across the 3 lines. (B) Western blot of total TRKA protein 7 days after transduction with either a nontargeting or TRKA shRNA. (C) 48 hours after transduction, cells were plated at a density of 5×10 4 cells/mL and cultured for 5 days. Cell growth and viability were stained with Trypan Blue and assessed using the ViCell. (D) Apoptosis was tracked in both control and knockdown cells using Annexin V staining via flow cytometry.
    Figure Legend Snippet: TRKA is not essential for the growth or survival of AML cell lines in vitro CMK, K562, and TF-1 cells were stably transfected with shRNA against TRKA or a scrambled control (ctrl) and monitored for changes in growth and viability. (A) qRT-PCR analysis of the NTRK1 mRNA levels in the transduced cell lines 7 days after transduction. Values were normalized to GAPDH and results are displayed as the mean mRNA (+s.d.) relative to the cells transfected with the control vector. There is a consistent knockdown of approximately 70% at the mRNA level across the 3 lines. (B) Western blot of total TRKA protein 7 days after transduction with either a nontargeting or TRKA shRNA. (C) 48 hours after transduction, cells were plated at a density of 5×10 4 cells/mL and cultured for 5 days. Cell growth and viability were stained with Trypan Blue and assessed using the ViCell. (D) Apoptosis was tracked in both control and knockdown cells using Annexin V staining via flow cytometry.

    Techniques Used: In Vitro, Stable Transfection, Transfection, shRNA, Quantitative RT-PCR, Transduction, Plasmid Preparation, Western Blot, Cell Culture, Staining, Flow Cytometry, Cytometry

    Normal and leukemic human myeloid cells express NTRK1 mRNA (A) NTRK1 mRNA expression in the context of the myeloid compartment extracted from the Novershtern et al gene expression dataset [ 24 ]. Each block represents the average of approximately 6 cell cultures. Cell populations are described in the original manuscript. (B) Expression levels of NTRK1 mRNA from normal CD34+ bone marrow cells (gray) and blasts from AML patient samples (red) profiled by the Microarray Initiative in Leukemia Expression (MILE) study. (C) Expression of NTRK1 from the MILE database further stratified by AML subtype. The highest levels of expression are observed in in t(8;21) and inv(16)/t(16;16) translocated tumors. (D) NTRK1 mRNA collected as part of Bourquin et al microarray gene expression study where M4/M5 leukemia was used as a reference for AMKL in both normal and Down syndrome individuals. (E) Quantitative RT-PCR (qRT-PCR) analysis of NTRK1 mRNA expression of a panel of 12 AML cell lines representing a variety of AML subsets. Results are represented as a relative fold-change after normalizing with GAPDH mRNA. Each value corresponds to the mean ± SEM of three independent experiments. TRKA mRNA is detectable in 92% (11/12) of cell lines with a range of expression approximately 15-fold. HSC= hematopoietic stem cell, CMP= common myeloid progenitor, MEP= megakaryocytic erythroid progenitor, GMP= granulocytic myeloid progenitor. AMKL=acute megakaryoblastic leukemia, DS= Down syndrome.
    Figure Legend Snippet: Normal and leukemic human myeloid cells express NTRK1 mRNA (A) NTRK1 mRNA expression in the context of the myeloid compartment extracted from the Novershtern et al gene expression dataset [ 24 ]. Each block represents the average of approximately 6 cell cultures. Cell populations are described in the original manuscript. (B) Expression levels of NTRK1 mRNA from normal CD34+ bone marrow cells (gray) and blasts from AML patient samples (red) profiled by the Microarray Initiative in Leukemia Expression (MILE) study. (C) Expression of NTRK1 from the MILE database further stratified by AML subtype. The highest levels of expression are observed in in t(8;21) and inv(16)/t(16;16) translocated tumors. (D) NTRK1 mRNA collected as part of Bourquin et al microarray gene expression study where M4/M5 leukemia was used as a reference for AMKL in both normal and Down syndrome individuals. (E) Quantitative RT-PCR (qRT-PCR) analysis of NTRK1 mRNA expression of a panel of 12 AML cell lines representing a variety of AML subsets. Results are represented as a relative fold-change after normalizing with GAPDH mRNA. Each value corresponds to the mean ± SEM of three independent experiments. TRKA mRNA is detectable in 92% (11/12) of cell lines with a range of expression approximately 15-fold. HSC= hematopoietic stem cell, CMP= common myeloid progenitor, MEP= megakaryocytic erythroid progenitor, GMP= granulocytic myeloid progenitor. AMKL=acute megakaryoblastic leukemia, DS= Down syndrome.

    Techniques Used: Expressing, Blocking Assay, Microarray, Quantitative RT-PCR

    3) Product Images from "Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract"

    Article Title: Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20632-6

    Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p
    Figure Legend Snippet: Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p

    Techniques Used: Cell Culture, Concentration Assay, Expressing

    Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p
    Figure Legend Snippet: Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p

    Techniques Used: Activity Assay, Incubation, Transfection

    LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).
    Figure Legend Snippet: LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction

    Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p
    Figure Legend Snippet: Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p

    Techniques Used: Incubation, Concentration Assay, Expressing

    4) Product Images from "Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract"

    Article Title: Oral delivery of siRNA lipid nanoparticles: Fate in the GI tract

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20632-6

    Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p
    Figure Legend Snippet: Mucin inhibits LNP-mediated gene silencing. Caco-2 cells were cultured with mucin, and LNPs were pipetted on top of the mucin layer. ( a ) Mucin inhibited LNP-mediated gene silencing (siGAPDH dose = 100 nM) as a function of concentration. Each data point was normalized to GAPDH expression for control wells receiving mucin only. A one-way ANOVA was performed. ****p

    Techniques Used: Cell Culture, Concentration Assay, Expressing

    Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p
    Figure Legend Snippet: Simulated digestion media inhibits LNP delivery activity. ( a ) At a dose of 10 nM, LNPs loaded with siRNA against GAPDH induced ~70% GAPDH knockdown (blue bar). Efficacy was completely inhibited when LNPs were incubated in digestion media prior to transfection (red bar). ( b ) The z-average diameter and ( c ) PDI of LNPs increased after incubation in digestion media. **p = 0.0045 and ****p

    Techniques Used: Activity Assay, Incubation, Transfection

    LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).
    Figure Legend Snippet: LNPs did not significantly silence GAPDH in the mouse colon. Mice received either an oral gavage or rectal administration of LNPs at an siGAPDH dose of 5 mg/kg. Mice were sacrificed 24 hours later. The colons were first washed with PBS and the intestinal mucosa was scraped off in the rectal area for mRNA extraction and qPCR. (n = 3).

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction

    Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p
    Figure Legend Snippet: Pepsin and bile salts inhibit gene silencing in a dose-dependent manner. After formulation, LNPs were diluted in pepsin or bile salt solutions and then incubated at 37 °C for 30 minutes. ( a ) LNPs silenced GAPDH less effectively (siRNA dose = 10 nM) with increasing pepsin concentration. Pepsin alone did not affect GAPDH expression (gray bar). A one-way ANOVA indicated significance. ****p

    Techniques Used: Incubation, Concentration Assay, Expressing

    5) Product Images from "NOP53 as A Candidate Modifier Locus for Familial Non-Medullary Thyroid Cancer"

    Article Title: NOP53 as A Candidate Modifier Locus for Familial Non-Medullary Thyroid Cancer

    Journal: Genes

    doi: 10.3390/genes10110899

    Effects of stable overexpression of NOP53 in three cell lines (TPC1, FTC133, BCPAP): ( a ) Validation of stable overexpression of wild type (WT) and D31H mutant NOP53 in three cell lines by qPCR; ( b ) Validation by Western blot. The lower band corresponds to the endogenous protein expression, whereas the upper band represents the exogenous overexpressed protein. The total protein lysates used were 25 µg for TPC1 cell line, and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell proliferation in thyroid cancer cell lines compared to the vector control; ( d ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell clonogenicity in thyroid cancer cell lines compared to the vector control. * indicates adjusted p value
    Figure Legend Snippet: Effects of stable overexpression of NOP53 in three cell lines (TPC1, FTC133, BCPAP): ( a ) Validation of stable overexpression of wild type (WT) and D31H mutant NOP53 in three cell lines by qPCR; ( b ) Validation by Western blot. The lower band corresponds to the endogenous protein expression, whereas the upper band represents the exogenous overexpressed protein. The total protein lysates used were 25 µg for TPC1 cell line, and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell proliferation in thyroid cancer cell lines compared to the vector control; ( d ) Overexpression of WT and D31H mutant NOP53 significantly increased the cell clonogenicity in thyroid cancer cell lines compared to the vector control. * indicates adjusted p value

    Techniques Used: Over Expression, Mutagenesis, Real-time Polymerase Chain Reaction, Western Blot, Expressing, Plasmid Preparation

    Knockdown of wild-type NOP53 reduces cell proliferation and clonogenicity: ( a ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 gene expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using qPCR; ( b ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 protein expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using Western blots. The total protein lysates used were 25 µg for TPC1 cell line; and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell proliferation compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 ; ( d ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell clonogenicity compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 . * indicates adjusted p value
    Figure Legend Snippet: Knockdown of wild-type NOP53 reduces cell proliferation and clonogenicity: ( a ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 gene expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using qPCR; ( b ) Validation of two different siRNAs (si#1 and si#2) targeting NOP53 protein expression in three different thyroid cancer cell lines (TPC1, FTC133 and BCPAP) using Western blots. The total protein lysates used were 25 µg for TPC1 cell line; and 30 µg for FTC133 and BCPAP cell lines. GAPDH and β-actin were used as an internal and loading control for qPCR and Western blot, respectively; ( c ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell proliferation compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 ; ( d ) Transient knockdown of NOP53 in three different cell lines with two siRNAs significantly reduced cell clonogenicity compared to negative control (scrambled), suggesting a proto-oncogenic function of NOP53 . * indicates adjusted p value

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Negative Control

    6) Product Images from "Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i"

    Article Title: Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.1102689

    siRNA-induced inhibition of CD23 mRNA expression Human tonsillar B cells were transfected with either control siRNA (■) or CD23 siRNA (□) and cultured for up to 5 days with IL-4 (200IU/ml) and anti-CD40 (1μg/ml). Cells were harvested at the times indicated and qPCR was performed to quantify mRNA expression levels for (A) CD23 and (B) GAPDH. Expression levels were calculated by ΔΔCt analysis, normalized against the endogenous reference gene β 2 -microglobulin and expressed relative to control siRNA-transfected cells at each timepoint (n=11).
    Figure Legend Snippet: siRNA-induced inhibition of CD23 mRNA expression Human tonsillar B cells were transfected with either control siRNA (■) or CD23 siRNA (□) and cultured for up to 5 days with IL-4 (200IU/ml) and anti-CD40 (1μg/ml). Cells were harvested at the times indicated and qPCR was performed to quantify mRNA expression levels for (A) CD23 and (B) GAPDH. Expression levels were calculated by ΔΔCt analysis, normalized against the endogenous reference gene β 2 -microglobulin and expressed relative to control siRNA-transfected cells at each timepoint (n=11).

    Techniques Used: Inhibition, Expressing, Transfection, Cell Culture, Real-time Polymerase Chain Reaction

    7) Product Images from "MicroRNAs modulate the noncanonical NF-?B pathway by regulating IKK? expression during macrophage differentiation"

    Article Title: MicroRNAs modulate the noncanonical NF-?B pathway by regulating IKK? expression during macrophage differentiation

    Journal: Nature immunology

    doi: 10.1038/ni.1918

    IKKα-targeting miRNAs affects noncanonical and canonical NF-κ.B gene expression (a) Real time PCR analysis of ELC mRNA in monocytes and macrophages, normalized to GAPDH, data representative of at least three independent experiments. Error bars, +/−standard deviation of the mean. (b) Anti-RelB immunoblots of lysates from macrophages (MΦ) treated with LPS for indicated time course (in hours). (c). Real time PCR analysis of ELC mRNA in monocytes, macrophages, or LPS-treated macrophages, normalized to GAPDH. Data representative of at least three independent experiments. Error bars, +/−standard deviation of the mean. (d)(e)(f), Macrophages (MΦ) were transfected with miRNA mimics or control mimic and 24 hours after transfection, cells were or were not challenged with LPS (1μg/ml) for another 24 hours. (d) Immunoblot showing IKKα protein level in corresponding protein samples for (e, f). (e) ELC and (f) A20 mRNA expression as measured by real time PCR, normalized to GAPDH mRNA. The relative fold increase in LPS treated cells compared to untreated cells is shown for (e) and (f) . Error bars, +/− range based on standard deviation of the mean. Data representative of at least three independent experiments. TRADD and β-actin blots indicate loading of lanes, (b, d).
    Figure Legend Snippet: IKKα-targeting miRNAs affects noncanonical and canonical NF-κ.B gene expression (a) Real time PCR analysis of ELC mRNA in monocytes and macrophages, normalized to GAPDH, data representative of at least three independent experiments. Error bars, +/−standard deviation of the mean. (b) Anti-RelB immunoblots of lysates from macrophages (MΦ) treated with LPS for indicated time course (in hours). (c). Real time PCR analysis of ELC mRNA in monocytes, macrophages, or LPS-treated macrophages, normalized to GAPDH. Data representative of at least three independent experiments. Error bars, +/−standard deviation of the mean. (d)(e)(f), Macrophages (MΦ) were transfected with miRNA mimics or control mimic and 24 hours after transfection, cells were or were not challenged with LPS (1μg/ml) for another 24 hours. (d) Immunoblot showing IKKα protein level in corresponding protein samples for (e, f). (e) ELC and (f) A20 mRNA expression as measured by real time PCR, normalized to GAPDH mRNA. The relative fold increase in LPS treated cells compared to untreated cells is shown for (e) and (f) . Error bars, +/− range based on standard deviation of the mean. Data representative of at least three independent experiments. TRADD and β-actin blots indicate loading of lanes, (b, d).

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Western Blot, Transfection

    MicroRNAs mimics reduce IKKα mRNA stability mRNA and protein was isolated from HeLa cells (a) or macrophages (MΦ), (b) transfected with control mimic or pooled miRNA mimics. IKKα mRNA was measured by real time PCR (left) and protein level of IKKα was analyzed by immunoblot (right). mRNA levels were normalized to GAPDH mRNA. Data representative of at least 5 independent experiments. Error bars, +/−standard error of the mean. TRADD and β-actin immunoblots indicate loading of lanes.
    Figure Legend Snippet: MicroRNAs mimics reduce IKKα mRNA stability mRNA and protein was isolated from HeLa cells (a) or macrophages (MΦ), (b) transfected with control mimic or pooled miRNA mimics. IKKα mRNA was measured by real time PCR (left) and protein level of IKKα was analyzed by immunoblot (right). mRNA levels were normalized to GAPDH mRNA. Data representative of at least 5 independent experiments. Error bars, +/−standard error of the mean. TRADD and β-actin immunoblots indicate loading of lanes.

    Techniques Used: Isolation, Transfection, Real-time Polymerase Chain Reaction, Western Blot

    IKKα is upregulated during monocyte differentiation (a) Immunoblot analysis of IKKα in U937 vs. PMA-differentiated U937 cells. (b) Immunoblot analysis of IKKα IKKβ and IKKγ in monocytes (Mo) vs. macrophages (MΦ). TRADD and β-Actin blots indicate loading of lanes (a, b). (c) Semi-quantitative RT-PCR analysis the IKKα mRNA level of monocytes cultured with rhGM-CSF for different days as indicated, GAPDH mRNA as control in this assay. (d) Quantitative Real time PCR analysis of IKKα mRNA in monocytes (Mo) vs. macrophages (MΦ), the relative IKKα level was normalized to GAPDH. Error bars, +/− standard deviation from the mean.
    Figure Legend Snippet: IKKα is upregulated during monocyte differentiation (a) Immunoblot analysis of IKKα in U937 vs. PMA-differentiated U937 cells. (b) Immunoblot analysis of IKKα IKKβ and IKKγ in monocytes (Mo) vs. macrophages (MΦ). TRADD and β-Actin blots indicate loading of lanes (a, b). (c) Semi-quantitative RT-PCR analysis the IKKα mRNA level of monocytes cultured with rhGM-CSF for different days as indicated, GAPDH mRNA as control in this assay. (d) Quantitative Real time PCR analysis of IKKα mRNA in monocytes (Mo) vs. macrophages (MΦ), the relative IKKα level was normalized to GAPDH. Error bars, +/− standard deviation from the mean.

    Techniques Used: Quantitative RT-PCR, Cell Culture, Real-time Polymerase Chain Reaction, Standard Deviation

    8) Product Images from "Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling"

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    Journal: Clinical and Molecular Hepatology

    doi: 10.3350/cmh.2017.0074

    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P
    Figure Legend Snippet: Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P

    Techniques Used: Isolation, Infection, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P
    Figure Legend Snippet: STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P

    Techniques Used: Infection, Isolation, Real-time Polymerase Chain Reaction, Expressing

    Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.
    Figure Legend Snippet: Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.

    Techniques Used: Expressing, Isolation, Infection, Real-time Polymerase Chain Reaction

    9) Product Images from "Anti-metastatic and anti-proliferative activity of eugenol against triple negative and HER2 positive breast cancer cells"

    Article Title: Anti-metastatic and anti-proliferative activity of eugenol against triple negative and HER2 positive breast cancer cells

    Journal: BMC Complementary and Alternative Medicine

    doi: 10.1186/s12906-018-2392-5

    Effect of eugenol treatment on the expression levels of caspases in MDA-MB-231 and SK-BR-3 cell lines. MDA-MB-231 and SK-BR-3 cells were treated for 48 h with eugenol (4 and 8 μM, and 5 and 10 μM, respectively). The mRNA levels of caspase-3 ( a ), caspase-7 ( c ), and caspase-9 ( e ) genes were quantified by RT-PCR and normalized to GAPDH . Protein expression levels of total and cleaved caspase-3 ( b ), cleaved caspase-7 ( d ) and total and cleaved caspase-9 ( f ) were determined by western blotting. Data are presented as mean ± SD ( n = 3). * and # indicate a significant change from untreated, 4, and 5 μM eugenol respectively, at p
    Figure Legend Snippet: Effect of eugenol treatment on the expression levels of caspases in MDA-MB-231 and SK-BR-3 cell lines. MDA-MB-231 and SK-BR-3 cells were treated for 48 h with eugenol (4 and 8 μM, and 5 and 10 μM, respectively). The mRNA levels of caspase-3 ( a ), caspase-7 ( c ), and caspase-9 ( e ) genes were quantified by RT-PCR and normalized to GAPDH . Protein expression levels of total and cleaved caspase-3 ( b ), cleaved caspase-7 ( d ) and total and cleaved caspase-9 ( f ) were determined by western blotting. Data are presented as mean ± SD ( n = 3). * and # indicate a significant change from untreated, 4, and 5 μM eugenol respectively, at p

    Techniques Used: Expressing, Multiple Displacement Amplification, Reverse Transcription Polymerase Chain Reaction, Western Blot

    10) Product Images from "Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling"

    Article Title: Interferon-free treatment for hepatitis C virus infection induces normalization of extrahepatic type I interferon signaling

    Journal: Clinical and Molecular Hepatology

    doi: 10.3350/cmh.2017.0074

    STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P
    Figure Legend Snippet: STAT1 phosphorylation decreased in the peripheral blood mononuclear cells (PBMCs) of HCV-infected patients after direct-acting antiviral (DAA) treatment. (A, C) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. Immunoblotting was performed to detect the protein levels of STAT1, PY-STAT1, and GAPDH. (B) PBMCs from HCV-infected patients were isolated before DAA treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed to identify the associations between expression levels of IFI44/CXCL10 and relative band intensity of PY-STAT1. STAT1, signal transducer and activator of transcription 1; HCV, hepatitis C virus; PY-STAT1, tyrosine-phosphorylated STAT1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10. * P

    Techniques Used: Infection, Isolation, Real-time Polymerase Chain Reaction, Expressing

    Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P
    Figure Legend Snippet: Direct-acting antiviral (DAA)-induced downregulation of endogenous IFN-β response in peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A, B) PBMCs from HCV-infected patients were isolated before DAA (pre DAA) and at the end of DAA (post DAA) treatment. TaqMan real-time quantitative polymerase chain reaction (PCR) was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. (C, D) Serum and PBMC from two HCV-infected patients were isolated before and at the end of DAA treatment. TaqMan real-time quantitative PCR was performed to detect viral RNA level of HCV in the sera and mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH in the PBMCs. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFN, interferon; IFI44, interferon-induced protein 44; CXCL10, C-X-C motif chemokine ligand 10; HCV, hepatitis C virus; wks, weeks; Pt, patient. * P

    Techniques Used: Isolation, Infection, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.
    Figure Legend Snippet: Pretreatment IFN-β expression correlates with the expression of IFI44 and CXCL10 in the peripheral blood mononuclear cells (PBMCs) isolated from HCV-infected patients. (A-D) PBMCs from HCV-infected patients were isolated before direct-acting antiviral treatment. TaqMan real-time quantitative polymerase chain reaction was performed to detect mRNA levels of IFN-β, IFI44, CXCL10, and GAPDH. Pearson's correlation analysis was performed. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IFI44, interferon-induced protein 44; IFN, interferon; CXCL10, C-X-C motif chemokine ligand 10; n.s ., not significant; HCV, hepatitis C virus; ALT, alanine aminotransferase.

    Techniques Used: Expressing, Isolation, Infection, Real-time Polymerase Chain Reaction

    11) Product Images from "Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution"

    Article Title: Modulation of LIN28B/Let-7 signaling by propranolol contributes to infantile hemangioma involution

    Journal: Arteriosclerosis, thrombosis, and vascular biology

    doi: 10.1161/ATVBAHA.118.310908

    Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p
    Figure Legend Snippet: Propranolol decreases the expression of LIN28B in IH treated patients and iPSCs (A) Representative immunostaining for LIN28B and GLUT1 of proliferative IH (n=4) and propranolol treated proliferating IH (n=4) samples. Nuclei were counterstained with DAPI. No positive staining was observed in the negative control sections (Alexa Fluor 488 or Cy3). Scale bars: 50 μm; original magnification, ×60 and ×120 (insets). (B) Quantification of LIN28B/GLUT1 fluorescence signal ratio in proliferative and propranolol-treated samples. (C) qRT-PCR analysis of LIN28B expression normalized to GAPDH in IH, iPSC, HemSC (line H42, from 3 independent passages), HUVEC and BeWo cells compared to NS. (D and E) Representative immunoblot for LIN28B and GAPDH expression in (D) iPSC and HemSC line H42, from 3 independent passages and (E) iPSCs treated with 50uM propranolol or vehicle control for 72 hours accompanied by densitometric quantification of LIN28B normalized to GAPDH. Data represent the mean ± SEM of at least 3 independent experiments. * p

    Techniques Used: Expressing, Immunostaining, Staining, Negative Control, Fluorescence, Quantitative RT-PCR

    LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p
    Figure Legend Snippet: LIN28B increases the expression of miRNAs of the mir-498(46) cistron (A) RT–PCR analysis using P0, P1, P5, P8 and P9 primer sets reveal the presence of transcripts generated upstream of mir-498(46) in IH (n=4) but not in NS. BeWo cells were used as positive control and H2B as reference gene. (B–D) HEK293 cells were transfected with FLAG-LIN28B or GFP control vector for 72 hours followed by (B) qRT-PCR analysis of six randomly selected miRNAs of the mir-498(46) cistron normalized to U18. Insert, representative immunoblot of LIN28B and GAPDH; (C) HPAII sensitivity assay of the mir-498(46) cistron CpG-island promoter region and (D) RT–PCR analysis as described in A. Data represents means ± SEM of 3 independent experiments. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Generated, Positive Control, Transfection, Plasmid Preparation, Quantitative RT-PCR, Sensitive Assay

    12) Product Images from "RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity"

    Article Title: RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-26651-7

    Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p
    Figure Legend Snippet: Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p

    Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Expressing

    13) Product Images from "RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity"

    Article Title: RNA Sequencing Reveals Novel Transcripts from Sympathetic Stellate Ganglia During Cardiac Sympathetic Hyperactivity

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-26651-7

    Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p
    Figure Legend Snippet: Extracellular Ligand-Gated Ion Channel Activity GO Group (GO:0005230). The differentially expressed genes in the MF GO group ‘extracellular ligand-gated ion channel activity’ (GO:0005230) are listed, where green and blue represent up- and downregulated genes respectively ( a ). The presence of these genes was validated using q RT-PCR and the ΔΔCT comparative method was applied for analysis (SHR/Wistar); with β2 microglobulin (B2m) selected as the housekeeping gene for comparison as there was no difference in B2m expression between strains in the RNAseq dataset. Log 2 fold change of the differentially expressed genes in SHR stellates as identified by RNAseq are represented in red ( b ). Log 2 fold change ± SEM of q RT-PCR SHR data are also depicted (blue; b ) relative to Wistar. Significance is indicated above the relevant bars. The RNAseq trends for up- or downregulation of each gene was confirmed with q RT-PCR; however, only Chrnb4 (p

    Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Expressing

    14) Product Images from "Gremlin Regulates Tubular Epithelial to Mesenchymal Transition via VEGFR2: Potential Role in Renal Fibrosis"

    Article Title: Gremlin Regulates Tubular Epithelial to Mesenchymal Transition via VEGFR2: Potential Role in Renal Fibrosis

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.01195

    Gremlin via Notch pathway induces EMT in cultured human tubular epithelial cells. Cells (HK2 cell line) were preincubated with DAPT (30 nM) before stimulation with Gremlin (10 ng/ml). Changes in EMT-related markers were assessed by confocal microscopy (A) or western blot (B) . Please, note that the pictures of e-cadherin, α-sma and their corresponding loading control (GAPDH) are the same images as shown in the Figure 2B but, in this case, Gremlin + DAPT point is included in the fourth lane . Results are expressed as mean ± SEM of five independent experiments. All changes induced by Gremlin were prevented by Notch inhibition. Figure (A) shows a representative experiment out of two performed by confocal microscopy and (B) shows representative images of western blot and quantification. (C) Gene expression levels were evaluated 24 h after Gremlin stimulation. Total cell RNA was isolated to assess mRNA levels by RT-qPCR. Data are expressed as mean ± SEM of six independent experiments. ∗ p
    Figure Legend Snippet: Gremlin via Notch pathway induces EMT in cultured human tubular epithelial cells. Cells (HK2 cell line) were preincubated with DAPT (30 nM) before stimulation with Gremlin (10 ng/ml). Changes in EMT-related markers were assessed by confocal microscopy (A) or western blot (B) . Please, note that the pictures of e-cadherin, α-sma and their corresponding loading control (GAPDH) are the same images as shown in the Figure 2B but, in this case, Gremlin + DAPT point is included in the fourth lane . Results are expressed as mean ± SEM of five independent experiments. All changes induced by Gremlin were prevented by Notch inhibition. Figure (A) shows a representative experiment out of two performed by confocal microscopy and (B) shows representative images of western blot and quantification. (C) Gene expression levels were evaluated 24 h after Gremlin stimulation. Total cell RNA was isolated to assess mRNA levels by RT-qPCR. Data are expressed as mean ± SEM of six independent experiments. ∗ p

    Techniques Used: Cell Culture, Confocal Microscopy, Western Blot, Inhibition, Expressing, Isolation, Quantitative RT-PCR

    15) Product Images from "Impaired Gastric Hormone Regulation of Osteoblasts and Lysyl Oxidase Drives Bone Disease in Diabetes Mellitus"

    Article Title: Impaired Gastric Hormone Regulation of Osteoblasts and Lysyl Oxidase Drives Bone Disease in Diabetes Mellitus

    Journal: JBMR Plus

    doi: 10.1002/jbm4.10212

    LOX paralogs regulation by GIP ( A ) MC3T3‐E1 cells were treated for 24 hours with a range of GIP concentrations followed by RNA isolation and qPCR. Data were calculated using the 2 –(ΔΔCT) method and are provided as fold change relative to GAPDH. Data are means ± SD, * p
    Figure Legend Snippet: LOX paralogs regulation by GIP ( A ) MC3T3‐E1 cells were treated for 24 hours with a range of GIP concentrations followed by RNA isolation and qPCR. Data were calculated using the 2 –(ΔΔCT) method and are provided as fold change relative to GAPDH. Data are means ± SD, * p

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction

    Diabetic primary bone cells. ( A ) LOX is the highest expressed paralog in nondiabetic primary osteoblasts. Absolute quantification of LOX isoforms in nondiabetic primary osteoblasts. Data were calculated based on a standard curve of known transcript copy numbers and normalized to the amount of cDNA added ( n = 5). ( B ) LOX is the most highly inhibited paralog in primary diabetic osteoblasts. Data represent percent of nondiabetic controls calculated using the ΔΔCT method using GAPDH internal control. Data are pooled from three independent experiments (data are means ± SE, * p
    Figure Legend Snippet: Diabetic primary bone cells. ( A ) LOX is the highest expressed paralog in nondiabetic primary osteoblasts. Absolute quantification of LOX isoforms in nondiabetic primary osteoblasts. Data were calculated based on a standard curve of known transcript copy numbers and normalized to the amount of cDNA added ( n = 5). ( B ) LOX is the most highly inhibited paralog in primary diabetic osteoblasts. Data represent percent of nondiabetic controls calculated using the ΔΔCT method using GAPDH internal control. Data are pooled from three independent experiments (data are means ± SE, * p

    Techniques Used:

    ( A ) LOX mRNA regulation by GIP depends on PKA. MC3T3 cells were treated with GIP for 4 hours in the presence and absence of PKA pathway activators and inhibitors, and RNA was analyzed for LOX levels. LOX RNA levels were increased by GIP, which was prevented when cells were treated with the adenylyl cyclase inhibitor SQ22536 or the PKA inhibitor PKI 14‐22. Data were calculated using the 2 –(ΔΔCT) method and are represented as fold change relative to GAPDH. Data are means ± SE, *** p
    Figure Legend Snippet: ( A ) LOX mRNA regulation by GIP depends on PKA. MC3T3 cells were treated with GIP for 4 hours in the presence and absence of PKA pathway activators and inhibitors, and RNA was analyzed for LOX levels. LOX RNA levels were increased by GIP, which was prevented when cells were treated with the adenylyl cyclase inhibitor SQ22536 or the PKA inhibitor PKI 14‐22. Data were calculated using the 2 –(ΔΔCT) method and are represented as fold change relative to GAPDH. Data are means ± SE, *** p

    Techniques Used:

    16) Product Images from "Mannosylerythritol lipids ameliorate ultraviolet A-induced aquaporin-3 downregulation by suppressing c-Jun N-terminal kinase phosphorylation in cultured human keratinocytes"

    Article Title: Mannosylerythritol lipids ameliorate ultraviolet A-induced aquaporin-3 downregulation by suppressing c-Jun N-terminal kinase phosphorylation in cultured human keratinocytes

    Journal: The Korean Journal of Physiology & Pharmacology : Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology

    doi: 10.4196/kjpp.2019.23.2.113

    Involvement of JNK phosphorylation in the UVA-induced downregulation of AQP3. (A) Cells were irradiated with UVA 3 J/cm 2 and harvested at the indicated time points. Protein samples were subjected to Western blotting for phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH. (B) Cells pretreated with 100 nM SP600125 (a JNK inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. (C) The mRNA expression of AQP3 was examined by qRT-PCR. (D) Cells pretreated with 10 µM PD98059 (an ERK inhibitor) or 5 µM SB203580 (a p38 inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. Values represent the mean expression level ± SD (n = 3, * p
    Figure Legend Snippet: Involvement of JNK phosphorylation in the UVA-induced downregulation of AQP3. (A) Cells were irradiated with UVA 3 J/cm 2 and harvested at the indicated time points. Protein samples were subjected to Western blotting for phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH. (B) Cells pretreated with 100 nM SP600125 (a JNK inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. (C) The mRNA expression of AQP3 was examined by qRT-PCR. (D) Cells pretreated with 10 µM PD98059 (an ERK inhibitor) or 5 µM SB203580 (a p38 inhibitor) for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 24 h. The protein level of AQP3 was analyzed by Western blotting and quantified relative to the level of GAPDH using the ImageJ software. Values represent the mean expression level ± SD (n = 3, * p

    Techniques Used: Irradiation, Western Blot, Software, Expressing, Quantitative RT-PCR

    MELs ameliorate the UVA-induced downregulation of AQP3 expression in HaCaT keratinocytes. (A) A structure of MELs. Two fatty acids were attached to −OH groups on mannosylerythritol as an ester bond. The fatty acid contains mainly 6–18 carbon atoms and the major is 8 carbon atoms. (B) HaCaT keratinocytes were treated with the indicated concentrations of MELs for 24 h and cell viability was determined using a CCK-8 kit (Dojindo, Kumamoto, Japan). DMSO was used as the vehicle control. (C) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs for 24 h were subjected to Western blot analysis of AQP3 proteins. (D) The protein levels of AQP3 were quantified relative to that of GAPDH using the Image J software. (E) The mRNA expression of AQP3 was analyzed by qRT-PCR. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p
    Figure Legend Snippet: MELs ameliorate the UVA-induced downregulation of AQP3 expression in HaCaT keratinocytes. (A) A structure of MELs. Two fatty acids were attached to −OH groups on mannosylerythritol as an ester bond. The fatty acid contains mainly 6–18 carbon atoms and the major is 8 carbon atoms. (B) HaCaT keratinocytes were treated with the indicated concentrations of MELs for 24 h and cell viability was determined using a CCK-8 kit (Dojindo, Kumamoto, Japan). DMSO was used as the vehicle control. (C) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs for 24 h were subjected to Western blot analysis of AQP3 proteins. (D) The protein levels of AQP3 were quantified relative to that of GAPDH using the Image J software. (E) The mRNA expression of AQP3 was analyzed by qRT-PCR. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p

    Techniques Used: Expressing, CCK-8 Assay, Western Blot, Software, Quantitative RT-PCR

    AQP3 expression is downregulated by UVA irradiation. (A) HaCaT keratinocytes were irradiated with the indicated doses of UVA or left non-irradiated (control) and harvested after 24 h for Western blot analysis. (B) The protein level of AQP3 was quantified relative to that of GAPDH using the Image J software from National Institutes of Health. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p
    Figure Legend Snippet: AQP3 expression is downregulated by UVA irradiation. (A) HaCaT keratinocytes were irradiated with the indicated doses of UVA or left non-irradiated (control) and harvested after 24 h for Western blot analysis. (B) The protein level of AQP3 was quantified relative to that of GAPDH using the Image J software from National Institutes of Health. The results are presented as the mean expression level obtained from three independent experiments ± SD ( ** p

    Techniques Used: Expressing, Irradiation, Western Blot, Software

    The effects of MELs on JNK phosphorylation and PPAR-γ expression in UVA-irradiated HaCaT keratinocytes. (A) Cells pretreated with the indicated concentrations of MELs for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 15 min. The protein levels of phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH were evaluated by Western blot analysis. (B) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs or a JNK inhibitor for 16 h were prepared for qRT-PCR analysis of PPAR-γ mRNA expression. Values represent the mean expression level obtained from three independent experiments ± SD ( * p
    Figure Legend Snippet: The effects of MELs on JNK phosphorylation and PPAR-γ expression in UVA-irradiated HaCaT keratinocytes. (A) Cells pretreated with the indicated concentrations of MELs for 1 h were irradiated with UVA 3 J/cm 2 and harvested after 15 min. The protein levels of phospho-JNK, total JNK, phospho-ERK, total ERK, phospho-p38, total p38, and GAPDH were evaluated by Western blot analysis. (B) Cells treated with UVA 3 J/cm 2 and the indicated concentrations of MELs or a JNK inhibitor for 16 h were prepared for qRT-PCR analysis of PPAR-γ mRNA expression. Values represent the mean expression level obtained from three independent experiments ± SD ( * p

    Techniques Used: Expressing, Irradiation, Western Blot, Quantitative RT-PCR

    17) Product Images from "Lipid nanoparticle siRNA cocktails for the treatment of mantle cell lymphoma"

    Article Title: Lipid nanoparticle siRNA cocktails for the treatment of mantle cell lymphoma

    Journal: Bioengineering & Translational Medicine

    doi: 10.1002/btm2.10088

    LNPs mediated durable gene silencing in JeKo‐1 cells. (a) Three lipidoid chemistries—303O 13 , 304O 13 , and 306O 13 —were formulated into siRNA‐loaded LNPs. (b) Treatment with each LNP resulted in dose‐dependent silencing of GAPDH in JeKo‐1 mantle cell lymphoma cells 24 hr post‐transfection. PBS and LNPs (siCntrl) at the maximum dose of 100 nM served as negative controls. (c) Following a single dose of 100 nM siGAPDH, 306O 13 LNPs mediated near‐complete GAPDH knockdown for at least 3 days with maximal silencing achieved by 36 hr (blue circles). In each panel, error bars represent standard deviation ( n = 3). Statistically significant differences compared to cells given PBS were determined using two‐tailed Welch's t tests. *, **, and **** indicate p ≤ .05, 0.01, and .0001, respectively
    Figure Legend Snippet: LNPs mediated durable gene silencing in JeKo‐1 cells. (a) Three lipidoid chemistries—303O 13 , 304O 13 , and 306O 13 —were formulated into siRNA‐loaded LNPs. (b) Treatment with each LNP resulted in dose‐dependent silencing of GAPDH in JeKo‐1 mantle cell lymphoma cells 24 hr post‐transfection. PBS and LNPs (siCntrl) at the maximum dose of 100 nM served as negative controls. (c) Following a single dose of 100 nM siGAPDH, 306O 13 LNPs mediated near‐complete GAPDH knockdown for at least 3 days with maximal silencing achieved by 36 hr (blue circles). In each panel, error bars represent standard deviation ( n = 3). Statistically significant differences compared to cells given PBS were determined using two‐tailed Welch's t tests. *, **, and **** indicate p ≤ .05, 0.01, and .0001, respectively

    Techniques Used: Transfection, Standard Deviation, Two Tailed Test

    18) Product Images from "The aryl hydrocarbon receptor and interferon gamma generate antiviral states via transcriptional repression"

    Article Title: The aryl hydrocarbon receptor and interferon gamma generate antiviral states via transcriptional repression

    Journal: eLife

    doi: 10.7554/eLife.38867

    CDK1 mRNA stability is not affected by AhR and IFN-γ. ( A ) Decay of CDK1, TNFα and IL-1β following transcriptional blockage with actinomycin D, monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( B ) Decay rate of CDK1 mRNA following transcriptional blockage with actinomycin D in the presence of AhR agonist, antagonist or IFN-γ. CDK1 mRNA was monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( C ) Mean CDK1 mRNA half-life (t 1/2 )±SEM for three different macrophage donors.
    Figure Legend Snippet: CDK1 mRNA stability is not affected by AhR and IFN-γ. ( A ) Decay of CDK1, TNFα and IL-1β following transcriptional blockage with actinomycin D, monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( B ) Decay rate of CDK1 mRNA following transcriptional blockage with actinomycin D in the presence of AhR agonist, antagonist or IFN-γ. CDK1 mRNA was monitored over time by qPCR and normalized to GAPDH. Representative example from three different donors. ( C ) Mean CDK1 mRNA half-life (t 1/2 )±SEM for three different macrophage donors.

    Techniques Used: Real-time Polymerase Chain Reaction

    Related Articles

    Transfection:

    Article Title: Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors
    Article Snippet: .. Transfection efficiency was assessed by western blotting (see below) and by TaqMan quantitative reverse transcription-polymerase chain reaction (qRT-PCR); ATP6AP1 (Hs00184593_m1) and ATP6AP2 (Hs00997145_m1) gene expression levels were evaluated, using GAPDH (Hs02786624) for normalization, as previously described . .. Custom high efficiency miR-E short-hairpin RNAs (shRNAs) in the SGEP vector (puromycin/GFP) targeting ATP6AP1 or ATP6AP2 were created by the MSKCC RNAi Core Facility, as previously described . miR-E shRNA targeted to Firefly Renilla Luciferase was used as a negative, non-targeting control.

    Article Title: Mosaic RAS/MAPK variants cause sporadic vascular malformations which respond to targeted therapy
    Article Snippet: Quantitative real-time PCR To assess the efficiency of transfection of plasmid DNA in the cells, quantitative expression analysis of the genes of interest MAP2K1 and BRAF as well as the endogenous control GAPDH was determined by real-time qPCR with TaqMan gene expression assays using the StepOnePlus (Thermo Fisher Scientific) instrument. .. Probes used for quantitative analysis were as follows: MAP2K1 (assay ID: Hs00983247_g1), BRAF (assay ID: Hs00269944_m1), and GAPDH (assay ID: Hs02786624_g1) (all from Life Technologies).

    Amplification:

    Article Title: Mosaic RAS/MAPK variants cause sporadic vascular malformations which respond to targeted therapy
    Article Snippet: Probes used for quantitative analysis were as follows: MAP2K1 (assay ID: Hs00983247_g1), BRAF (assay ID: Hs00269944_m1), and GAPDH (assay ID: Hs02786624_g1) (all from Life Technologies). .. Results of the quantitative gene expression levels were obtained after the amplification reaction using StepOne software (version 2.3).

    Cycling Probe Technology:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: .. The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1). .. The mRNA expression level of each gene was normalized using GADPH as an internal control.

    Synthesized:

    Article Title: IL‐2 modulates Th2 cell responses to glucocorticosteroid: A cause of persistent type 2 inflammation?
    Article Snippet: 2.5 Quantitative real‐time polymerase chain reaction Total RNA was isolated using the RNeasy mini plus extraction kit (Qiagen, ON, Canada) and complementary DNA was synthesized from 400 ng RNA using iScript reverse transcriptase (Bio‐Rad, Hercules, CA). .. TaqMan gene expression assays (Life Technologies, Carlsbad, CA) for IL‐13 (Hs00174379_m1), B‐cell lymphoma 2 (BCL‐2; Hs00608023_m1), Bcl‐2 interacting mediator (BIM; Hs00708019_s1), total GC receptor (GR; Hs00353740_m1), GRβ (GRβ; (Hs00354508_m1), FK506 binding protein 51 (FKBP5; Hs01561006_m), and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH; Hs02786624_g1) were used.

    Isolation:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: Total RNA from HuH7 cells was isolated using Macherey–Nagel’s RNA extraction kit (Macherey–Nagel GmbH & Co. KG, Germany). .. The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1).

    Article Title: ST6Gal-I sialyltransferase promotes chemoresistance in pancreatic ductal adenocarcinoma by abrogating gemcitabine-mediated DNA damage
    Article Snippet: For the calculation of GSR, RNA was isolated after 24-h gemcitabine treatment and subjected to qRT-PCR. .. Primers were acquired from Applied Biosystems: GAPDH, catalog number 4331182, Assay ID Hs02786624_g1; hENT1, catalog number 4331182, Assay ID Hs01085706_m1; DCK, catalog number 4331182, Assay ID Hs01040726_m1; RRM1, catalog number 4331182, Assay ID Hs01040698_m1; RRM2, catalog number 4331182, Assay ID Hs00357247_g1.

    Article Title: An IL-15 superagonist/IL-15Rα fusion complex protects and rescues NK cell cytotoxic function from TGF-β1-mediated immunosuppression
    Article Snippet: Paragraph title: RNA isolation and quantitative real-time PCR ... Resultant cDNA (100 ng) was quantitated using TaqMan primers and probes as follows: CD226 (Hs00170832_m1), KLRK1 (Hs00183683_m1), NCR3 (Hs01553309_g1), GZMB (Hs00188051_m1), PRF1 (Hs00169473_m1), EOMES (Hs00172872_m1), JUN (Hs01103582_s1), SERPINE1 (Hs00167155_m1), SMAD7 (Hs00998193_m1), and GAPDH (Hs02786624_g1) (Life Technologies, Grand Island, NY).

    Article Title: IL‐2 modulates Th2 cell responses to glucocorticosteroid: A cause of persistent type 2 inflammation?
    Article Snippet: 2.5 Quantitative real‐time polymerase chain reaction Total RNA was isolated using the RNeasy mini plus extraction kit (Qiagen, ON, Canada) and complementary DNA was synthesized from 400 ng RNA using iScript reverse transcriptase (Bio‐Rad, Hercules, CA). .. TaqMan gene expression assays (Life Technologies, Carlsbad, CA) for IL‐13 (Hs00174379_m1), B‐cell lymphoma 2 (BCL‐2; Hs00608023_m1), Bcl‐2 interacting mediator (BIM; Hs00708019_s1), total GC receptor (GR; Hs00353740_m1), GRβ (GRβ; (Hs00354508_m1), FK506 binding protein 51 (FKBP5; Hs01561006_m), and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH; Hs02786624_g1) were used.

    RNA Extraction:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: Total RNA from HuH7 cells was isolated using Macherey–Nagel’s RNA extraction kit (Macherey–Nagel GmbH & Co. KG, Germany). .. The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1).

    Spectrophotometry:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: The quantity of RNA was evaluated using a NanoDrop 2000 Spectrophotometer (Thermo Scientific™ Co., Ltd., USA). .. The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1).

    Pyrolysis Gas Chromatography:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: .. The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1). .. The mRNA expression level of each gene was normalized using GADPH as an internal control.

    Real-time Polymerase Chain Reaction:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: Paragraph title: Real-time PCR analysis ... The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1).

    Article Title: An IL-15 superagonist/IL-15Rα fusion complex protects and rescues NK cell cytotoxic function from TGF-β1-mediated immunosuppression
    Article Snippet: Paragraph title: RNA isolation and quantitative real-time PCR ... Resultant cDNA (100 ng) was quantitated using TaqMan primers and probes as follows: CD226 (Hs00170832_m1), KLRK1 (Hs00183683_m1), NCR3 (Hs01553309_g1), GZMB (Hs00188051_m1), PRF1 (Hs00169473_m1), EOMES (Hs00172872_m1), JUN (Hs01103582_s1), SERPINE1 (Hs00167155_m1), SMAD7 (Hs00998193_m1), and GAPDH (Hs02786624_g1) (Life Technologies, Grand Island, NY).

    Article Title: Mitochondrial protection partly mitigates kidney cellular senescence in swine atherosclerotic renal artery stenosis
    Article Snippet: .. Renal gene expression of p 16 (Hs00923894), p 21 (Hs00355782), p 53 (Hs01034249), Activin-A (Hs01081598), and GAPDH (Hs02786624) was assessed on Applied Biosystems ViiA7 Real-Time PCR systems using the delta-delta CT method with validated TaqMan primers from Thermo Fisher Scientific (Waltham, MA) [ ]. .. Statistical analysis was performed using JMP software version 13.0 (SAS Institute, Cary, NC).

    Article Title: MicroRNAs modulate the noncanonical NF-?B pathway by regulating IKK? expression during macrophage differentiation
    Article Snippet: Paragraph title: Real Time PCR ... The following MGB assays from Applied Biosystems were used for gene expression analysis: GAPDH, Hs02786624_g1; ELC, Hs00171149_m1; BLC, Hs00757930_m1; SLC, Hs00171076_m1; SDF-1, Hs00171022_m1; A20, Hs00234713_m1; ICAM, Hs00164932_m1; CCL4, Hs00605740_g1;IL-10, Hs00961620_g1.

    Article Title: Induction of autophagy is essential for monocyte-macrophage differentiation
    Article Snippet: Paragraph title: Real-time PCR ... The following minor groove binder assays from Applied Biosystems were used for gene-expression analysis: GAPDH, Hs02786624_g1; human TNF-α, Hs01113624_g1; and human IL12p40, Hs00233688_m1.

    Article Title: IL‐2 modulates Th2 cell responses to glucocorticosteroid: A cause of persistent type 2 inflammation?
    Article Snippet: Paragraph title: Quantitative real‐time polymerase chain reaction ... TaqMan gene expression assays (Life Technologies, Carlsbad, CA) for IL‐13 (Hs00174379_m1), B‐cell lymphoma 2 (BCL‐2; Hs00608023_m1), Bcl‐2 interacting mediator (BIM; Hs00708019_s1), total GC receptor (GR; Hs00353740_m1), GRβ (GRβ; (Hs00354508_m1), FK506 binding protein 51 (FKBP5; Hs01561006_m), and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH; Hs02786624_g1) were used.

    Article Title: Mosaic RAS/MAPK variants cause sporadic vascular malformations which respond to targeted therapy
    Article Snippet: Paragraph title: Quantitative real-time PCR ... Probes used for quantitative analysis were as follows: MAP2K1 (assay ID: Hs00983247_g1), BRAF (assay ID: Hs00269944_m1), and GAPDH (assay ID: Hs02786624_g1) (all from Life Technologies).

    Concentration Assay:

    Article Title: ST6Gal-I sialyltransferase promotes chemoresistance in pancreatic ductal adenocarcinoma by abrogating gemcitabine-mediated DNA damage
    Article Snippet: Total RNA concentration was measured and utilized for cDNA preparation using the SuperScript VILO cDNA Synthesis kit (Thermo Fisher). qRT-PCR samples were prepared using TaqMan Fast Advanced Master Mix (Thermo Fisher). .. Primers were acquired from Applied Biosystems: GAPDH, catalog number 4331182, Assay ID Hs02786624_g1; hENT1, catalog number 4331182, Assay ID Hs01085706_m1; DCK, catalog number 4331182, Assay ID Hs01040726_m1; RRM1, catalog number 4331182, Assay ID Hs01040698_m1; RRM2, catalog number 4331182, Assay ID Hs00357247_g1.

    Incubation:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: After 24 h, the cells were incubated with different Cy3g concentrations for different times (1, 3, 6, and 24 h). .. The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1).

    other:

    Article Title: Somatic activating mutations in MAP2K1 cause melorheostosis
    Article Snippet: Human GAPDH (Hs02786624_g1) and TBP (Hs00427620_m1) were used as endogenous controls for normalization.

    Article Title: HSP90/AXL/eIF4E-regulated unfolded protein response as an acquired vulnerability in drug-resistant KRAS-mutant lung cancer
    Article Snippet: GAPDH (Hs02786624_g1) and ACTB (Hs01060665_g1) were used as endogenous normalization controls.

    Article Title: MicroRNA binding mediated Functional sequence variant in 3′-UTR of DNA repair Gene XPC in Age-related Cataract
    Article Snippet: Human GAPDH (Hs02786624_g1) was used as housekeeping gene control.

    Article Title: Soluble CD23 Controls IgE Synthesis and Homeostasis in Human B Cells i
    Article Snippet: GAPDH: Hs02786624_g1; β2microglobulin: 4310886E; CD23: Hs00233627_m1; εGLT: Forward 5′ CTGTCCAGGAACCCGACAGA 3′, Reverse 5′ TGCAGCAGCGGGTCAAG 3′ with MGB probe 6FAM-AG GCACCAAATG-MGB.

    Activity Assay:

    Article Title: Mitochondrial protection partly mitigates kidney cellular senescence in swine atherosclerotic renal artery stenosis
    Article Snippet: In addition, fluorimetric SA-β-Gal activity was assayed using a Cellular Senescence Activity Assay Kit (Enzo Life Sciences, Farmingdale, NY). .. Renal gene expression of p 16 (Hs00923894), p 21 (Hs00355782), p 53 (Hs01034249), Activin-A (Hs01081598), and GAPDH (Hs02786624) was assessed on Applied Biosystems ViiA7 Real-Time PCR systems using the delta-delta CT method with validated TaqMan primers from Thermo Fisher Scientific (Waltham, MA) [ ].

    Quantitative RT-PCR:

    Article Title: ST6Gal-I sialyltransferase promotes chemoresistance in pancreatic ductal adenocarcinoma by abrogating gemcitabine-mediated DNA damage
    Article Snippet: Total RNA concentration was measured and utilized for cDNA preparation using the SuperScript VILO cDNA Synthesis kit (Thermo Fisher). qRT-PCR samples were prepared using TaqMan Fast Advanced Master Mix (Thermo Fisher). .. Primers were acquired from Applied Biosystems: GAPDH, catalog number 4331182, Assay ID Hs02786624_g1; hENT1, catalog number 4331182, Assay ID Hs01085706_m1; DCK, catalog number 4331182, Assay ID Hs01040726_m1; RRM1, catalog number 4331182, Assay ID Hs01040698_m1; RRM2, catalog number 4331182, Assay ID Hs00357247_g1.

    Article Title: Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors
    Article Snippet: .. Transfection efficiency was assessed by western blotting (see below) and by TaqMan quantitative reverse transcription-polymerase chain reaction (qRT-PCR); ATP6AP1 (Hs00184593_m1) and ATP6AP2 (Hs00997145_m1) gene expression levels were evaluated, using GAPDH (Hs02786624) for normalization, as previously described . .. Custom high efficiency miR-E short-hairpin RNAs (shRNAs) in the SGEP vector (puromycin/GFP) targeting ATP6AP1 or ATP6AP2 were created by the MSKCC RNAi Core Facility, as previously described . miR-E shRNA targeted to Firefly Renilla Luciferase was used as a negative, non-targeting control.

    Expressing:

    Article Title: Cyanidin-3-glucoside enhances mitochondrial function and biogenesis in a human hepatocyte cell line
    Article Snippet: The following primer sets and TaqMan probes for experimental genes were purchased from Applied Biosystems (CA, USA): GADPH (Hs02786624_g1), PGC-1α (Hs01016719_m1), TFAM (Hs00273327_s1), NRF1 (Hs00602161_m1), SIRT1 (Mm00490758_m1), CPT-1β (Hs03046298_s1) and PFK1 (Hs01075411_m1). .. The mRNA expression level of each gene was normalized using GADPH as an internal control.

    Article Title: ST6Gal-I sialyltransferase promotes chemoresistance in pancreatic ductal adenocarcinoma by abrogating gemcitabine-mediated DNA damage
    Article Snippet: Primers were acquired from Applied Biosystems: GAPDH, catalog number 4331182, Assay ID Hs02786624_g1; hENT1, catalog number 4331182, Assay ID Hs01085706_m1; DCK, catalog number 4331182, Assay ID Hs01040726_m1; RRM1, catalog number 4331182, Assay ID Hs01040698_m1; RRM2, catalog number 4331182, Assay ID Hs00357247_g1. .. The gene expression (RQ) values for each gene were determined and used in the following formula to obtain the ratio.

    Article Title: An IL-15 superagonist/IL-15Rα fusion complex protects and rescues NK cell cytotoxic function from TGF-β1-mediated immunosuppression
    Article Snippet: Resultant cDNA (100 ng) was quantitated using TaqMan primers and probes as follows: CD226 (Hs00170832_m1), KLRK1 (Hs00183683_m1), NCR3 (Hs01553309_g1), GZMB (Hs00188051_m1), PRF1 (Hs00169473_m1), EOMES (Hs00172872_m1), JUN (Hs01103582_s1), SERPINE1 (Hs00167155_m1), SMAD7 (Hs00998193_m1), and GAPDH (Hs02786624_g1) (Life Technologies, Grand Island, NY). .. Each mRNA expression level was calculated as expression relative to GAPDH .

    Article Title: Mitochondrial protection partly mitigates kidney cellular senescence in swine atherosclerotic renal artery stenosis
    Article Snippet: .. Renal gene expression of p 16 (Hs00923894), p 21 (Hs00355782), p 53 (Hs01034249), Activin-A (Hs01081598), and GAPDH (Hs02786624) was assessed on Applied Biosystems ViiA7 Real-Time PCR systems using the delta-delta CT method with validated TaqMan primers from Thermo Fisher Scientific (Waltham, MA) [ ]. .. Statistical analysis was performed using JMP software version 13.0 (SAS Institute, Cary, NC).

    Article Title: MicroRNAs modulate the noncanonical NF-?B pathway by regulating IKK? expression during macrophage differentiation
    Article Snippet: .. The following MGB assays from Applied Biosystems were used for gene expression analysis: GAPDH, Hs02786624_g1; ELC, Hs00171149_m1; BLC, Hs00757930_m1; SLC, Hs00171076_m1; SDF-1, Hs00171022_m1; A20, Hs00234713_m1; ICAM, Hs00164932_m1; CCL4, Hs00605740_g1;IL-10, Hs00961620_g1. .. For miRNA quantitation, the following Applied Biosystems Taqman® MicroRNA assays were used: miRNA-15, 000389; miRNA-16, 000391; miRNA-223, 001006; miRNA-142-5p, 002248; let-7, 002619; RNU48, 001006.

    Article Title: Induction of autophagy is essential for monocyte-macrophage differentiation
    Article Snippet: Gene expression was normalized to that of GAPDH. .. The following minor groove binder assays from Applied Biosystems were used for gene-expression analysis: GAPDH, Hs02786624_g1; human TNF-α, Hs01113624_g1; and human IL12p40, Hs00233688_m1.

    Article Title: Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors
    Article Snippet: .. Transfection efficiency was assessed by western blotting (see below) and by TaqMan quantitative reverse transcription-polymerase chain reaction (qRT-PCR); ATP6AP1 (Hs00184593_m1) and ATP6AP2 (Hs00997145_m1) gene expression levels were evaluated, using GAPDH (Hs02786624) for normalization, as previously described . .. Custom high efficiency miR-E short-hairpin RNAs (shRNAs) in the SGEP vector (puromycin/GFP) targeting ATP6AP1 or ATP6AP2 were created by the MSKCC RNAi Core Facility, as previously described . miR-E shRNA targeted to Firefly Renilla Luciferase was used as a negative, non-targeting control.

    Article Title: Cancer cell lipid class homeostasis is altered under nutrient-deprivation but stable under hypoxia
    Article Snippet: .. The expression of each gene was normalized to the expression of GADPH (Hs02786624_g1). ..

    Article Title: IL‐2 modulates Th2 cell responses to glucocorticosteroid: A cause of persistent type 2 inflammation?
    Article Snippet: .. TaqMan gene expression assays (Life Technologies, Carlsbad, CA) for IL‐13 (Hs00174379_m1), B‐cell lymphoma 2 (BCL‐2; Hs00608023_m1), Bcl‐2 interacting mediator (BIM; Hs00708019_s1), total GC receptor (GR; Hs00353740_m1), GRβ (GRβ; (Hs00354508_m1), FK506 binding protein 51 (FKBP5; Hs01561006_m), and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH; Hs02786624_g1) were used. ..

    Article Title: Mosaic RAS/MAPK variants cause sporadic vascular malformations which respond to targeted therapy
    Article Snippet: Standard protocol per the manufacturer’s guidelines was followed for Applied Biosystems TaqMan Gene Expression Assay on the StepOnePlus instrument. .. Probes used for quantitative analysis were as follows: MAP2K1 (assay ID: Hs00983247_g1), BRAF (assay ID: Hs00269944_m1), and GAPDH (assay ID: Hs02786624_g1) (all from Life Technologies).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors
    Article Snippet: .. Transfection efficiency was assessed by western blotting (see below) and by TaqMan quantitative reverse transcription-polymerase chain reaction (qRT-PCR); ATP6AP1 (Hs00184593_m1) and ATP6AP2 (Hs00997145_m1) gene expression levels were evaluated, using GAPDH (Hs02786624) for normalization, as previously described . .. Custom high efficiency miR-E short-hairpin RNAs (shRNAs) in the SGEP vector (puromycin/GFP) targeting ATP6AP1 or ATP6AP2 were created by the MSKCC RNAi Core Facility, as previously described . miR-E shRNA targeted to Firefly Renilla Luciferase was used as a negative, non-targeting control.

    Western Blot:

    Article Title: Mitochondrial protection partly mitigates kidney cellular senescence in swine atherosclerotic renal artery stenosis
    Article Snippet: Protein expression of γ-phosphorylated histone-2AX (γH2AX) (1:1000 Abcam), total H2AX (1:1000 Abcam), plasminogen activator inhibitor (PAI)-1 (1:1000 Abcam), monocyte chemoattractant protein (MCP)-1 (1:10 Abcam), transforming growth factor (TGF)-β (1:1000 Abcam), and tumor necrosis factor (TNF)-α (1:100 Abcam) was measured in 100μg of protein from each homogenized kidney tissue sample by Western blot [ ]. .. Renal gene expression of p 16 (Hs00923894), p 21 (Hs00355782), p 53 (Hs01034249), Activin-A (Hs01081598), and GAPDH (Hs02786624) was assessed on Applied Biosystems ViiA7 Real-Time PCR systems using the delta-delta CT method with validated TaqMan primers from Thermo Fisher Scientific (Waltham, MA) [ ].

    Article Title: Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors
    Article Snippet: .. Transfection efficiency was assessed by western blotting (see below) and by TaqMan quantitative reverse transcription-polymerase chain reaction (qRT-PCR); ATP6AP1 (Hs00184593_m1) and ATP6AP2 (Hs00997145_m1) gene expression levels were evaluated, using GAPDH (Hs02786624) for normalization, as previously described . .. Custom high efficiency miR-E short-hairpin RNAs (shRNAs) in the SGEP vector (puromycin/GFP) targeting ATP6AP1 or ATP6AP2 were created by the MSKCC RNAi Core Facility, as previously described . miR-E shRNA targeted to Firefly Renilla Luciferase was used as a negative, non-targeting control.

    Quantitation Assay:

    Article Title: MicroRNAs modulate the noncanonical NF-?B pathway by regulating IKK? expression during macrophage differentiation
    Article Snippet: Data was analyzed using the StepOnePlus software, and gene expression was normalized to GAPDH levels. miRNA quantitation was done similarly using Applied Biosystem Taqman® reagents and protocols, with the exception that reverse transcription was done with their associated miRNA assay primers using the Taqman® miRNA transcription kit and protocol, and assays were performed in triplicate using twice the suggested amounts of template cDNA. .. The following MGB assays from Applied Biosystems were used for gene expression analysis: GAPDH, Hs02786624_g1; ELC, Hs00171149_m1; BLC, Hs00757930_m1; SLC, Hs00171076_m1; SDF-1, Hs00171022_m1; A20, Hs00234713_m1; ICAM, Hs00164932_m1; CCL4, Hs00605740_g1;IL-10, Hs00961620_g1.

    Binding Assay:

    Article Title: IL‐2 modulates Th2 cell responses to glucocorticosteroid: A cause of persistent type 2 inflammation?
    Article Snippet: .. TaqMan gene expression assays (Life Technologies, Carlsbad, CA) for IL‐13 (Hs00174379_m1), B‐cell lymphoma 2 (BCL‐2; Hs00608023_m1), Bcl‐2 interacting mediator (BIM; Hs00708019_s1), total GC receptor (GR; Hs00353740_m1), GRβ (GRβ; (Hs00354508_m1), FK506 binding protein 51 (FKBP5; Hs01561006_m), and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH; Hs02786624_g1) were used. ..

    Plasmid Preparation:

    Article Title: Mosaic RAS/MAPK variants cause sporadic vascular malformations which respond to targeted therapy
    Article Snippet: Quantitative real-time PCR To assess the efficiency of transfection of plasmid DNA in the cells, quantitative expression analysis of the genes of interest MAP2K1 and BRAF as well as the endogenous control GAPDH was determined by real-time qPCR with TaqMan gene expression assays using the StepOnePlus (Thermo Fisher Scientific) instrument. .. Probes used for quantitative analysis were as follows: MAP2K1 (assay ID: Hs00983247_g1), BRAF (assay ID: Hs00269944_m1), and GAPDH (assay ID: Hs02786624_g1) (all from Life Technologies).

    Software:

    Article Title: Mitochondrial protection partly mitigates kidney cellular senescence in swine atherosclerotic renal artery stenosis
    Article Snippet: GAPDH (1:5000 Abcam) was used as loading control and band intensity quantified using ImageJ software. .. Renal gene expression of p 16 (Hs00923894), p 21 (Hs00355782), p 53 (Hs01034249), Activin-A (Hs01081598), and GAPDH (Hs02786624) was assessed on Applied Biosystems ViiA7 Real-Time PCR systems using the delta-delta CT method with validated TaqMan primers from Thermo Fisher Scientific (Waltham, MA) [ ].

    Article Title: MicroRNAs modulate the noncanonical NF-?B pathway by regulating IKK? expression during macrophage differentiation
    Article Snippet: Data was analyzed using the StepOnePlus software, and gene expression was normalized to GAPDH levels. miRNA quantitation was done similarly using Applied Biosystem Taqman® reagents and protocols, with the exception that reverse transcription was done with their associated miRNA assay primers using the Taqman® miRNA transcription kit and protocol, and assays were performed in triplicate using twice the suggested amounts of template cDNA. .. The following MGB assays from Applied Biosystems were used for gene expression analysis: GAPDH, Hs02786624_g1; ELC, Hs00171149_m1; BLC, Hs00757930_m1; SLC, Hs00171076_m1; SDF-1, Hs00171022_m1; A20, Hs00234713_m1; ICAM, Hs00164932_m1; CCL4, Hs00605740_g1;IL-10, Hs00961620_g1.

    Article Title: Mosaic RAS/MAPK variants cause sporadic vascular malformations which respond to targeted therapy
    Article Snippet: Probes used for quantitative analysis were as follows: MAP2K1 (assay ID: Hs00983247_g1), BRAF (assay ID: Hs00269944_m1), and GAPDH (assay ID: Hs02786624_g1) (all from Life Technologies). .. Results of the quantitative gene expression levels were obtained after the amplification reaction using StepOne software (version 2.3).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gene exp gapdh hs02786624 g1
    Gene Exp Gapdh Hs02786624 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02786624 g1/product/Thermo Fisher
    Average 99 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02786624 g1 - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results