gel extraction kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    MinElute Gel Extraction Kit
    Description:
    For gel extraction of up to 5 μg DNA fragments 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute Gel Extraction Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Gel Extraction Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Gel Extraction of up to 5μg DNA fragments in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers Collection Tubes 2mL Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    Catalog Number:
    28604
    Price:
    136
    Category:
    MinElute Gel Extraction Kit
    Buy from Supplier


    Structured Review

    Qiagen gel extraction kit
    MinElute Gel Extraction Kit
    For gel extraction of up to 5 μg DNA fragments 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute Gel Extraction Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Gel Extraction Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Gel Extraction of up to 5μg DNA fragments in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers Collection Tubes 2mL Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    https://www.bioz.com/result/gel extraction kit/product/Qiagen
    Average 90 stars, based on 1252 article reviews
    Price from $9.99 to $1999.99
    gel extraction kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Phosphatidylinositol 3-Kinase (PI3K) δ blockade increases genomic instability in B cells"

    Article Title: Phosphatidylinositol 3-Kinase (PI3K) δ blockade increases genomic instability in B cells

    Journal: Nature

    doi: 10.1038/nature21406

    Ibrutinib increases AID expression and the frequency of translocations to AID on- and off-target sites in mouse activated B cells a , AKT phosphorylation was detected by Western Blot in mouse activated B cells treated with DMSO, idelalisib, duvelisib or ibrutinib (1 μM) for the indicated time points (n = 2 biological replicates). For gel source data, see Supplementary Figure 1 . b , MEC1 and Mino human lymphoma cells were treated with the indicated inhibitors (1 μM) and AKT phosphorylation was evaluated by Western Blot (n = 3 biological replicates). c, Viable cells were counted at the indicated time points by Trypan Blue exclusion in activated B cells treated with DMSO or ibrutinib (1 μM). Data are expressed as mean ± s.d. (n=3). P values calculated by two-tailed Student’s t -test. d, Western blot for AID protein expression in activated B cells treated with 1 μM ibrutinib. The DMSO panel from Fig. 1a is shown for comparison (n=3 biological replicates). e, Aicda mRNA levels analyzed by qRT-PCR in activated B cells treated with DMSO or ibrutinib (1 μM). Data are expressed as mean ± s.d. (n = 3 technical replicates, n = 3 biological replicates). * P
    Figure Legend Snippet: Ibrutinib increases AID expression and the frequency of translocations to AID on- and off-target sites in mouse activated B cells a , AKT phosphorylation was detected by Western Blot in mouse activated B cells treated with DMSO, idelalisib, duvelisib or ibrutinib (1 μM) for the indicated time points (n = 2 biological replicates). For gel source data, see Supplementary Figure 1 . b , MEC1 and Mino human lymphoma cells were treated with the indicated inhibitors (1 μM) and AKT phosphorylation was evaluated by Western Blot (n = 3 biological replicates). c, Viable cells were counted at the indicated time points by Trypan Blue exclusion in activated B cells treated with DMSO or ibrutinib (1 μM). Data are expressed as mean ± s.d. (n=3). P values calculated by two-tailed Student’s t -test. d, Western blot for AID protein expression in activated B cells treated with 1 μM ibrutinib. The DMSO panel from Fig. 1a is shown for comparison (n=3 biological replicates). e, Aicda mRNA levels analyzed by qRT-PCR in activated B cells treated with DMSO or ibrutinib (1 μM). Data are expressed as mean ± s.d. (n = 3 technical replicates, n = 3 biological replicates). * P

    Techniques Used: Expressing, Western Blot, Two Tailed Test, Quantitative RT-PCR

    PI3Kδ inhibitors and ibrutinib increase c-myc DSB formation and the incidence of plasma cell (PC) tumor in mice a, Detailed view of the distribution of rearrangements (deletions or inversions) in the c-myc locus in mice treated as above. Numbers of translocation junctions in focal clusters are indicated in bold. b , RPM Frequency of rearrangements (deletions or inversions) in the c-myc locus in GC B cell from mice treated in vivo with the idelalisib or duvelisib. Junctions within ±300 bp of primer region were excluded. Significance is calculated as false discovery rate ( FDR ) by comparing idelalisib or duvelisib to DMSO treated mouse as indicated in the Methods. ** FDR ≤ 0.01. c , Schematic representation of the experimental outline of pristane-induced PCT in mice treated with PI3Kδ inhibitors and ibrutinib. The mice were treated in two independent biological experimental replicates, each consisting of 6 mice per group. d, Direct PCR assay for Igh/c-myc translocation in mice with PC tumors. Translocations from c-myc to the IgHα locus are shown. Translocations for the only mouse in the vehicle group and from three example mice from treated groups are shown. Bands were purified from gels and were sequenced to confirm the Igh/c-myc translocation junction. For gel source data, see Supplementary Figure 1 . e, Development of PC tumor in mice induced with pristane and treated with idelalisib, duvelisib or ibrutinib is plotted over time. The presence of PC tumors was confirmed by histology (n = 12 for each treatment in 2 independent cohorts of 6 mice). P values calculated by Log-rank (Mantel-Cox) test. f , Example histology of PC tumors in mice induced with pristane and treated with the indicated drugs. Magnification 40x; Scale bar = 50μm; Insets: high magnification image of clusters of atypical plasma cells.
    Figure Legend Snippet: PI3Kδ inhibitors and ibrutinib increase c-myc DSB formation and the incidence of plasma cell (PC) tumor in mice a, Detailed view of the distribution of rearrangements (deletions or inversions) in the c-myc locus in mice treated as above. Numbers of translocation junctions in focal clusters are indicated in bold. b , RPM Frequency of rearrangements (deletions or inversions) in the c-myc locus in GC B cell from mice treated in vivo with the idelalisib or duvelisib. Junctions within ±300 bp of primer region were excluded. Significance is calculated as false discovery rate ( FDR ) by comparing idelalisib or duvelisib to DMSO treated mouse as indicated in the Methods. ** FDR ≤ 0.01. c , Schematic representation of the experimental outline of pristane-induced PCT in mice treated with PI3Kδ inhibitors and ibrutinib. The mice were treated in two independent biological experimental replicates, each consisting of 6 mice per group. d, Direct PCR assay for Igh/c-myc translocation in mice with PC tumors. Translocations from c-myc to the IgHα locus are shown. Translocations for the only mouse in the vehicle group and from three example mice from treated groups are shown. Bands were purified from gels and were sequenced to confirm the Igh/c-myc translocation junction. For gel source data, see Supplementary Figure 1 . e, Development of PC tumor in mice induced with pristane and treated with idelalisib, duvelisib or ibrutinib is plotted over time. The presence of PC tumors was confirmed by histology (n = 12 for each treatment in 2 independent cohorts of 6 mice). P values calculated by Log-rank (Mantel-Cox) test. f , Example histology of PC tumors in mice induced with pristane and treated with the indicated drugs. Magnification 40x; Scale bar = 50μm; Insets: high magnification image of clusters of atypical plasma cells.

    Techniques Used: Mouse Assay, Translocation Assay, In Vivo, Polymerase Chain Reaction, Purification

    Phosphatidylinositol 3-Kinase (PI3K)δ blockade increases AID expression and CSR in activated mouse B cells a , Western blot for AID protein from B cells treated with the indicated inhibitors (1 μM) (n = 3 biological replicates). For gel source data, see Supplementary Figure 1 . b , Aicda mRNA levels were analyzed by qRT-PCR. Data are expressed as mean ± s.d. (n = 3 biological replicates).. ** P ≤ 0.01, *** P ≤ 0.001, two-tailed Student’s t -test from idelalisib or duvelisib vs DMSO-treated B cells. c, GRO-Seq profiles of Aicda gene in B cells at 48 h after activation (n = 2 biological replicates). Blue profiles: sense transcription, Red profiles: antisense transcription. d, Quantification of GRO-Seq sense and antisense reads per kilobase per million mapped reads (RPKM) in the Aicda gene, ** P ≤ 0.01 ,***P ≤ 0.001, multiple test adjusted. e, IgG 1 CSR in activated B cells. Data are expressed as mean ± s.d. (n = 3 biological replicates). ** P ≤ 0.01, *** P ≤ 0.001, two-tailed Student’s t -test from idelalisib or duvelisib vs DMSO treated B cells
    Figure Legend Snippet: Phosphatidylinositol 3-Kinase (PI3K)δ blockade increases AID expression and CSR in activated mouse B cells a , Western blot for AID protein from B cells treated with the indicated inhibitors (1 μM) (n = 3 biological replicates). For gel source data, see Supplementary Figure 1 . b , Aicda mRNA levels were analyzed by qRT-PCR. Data are expressed as mean ± s.d. (n = 3 biological replicates).. ** P ≤ 0.01, *** P ≤ 0.001, two-tailed Student’s t -test from idelalisib or duvelisib vs DMSO-treated B cells. c, GRO-Seq profiles of Aicda gene in B cells at 48 h after activation (n = 2 biological replicates). Blue profiles: sense transcription, Red profiles: antisense transcription. d, Quantification of GRO-Seq sense and antisense reads per kilobase per million mapped reads (RPKM) in the Aicda gene, ** P ≤ 0.01 ,***P ≤ 0.001, multiple test adjusted. e, IgG 1 CSR in activated B cells. Data are expressed as mean ± s.d. (n = 3 biological replicates). ** P ≤ 0.01, *** P ≤ 0.001, two-tailed Student’s t -test from idelalisib or duvelisib vs DMSO treated B cells

    Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Two Tailed Test, Activation Assay

    Related Articles

    Clone Assay:

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: .. The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN). .. Sequencing was performed with M13 forward and reverse primers and an internal primer (5′-AGC AAT ACC ATG TGA ACG ATG AA-3′) using the BigDye Terminator cycle sequencing kit (Applied Biosystems) and standard cycling conditions.

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Article Title: The West Nile virus mutant spectrum is host-dependant and a determinant of mortality in mice
    Article Snippet: Paragraph title: High‐Fidelity RT‐PCR, Cloning and Sequencing ... DNA was recovered using the MinElute Gel Extraction Kit (Qiagen) as specified by the manufacturer.

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: Paragraph title: Cloning of target genes for sequencing and making of standards ... PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen).

    Amplification:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: The amplification program was the following: 94°C for 3 minutes, then 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, 68°C for 30 seconds, followed by 68°C for 5 minutes. .. The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense
    Article Snippet: First, DNA of five individuals was mixed to pre-pools prior to gene amplification by polymerase chain reaction (PCR) using the Phusion® high-fidelity DNA Polymerase kit (Finnzymes, distributed by New England BioLabs, Inc.). .. Second, the five PCR product pre-pools per gene were brought together during PCR product purification with the MinElute® Gel Extraction Kit (Qiagen), resulting in one PCR product pool per gene.

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen). .. Different libraries were multiplexed by mixing in equimolar amounts with 40% PhiX Control (Illumina) in elution buffer (Qiagen), and sequencing was performed on the HiSeq 2000 or GAII sequencers (Illumina).

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: Partial target gene cDNAs were amplified from ovary or liver templates using PCR (Bioline: Biotaq Red DNA Polymerase, 10× NH4 Buffer, 50 mM MgCl2 Solution). .. PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen).

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: Library amplification readymix (KAPA Biosystems). .. MinElute gel extraction kit (Qiagen or equivalent).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: PCR amplification of GAPDH (556pb) was used as an internal control for DNA quality. .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method.

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: Paragraph title: Amplification of HIV-1 p24 ... The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN).

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: The product of the RT reaction performed on the cap was centrifuged into a tube, and 5-µl aliquots from all reactions were subjected to nested PCR amplification of IgG heavy or light chain sequences as described ( ). .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA).

    Synthesized:

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: Briefly, first-strand cDNAs were synthesized from rRNA-depleted RNA samples, followed by second-strand synthesis with DNA polymerase I and RNase H. The double-stranded cDNAs were then end-repaired and ligated to adaptors. .. Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    TA Cloning:

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Construct:

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: RNA Sequencing (RNA-seq) Ribosomal RNAs (rRNAs) from total RNA (5 μg) were removed using a RiboMinusTM Transcriptome Isolation Kit (Invitrogen). rRNA-depleted total RNAs (100 ng) were used to construct paired-end transcriptome libraries using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, MA, USA). .. Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Concentration Assay:

    Article Title: Ultra-precise detection of mutations by droplet-based amplification of circularized DNA
    Article Snippet: Subsequently, the gels with DNAs in length of 80 ~ 140 bp marked with 20 bp DNA ladder (Takara) were particularly cut off, and further extracted using QIAGEN MinElute Gel Extraction Kit (6X buffer QG). .. The ultimate DNA concentration was calibrated using Qubit 2.0 dsDNA HS Assay kit.

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: The amplification efficiency was checked on the agarose gel by comparing to a known concentration of a standard probe. .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen).

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: The inner (nested) PCR reactions used 1 μl of the first-round RT-PCR product in 50 μl containing: 1 × Buffer (with 1.5 mM MgCl2 final concentration), 0.05U/μl Expand HiFi Plus polymerase (Roche Applied Science), 400 nM dNTP mix, 0.5 μM of primers MO043 and MO045. .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN).

    Electrophoresis:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: Amplicons were visualized by electrophoresis in agarose gel at 1%. .. The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: All products were analyzed by electrophoresis in acrylamide gels at 6%. .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method.

    Incubation:

    Article Title: Ultra-precise detection of mutations by droplet-based amplification of circularized DNA
    Article Snippet: Subsequently, the gels with DNAs in length of 80 ~ 140 bp marked with 20 bp DNA ladder (Takara) were particularly cut off, and further extracted using QIAGEN MinElute Gel Extraction Kit (6X buffer QG). .. Subsequently, 0.5 μl Exonuclease I (NEB, M0293S) and 0.5 μl Exonuclease III (NEB, M0206S) were added into the reaction and jointly incubated at 37 °C for 1 h. The inner enzymes were inactivated at 80 °C for another 20 min.

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: The tubes, or the cap, were incubated at 65 °C for 3 min, and then at 25 °C for 3 min. To each reaction, 3 µl 0.1 M dTT, 1.5 µl dNTPs, 0.5 µl RNase inhibitor, and 0.5 µl SuperScript III (Invitrogen) were added, followed by incubation at 37 °C for 60 min, and at 70 °C for 10 min. .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA).

    Expressing:

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: Cell lines expressing HPV-16 (SiHa) and HPV-18 (HeLa) were used as positive controls. .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method.

    Modification:

    Article Title: Plasminogen Binding by Group A Streptococcal Isolates from a Region of Hyperendemicity for Streptococcal Skin Infection and a High Incidence of Invasive Infection
    Article Snippet: The method used to determine emm STs was modified from the S. pyogenes emm ) or with primers VUF and SBR as previously described ( ). .. The resulting PCR product was purified by using a MinElute gel extraction kit (Qiagen) and sequenced with BigDye ready reaction mix (Applied Biosystems, Boston, Mass.) using emm1 or emmseq2 primers.

    Transformation Assay:

    Article Title: The West Nile virus mutant spectrum is host-dependant and a determinant of mortality in mice
    Article Snippet: DNA was recovered using the MinElute Gel Extraction Kit (Qiagen) as specified by the manufacturer. .. The recovered DNA was ligated into the cloning vector pCR‐Script Amp SK (+) and transformed into XL10‐Gold Ultracompetent cells (Stratagene) according to the manufacturers protocol.

    Hybridization:

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: Expressed sequence tags obtained after suppressive subtractive hybridization of two ovarian libraries from A. australis (Lokman, unpubl. data) yielded the sequence information for eel orthologues of l36 , a ribosomal protein, and nucleolar protein-14 (nop14 ). .. PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen).

    Transfection:

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen). .. Ligated plasmids were transfected into Escherichia coli XL-1 Blue, grown overnight and single colonies amplified in 2YT medium.

    Ligation:

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: Quick ligation kit (NEB or equivalent). .. MinElute gel extraction kit (Qiagen or equivalent).

    Cell Culture:

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. These were cultured in DMEM with 10% fetal calf serum (FCS).

    Polymerase Chain Reaction:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: A first, PCR was performed with the following conditions: 50 ng of template from each DNA sample were added to a final reaction mixture of 30 μl containing 1X reaction buffer, 2.5 mM MgSO4 , 1mM dNTP, 0.2 U Platinum Taq DNA Polymerase High Fidelity (Invitrogen) and 5 pmol/μL of the primers. .. The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: STAT3 is constitutively activated in chronic active Epstein-Barr virus infection and can be a therapeutic target
    Article Snippet: .. The PCR product was run on an agarose gel, excised with a scalpel, and purified using the MinElute Gel Extraction Kit (QIAGEN, Hilden, Germany). .. Furthermore, sequencing was performed using Ion PGM (Life Technologies, CA).

    Article Title: Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense
    Article Snippet: .. Second, the five PCR product pre-pools per gene were brought together during PCR product purification with the MinElute® Gel Extraction Kit (Qiagen), resulting in one PCR product pool per gene. .. Finally, all 30 PCR product pools per population were mixed in equimolar quantities and concentrated to ≥200 ng µl−1 using the Amicon® Ultra-0.5 Centrifugal Filter Devices (Millipore).

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: DNA fragments were amplified with 10 to 15 cycles of PCR with SELEX round-specific primers , and the total amplicon was used in the subsequent SELEX round. .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen).

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: .. The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN). .. Sequencing was performed with M13 forward and reverse primers and an internal primer (5′-AGC AAT ACC ATG TGA ACG ATG AA-3′) using the BigDye Terminator cycle sequencing kit (Applied Biosystems) and standard cycling conditions.

    Article Title: Plasminogen Binding by Group A Streptococcal Isolates from a Region of Hyperendemicity for Streptococcal Skin Infection and a High Incidence of Invasive Infection
    Article Snippet: .. The resulting PCR product was purified by using a MinElute gel extraction kit (Qiagen) and sequenced with BigDye ready reaction mix (Applied Biosystems, Boston, Mass.) using emm1 or emmseq2 primers. .. The resulting sequences were compared to emm sequences in the S. pyogenes emm sequence database.

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: .. PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen). .. Complementary DNAs were then ligated into pGEM T-Easy Vector (Promega) according to manufacturer's instructions.

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: MinElute PCR purification kit (Qiagen or equivalent). .. MinElute gel extraction kit (Qiagen or equivalent).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: PCR amplification of GAPDH (556pb) was used as an internal control for DNA quality. .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method.

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN). .. Amplfication of near full-length HIV-1 genomes In addition to env and p24 fragments, near full-length genome sequence was obtained by amplifying three further fragments: (A) 5' LTR to gag p24, (B) gag p24 to env and (C) env to 3' LTR.

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: PCR products were resolved on 2% agarose gels. .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA).

    DNA Sequencing:

    Article Title: STAT3 is constitutively activated in chronic active Epstein-Barr virus infection and can be a therapeutic target
    Article Snippet: Paragraph title: DNA sequencing ... The PCR product was run on an agarose gel, excised with a scalpel, and purified using the MinElute Gel Extraction Kit (QIAGEN, Hilden, Germany).

    Sequencing:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: Paragraph title: High-throughput sequencing of 16S rDNA amplicons ... The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: STAT3 is constitutively activated in chronic active Epstein-Barr virus infection and can be a therapeutic target
    Article Snippet: The PCR product was run on an agarose gel, excised with a scalpel, and purified using the MinElute Gel Extraction Kit (QIAGEN, Hilden, Germany). .. Furthermore, sequencing was performed using Ion PGM (Life Technologies, CA).

    Article Title: Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense
    Article Snippet: Paragraph title: 2.2. Choice of genes and sequencing approach ... Second, the five PCR product pre-pools per gene were brought together during PCR product purification with the MinElute® Gel Extraction Kit (Qiagen), resulting in one PCR product pool per gene.

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen). .. Different libraries were multiplexed by mixing in equimolar amounts with 40% PhiX Control (Illumina) in elution buffer (Qiagen), and sequencing was performed on the HiSeq 2000 or GAII sequencers (Illumina).

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: Paragraph title: Sequencing of 16S rRNA genes. ... The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN).

    Article Title: Plasminogen Binding by Group A Streptococcal Isolates from a Region of Hyperendemicity for Streptococcal Skin Infection and a High Incidence of Invasive Infection
    Article Snippet: The resulting PCR product was purified by using a MinElute gel extraction kit (Qiagen) and sequenced with BigDye ready reaction mix (Applied Biosystems, Boston, Mass.) using emm1 or emmseq2 primers. .. The resulting sequences were compared to emm sequences in the S. pyogenes emm sequence database.

    Article Title: The West Nile virus mutant spectrum is host-dependant and a determinant of mortality in mice
    Article Snippet: Paragraph title: High‐Fidelity RT‐PCR, Cloning and Sequencing ... DNA was recovered using the MinElute Gel Extraction Kit (Qiagen) as specified by the manufacturer.

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: Paragraph title: Cloning of target genes for sequencing and making of standards ... PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen).

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA). .. The IgG amplification products were confirmed by sequencing at the University of Colorado Health Sciences Cancer Center DNA Analysis and Sequencing Core (Denver, CO), and analyzed in DNAsis Max (Miraibio Inc, Alameda, CA).

    Binding Assay:

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: After immunoprecipitation, beads were washed five times with 150 μL of binding buffer without salmon-sperm DNA and bound DNA was eluted with 50 μL 1× TE in a thermomixer at 90°C with full mixing speed. .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen).

    ChIP-sequencing:

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: The SEP3 antibodies were previously used in ChIP-seq experiments ( ; ). .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen).

    RNA Sequencing Assay:

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: Paragraph title: RNA Sequencing (RNA-seq) ... Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Magnetic Beads:

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: Magnetic beads with attached antibodies where prepared in advance according to the manufacturer’s instructions (MyOne) with purified antibodies resuspended in 1× PBS (∼1 mg/mL); 20 µg of antibodies and 0.5 mg of beads were used for a single binding reaction. .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen).

    Isolation:

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: RNA Sequencing (RNA-seq) Ribosomal RNAs (rRNAs) from total RNA (5 μg) were removed using a RiboMinusTM Transcriptome Isolation Kit (Invitrogen). rRNA-depleted total RNAs (100 ng) were used to construct paired-end transcriptome libraries using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, MA, USA). .. Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: From the monocytes, total cellular mRNA was isolated using Qiagen mRNA purification kit as described by the manufacturer. cDNA was obtained by one-step reverse transcription polymerase chain reaction (RT-PCR), using a forward oligonucleotide primer (primer D04 F: GAAACTATTTTATCAAAAGCATGC) and a reverse oligonucleotide primer (primer D05 R: GGCAATTATCATAGCCAGCAG). .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer.

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen). .. Plasmid was isolated using the Qiaprep Spin Miniprep Kit (Qiagen) and sequenced (Allan Wilson Centre Genome Service, Palmerston North, New Zealand) using M13 forward and reverse primers.

    Detection Assay:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method. .. HPV status was confirmed with the AnyplexTM II HPV HR Detection assay from Seegene® , based on multiplex real-time PCR, TOCE and DPO primer pairs technology, according to the supplier’s instructions.

    Multiplex Assay:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany). .. Amplicons were re-amplified and processed with the same primers linked to adapter A of the 454 sequencing protocol followed by a 6-mer multiplex identifier and by the primer 347F.

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method. .. HPV status was confirmed with the AnyplexTM II HPV HR Detection assay from Seegene® , based on multiplex real-time PCR, TOCE and DPO primer pairs technology, according to the supplier’s instructions.

    Purification:

    Article Title: Ultra-precise detection of mutations by droplet-based amplification of circularized DNA
    Article Snippet: The purified DNA was phosphorylated at 37 °C for 30 min in a standard reaction consisting of 44 μl DNA, 10U T4 PNK (T4 Polynucleotide Kinase, NEB, M0201S), 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, then was run on a 4 % agarose gel at 80 V for 80 min. .. Subsequently, the gels with DNAs in length of 80 ~ 140 bp marked with 20 bp DNA ladder (Takara) were particularly cut off, and further extracted using QIAGEN MinElute Gel Extraction Kit (6X buffer QG).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: .. The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany). .. Amplicons were re-amplified and processed with the same primers linked to adapter A of the 454 sequencing protocol followed by a 6-mer multiplex identifier and by the primer 347F.

    Article Title: STAT3 is constitutively activated in chronic active Epstein-Barr virus infection and can be a therapeutic target
    Article Snippet: .. The PCR product was run on an agarose gel, excised with a scalpel, and purified using the MinElute Gel Extraction Kit (QIAGEN, Hilden, Germany). .. Furthermore, sequencing was performed using Ion PGM (Life Technologies, CA).

    Article Title: Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense
    Article Snippet: .. Second, the five PCR product pre-pools per gene were brought together during PCR product purification with the MinElute® Gel Extraction Kit (Qiagen), resulting in one PCR product pool per gene. .. Finally, all 30 PCR product pools per population were mixed in equimolar quantities and concentrated to ≥200 ng µl−1 using the Amicon® Ultra-0.5 Centrifugal Filter Devices (Millipore).

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen). .. Different libraries were multiplexed by mixing in equimolar amounts with 40% PhiX Control (Illumina) in elution buffer (Qiagen), and sequencing was performed on the HiSeq 2000 or GAII sequencers (Illumina).

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: .. The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN). .. Sequencing was performed with M13 forward and reverse primers and an internal primer (5′-AGC AAT ACC ATG TGA ACG ATG AA-3′) using the BigDye Terminator cycle sequencing kit (Applied Biosystems) and standard cycling conditions.

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: .. Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany). ..

    Article Title: Plasminogen Binding by Group A Streptococcal Isolates from a Region of Hyperendemicity for Streptococcal Skin Infection and a High Incidence of Invasive Infection
    Article Snippet: .. The resulting PCR product was purified by using a MinElute gel extraction kit (Qiagen) and sequenced with BigDye ready reaction mix (Applied Biosystems, Boston, Mass.) using emm1 or emmseq2 primers. .. The resulting sequences were compared to emm sequences in the S. pyogenes emm sequence database.

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: From the monocytes, total cellular mRNA was isolated using Qiagen mRNA purification kit as described by the manufacturer. cDNA was obtained by one-step reverse transcription polymerase chain reaction (RT-PCR), using a forward oligonucleotide primer (primer D04 F: GAAACTATTTTATCAAAAGCATGC) and a reverse oligonucleotide primer (primer D05 R: GGCAATTATCATAGCCAGCAG). .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer.

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: MinElute PCR purification kit (Qiagen or equivalent). .. MinElute gel extraction kit (Qiagen or equivalent).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method. ..

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN). .. Amplfication of near full-length HIV-1 genomes In addition to env and p24 fragments, near full-length genome sequence was obtained by amplifying three further fragments: (A) 5' LTR to gag p24, (B) gag p24 to env and (C) env to 3' LTR.

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA). .. The IgG amplification products were confirmed by sequencing at the University of Colorado Health Sciences Cancer Center DNA Analysis and Sequencing Core (Denver, CO), and analyzed in DNAsis Max (Miraibio Inc, Alameda, CA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: From the monocytes, total cellular mRNA was isolated using Qiagen mRNA purification kit as described by the manufacturer. cDNA was obtained by one-step reverse transcription polymerase chain reaction (RT-PCR), using a forward oligonucleotide primer (primer D04 F: GAAACTATTTTATCAAAAGCATGC) and a reverse oligonucleotide primer (primer D05 R: GGCAATTATCATAGCCAGCAG). .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer.

    Article Title: The West Nile virus mutant spectrum is host-dependant and a determinant of mortality in mice
    Article Snippet: Paragraph title: High‐Fidelity RT‐PCR, Cloning and Sequencing ... DNA was recovered using the MinElute Gel Extraction Kit (Qiagen) as specified by the manufacturer.

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: The inner (nested) PCR reactions used 1 μl of the first-round RT-PCR product in 50 μl containing: 1 × Buffer (with 1.5 mM MgCl2 final concentration), 0.05U/μl Expand HiFi Plus polymerase (Roche Applied Science), 400 nM dNTP mix, 0.5 μM of primers MO043 and MO045. .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN).

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: Paragraph title: 2.3. RT-PCR ... Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA).

    Gel Extraction:

    Article Title: Ultra-precise detection of mutations by droplet-based amplification of circularized DNA
    Article Snippet: .. Subsequently, the gels with DNAs in length of 80 ~ 140 bp marked with 20 bp DNA ladder (Takara) were particularly cut off, and further extracted using QIAGEN MinElute Gel Extraction Kit (6X buffer QG). .. The ultimate DNA concentration was calibrated using Qubit 2.0 dsDNA HS Assay kit.

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: .. The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany). .. Amplicons were re-amplified and processed with the same primers linked to adapter A of the 454 sequencing protocol followed by a 6-mer multiplex identifier and by the primer 347F.

    Article Title: STAT3 is constitutively activated in chronic active Epstein-Barr virus infection and can be a therapeutic target
    Article Snippet: .. The PCR product was run on an agarose gel, excised with a scalpel, and purified using the MinElute Gel Extraction Kit (QIAGEN, Hilden, Germany). .. Furthermore, sequencing was performed using Ion PGM (Life Technologies, CA).

    Article Title: Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense
    Article Snippet: .. Second, the five PCR product pre-pools per gene were brought together during PCR product purification with the MinElute® Gel Extraction Kit (Qiagen), resulting in one PCR product pool per gene. .. Finally, all 30 PCR product pools per population were mixed in equimolar quantities and concentrated to ≥200 ng µl−1 using the Amicon® Ultra-0.5 Centrifugal Filter Devices (Millipore).

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen). .. Different libraries were multiplexed by mixing in equimolar amounts with 40% PhiX Control (Illumina) in elution buffer (Qiagen), and sequencing was performed on the HiSeq 2000 or GAII sequencers (Illumina).

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: .. The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN). .. Sequencing was performed with M13 forward and reverse primers and an internal primer (5′-AGC AAT ACC ATG TGA ACG ATG AA-3′) using the BigDye Terminator cycle sequencing kit (Applied Biosystems) and standard cycling conditions.

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: .. Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany). ..

    Article Title: Plasminogen Binding by Group A Streptococcal Isolates from a Region of Hyperendemicity for Streptococcal Skin Infection and a High Incidence of Invasive Infection
    Article Snippet: .. The resulting PCR product was purified by using a MinElute gel extraction kit (Qiagen) and sequenced with BigDye ready reaction mix (Applied Biosystems, Boston, Mass.) using emm1 or emmseq2 primers. .. The resulting sequences were compared to emm sequences in the S. pyogenes emm sequence database.

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Article Title: The West Nile virus mutant spectrum is host-dependant and a determinant of mortality in mice
    Article Snippet: .. DNA was recovered using the MinElute Gel Extraction Kit (Qiagen) as specified by the manufacturer. .. The recovered DNA was ligated into the cloning vector pCR‐Script Amp SK (+) and transformed into XL10‐Gold Ultracompetent cells (Stratagene) according to the manufacturers protocol.

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: .. PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen). .. Complementary DNAs were then ligated into pGEM T-Easy Vector (Promega) according to manufacturer's instructions.

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: .. MinElute gel extraction kit (Qiagen or equivalent). .. Certified low-range ultra agarose (Bio-Rad or equivalent).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method. ..

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN). .. Amplfication of near full-length HIV-1 genomes In addition to env and p24 fragments, near full-length genome sequence was obtained by amplifying three further fragments: (A) 5' LTR to gag p24, (B) gag p24 to env and (C) env to 3' LTR.

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA). .. The IgG amplification products were confirmed by sequencing at the University of Colorado Health Sciences Cancer Center DNA Analysis and Sequencing Core (Denver, CO), and analyzed in DNAsis Max (Miraibio Inc, Alameda, CA).

    Nested PCR:

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: The inner (nested) PCR reactions used 1 μl of the first-round RT-PCR product in 50 μl containing: 1 × Buffer (with 1.5 mM MgCl2 final concentration), 0.05U/μl Expand HiFi Plus polymerase (Roche Applied Science), 400 nM dNTP mix, 0.5 μM of primers MO043 and MO045. .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN).

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: The product of the RT reaction performed on the cap was centrifuged into a tube, and 5-µl aliquots from all reactions were subjected to nested PCR amplification of IgG heavy or light chain sequences as described ( ). .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA).

    Agarose Gel Electrophoresis:

    Article Title: Ultra-precise detection of mutations by droplet-based amplification of circularized DNA
    Article Snippet: The purified DNA was phosphorylated at 37 °C for 30 min in a standard reaction consisting of 44 μl DNA, 10U T4 PNK (T4 Polynucleotide Kinase, NEB, M0201S), 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, then was run on a 4 % agarose gel at 80 V for 80 min. .. Subsequently, the gels with DNAs in length of 80 ~ 140 bp marked with 20 bp DNA ladder (Takara) were particularly cut off, and further extracted using QIAGEN MinElute Gel Extraction Kit (6X buffer QG).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: Amplicons were visualized by electrophoresis in agarose gel at 1%. .. The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: STAT3 is constitutively activated in chronic active Epstein-Barr virus infection and can be a therapeutic target
    Article Snippet: .. The PCR product was run on an agarose gel, excised with a scalpel, and purified using the MinElute Gel Extraction Kit (QIAGEN, Hilden, Germany). .. Furthermore, sequencing was performed using Ion PGM (Life Technologies, CA).

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen). .. Different libraries were multiplexed by mixing in equimolar amounts with 40% PhiX Control (Illumina) in elution buffer (Qiagen), and sequencing was performed on the HiSeq 2000 or GAII sequencers (Illumina).

    Article Title: RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies
    Article Snippet: .. Ligated libraries were then separated on a 2% agarose gel (Duchefa, Haarlem, The Netherlands), and fragments with sizes between 300–400 bp were purified using the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany). ..

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Activated Clotting Time Assay:

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: For “ Candidatus Mycoplasma haemominutum” and M. haemofelis , species-specific primers (for “ Candidatus Mycoplasma haemominutum,” forward primer 5′-AAG TCG AAC GAA GAG GGT TTA CTC-3′ and reverse primer 5′-TTW AAT ACG GTT TCA ACT AGT ACT TTC TCC-3′ were used; for M. haemofelis , forward primer 5′-TCG AAC GGA YYT TGG TTT CG-3′ and reverse primer 5′-CAA ATG AAT GTA TTT TTA AAT GCC CAC-3′ were used) that amplify 1,354 bp and 1,309 bp of the gene, respectively, were designed. .. The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN).

    Plasmid Preparation:

    Article Title: Prevalence, Risk Factor Analysis, and Follow-Up of Infections Caused by Three Feline Hemoplasma Species in Cats in Switzerland
    Article Snippet: .. The program was as follows: 98°C for 3 min; 35 cycles of 98°C for 10 s, 63 to 68°C for 30 s, and 72°C for 1 min; and a final elongation step at 72°C for 10 min. PCR products were gel purified with a MinElute gel extraction kit (QIAGEN, Hombrechtikon, Switzerland) and cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen), and plasmid DNA was purified using a QIAprep Spin Miniprep kit (QIAGEN). .. Sequencing was performed with M13 forward and reverse primers and an internal primer (5′-AGC AAT ACC ATG TGA ACG ATG AA-3′) using the BigDye Terminator cycle sequencing kit (Applied Biosystems) and standard cycling conditions.

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: .. The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer. .. Expression and purification of MCP-1 was performed as previously described [ ].

    Article Title: The West Nile virus mutant spectrum is host-dependant and a determinant of mortality in mice
    Article Snippet: DNA was recovered using the MinElute Gel Extraction Kit (Qiagen) as specified by the manufacturer. .. The recovered DNA was ligated into the cloning vector pCR‐Script Amp SK (+) and transformed into XL10‐Gold Ultracompetent cells (Stratagene) according to the manufacturers protocol.

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen). .. Complementary DNAs were then ligated into pGEM T-Easy Vector (Promega) according to manufacturer's instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: Complementary DNAs were cloned into plasmids for sequencing or development of qPCR standards. .. PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen).

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method. .. HPV status was confirmed with the AnyplexTM II HPV HR Detection assay from Seegene® , based on multiplex real-time PCR, TOCE and DPO primer pairs technology, according to the supplier’s instructions.

    Negative Control:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: Deionized H2 O served as a negative control. .. The DNA band obtained was extracted and purified with the MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using the Sanger method.

    Sample Prep:

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: TruSeq PCR-Free LT DNA sample prep kit set A (Illumina). .. MinElute gel extraction kit (Qiagen or equivalent).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Monocyte Chemoattractant Protein-1 in Antineutrophil Cytoplasmic Autoantibody-Associated Vasculitis: Biomarker Potential and Association with Polymorphisms in the MCP-1 and the CC Chemokine Receptor-2 Gene
    Article Snippet: Paragraph title: 2.3. MCP-1 Enzyme-Linked Immunosorbent Assay (ELISA) ... The PCR product from the PCR was analyzed on a 1% agarose gel, and MCP-1 (300 bp) was extracted by using MinElute Gel Extraction Kit (Qiagen) as described by the manufacturer. cDNA was cloned into a pCR2.1TOPO (TA 3.9 kb) vector using (TA Cloning Kit, Invitrogen) as described by the manufacturer.

    Next-Generation Sequencing:

    Article Title: Analyzing genome rearrangements in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: 2.2 For preparing libraries for NGS to analyze GCR structures ... MinElute gel extraction kit (Qiagen or equivalent).

    Laser Capture Microdissection:

    Article Title: Laser capture microdissection and single-cell RT-PCR without RNA purification
    Article Snippet: We then compared the freeze–thaw method with performance of RT on the cap surface, using six LCM caps per method and one or three cells per cap. .. Appropriately sized bands were excised and DNA was purified using the MinElute Gel Extraction kit (Qiagen, Valencia, CA).

    Immunoprecipitation:

    Article Title: Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes
    Article Snippet: After immunoprecipitation, beads were washed five times with 150 μL of binding buffer without salmon-sperm DNA and bound DNA was eluted with 50 μL 1× TE in a thermomixer at 90°C with full mixing speed. .. Samples for sequencing, after amplification, were cut out from agarose gel and purified using MinElute gel extraction kit (Qiagen).

    High Throughput Screening Assay:

    Article Title: Cervical Microbiome and Cytokine Profile at Various Stages of Cervical Cancer: A Pilot Study
    Article Snippet: Paragraph title: High-throughput sequencing of 16S rDNA amplicons ... The DNA bands obtained were purified by MinElute Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense
    Article Snippet: Second, the five PCR product pre-pools per gene were brought together during PCR product purification with the MinElute® Gel Extraction Kit (Qiagen), resulting in one PCR product pool per gene. .. DNA library construction and high-throughput sequencing (paired-end, 100 bp) on a Genome Sequencer Illumina HiSeq2000 were performed by GATC Biotech AG (Konstanz, Germany).

    Staining:

    Article Title: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form
    Article Snippet: .. The PCR products were resolved on a 1% agarose (Tris-Borate EDTA, TBE) gel, DNA was visualized by ethidium bromide staining and the product was purified using the MinElute Gel Extraction Kit (QIAGEN). .. Amplfication of near full-length HIV-1 genomes In addition to env and p24 fragments, near full-length genome sequence was obtained by amplifying three further fragments: (A) 5' LTR to gag p24, (B) gag p24 to env and (C) env to 3' LTR.

    Fluorescence In Situ Hybridization:

    Article Title: The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: a cautionary tale
    Article Snippet: Degenerate primers for ornithine decarboxylase-1 (odc1 ) were designed on the basis of conserved motifs among odc1 orthologues from several teleost fish. .. PCR products were electrophoresed, and amplicons of expected sizes extracted from the gel using the MinElute Gel Extraction Kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen qiaquick gel extractio n kit
    Qiaquick Gel Extractio N Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick gel extractio n kit/product/Qiagen
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    qiaquick gel extractio n kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results