Structured Review

TaKaRa gc buffer
Gc Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 194 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gc buffer/product/TaKaRa
Average 96 stars, based on 194 article reviews
Price from $9.99 to $1999.99
gc buffer - by Bioz Stars, 2020-08
96/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Rapid generation of gene-targeted EPS-derived mouse models through tetraploid complementation
Article Snippet: .. Genomic PCR was performed using PrimeSTAR® HS DNA Polymerase with GC Buffer (Takara, R044B). ..

Article Title: Exposure to polycyclic aromatic hydrocarbons derived from vehicle exhaust gas induces premature senescence in mouse lung fibroblast cells
Article Snippet: .. PCR was performed using PrimeSTAR® HS DNA Polymerase mix (cat. no. R044A; Takara Bio, Inc., Otsu, Japan). .. PCR thermocycling conditions were as follows: Initial denaturation at 97°C for 10 min, followed by 35 cycles of 96°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, and a final extension at 72°C for 5 min.

Transgenic Assay:

Article Title: The rice Os NAC6 transcription factor orchestrates multiple molecular mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance
Article Snippet: .. To generate OsNAC6::GUS transgenic plants, a 2‐kb promoter region (upstream region of the ATG start codon) of OsNAC6 was amplified using PrimeSTAR HS DNA Polymerase (5′‐CTGCAGTGTGCAAACTTTCAATG TTGAC‐3′ and 5′‐GAATTCCTCTCTCCCCCTTCTCCGGT‐3′) and ligated upstream of the β‐glucuronidase (GUS ) reporter gene in the rice transformation vector pCAMBIA1391Z using the Eco R1 and Pst 1 restriction sites. .. Transgenic plants were obtained by Agrobacterium tumefaciens (LBA4404)‐mediated embryogenic callus (Nipponbare) transformation.

Transformation Assay:

Article Title: The rice Os NAC6 transcription factor orchestrates multiple molecular mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance
Article Snippet: .. To generate OsNAC6::GUS transgenic plants, a 2‐kb promoter region (upstream region of the ATG start codon) of OsNAC6 was amplified using PrimeSTAR HS DNA Polymerase (5′‐CTGCAGTGTGCAAACTTTCAATG TTGAC‐3′ and 5′‐GAATTCCTCTCTCCCCCTTCTCCGGT‐3′) and ligated upstream of the β‐glucuronidase (GUS ) reporter gene in the rice transformation vector pCAMBIA1391Z using the Eco R1 and Pst 1 restriction sites. .. Transgenic plants were obtained by Agrobacterium tumefaciens (LBA4404)‐mediated embryogenic callus (Nipponbare) transformation.

Amplification:

Article Title: The rice Os NAC6 transcription factor orchestrates multiple molecular mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance
Article Snippet: .. To generate OsNAC6::GUS transgenic plants, a 2‐kb promoter region (upstream region of the ATG start codon) of OsNAC6 was amplified using PrimeSTAR HS DNA Polymerase (5′‐CTGCAGTGTGCAAACTTTCAATG TTGAC‐3′ and 5′‐GAATTCCTCTCTCCCCCTTCTCCGGT‐3′) and ligated upstream of the β‐glucuronidase (GUS ) reporter gene in the rice transformation vector pCAMBIA1391Z using the Eco R1 and Pst 1 restriction sites. .. Transgenic plants were obtained by Agrobacterium tumefaciens (LBA4404)‐mediated embryogenic callus (Nipponbare) transformation.

Article Title: miR-214-mediated downregulation of RNF8 induces chromosomal instability in ovarian cancer cells
Article Snippet: .. The enzymes for cDNA amplification were purchased by PrimeSTAR (Takara, R044A). .. The sequences of inserted DNA fragments were verified by DNA sequencing.

Plasmid Preparation:

Article Title: The rice Os NAC6 transcription factor orchestrates multiple molecular mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance
Article Snippet: .. To generate OsNAC6::GUS transgenic plants, a 2‐kb promoter region (upstream region of the ATG start codon) of OsNAC6 was amplified using PrimeSTAR HS DNA Polymerase (5′‐CTGCAGTGTGCAAACTTTCAATG TTGAC‐3′ and 5′‐GAATTCCTCTCTCCCCCTTCTCCGGT‐3′) and ligated upstream of the β‐glucuronidase (GUS ) reporter gene in the rice transformation vector pCAMBIA1391Z using the Eco R1 and Pst 1 restriction sites. .. Transgenic plants were obtained by Agrobacterium tumefaciens (LBA4404)‐mediated embryogenic callus (Nipponbare) transformation.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    TaKaRa primestar gc buffer
    Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Primestar Gc Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primestar gc buffer/product/TaKaRa
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    primestar gc buffer - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    85
    TaKaRa gc genomic pcr reaction buffer
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Gc Genomic Pcr Reaction Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc genomic pcr reaction buffer/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gc genomic pcr reaction buffer - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    TaKaRa special gc buffer i
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Special Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/special gc buffer i/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    special gc buffer i - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    93
    TaKaRa gc buffer
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Gc Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 194 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc buffer/product/TaKaRa
    Average 93 stars, based on 194 article reviews
    Price from $9.99 to $1999.99
    gc buffer - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). PrimeSTAR HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).

    Journal: Nucleic Acids Research

    Article Title: Mechanical properties of DNA-like polymers

    doi: 10.1093/nar/gkt808

    Figure Lengend Snippet: Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). PrimeSTAR HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).

    Article Snippet: For analogs 3 , 4 , 5 , 6 and 9 , PCR reactions (100 µl) included 20 ng template, 0.4 mM forward and reverse primers, PrimeSTAR GC buffer (Takara), 0.2 mM each dNTP (again with dTTP completely replaced with analog, except for variant 9 , which completely replaced dATP), 2 M betaine (Sigma-Aldrich) and 5 U PrimeSTAR HS DNA polymerase (Takara).

    Techniques: Polymerase Chain Reaction, Polyacrylamide Gel Electrophoresis, Marker, Chromatography, Flow Cytometry

    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the PCR-based methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, Msp I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.

    Journal: British Journal of Cancer

    Article Title: Methylation analysis of the glypican 3 gene in embryonal tumours

    doi: 10.1038/sj.bjc.6601716

    Figure Lengend Snippet: Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the PCR-based methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, Msp I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.

    Article Snippet: Polymerase chain reactions were performed in a total volume of 20 μ l containing 1 μ l of the Hpa II or Msp I digestion reactions (10 ng of genomic DNA), 1 × of ‘GC Genomic PCR Reaction Buffer’ (Clontech, Palo Alto, CA, USA), 1.1 mM Mg(OAc)2 , 200 μ M of each of the four dNTPs, 1 M ‘GC-Melt’ (Clontech, Palo Alto, CA, USA), 0.4 μ M of each primer (proximal sites: B2 (ACGTGCTGCTACCCAGCCGCTGCA) and L2 (GGAACTTCTCCCAGAGCCAGTCAGAGCG); distal sites: E2 (CCGCTCATTGGCCTACAGCCTGGAGGGC) and J2 (TATTCAAAGGTGAGGCAGGCTGTGAAAAGC)) and 1 × of ‘Advantage GC Genomic Polymerase Mix’ (Clontech, Palo Alto, CA, USA).

    Techniques: Methylation, Polymerase Chain Reaction, Southern Blot, Amplification, Expressing

    Methylation analysis of the GPC3 promoter in tumour cell DNA samples. PCR- ( A ) and Southern blot- ( B ) based methylation assays were performed on tumour cell DNA samples from NB cell lines (SK-N-AS, SK-N-SH), primary NBs (N4, N5) and primary WTs (WT51, WT116, WT158, WT177). Only results for samples with abnormal DNA methylation patterns are shown. Digestions: ( A ) H: Hpa II; M: Msp I; U: undigested; ( B ) H: Hind III; B: Bss HII; S: Sac II and E: Eag I.

    Journal: British Journal of Cancer

    Article Title: Methylation analysis of the glypican 3 gene in embryonal tumours

    doi: 10.1038/sj.bjc.6601716

    Figure Lengend Snippet: Methylation analysis of the GPC3 promoter in tumour cell DNA samples. PCR- ( A ) and Southern blot- ( B ) based methylation assays were performed on tumour cell DNA samples from NB cell lines (SK-N-AS, SK-N-SH), primary NBs (N4, N5) and primary WTs (WT51, WT116, WT158, WT177). Only results for samples with abnormal DNA methylation patterns are shown. Digestions: ( A ) H: Hpa II; M: Msp I; U: undigested; ( B ) H: Hind III; B: Bss HII; S: Sac II and E: Eag I.

    Article Snippet: Polymerase chain reactions were performed in a total volume of 20 μ l containing 1 μ l of the Hpa II or Msp I digestion reactions (10 ng of genomic DNA), 1 × of ‘GC Genomic PCR Reaction Buffer’ (Clontech, Palo Alto, CA, USA), 1.1 mM Mg(OAc)2 , 200 μ M of each of the four dNTPs, 1 M ‘GC-Melt’ (Clontech, Palo Alto, CA, USA), 0.4 μ M of each primer (proximal sites: B2 (ACGTGCTGCTACCCAGCCGCTGCA) and L2 (GGAACTTCTCCCAGAGCCAGTCAGAGCG); distal sites: E2 (CCGCTCATTGGCCTACAGCCTGGAGGGC) and J2 (TATTCAAAGGTGAGGCAGGCTGTGAAAAGC)) and 1 × of ‘Advantage GC Genomic Polymerase Mix’ (Clontech, Palo Alto, CA, USA).

    Techniques: Methylation, Polymerase Chain Reaction, Southern Blot, DNA Methylation Assay