Structured Review

TaKaRa gc buffer
Gc Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gc buffer/product/TaKaRa
Average 99 stars, based on 160 article reviews
Price from $9.99 to $1999.99
gc buffer - by Bioz Stars, 2020-01
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: OsLEA3-2, an Abiotic Stress Induced Gene of Rice Plays a Key Role in Salt and Drought Tolerance
Article Snippet: .. PCR was performed using a PrimeSTAR DNA polymerase (TaKaRa) with a GC buffer, and the products of which were then cloned into a pMD18-T vector (TaKaRa) and sent to be sequenced. .. Subcellular Localization of OsLEA3-2 Onion epidermal cells were bombarded with the construct of a double 35 S: GFP: OsLEA3-2 transgene using a particle gun-mediated system (PDS-1000/He; Bio-Rad) and were observed with a confocal microscope (Zeiss LSM510; Carl Zeiss MicroImaging GmbH, Jena, Germany).

Article Title: Identification of an enhancer region within the TP63/LEPREL1 locus containing genetic variants associated with bladder cancer risk
Article Snippet: Paragraph title: Cloning of enhancer reporter vectors ... The ΔNTP63 promoter region [ ], the LEPREL1 promoter region and the intergenic enhancer region were PCR-amplified using PrimeSTAR HS DNA polymerase and a GC buffer (Takara, Shiga, Japan).

Article Title: A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway
Article Snippet: Ex Taq and LA Taq with GC Buffer (Takara) were used for PCR amplification following the manufacturer’s protocol. .. PCR products were gel-purified with QIAquick (QIAGEN, Duesseldorf, Germany), cloned into the pGEM-T easy vector, and sequenced.

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: .. Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA). .. Long PCR cycling included a 1 min initial denaturation at 94°C, 14 cycles of 10 sec denaturation at 98°C and a 10 min annealing and extension at 68°C, 21 cycles of 10 sec denaturation at 98°C and a 10 min plus 5 sec/cycle annealing and extension at 68°C plus a final extension at 68°C for 10 min. To determine gene-corrected clones, exon 4 of FANCA was PCR-amplified with the following primers: 5′-TTGCCCACCGTTTCTCACTTTATTGAATGCAGACC-3′ and 5′-AGGCAACCATCCCGGCTGAGAGAATACCCA -3′ with Phusion High-Fidelity DNA Polymerase (NEB).

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: Paragraph title: 2.1.1. Cloning of rfaE from B. pseudomallei ... PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used.

Amplification:

Article Title: OsLEA3-2, an Abiotic Stress Induced Gene of Rice Plays a Key Role in Salt and Drought Tolerance
Article Snippet: The primer sets used in the 5′- and 3′-rapid amplification of cDNA ends experiments are listed in . .. PCR was performed using a PrimeSTAR DNA polymerase (TaKaRa) with a GC buffer, and the products of which were then cloned into a pMD18-T vector (TaKaRa) and sent to be sequenced.

Article Title: Sino Longitudinal Study on Cognitive Decline (SILCODE): protocol for a Chinese longitudinal observational study to develop risk prediction models of conversion to mild cognitive impairment in individuals with subjective cognitive decline
Article Snippet: .. ApoE will be amplified using the following conditions: 1 cycle of 98°C for 10 s, 35 cycles of 72°C for 5 s, 1 cycle of 72°C for 5 min. PCR was performed in a final volume of 30 µl, containing 10 pmol of forward and reverse primers and 50 ng of genomic DNA template, using PrimeSTAR HS DNA Polymerase with GC Buffer (Takara Bio, Kusatsu, Shiga, Japan). ..

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol. .. The amplification protocol included an initial one-minute denaturing step at 94 °C, 30 cycles at 94 °C for 30 seconds, 55 °C for 30 seconds, 72 °C for two minutes, and a final elongation step at 72 °C for five minutes.

Article Title: Identification of an enhancer region within the TP63/LEPREL1 locus containing genetic variants associated with bladder cancer risk
Article Snippet: The ΔNTP63 promoter region [ ], the LEPREL1 promoter region and the intergenic enhancer region were PCR-amplified using PrimeSTAR HS DNA polymerase and a GC buffer (Takara, Shiga, Japan). .. For isolation of the enhancer (E1) containing the risk and the non-risk haplotypes (AA and GG, respectively), the region encompassing rs4687103 and rs4687104 was amplified.

Article Title: The co-existence of NS5A and NS5B resistance-associated substitutions is associated with virologic failure in Hepatitis C Virus genotype 1 patients treated with sofosbuvir and ledipasvir
Article Snippet: .. The target HCV genome was amplified by a nested PCR using PrimeSTAR GXL DNA Polymerase or LA Taq with GC Buffer (TaKaRa Bio). ..

Article Title: Single Amino Acid Polymorphisms of Pertussis Toxin Subunit S2 (PtxB) Affect Protein Function
Article Snippet: .. Amplification of the region containing whole ptxB gene of each strain were performed using PtxXB-F (gcatcgcgtattcgttctagac) and PtxXB-R (tatgccgagcacggacaa), using PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio, Ohtsu, Japan). ..

Article Title: A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4
Article Snippet: PCR of the SOX10 exons was performed in a total volume of 50 μL containing 60 ng of genomic DNA, 400 nM each of the forward and reverse primers, 40 mM dNTPs, and 2.5 U LA Taq DNA polymerase with GC buffer I from TAKARA (Tokyo, Japan). .. The amplification consisted of an initial denaturation stage at 94 °C for 3 min, followed by 35 cycles consisting of denaturation at 94 °C for 30 s, annealing for 30 s at 60 °C, and extension at 72 °C for 50 s, with an extension step performed at 72 °C for 3 min. Amplification of exons for the remaining genes was performed using 2× PCR master mix under similar conditions, except for annealing at 57 °C.

Article Title: Microbial Diversity in Sediments from the Bottom of the Challenger Deep, the Mariana Trench
Article Snippet: .. These SSU rRNA gene fragments were amplified from environmental DNA assemblages using LA Taq polymerase with GC buffer (Takara Bio, Kusatsu, Japan). .. In the archaeal amoA clone analysis, the primer set arch-amoAF/arch-amoAR ( ) was used with EX Taq polymerase (Takara Bio) to amplify gene fragments from the environmental DNA assemblages as described previously ( ).

Article Title: A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway
Article Snippet: .. Ex Taq and LA Taq with GC Buffer (Takara) were used for PCR amplification following the manufacturer’s protocol. .. PCR products were gel-purified with QIAquick (QIAGEN, Duesseldorf, Germany), cloned into the pGEM-T easy vector, and sequenced.

Article Title: Identification of a novel nonsense mutation of the neurotrophic tyrosine kinase receptor type 1 gene in two siblings with congenital insensitivity to pain with anhidrosis
Article Snippet: .. All 17 exons and intron–exon boundaries of NRTK1 were amplified by PCR using LA Taq with GC buffer (TaKaRa, Shiga, Japan). .. After an initial denaturation at 95℃ for 3 min, 35 cycles of amplification were performed, with denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 45 s; a final extension was then carried out at 72℃ for 7 min. Amplified DNA fragments were purified and sequenced in both directions using an ABI 3130 Genetic Analyzer (Applied Biosystems).

Synthesized:

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: Total RNA was extracted from PBMC using the EasyPure RNA Kit (Transgen, Beijing, China), and cDNA was synthesized from the total RNA sample using the TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for PCR (Transgen, Beijing, China). .. To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan).

Construct:

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: Construction of Fab phage display libraries Fab phage display libraries were constructed using the pComb3X vector expression system based on a well-established protocol (Protocol 9.1: Human Fab Libraries)[ ]. .. To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan).

Electrophoresis:

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol. .. Successful PCR amplification was verified by electrophoresis on a 1% agarose gel with 5 µL of each PCR product and 2 µL of 6x loading dye.

Incubation:

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used. .. The PCR product treated with T4 DNA polymerase (New England Biolabs, Beverley, Massachusetts, USA) in the presence of dTTP was ligated with the digested vector incubated with T4 DNA polymerase in the presence of dATP.

Expressing:

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used. .. The LIC expression vector pB2 (Kim et al. , 2005 ), which expresses the cloned gene fused to a noncleavable N-terminal His6 tag, was digested with SmaI.

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: Construction of Fab phage display libraries Fab phage display libraries were constructed using the pComb3X vector expression system based on a well-established protocol (Protocol 9.1: Human Fab Libraries)[ ]. .. To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan).

Transformation Assay:

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used. .. The ligation product was transformed into DH5α competent cells.

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan). .. Recombinant plasmids were transformed into competent Escherichia coli (E . coli ) TG1 cells by electroporation (Bio-Rad, Hercules, CA, USA).

Electroporation:

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan). .. Recombinant plasmids were transformed into competent Escherichia coli (E . coli ) TG1 cells by electroporation (Bio-Rad, Hercules, CA, USA).

Ligation:

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: The primer sequences used for ligation-independent cloning (LIC) are shown in Table 1 . .. PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used.

Infection:

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: The M3 virus, which has a partial LAT deletion mutation, was harvested from the infected 293T cells at 48 h.p.i., and viral genomic DNA was extracted using the TIANamp Virus RNA/DNA Kit (Tiangen, Beijing, China). .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: Two to four days after infection, G418 (25-450 μg/ml; Invitrogen) was added to the medium to start positive selection. .. Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA).

Generated:

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA). .. Finally, one gene-corrected clone was generated.

Imaging:

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: The products were analyzed on 1.5% agarose gels, which were stained with ethidium bromide (EB) and imaged using a Bio-Rad Gel Doc gel imaging system (Bio-Rad, California, USA). .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Polymerase Chain Reaction:

Article Title: OsLEA3-2, an Abiotic Stress Induced Gene of Rice Plays a Key Role in Salt and Drought Tolerance
Article Snippet: .. PCR was performed using a PrimeSTAR DNA polymerase (TaKaRa) with a GC buffer, and the products of which were then cloned into a pMD18-T vector (TaKaRa) and sent to be sequenced. .. Subcellular Localization of OsLEA3-2 Onion epidermal cells were bombarded with the construct of a double 35 S: GFP: OsLEA3-2 transgene using a particle gun-mediated system (PDS-1000/He; Bio-Rad) and were observed with a confocal microscope (Zeiss LSM510; Carl Zeiss MicroImaging GmbH, Jena, Germany).

Article Title: Sino Longitudinal Study on Cognitive Decline (SILCODE): protocol for a Chinese longitudinal observational study to develop risk prediction models of conversion to mild cognitive impairment in individuals with subjective cognitive decline
Article Snippet: .. ApoE will be amplified using the following conditions: 1 cycle of 98°C for 10 s, 35 cycles of 72°C for 5 s, 1 cycle of 72°C for 5 min. PCR was performed in a final volume of 30 µl, containing 10 pmol of forward and reverse primers and 50 ng of genomic DNA template, using PrimeSTAR HS DNA Polymerase with GC Buffer (Takara Bio, Kusatsu, Shiga, Japan). ..

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: .. PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol. .. Briefly, the PCR reaction contained 0.25 ul of LA Taq, 12.5 ul of 2x GC Buffer 1, 4 ul of 2.5 mM dNTP, 1 ul of 20 ng/ul forward primer, 1 ul of 20 ng/ul reverse primer, 1 ul of 20 ng/ul sample DNA, and 4.25 ul of ddH2O.

Article Title: Identification of an enhancer region within the TP63/LEPREL1 locus containing genetic variants associated with bladder cancer risk
Article Snippet: .. The ΔNTP63 promoter region [ ], the LEPREL1 promoter region and the intergenic enhancer region were PCR-amplified using PrimeSTAR HS DNA polymerase and a GC buffer (Takara, Shiga, Japan). ..

Article Title: The co-existence of NS5A and NS5B resistance-associated substitutions is associated with virologic failure in Hepatitis C Virus genotype 1 patients treated with sofosbuvir and ledipasvir
Article Snippet: The target HCV genome was amplified by a nested PCR using PrimeSTAR GXL DNA Polymerase or LA Taq with GC Buffer (TaKaRa Bio). .. Reverse transcription was performed at 37°C for 15 minutes and terminated at 85°C for 5 seconds, followed by the first-round PCR over 30 cycles, with each cycle consisting of denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds and extension at 68°C for 60 seconds.

Article Title: A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4
Article Snippet: .. PCR of the SOX10 exons was performed in a total volume of 50 μL containing 60 ng of genomic DNA, 400 nM each of the forward and reverse primers, 40 mM dNTPs, and 2.5 U LA Taq DNA polymerase with GC buffer I from TAKARA (Tokyo, Japan). .. The amplification consisted of an initial denaturation stage at 94 °C for 3 min, followed by 35 cycles consisting of denaturation at 94 °C for 30 s, annealing for 30 s at 60 °C, and extension at 72 °C for 50 s, with an extension step performed at 72 °C for 3 min. Amplification of exons for the remaining genes was performed using 2× PCR master mix under similar conditions, except for annealing at 57 °C.

Article Title: Antioxidant enzyme, 3-mercaptopyruvate sulfurtransferase-knockout mice exhibit increased anxiety-like behaviors: a model for human mercaptolactate-cysteine disulfiduria
Article Snippet: .. PCR for genotyping PCR was performed using LA Taq with GC buffer (Takara Bio Inc., Shiga, Japan). ..

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R. .. The products were analyzed on 1.5% agarose gels, which were stained with EB and imaged using the Bio-Rad Gel Doc gel imaging system.

Article Title: Microbial Diversity in Sediments from the Bottom of the Challenger Deep, the Mariana Trench
Article Snippet: In clone analyses of archaeal and bacterial SSU rRNA genes, the primer sets Arch21F/Arch958R ( ) and Bac27F/Bac927R ( , ) were used, respectively, for PCR amplification. .. These SSU rRNA gene fragments were amplified from environmental DNA assemblages using LA Taq polymerase with GC buffer (Takara Bio, Kusatsu, Japan).

Article Title: A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway
Article Snippet: .. Ex Taq and LA Taq with GC Buffer (Takara) were used for PCR amplification following the manufacturer’s protocol. .. PCR products were gel-purified with QIAquick (QIAGEN, Duesseldorf, Germany), cloned into the pGEM-T easy vector, and sequenced.

Article Title: Identification of a novel nonsense mutation of the neurotrophic tyrosine kinase receptor type 1 gene in two siblings with congenital insensitivity to pain with anhidrosis
Article Snippet: .. All 17 exons and intron–exon boundaries of NRTK1 were amplified by PCR using LA Taq with GC buffer (TaKaRa, Shiga, Japan). .. After an initial denaturation at 95℃ for 3 min, 35 cycles of amplification were performed, with denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 45 s; a final extension was then carried out at 72℃ for 7 min. Amplified DNA fragments were purified and sequenced in both directions using an ABI 3130 Genetic Analyzer (Applied Biosystems).

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: .. Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA). .. Long PCR cycling included a 1 min initial denaturation at 94°C, 14 cycles of 10 sec denaturation at 98°C and a 10 min annealing and extension at 68°C, 21 cycles of 10 sec denaturation at 98°C and a 10 min plus 5 sec/cycle annealing and extension at 68°C plus a final extension at 68°C for 10 min. To determine gene-corrected clones, exon 4 of FANCA was PCR-amplified with the following primers: 5′-TTGCCCACCGTTTCTCACTTTATTGAATGCAGACC-3′ and 5′-AGGCAACCATCCCGGCTGAGAGAATACCCA -3′ with Phusion High-Fidelity DNA Polymerase (NEB).

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: The rfaE gene coding for the HldC protein (NCBI Reference Sequence ) was amplifled by PCR using 200 ng B. pseudomallei genomic DNA template and 50 µ M of primers. .. PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used.

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: .. To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan). .. The resultant Fab gene segments were digested with restriction enzyme Sfi I (New England Biolabs, Ipswich, MA, USA), and ligated into the phagemid pComb3XSS that had been cut with the same restriction enzyme using T4 DNA Ligase (New England Biolabs, Ipswich, MA, USA).

Recombinant:

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: Paragraph title: Construction of recombinant mutant viruses ... The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan). .. Recombinant plasmids were transformed into competent Escherichia coli (E . coli ) TG1 cells by electroporation (Bio-Rad, Hercules, CA, USA).

DNA Sequencing:

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: Paragraph title: DNA sequencing ... PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol.

Article Title: Single Amino Acid Polymorphisms of Pertussis Toxin Subunit S2 (PtxB) Affect Protein Function
Article Snippet: DNA sequencing and alleles of ptxA and prn were performed as described by Mooi et al [ ]. .. Amplification of the region containing whole ptxB gene of each strain were performed using PtxXB-F (gcatcgcgtattcgttctagac) and PtxXB-R (tatgccgagcacggacaa), using PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio, Ohtsu, Japan).

Plaque Assay:

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: After detecting the mutation efficiency, the mutated virus was purified via a plaque assay. .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Mutagenesis:

Article Title: A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4
Article Snippet: Paragraph title: Mutation screening ... PCR of the SOX10 exons was performed in a total volume of 50 μL containing 60 ng of genomic DNA, 400 nM each of the forward and reverse primers, 40 mM dNTPs, and 2.5 U LA Taq DNA polymerase with GC buffer I from TAKARA (Tokyo, Japan).

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: Paragraph title: Construction of recombinant mutant viruses ... The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Isolation:

Article Title: OsLEA3-2, an Abiotic Stress Induced Gene of Rice Plays a Key Role in Salt and Drought Tolerance
Article Snippet: Cloning and Sequencing of the Full-length OsLEA cDNA The total RNA isolated from 200 mM NaCl treated seedlings was used to clone the OsLEA gene. .. PCR was performed using a PrimeSTAR DNA polymerase (TaKaRa) with a GC buffer, and the products of which were then cloned into a pMD18-T vector (TaKaRa) and sent to be sequenced.

Article Title: Identification of an enhancer region within the TP63/LEPREL1 locus containing genetic variants associated with bladder cancer risk
Article Snippet: Cloning of enhancer reporter vectors DNA was isolated from fresh frozen tissue samples (normal bladder adjacent to tumor) using a QIAamp DNA Mini kit (QIAGEN, Hilden, Germany), according to manufacturer’s instructions. .. The ΔNTP63 promoter region [ ], the LEPREL1 promoter region and the intergenic enhancer region were PCR-amplified using PrimeSTAR HS DNA polymerase and a GC buffer (Takara, Shiga, Japan).

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: Paragraph title: Isolation of gene-corrected human iPSCs ... Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA).

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: Peripheral blood mononuclear cells (PBMC) were isolated from fresh whole blood within 2 h after collection using the Lymphocyte Separation Medium (TBDsciences, Tianjin, China). .. To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan).

Size-exclusion Chromatography:

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA). .. Long PCR cycling included a 1 min initial denaturation at 94°C, 14 cycles of 10 sec denaturation at 98°C and a 10 min annealing and extension at 68°C, 21 cycles of 10 sec denaturation at 98°C and a 10 min plus 5 sec/cycle annealing and extension at 68°C plus a final extension at 68°C for 10 min. To determine gene-corrected clones, exon 4 of FANCA was PCR-amplified with the following primers: 5′-TTGCCCACCGTTTCTCACTTTATTGAATGCAGACC-3′ and 5′-AGGCAACCATCCCGGCTGAGAGAATACCCA -3′ with Phusion High-Fidelity DNA Polymerase (NEB).

Purification:

Article Title: A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4
Article Snippet: PCR of the SOX10 exons was performed in a total volume of 50 μL containing 60 ng of genomic DNA, 400 nM each of the forward and reverse primers, 40 mM dNTPs, and 2.5 U LA Taq DNA polymerase with GC buffer I from TAKARA (Tokyo, Japan). .. PCR products were purified and sequenced using an ABI 3500 Dx genetic analyser with a BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, CA, USA), and the sequences were analysed using NCBI BLAST ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ).

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: After detecting the mutation efficiency, the mutated virus was purified via a plaque assay. .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Article Title: Identification of a novel nonsense mutation of the neurotrophic tyrosine kinase receptor type 1 gene in two siblings with congenital insensitivity to pain with anhidrosis
Article Snippet: All 17 exons and intron–exon boundaries of NRTK1 were amplified by PCR using LA Taq with GC buffer (TaKaRa, Shiga, Japan). .. After an initial denaturation at 95℃ for 3 min, 35 cycles of amplification were performed, with denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 45 s; a final extension was then carried out at 72℃ for 7 min. Amplified DNA fragments were purified and sequenced in both directions using an ABI 3130 Genetic Analyzer (Applied Biosystems).

Sequencing:

Article Title: OsLEA3-2, an Abiotic Stress Induced Gene of Rice Plays a Key Role in Salt and Drought Tolerance
Article Snippet: Paragraph title: Cloning and Sequencing of the Full-length OsLEA cDNA ... PCR was performed using a PrimeSTAR DNA polymerase (TaKaRa) with a GC buffer, and the products of which were then cloned into a pMD18-T vector (TaKaRa) and sent to be sequenced.

Article Title: Sino Longitudinal Study on Cognitive Decline (SILCODE): protocol for a Chinese longitudinal observational study to develop risk prediction models of conversion to mild cognitive impairment in individuals with subjective cognitive decline
Article Snippet: ApoE will be genotyped using the standard Sanger sequencing method (Sangon, Shanghai, China) using the following primers: 5ʹ-ACGCGGGCACGGCTGTCCAAGG-3ʹ (forward) and 5ʹ-GGCGCTCGCGGATGGCGCTGA-3ʹ (reverse). .. ApoE will be amplified using the following conditions: 1 cycle of 98°C for 10 s, 35 cycles of 72°C for 5 s, 1 cycle of 72°C for 5 min. PCR was performed in a final volume of 30 µl, containing 10 pmol of forward and reverse primers and 50 ng of genomic DNA template, using PrimeSTAR HS DNA Polymerase with GC Buffer (Takara Bio, Kusatsu, Shiga, Japan).

Article Title: The co-existence of NS5A and NS5B resistance-associated substitutions is associated with virologic failure in Hepatitis C Virus genotype 1 patients treated with sofosbuvir and ledipasvir
Article Snippet: The detection of HCV RASs As described in detail previously [ ], we investigated the viral genome sequence by direct sequencing. .. The target HCV genome was amplified by a nested PCR using PrimeSTAR GXL DNA Polymerase or LA Taq with GC Buffer (TaKaRa Bio).

Article Title: Single Amino Acid Polymorphisms of Pertussis Toxin Subunit S2 (PtxB) Affect Protein Function
Article Snippet: Paragraph title: Sequencing ... Amplification of the region containing whole ptxB gene of each strain were performed using PtxXB-F (gcatcgcgtattcgttctagac) and PtxXB-R (tatgccgagcacggacaa), using PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio, Ohtsu, Japan).

Article Title: A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4
Article Snippet: PCR of the SOX10 exons was performed in a total volume of 50 μL containing 60 ng of genomic DNA, 400 nM each of the forward and reverse primers, 40 mM dNTPs, and 2.5 U LA Taq DNA polymerase with GC buffer I from TAKARA (Tokyo, Japan). .. PCR products were purified and sequenced using an ABI 3500 Dx genetic analyser with a BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, CA, USA), and the sequences were analysed using NCBI BLAST ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ).

Article Title: Microbial Diversity in Sediments from the Bottom of the Challenger Deep, the Mariana Trench
Article Snippet: Paragraph title: Sequencing analyses ... These SSU rRNA gene fragments were amplified from environmental DNA assemblages using LA Taq polymerase with GC buffer (Takara Bio, Kusatsu, Japan).

Article Title: Identification of a novel nonsense mutation of the neurotrophic tyrosine kinase receptor type 1 gene in two siblings with congenital insensitivity to pain with anhidrosis
Article Snippet: All 17 exons and intron–exon boundaries of NRTK1 were amplified by PCR using LA Taq with GC buffer (TaKaRa, Shiga, Japan). .. The resulting sequences were analysed and compared with the reference sequence of NTRK1 (NM_002529.3) in the NCBI database.

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: The rfaE gene coding for the HldC protein (NCBI Reference Sequence ) was amplifled by PCR using 200 ng B. pseudomallei genomic DNA template and 50 µ M of primers. .. PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used.

CRISPR:

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R. .. The products were analyzed on 1.5% agarose gels, which were stained with EB and imaged using the Bio-Rad Gel Doc gel imaging system.

Nested PCR:

Article Title: The co-existence of NS5A and NS5B resistance-associated substitutions is associated with virologic failure in Hepatitis C Virus genotype 1 patients treated with sofosbuvir and ledipasvir
Article Snippet: .. The target HCV genome was amplified by a nested PCR using PrimeSTAR GXL DNA Polymerase or LA Taq with GC Buffer (TaKaRa Bio). ..

Plasmid Preparation:

Article Title: OsLEA3-2, an Abiotic Stress Induced Gene of Rice Plays a Key Role in Salt and Drought Tolerance
Article Snippet: .. PCR was performed using a PrimeSTAR DNA polymerase (TaKaRa) with a GC buffer, and the products of which were then cloned into a pMD18-T vector (TaKaRa) and sent to be sequenced. .. Subcellular Localization of OsLEA3-2 Onion epidermal cells were bombarded with the construct of a double 35 S: GFP: OsLEA3-2 transgene using a particle gun-mediated system (PDS-1000/He; Bio-Rad) and were observed with a confocal microscope (Zeiss LSM510; Carl Zeiss MicroImaging GmbH, Jena, Germany).

Article Title: A Novel lnc-RNA, Named lnc-ORA, Is Identified by RNA-Seq Analysis, and Its Knockdown Inhibits Adipogenesis by Regulating the PI3K/AKT/mTOR Signaling Pathway
Article Snippet: Ex Taq and LA Taq with GC Buffer (Takara) were used for PCR amplification following the manufacturer’s protocol. .. PCR products were gel-purified with QIAquick (QIAGEN, Duesseldorf, Germany), cloned into the pGEM-T easy vector, and sequenced.

Article Title: Expression and crystallographic studies of d-glycero-β-d-manno-heptose-1-phosphate adenylyltransferase from Burkholderia pseudomallei
Article Snippet: PrimeSTAR HS DNA polymerase with GC buffer (Takara Bio Inc., Shiga, Japan) designed for high-GC-content genomic DNA was used. .. The LIC expression vector pB2 (Kim et al. , 2005 ), which expresses the cloned gene fused to a noncleavable N-terminal His6 tag, was digested with SmaI.

Article Title: Development of two antigen-binding fragments to a conserved linear epitope of human adenovirus and their application in immunofluorescence
Article Snippet: Construction of Fab phage display libraries Fab phage display libraries were constructed using the pComb3X vector expression system based on a well-established protocol (Protocol 9.1: Human Fab Libraries)[ ]. .. To generate Fab gene segments, a three-step PCR method was performed using PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa, Tokyo, Japan).

Software:

Article Title: Identification of an enhancer region within the TP63/LEPREL1 locus containing genetic variants associated with bladder cancer risk
Article Snippet: The ΔNTP63 promoter region [ ], the LEPREL1 promoter region and the intergenic enhancer region were PCR-amplified using PrimeSTAR HS DNA polymerase and a GC buffer (Takara, Shiga, Japan). .. Haplotypes were determined using Haploview software [ ].

Selection:

Article Title: Modeling Fanconi Anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs
Article Snippet: After 10-13 days, 4 μM Ganciclovir (GANC; Invitrogen) in addition to G418 was added to the medium to start negative selection. .. Gene-targeted clones were determined by PCR of genomic DNA from drug-resistant clones with the following primers (P1, 5′- GGAACCCACTGGTCATGTTTGCTTTTGCCCAT -3′; P2, 5′-CCCCAAAGGCCTACCCGCTTCCATTGCTCA-3′; P3, 5′-CTACCTGCCCATTCGACCACCAAGCGAAACATC-3′; P4, 5′-TACCAGGTTATAGTAGCTCAGGAATGCTAAGTCGCTCA-3′; see ) using LA Taq DNA Polymerase and GC Buffer (TAKARA).

Agarose Gel Electrophoresis:

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol. .. Successful PCR amplification was verified by electrophoresis on a 1% agarose gel with 5 µL of each PCR product and 2 µL of 6x loading dye.

Proximity Ligation Assay:

Article Title: A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4
Article Snippet: Some of the primers used in the study were referenced from a master’s thesis (title here, Dong Siqi; Chinese PLA General Hospital, Beijing, China), and other primers were designed using Primer 5. .. PCR of the SOX10 exons was performed in a total volume of 50 μL containing 60 ng of genomic DNA, 400 nM each of the forward and reverse primers, 40 mM dNTPs, and 2.5 U LA Taq DNA polymerase with GC buffer I from TAKARA (Tokyo, Japan).

Staining:

Article Title: Attenuated phenotypes and analysis of a herpes simplex virus 1 strain with partial deletion of the UL7, UL41 and LAT genes
Article Snippet: The products were analyzed on 1.5% agarose gels, which were stained with ethidium bromide (EB) and imaged using a Bio-Rad Gel Doc gel imaging system (Bio-Rad, California, USA). .. The genomic region surrounding the CRISPR target site of the LAT gene was PCR-amplified using PrimeSTAR HS DNA polymerase with GC buffer (TAKARA, Dalian, China) and the primers LAT-F and LAT-R.

Spectrophotometry:

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: Genomic DNA was quantified and evaluated for quality and purity using NanoDrop One Spectrophotometer (Thermo Fisher). .. PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol.

Lysis:

Article Title: Effect of a phosphodiesterase-5A (PDE5A) gene polymorphism on response to sildenafil therapy in canine pulmonary hypertension
Article Snippet: The white blood cell pellet was then resuspended in cell lysis solution overnight at room temperature. .. PCR reaction was performed with LA Taq with GC Buffer (Takara Bio USA) following the manufacturer protocol.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    TaKaRa primestar hs dna polymerase mix
    Primestar Hs Dna Polymerase Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 259 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primestar hs dna polymerase mix/product/TaKaRa
    Average 87 stars, based on 259 article reviews
    Price from $9.99 to $1999.99
    primestar hs dna polymerase mix - by Bioz Stars, 2020-01
    87/100 stars
      Buy from Supplier

    Image Search Results