Journal: Journal of Oral Microbiology
Article Title: Oral Fusobacterium nucleatum resists the acidic pH of the stomach due to membrane erucic acid synthesized via enoyl-CoA hydratase-related protein FnFabM
doi: 10.1080/20002297.2025.2453964
Figure Lengend Snippet: Viability of simulated oral flora in the Dynamic pH Model System and robust viability of Fusobacterium nucleatum , demonstrating superior acid resistance in extreme acid conditions. (a) Bacterial viability determination of the simulating oral flora in the Dynamic in vitro human upper GI tract model system. A total of 19 bacterial suspensions were prepared and mixed together to simulate the oral bacteria communities. Samples (1 ml) were taken from the stomach reactor at 0, 15, 30, 60 and 90 minutes, and from the duodenum reactor at 2, 3, 3.5, 4.5 and 5.5 hours. Bacterial viability was determined using the LIVE/DEAD BacLight bacterial viability kit. (b) Acid resistance test of oral bacterial communities in a series of different pH solutions without enzymes. A total of 19 bacteria suspensions were prepared and mixed together to simulate the oral bacteria communities. The bacterial mixture (1 ml) was centrifuged at 10,000×g for 5 min at 4°C, resuspended with various pH solutions, and incubated in an anaerobic workstation with an atmosphere of 5% CO 2 , 10% H 2 and 85% N 2 at 37°C for the corresponding timepoints. Bacterial viability was determined using the LIVE/DEAD BacLight bacterial viability kit. (c) 16S rRNA sequencing of stained bacteria indicated the extraordinarily high viability of Fusobacterium in acid environments. The stained bacteria suspension was transferred into a flow cytometry tube and sorted using a MoFlo XDP cell Sorter (Beckman Coulter), followed by 16S rRNA sequencing. (d) Acid survival tests of six strains of Fusobacterium bacteria members indicated robust viability of F. nucleatum under pH 1.5 condition. F. nucleatum showed the best acid resistance compared with the other tested Fusobacterium bacteria under pH 1.5 condition. Acid survival tests of (e) F. nucleatum ATCC 25586, (f) F. nucleatum (612), (g) F. necrophorum (M530), and (h) F. mortiferum at pH 1.5, pH 3.5, and pH 7.2. The experiment was performed three times. The data are expressed as mean ± standard deviation (SD) or standard error of the mean (SEM). The p values are indicated.
Article Snippet: For each of the aforementioned treatments, four independent biological replicates were analyzed and the mRNA of the Fusobacterium nucleatum subsp. nucleatum ATCC 25586 DNA-directed RNA polymerase beta chain ( rpoB ) gene (GenBank: GQ274958.1) was used as a reference gene for the normalization of the expression data ( FnrpoB forward primer: TGCAGAAGCAGAAGCTTTCA and FnrpoB Reverse primer: ACTGTTACTTGATCTCCTGGTCT).
Techniques: In Vitro, Bacteria, Incubation, Sequencing, Staining, Suspension, Flow Cytometry, Standard Deviation
ATCC is a verified supplier 
ATCC manufactures this product 
