gdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    New England Biolabs gdna
    Destabilized Cas9 and nuclease protection effects on precise, seamless genome-cassette ligation. ( A ) Schematic diagrams of the pKER series of cassettes organized by brightness. Each cassette consists of a fluorescent protein under the control of the EF1α promoter and followed by the rabbit beta-globin terminator sequence. ( B ) Diagrams of Cas9-DD and DD-Cas9 showing the location of the destabilization domain on SpCas9. The domain is near the PAM-binding domain at the C-terminus. ( C ) Schematic diagram displaying the workflow for comparing WT-Cas9 to Cas9-DD. HEK293 cells are transfected with pKER-Clover cassette and the PAX7 PAMs Out-Large pair of vectors encoding either WT-Cas9 or Cas9-DD. Two days post-transfection, a portion of the cells are subjected to flow cytometric analysis and the remainder are reserved for genomic <t>DNA</t> isolation for sequence analysis. ( D ) Representative flow cytometric data for the pKER-Clover cassette and the PAX7 PAMs Out-Large sgRNAs with destabilized Cas9-DD. ( E ) Quantification of the percentage of Clover+ cells for phosphorylated and unphosphorylated cassettes for WT-Cas9, destabilized Cas9-DD, and stabilized Cas9-DD (1 μM Shield-1 for 24 h). n = 5 independent experiments each consisting of three technical replicates. Data is displayed as the mean ± SEM of the averages of each experiment. ** P
    Gdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gdna - by Bioz Stars, 2021-05
    86/100 stars

    Images

    1) Product Images from "In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining"

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv1542

    Destabilized Cas9 and nuclease protection effects on precise, seamless genome-cassette ligation. ( A ) Schematic diagrams of the pKER series of cassettes organized by brightness. Each cassette consists of a fluorescent protein under the control of the EF1α promoter and followed by the rabbit beta-globin terminator sequence. ( B ) Diagrams of Cas9-DD and DD-Cas9 showing the location of the destabilization domain on SpCas9. The domain is near the PAM-binding domain at the C-terminus. ( C ) Schematic diagram displaying the workflow for comparing WT-Cas9 to Cas9-DD. HEK293 cells are transfected with pKER-Clover cassette and the PAX7 PAMs Out-Large pair of vectors encoding either WT-Cas9 or Cas9-DD. Two days post-transfection, a portion of the cells are subjected to flow cytometric analysis and the remainder are reserved for genomic DNA isolation for sequence analysis. ( D ) Representative flow cytometric data for the pKER-Clover cassette and the PAX7 PAMs Out-Large sgRNAs with destabilized Cas9-DD. ( E ) Quantification of the percentage of Clover+ cells for phosphorylated and unphosphorylated cassettes for WT-Cas9, destabilized Cas9-DD, and stabilized Cas9-DD (1 μM Shield-1 for 24 h). n = 5 independent experiments each consisting of three technical replicates. Data is displayed as the mean ± SEM of the averages of each experiment. ** P
    Figure Legend Snippet: Destabilized Cas9 and nuclease protection effects on precise, seamless genome-cassette ligation. ( A ) Schematic diagrams of the pKER series of cassettes organized by brightness. Each cassette consists of a fluorescent protein under the control of the EF1α promoter and followed by the rabbit beta-globin terminator sequence. ( B ) Diagrams of Cas9-DD and DD-Cas9 showing the location of the destabilization domain on SpCas9. The domain is near the PAM-binding domain at the C-terminus. ( C ) Schematic diagram displaying the workflow for comparing WT-Cas9 to Cas9-DD. HEK293 cells are transfected with pKER-Clover cassette and the PAX7 PAMs Out-Large pair of vectors encoding either WT-Cas9 or Cas9-DD. Two days post-transfection, a portion of the cells are subjected to flow cytometric analysis and the remainder are reserved for genomic DNA isolation for sequence analysis. ( D ) Representative flow cytometric data for the pKER-Clover cassette and the PAX7 PAMs Out-Large sgRNAs with destabilized Cas9-DD. ( E ) Quantification of the percentage of Clover+ cells for phosphorylated and unphosphorylated cassettes for WT-Cas9, destabilized Cas9-DD, and stabilized Cas9-DD (1 μM Shield-1 for 24 h). n = 5 independent experiments each consisting of three technical replicates. Data is displayed as the mean ± SEM of the averages of each experiment. ** P

    Techniques Used: Ligation, Sequencing, Binding Assay, Transfection, Flow Cytometry, DNA Extraction

    Targeted analysis of off-target KiBL events in hiPSCs. Genomic DNA from various CRISPR/Cas9-treated UPT-Clover+ cells was subjected to whole genome amplification and used for analysis of the top six off-target sites (denoted OT1–6) for both the sgRNAs of the H11 PAMs Out pair. Each off-target site was analyzed using a sense (denoted F) and an antisense (denoted R) primer designed to amplify the off-target locus. Each F and R primer were used in two amplifications, one with the 5′ pKER cassette detection primer and the other with the 3′ pKER cassette detection primer. H11 F and H11 R correspond to the primers H11-X1-Fwd and H11-X1-Rev respectively and act as on-target controls. White indicates lack of detection, grey indicates faint detection, and black indicates strong detection. Each Cas9 treatment originated from an independent pool of cells.
    Figure Legend Snippet: Targeted analysis of off-target KiBL events in hiPSCs. Genomic DNA from various CRISPR/Cas9-treated UPT-Clover+ cells was subjected to whole genome amplification and used for analysis of the top six off-target sites (denoted OT1–6) for both the sgRNAs of the H11 PAMs Out pair. Each off-target site was analyzed using a sense (denoted F) and an antisense (denoted R) primer designed to amplify the off-target locus. Each F and R primer were used in two amplifications, one with the 5′ pKER cassette detection primer and the other with the 3′ pKER cassette detection primer. H11 F and H11 R correspond to the primers H11-X1-Fwd and H11-X1-Rev respectively and act as on-target controls. White indicates lack of detection, grey indicates faint detection, and black indicates strong detection. Each Cas9 treatment originated from an independent pool of cells.

    Techniques Used: CRISPR, Whole Genome Amplification, Activated Clotting Time Assay

    2) Product Images from "High molecular weight DNA extraction strategies for long-read sequencing of complex metagenomes"

    Article Title: High molecular weight DNA extraction strategies for long-read sequencing of complex metagenomes

    Journal: bioRxiv

    doi: 10.1101/2021.03.03.433801

    Agarose gel electrophoresis of genomic DNA isolated from a pool of tongue dorsum samples. Genomic DNA was electrophoresed on a 0.8% (w/v) agarose gel. Method 1, Method 2 and Method 3 replicates (22 ng input, left panel) and Method 4, Method 5 and Method 6 replicates (44 ng input, right panel) are shown. Different DNA inputs were used based on overall sample availability. λ-HindIII, Lambda DNA, digested with the restriction endonuclease HindIII, was used to assess fragment size distribution.
    Figure Legend Snippet: Agarose gel electrophoresis of genomic DNA isolated from a pool of tongue dorsum samples. Genomic DNA was electrophoresed on a 0.8% (w/v) agarose gel. Method 1, Method 2 and Method 3 replicates (22 ng input, left panel) and Method 4, Method 5 and Method 6 replicates (44 ng input, right panel) are shown. Different DNA inputs were used based on overall sample availability. λ-HindIII, Lambda DNA, digested with the restriction endonuclease HindIII, was used to assess fragment size distribution.

    Techniques Used: Agarose Gel Electrophoresis, Isolation, Lambda DNA Preparation

    Related Articles

    Methylation:

    Article Title: Epigenetically reprogrammed methylation landscape drives the DNA self-assembly and serves as a universal cancer biomarker
    Article Snippet: Jurkat 100% methylated and Azacytidine treated Jurkat gDNA were purchased from New Englands Biolabs. .. Enzymatically methylated gDNAs are obtained using the M.SssI CpG methyltransferase enzyme (New England Biolabs), which was allowed to insert methyl groups onto CpG sites of unmethylated whole genome amplified (WGA) DNA in the presence of SAM donor, according to manufacturer instructions. ..

    Amplification:

    Article Title: Epigenetically reprogrammed methylation landscape drives the DNA self-assembly and serves as a universal cancer biomarker
    Article Snippet: Jurkat 100% methylated and Azacytidine treated Jurkat gDNA were purchased from New Englands Biolabs. .. Enzymatically methylated gDNAs are obtained using the M.SssI CpG methyltransferase enzyme (New England Biolabs), which was allowed to insert methyl groups onto CpG sites of unmethylated whole genome amplified (WGA) DNA in the presence of SAM donor, according to manufacturer instructions. ..

    Whole Genome Amplification:

    Article Title: Epigenetically reprogrammed methylation landscape drives the DNA self-assembly and serves as a universal cancer biomarker
    Article Snippet: Jurkat 100% methylated and Azacytidine treated Jurkat gDNA were purchased from New Englands Biolabs. .. Enzymatically methylated gDNAs are obtained using the M.SssI CpG methyltransferase enzyme (New England Biolabs), which was allowed to insert methyl groups onto CpG sites of unmethylated whole genome amplified (WGA) DNA in the presence of SAM donor, according to manufacturer instructions. ..

    DNA Extraction:

    Article Title: RNAi screens in mice identify physiological regulators of oncogenic growth
    Article Snippet: Sample preparation and pre-amplification Epidermal cells were isolated from E18.5 mouse skin using previously established procedures . .. Cells from individual embryos were used for genomic DNA isolation with the DNeasy Blood & Tissue Kit (Qiagen), and each sample was analyzed for target transduction using real-time PCR. gDNAs from 30 transduced embryos were pooled, and 200 μg of the total were used as template in a 10 ml pre-amplification reaction with 21 cycles and Phusion High-Fidelity DNA Polymerase (NEB). .. PCR products were run on a 2% agarose gel, and a clean ~200 bp band was isolated using QIAquick Gel Extraction Kit as recommended by the manufacturer (Qiagen).

    Transduction:

    Article Title: RNAi screens in mice identify physiological regulators of oncogenic growth
    Article Snippet: Sample preparation and pre-amplification Epidermal cells were isolated from E18.5 mouse skin using previously established procedures . .. Cells from individual embryos were used for genomic DNA isolation with the DNeasy Blood & Tissue Kit (Qiagen), and each sample was analyzed for target transduction using real-time PCR. gDNAs from 30 transduced embryos were pooled, and 200 μg of the total were used as template in a 10 ml pre-amplification reaction with 21 cycles and Phusion High-Fidelity DNA Polymerase (NEB). .. PCR products were run on a 2% agarose gel, and a clean ~200 bp band was isolated using QIAquick Gel Extraction Kit as recommended by the manufacturer (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: RNAi screens in mice identify physiological regulators of oncogenic growth
    Article Snippet: Sample preparation and pre-amplification Epidermal cells were isolated from E18.5 mouse skin using previously established procedures . .. Cells from individual embryos were used for genomic DNA isolation with the DNeasy Blood & Tissue Kit (Qiagen), and each sample was analyzed for target transduction using real-time PCR. gDNAs from 30 transduced embryos were pooled, and 200 μg of the total were used as template in a 10 ml pre-amplification reaction with 21 cycles and Phusion High-Fidelity DNA Polymerase (NEB). .. PCR products were run on a 2% agarose gel, and a clean ~200 bp band was isolated using QIAquick Gel Extraction Kit as recommended by the manufacturer (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Genome-wide Mapping of Off-Target Events in Single-Stranded Oligodeoxynucleotide-Mediated Gene Repair Experiments
    Article Snippet: .. The EGFP -specific PCR program started with an initial denaturation at 96°C for 3 min, followed by 35 cycles with 94°C for 30 s, 54°C for 45 s, and 72°C for 30 s; the final elongation was carried out at 72°C for 5 min. For gDNAs from experiments with cybb100 ssODNs, the following adaptations were made: the linker for dA-tailed gDNA fragments consisted of the two annealed oligonucleotides 5′-phosphate-GGCTATTCGGCTATGACTAG-3′ and 5′-CTAGTCATAGCCGAATAGCCT-3′. gDNAs were dephosphorylated before HaeIII digestion. gDNAs equivalent to ∼2.5 × 105 cells (2.25 μg [HEK293] or 1.5 μg [CD34+ ]) were treated with 4 U of Shrimp Alkaline Phosphatase (M0371S, New England Biolabs) in 1× CutSmart Buffer (B7204S, New England Biolabs). .. Afterward, 60 U of the blunt-cutting restriction enzyme HaeIII (27-0866-02, Pharmacia) were added, and the samples were incubated overnight at 37°C. dA-tailing reactions were performed (NEBNext dA-tailing (E6053S, New England Biolabs) after washing of the beads (see above).

    Article Title: Amelioration of hemophilia B through CRISPR/Cas9 induced homology-independent targeted integration
    Article Snippet: .. 20 μg sonicated gDNAs and biotin primers (Sangon, Shanghai) were repeatedly annealed and denatured as follows: 95°C 3 min; 95°C 2 min, Ta (annealing temperature) 3 min, 5 cycles; Ta 3 min. Bst polymerase 3.0 (NEB) was added to perform for primer extension: 65°C 10 min, 80°C 5 min. AxyPrep Mag PCR Clean-Up beads (Axygen, US) were used to remove excess biotin primers. .. The purified products were heated to 95°C for 5 min and then rapidly cooled on ice for 5 min for DNA denaturation.

    Sonication:

    Article Title: Amelioration of hemophilia B through CRISPR/Cas9 induced homology-independent targeted integration
    Article Snippet: .. 20 μg sonicated gDNAs and biotin primers (Sangon, Shanghai) were repeatedly annealed and denatured as follows: 95°C 3 min; 95°C 2 min, Ta (annealing temperature) 3 min, 5 cycles; Ta 3 min. Bst polymerase 3.0 (NEB) was added to perform for primer extension: 65°C 10 min, 80°C 5 min. AxyPrep Mag PCR Clean-Up beads (Axygen, US) were used to remove excess biotin primers. .. The purified products were heated to 95°C for 5 min and then rapidly cooled on ice for 5 min for DNA denaturation.

    Incubation:

    Article Title: Genome-wide Mapping of Off-Target Events in Single-Stranded Oligodeoxynucleotide-Mediated Gene Repair Experiments
    Article Snippet: .. Before bead incubation, gDNAs from experiments with cor21 ssODNs were digested with DpnII (R0543S, New England Biolabs, Frankfurt, Germany) generating compatible ends for linker ligation. ..

    Ligation:

    Article Title: Genome-wide Mapping of Off-Target Events in Single-Stranded Oligodeoxynucleotide-Mediated Gene Repair Experiments
    Article Snippet: .. Before bead incubation, gDNAs from experiments with cor21 ssODNs were digested with DpnII (R0543S, New England Biolabs, Frankfurt, Germany) generating compatible ends for linker ligation. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs monarch gdna blood lysis buffer
    SHK-1 cells were electroporated with 1.4 μM Cas9:gRNA RNP and transferred to 2 separate 96-well plates. (A) After 48h, cell survival (plate1) was calculated using CellTiter Glo 2.0. (B) genomic <t>DNA</t> (plate 2) was extracted at 7 dpt, and the target sequence amplified by PCR and editing efficiency estimated using Sanger sequencing. (C) Using 1.4 μM RNP, the editing efficiency after 7 and 14 ddpt was estimated for different electroporation settings. (D) All the sequencing data, obtained from ICE analysis of Sanger sequencing of the intergenic target region from optimisation experiments (n=55) were pooled and plotted according to edit pattern.
    Monarch Gdna Blood Lysis Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/monarch gdna blood lysis buffer/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    monarch gdna blood lysis buffer - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    96
    New England Biolabs hpv18
    Alignment of RGW sequence and HPV specific sequencing from this study to published sequences on human chromosome 8 and <t>HPV18</t> sequences. Positions of the primers used for detection of the HPV18 target sequence in the enrichment (HPV5901f and HPV5994r) are illustrated by small triangles in HPU89349.
    Hpv18, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hpv18/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hpv18 - by Bioz Stars, 2021-05
    96/100 stars
      Buy from Supplier

    99
    New England Biolabs p atrosepticum scri1043 genomic dna
    P. <t>atrosepticum</t> produces molecular hydrogen gas. A. Anaerobic hydrogen production is optimal at lower temperatures. The P. atrosepticum SCRI1043 parent strain was incubated in M9 medium supplemented with 0.8% (w/v) glucose for 168 h at the temperatures indicated before gaseous H 2 accumulation was quantified. B. A time course of H 2 accumulation. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C and gaseous H 2 accumulation was measured every 24 h. C. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with either 0.5% (v/v) glycerol and 0.4% (w/v) nitrate (‘Gly Nit’); 0.5% (v/v) glycerol and 0.4% (w/v) fumarate (‘Gly Fum’); 0.5% (v/v) glycerol only (Gly); or 0.8% (w/v) glucose only (‘Glc’) at 24°C for 48 h. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).
    P Atrosepticum Scri1043 Genomic Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p atrosepticum scri1043 genomic dna/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    p atrosepticum scri1043 genomic dna - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    SHK-1 cells were electroporated with 1.4 μM Cas9:gRNA RNP and transferred to 2 separate 96-well plates. (A) After 48h, cell survival (plate1) was calculated using CellTiter Glo 2.0. (B) genomic DNA (plate 2) was extracted at 7 dpt, and the target sequence amplified by PCR and editing efficiency estimated using Sanger sequencing. (C) Using 1.4 μM RNP, the editing efficiency after 7 and 14 ddpt was estimated for different electroporation settings. (D) All the sequencing data, obtained from ICE analysis of Sanger sequencing of the intergenic target region from optimisation experiments (n=55) were pooled and plotted according to edit pattern.

    Journal: bioRxiv

    Article Title: Efficient genome editing in multiple salmonid cell lines using ribonucleoprotein complexes

    doi: 10.1101/2020.04.03.022038

    Figure Lengend Snippet: SHK-1 cells were electroporated with 1.4 μM Cas9:gRNA RNP and transferred to 2 separate 96-well plates. (A) After 48h, cell survival (plate1) was calculated using CellTiter Glo 2.0. (B) genomic DNA (plate 2) was extracted at 7 dpt, and the target sequence amplified by PCR and editing efficiency estimated using Sanger sequencing. (C) Using 1.4 μM RNP, the editing efficiency after 7 and 14 ddpt was estimated for different electroporation settings. (D) All the sequencing data, obtained from ICE analysis of Sanger sequencing of the intergenic target region from optimisation experiments (n=55) were pooled and plotted according to edit pattern.

    Article Snippet: Genomic DNA (gDNA) was extracted with QuickExtract buffer (Lucigen, Middleton, USA) by adding 30 μL to a well of a 96-well plate and incubating for 5 min.

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction, Electroporation

    Alignment of RGW sequence and HPV specific sequencing from this study to published sequences on human chromosome 8 and HPV18 sequences. Positions of the primers used for detection of the HPV18 target sequence in the enrichment (HPV5901f and HPV5994r) are illustrated by small triangles in HPU89349.

    Journal: PLoS ONE

    Article Title: Partition Enrichment of Nucleotide Sequences (PINS) - A Generally Applicable, Sequence Based Method for Enrichment of Complex DNA Samples

    doi: 10.1371/journal.pone.0106817

    Figure Lengend Snippet: Alignment of RGW sequence and HPV specific sequencing from this study to published sequences on human chromosome 8 and HPV18 sequences. Positions of the primers used for detection of the HPV18 target sequence in the enrichment (HPV5901f and HPV5994r) are illustrated by small triangles in HPU89349.

    Article Snippet: Nucleic acid templates HeLa DNA containing HPV18 was purchased from New England Biolabs in a concentration of 100 ng/µL (NEB-N4006S).

    Techniques: Sequencing

    Cleavage analysis of Asi SI sites. ( A ) Genomic DNA was extracted before and after 4OHT treatment and assayed for cleavage at Asi SI sites as described in ‘Materials and methods' section. Pulled down DNA was analysed by Q–PCR amplification

    Journal: The EMBO Journal

    Article Title: High-resolution profiling of ?H2AX around DNA double strand breaks in the mammalian genome

    doi: 10.1038/emboj.2010.38

    Figure Lengend Snippet: Cleavage analysis of Asi SI sites. ( A ) Genomic DNA was extracted before and after 4OHT treatment and assayed for cleavage at Asi SI sites as described in ‘Materials and methods' section. Pulled down DNA was analysed by Q–PCR amplification

    Article Snippet: Asi SI genomic DNA, kindly provided by New England Biolabs (NEB), was amplified using the following primer pair (FW: ATAGATCTCATGGGCGAGTCTATTGATCA, REV: CTCGTCGACTCACAACATCACCTGGTC).

    Techniques: Polymerase Chain Reaction, Amplification

    4OHT treatment induces sequence-specific DSB induction in the Asi SI–ER U20S cell line. ( A ) U20S cells, which stably express Asi SI–ER–HA, were co-stained with DAPI (DNA) after incubation with antibodies against the HA tag, and γH2AX,

    Journal: The EMBO Journal

    Article Title: High-resolution profiling of ?H2AX around DNA double strand breaks in the mammalian genome

    doi: 10.1038/emboj.2010.38

    Figure Lengend Snippet: 4OHT treatment induces sequence-specific DSB induction in the Asi SI–ER U20S cell line. ( A ) U20S cells, which stably express Asi SI–ER–HA, were co-stained with DAPI (DNA) after incubation with antibodies against the HA tag, and γH2AX,

    Article Snippet: Asi SI genomic DNA, kindly provided by New England Biolabs (NEB), was amplified using the following primer pair (FW: ATAGATCTCATGGGCGAGTCTATTGATCA, REV: CTCGTCGACTCACAACATCACCTGGTC).

    Techniques: Sequencing, Stable Transfection, Staining, Incubation

    P. atrosepticum produces molecular hydrogen gas. A. Anaerobic hydrogen production is optimal at lower temperatures. The P. atrosepticum SCRI1043 parent strain was incubated in M9 medium supplemented with 0.8% (w/v) glucose for 168 h at the temperatures indicated before gaseous H 2 accumulation was quantified. B. A time course of H 2 accumulation. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C and gaseous H 2 accumulation was measured every 24 h. C. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with either 0.5% (v/v) glycerol and 0.4% (w/v) nitrate (‘Gly Nit’); 0.5% (v/v) glycerol and 0.4% (w/v) fumarate (‘Gly Fum’); 0.5% (v/v) glycerol only (Gly); or 0.8% (w/v) glucose only (‘Glc’) at 24°C for 48 h. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Journal: Molecular Microbiology

    Article Title: The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase‐2 complex

    doi: 10.1111/mmi.14370

    Figure Lengend Snippet: P. atrosepticum produces molecular hydrogen gas. A. Anaerobic hydrogen production is optimal at lower temperatures. The P. atrosepticum SCRI1043 parent strain was incubated in M9 medium supplemented with 0.8% (w/v) glucose for 168 h at the temperatures indicated before gaseous H 2 accumulation was quantified. B. A time course of H 2 accumulation. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C and gaseous H 2 accumulation was measured every 24 h. C. P. atrosepticum SCRI1043 was incubated in M9 medium supplemented with either 0.5% (v/v) glycerol and 0.4% (w/v) nitrate (‘Gly Nit’); 0.5% (v/v) glycerol and 0.4% (w/v) fumarate (‘Gly Fum’); 0.5% (v/v) glycerol only (Gly); or 0.8% (w/v) glucose only (‘Glc’) at 24°C for 48 h. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Article Snippet: Plasmids and complementation All plasmids were cloned using Gibson assembly (HiFi Assembly, NEB) using DNA amplified from P. atrosepticum SCRI1043 genomic DNA (Table ).

    Techniques: Incubation

    Hydrogen gas is produced by the activity of a selenium‐free formate dehydrogenase. A. Addition of exogenous formate increases H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ) and PH002 (Δ hybC ) were incubated in low‐salt (5 g l –1 ) LB (LSLB) rich medium supplemented with 0.2% or 0.4% (w/v) formate at 24°C for 48 h. B. The formate dehydrogenase encoded within the gene cluster is responsible for FHL‐2 activity. Strains SCRI1043, PH004 (Δ fdhF ), PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. C. Alternative formate dehydrogenase homologues do not have a major role in H 2 production. Strains SCRI1043, PH002 (Δ hybC ), PH019 (Δ hybC Δ ECA1964 ), PH028 (Δ hybC Δ ECA1507 ) and PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. D. Complementation of the mutant phenotype in trans . Strains PH002 (Δ hybC ) and PH005 (Δ hybC Δ fdhF ) were separately transformed with plasmids encoding either FdhF, ECA1964 or ECA1507 under the control of constitutive promoters. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3). In panel (D) a one‐tailed t ‐test was used to determine statistical significance (* P

    Journal: Molecular Microbiology

    Article Title: The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase‐2 complex

    doi: 10.1111/mmi.14370

    Figure Lengend Snippet: Hydrogen gas is produced by the activity of a selenium‐free formate dehydrogenase. A. Addition of exogenous formate increases H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ) and PH002 (Δ hybC ) were incubated in low‐salt (5 g l –1 ) LB (LSLB) rich medium supplemented with 0.2% or 0.4% (w/v) formate at 24°C for 48 h. B. The formate dehydrogenase encoded within the gene cluster is responsible for FHL‐2 activity. Strains SCRI1043, PH004 (Δ fdhF ), PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. C. Alternative formate dehydrogenase homologues do not have a major role in H 2 production. Strains SCRI1043, PH002 (Δ hybC ), PH019 (Δ hybC Δ ECA1964 ), PH028 (Δ hybC Δ ECA1507 ) and PH005 (Δ hybC Δ fdhF ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. D. Complementation of the mutant phenotype in trans . Strains PH002 (Δ hybC ) and PH005 (Δ hybC Δ fdhF ) were separately transformed with plasmids encoding either FdhF, ECA1964 or ECA1507 under the control of constitutive promoters. In all cases, the levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3). In panel (D) a one‐tailed t ‐test was used to determine statistical significance (* P

    Article Snippet: Plasmids and complementation All plasmids were cloned using Gibson assembly (HiFi Assembly, NEB) using DNA amplified from P. atrosepticum SCRI1043 genomic DNA (Table ).

    Techniques: Produced, Activity Assay, Incubation, Mutagenesis, Transformation Assay, One-tailed Test

    Hydrogen gas is produced by the activity of [NiFe]‐Hydrogenase‐4. A. Hyd‐4 is responsible for fermentative H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. B. Complementation of the mutant phenotype in trans . Strains PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were separately transformed with plasmids encoding either HyfG or HybC under the control of constitutive promoters. Levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Journal: Molecular Microbiology

    Article Title: The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase‐2 complex

    doi: 10.1111/mmi.14370

    Figure Lengend Snippet: Hydrogen gas is produced by the activity of [NiFe]‐Hydrogenase‐4. A. Hyd‐4 is responsible for fermentative H 2 production. P. atrosepticum parental strain SCRI1043 and mutants PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were incubated in M9 medium supplemented with 0.8% (w/v) glucose at 24°C for 48 h. B. Complementation of the mutant phenotype in trans . Strains PH001 (Δ hyfG ), PH002 (Δ hybC ) and PH003 (Δ hybC Δ hyfG ) were separately transformed with plasmids encoding either HyfG or HybC under the control of constitutive promoters. Levels of molecular H 2 in the culture headspace were quantified by GC and normalised to OD 600 and culture volume. Error bars represent SD ( n = 3).

    Article Snippet: Plasmids and complementation All plasmids were cloned using Gibson assembly (HiFi Assembly, NEB) using DNA amplified from P. atrosepticum SCRI1043 genomic DNA (Table ).

    Techniques: Produced, Activity Assay, Incubation, Mutagenesis, Transformation Assay