fks1 mutant strains  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATCC fks1 mutant strains
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 Mutant Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 mutant strains/product/ATCC
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 mutant strains - by Bioz Stars, 2024-03
    90/100 stars

    Images

    1) Product Images from "Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates"

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    Journal: Medical mycology

    doi: 10.1093/mmy/myt007

     . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 mutants.

    Techniques Used: Activity Assay, Mutagenesis

     . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1 mutants.

    Techniques Used: Mutagenesis

    Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.

    Techniques Used: Concentration Assay, Crystal Violet Assay

    Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.

    Techniques Used: Activity Assay, Concentration Assay, XTT Assay

    Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.
    Figure Legend Snippet: Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.

    Techniques Used: Electron Microscopy

    mutants fks1 v595i  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC mutants fks1 v595i
    Mutants Fks1 V595i, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutants fks1 v595i/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutants fks1 v595i - by Bioz Stars, 2024-03
    86/100 stars

    Images

    fks1 r658g mutant confers echinocandin resistance  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC fks1 r658g mutant confers echinocandin resistance
    Fks1 R658g Mutant Confers Echinocandin Resistance, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 r658g mutant confers echinocandin resistance/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 r658g mutant confers echinocandin resistance - by Bioz Stars, 2024-03
    86/100 stars

    Images

    mutant carrying fks1 r658g  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC mutant carrying fks1 r658g
    Mutant Carrying Fks1 R658g, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant carrying fks1 r658g/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant carrying fks1 r658g - by Bioz Stars, 2024-03
    86/100 stars

    Images

    fks1 r658g mutant  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC fks1 r658g mutant
    Fks1 R658g Mutant, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 r658g mutant/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 r658g mutant - by Bioz Stars, 2024-03
    86/100 stars

    Images

    mutant carrying fks1 r658g  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC mutant carrying fks1 r658g
    Mutant Carrying Fks1 R658g, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant carrying fks1 r658g/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant carrying fks1 r658g - by Bioz Stars, 2024-03
    86/100 stars

    Images

    mutant harbouring fks1 s656p  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC mutant harbouring fks1 s656p
    Strain characteristics of the pan-echinocandin resistant C. parapsilosis clinical isolate. (A) In vitro susceptibility to nine common antifungal drugs. The dashed red line indicates the breakpoints for defining drug resistance or cut-off values for non-wild type. (B) Transmembrane helix predictions for <t>Fks1</t> of C. parapsilosis. The location of the amino acid 656 is labelled.
    Mutant Harbouring Fks1 S656p, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant harbouring fks1 s656p/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant harbouring fks1 s656p - by Bioz Stars, 2024-03
    86/100 stars

    Images

    1) Product Images from "Decreased echinocandin susceptibility in Candida parapsilosis causing candidemia and emergence of a pan-echinocandin resistant case in China"

    Article Title: Decreased echinocandin susceptibility in Candida parapsilosis causing candidemia and emergence of a pan-echinocandin resistant case in China

    Journal: Emerging Microbes & Infections

    doi: 10.1080/22221751.2022.2153086

    Strain characteristics of the pan-echinocandin resistant C. parapsilosis clinical isolate. (A) In vitro susceptibility to nine common antifungal drugs. The dashed red line indicates the breakpoints for defining drug resistance or cut-off values for non-wild type. (B) Transmembrane helix predictions for Fks1 of C. parapsilosis. The location of the amino acid 656 is labelled.
    Figure Legend Snippet: Strain characteristics of the pan-echinocandin resistant C. parapsilosis clinical isolate. (A) In vitro susceptibility to nine common antifungal drugs. The dashed red line indicates the breakpoints for defining drug resistance or cut-off values for non-wild type. (B) Transmembrane helix predictions for Fks1 of C. parapsilosis. The location of the amino acid 656 is labelled.

    Techniques Used: In Vitro

    Structural and functional effect of the S656P substitution in Fks1. (A) The predicted structural model for the variants of the Fks1 protein (amino acids 400∼900), the S656P substitution would result in the helix-to-coil transition, disrupting conformation of this ɑ-helix. (B) Echinocandin MICs for susceptible C. parapsilosis strain ATCC 22019 and its mutant harbouring Fks1 S656P, and the pan-echinocandin resistant clinical isolate TJ1197 and its mutant with WT of Fks1. (C) Changes in expression of the FKS1 and CHS3 genes in response to micafungin at the sub-MICs. (D) Echinocandin MICs for susceptible C. orthopsilosis ATCC 96139, C. metapsilosis ATCC 96143, and their mutants carrying homologous modifications, S649P and S656P, respectively. Dashed red lines indicate the breakpoints for defining drug resistance or cut-off values for non-wild type. AND, anidulafungin; CAS, caspofungin; MF, micafungin. **, P < 0.01; ***, P < 0.001.
    Figure Legend Snippet: Structural and functional effect of the S656P substitution in Fks1. (A) The predicted structural model for the variants of the Fks1 protein (amino acids 400∼900), the S656P substitution would result in the helix-to-coil transition, disrupting conformation of this ɑ-helix. (B) Echinocandin MICs for susceptible C. parapsilosis strain ATCC 22019 and its mutant harbouring Fks1 S656P, and the pan-echinocandin resistant clinical isolate TJ1197 and its mutant with WT of Fks1. (C) Changes in expression of the FKS1 and CHS3 genes in response to micafungin at the sub-MICs. (D) Echinocandin MICs for susceptible C. orthopsilosis ATCC 96139, C. metapsilosis ATCC 96143, and their mutants carrying homologous modifications, S649P and S656P, respectively. Dashed red lines indicate the breakpoints for defining drug resistance or cut-off values for non-wild type. AND, anidulafungin; CAS, caspofungin; MF, micafungin. **, P < 0.01; ***, P < 0.001.

    Techniques Used: Functional Assay, Mutagenesis, Expressing

    mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation
    (A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric <t>FKS1,</t> and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).
    Mutant 8 Fks1 649 Ura3r S Cerevisiae Antisense Gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg Generation, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation - by Bioz Stars, 2024-03
    86/100 stars

    Images

    1) Product Images from "Molecular Confirmation of the Relationship between Candida guilliermondii Fks1p Naturally Occurring Amino Acid Substitutions and Its Intrinsic Reduced Echinocandin Susceptibility"

    Article Title: Molecular Confirmation of the Relationship between Candida guilliermondii Fks1p Naturally Occurring Amino Acid Substitutions and Its Intrinsic Reduced Echinocandin Susceptibility

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.02644-16

    (A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric FKS1, and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).
    Figure Legend Snippet: (A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric FKS1, and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).

    Techniques Used: Isolation, Diffusion-based Assay

    Primers used in this study
    Figure Legend Snippet: Primers used in this study

    Techniques Used: Sequencing, Mutagenesis

    fks1 mutant strains  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATCC fks1 mutant strains
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 Mutant Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 mutant strains/product/ATCC
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 mutant strains - by Bioz Stars, 2024-03
    90/100 stars

    Images

    1) Product Images from "Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates"

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    Journal: Medical mycology

    doi: 10.1093/mmy/myt007

     . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 mutants.

    Techniques Used: Activity Assay, Mutagenesis

     . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1 mutants.

    Techniques Used: Mutagenesis

    Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.

    Techniques Used: Concentration Assay, Crystal Violet Assay

    Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.

    Techniques Used: Activity Assay, Concentration Assay, XTT Assay

    Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.
    Figure Legend Snippet: Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.

    Techniques Used: Electron Microscopy

    fks1 mutant strains  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATCC fks1 mutant strains
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 Mutant Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 mutant strains/product/ATCC
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 mutant strains - by Bioz Stars, 2024-03
    90/100 stars

    Images

    1) Product Images from "Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates"

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    Journal: Medical mycology

    doi: 10.1093/mmy/myt007

     . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 mutants.

    Techniques Used: Activity Assay, Mutagenesis

     . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1 mutants.

    Techniques Used: Mutagenesis

    Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.

    Techniques Used: Concentration Assay, Crystal Violet Assay

    Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.

    Techniques Used: Activity Assay, Concentration Assay, XTT Assay

    Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.
    Figure Legend Snippet: Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.

    Techniques Used: Electron Microscopy

    fks1 mutant strains  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATCC fks1 mutant strains
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 Mutant Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 mutant strains/product/ATCC
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 mutant strains - by Bioz Stars, 2024-03
    90/100 stars

    Images

    1) Product Images from "Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates"

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    Journal: Medical mycology

    doi: 10.1093/mmy/myt007

     . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 mutants.

    Techniques Used: Activity Assay, Mutagenesis

     . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1  mutants.
    Figure Legend Snippet: . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1 mutants.

    Techniques Used: Mutagenesis

    Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.

    Techniques Used: Concentration Assay, Crystal Violet Assay

    Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.
    Figure Legend Snippet: Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.

    Techniques Used: Activity Assay, Concentration Assay, XTT Assay

    Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.
    Figure Legend Snippet: Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.

    Techniques Used: Electron Microscopy

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    ATCC fks1 mutant strains
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 Mutant Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 mutant strains/product/ATCC
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 mutant strains - by Bioz Stars, 2024-03
    90/100 stars
      Buy from Supplier

    86
    ATCC mutants fks1 v595i
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Mutants Fks1 V595i, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutants fks1 v595i/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutants fks1 v595i - by Bioz Stars, 2024-03
    86/100 stars
      Buy from Supplier

    86
    ATCC fks1 r658g mutant confers echinocandin resistance
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 R658g Mutant Confers Echinocandin Resistance, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 r658g mutant confers echinocandin resistance/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 r658g mutant confers echinocandin resistance - by Bioz Stars, 2024-03
    86/100 stars
      Buy from Supplier

    86
    ATCC mutant carrying fks1 r658g
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Mutant Carrying Fks1 R658g, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant carrying fks1 r658g/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant carrying fks1 r658g - by Bioz Stars, 2024-03
    86/100 stars
      Buy from Supplier

    86
    ATCC fks1 r658g mutant
    <t> . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 </t> mutants.
    Fks1 R658g Mutant, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fks1 r658g mutant/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fks1 r658g mutant - by Bioz Stars, 2024-03
    86/100 stars
      Buy from Supplier

    86
    ATCC mutant harbouring fks1 s656p
    Strain characteristics of the pan-echinocandin resistant C. parapsilosis clinical isolate. (A) In vitro susceptibility to nine common antifungal drugs. The dashed red line indicates the breakpoints for defining drug resistance or cut-off values for non-wild type. (B) Transmembrane helix predictions for <t>Fks1</t> of C. parapsilosis. The location of the amino acid 656 is labelled.
    Mutant Harbouring Fks1 S656p, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant harbouring fks1 s656p/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant harbouring fks1 s656p - by Bioz Stars, 2024-03
    86/100 stars
      Buy from Supplier

    86
    ATCC mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation
    (A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric <t>FKS1,</t> and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).
    Mutant 8 Fks1 649 Ura3r S Cerevisiae Antisense Gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg Generation, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutant 8 fks1 649 ura3r s cerevisiae antisense gtattcacctgtacacctcattgcagtggtggacaaaattggtatttcacaccgcatagg generation - by Bioz Stars, 2024-03
    86/100 stars
      Buy from Supplier

    Image Search Results


     . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1  mutants.

    Journal: Medical mycology

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    doi: 10.1093/mmy/myt007

    Figure Lengend Snippet: . Comparison of echinocandin activity on planktonic (pMIC 80 ) and sessile (sMIC 80 ) cells of Candida albicans fks1 mutants.

    Article Snippet: Two fks1 mutant strains (32746 and 5415) were categorized as poor biofilm producers, four (2762, 4254, 4715, and 42286) and the three ATCC reference strains were moderate biofilm producers, and six fks1 mutant strains (41509, 42379, 42996, 43001, 53264, and 41301) were categorized as strong biofilm producers.

    Techniques: Activity Assay, Mutagenesis

     . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1  mutants.

    Journal: Medical mycology

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    doi: 10.1093/mmy/myt007

    Figure Lengend Snippet: . Comparison of paradoxical effect concentrations of planktonic and sessile cells of Candida albicans fks1 mutants.

    Article Snippet: Two fks1 mutant strains (32746 and 5415) were categorized as poor biofilm producers, four (2762, 4254, 4715, and 42286) and the three ATCC reference strains were moderate biofilm producers, and six fks1 mutant strains (41509, 42379, 42996, 43001, 53264, and 41301) were categorized as strong biofilm producers.

    Techniques: Mutagenesis

    Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.

    Journal: Medical mycology

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    doi: 10.1093/mmy/myt007

    Figure Lengend Snippet: Assessment of biofilm mass of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in triplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37°C for 24 h. Biofilm mass was quantified using the crystal violet assay. Light absorbance was measured in a plate reader at OD 630 nm. Each experiment was performed independently three times.

    Article Snippet: Two fks1 mutant strains (32746 and 5415) were categorized as poor biofilm producers, four (2762, 4254, 4715, and 42286) and the three ATCC reference strains were moderate biofilm producers, and six fks1 mutant strains (41509, 42379, 42996, 43001, 53264, and 41301) were categorized as strong biofilm producers.

    Techniques: Concentration Assay, Crystal Violet Assay

    Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.

    Journal: Medical mycology

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    doi: 10.1093/mmy/myt007

    Figure Lengend Snippet: Assessment of biofilm metabolic activity of Candida albicans reference strains and fks1 clinical isolates. Biofilms were grown in quadruplicate at a concentration of 1 × 106 cells/ml in buffered RPMI-1640 at 37° C for 24 h. The XTT assay was used to assay sessile metabolic activity. Formation of the colored formazan was subsequently measured at OD 490 nm. Each experiment was performed independently three times.

    Article Snippet: Two fks1 mutant strains (32746 and 5415) were categorized as poor biofilm producers, four (2762, 4254, 4715, and 42286) and the three ATCC reference strains were moderate biofilm producers, and six fks1 mutant strains (41509, 42379, 42996, 43001, 53264, and 41301) were categorized as strong biofilm producers.

    Techniques: Activity Assay, Concentration Assay, XTT Assay

    Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.

    Journal: Medical mycology

    Article Title: Paradoxical antifungal activity and structural observations in biofilms formed by echinocandin-resistant Candida albicans clinical isolates

    doi: 10.1093/mmy/myt007

    Figure Lengend Snippet: Ultrastructural assessment of biofilm morphology using scanning electron microscopy. (A) Scanning electron microscopy of representative Candida albicans fks1 mutants that form poor (4254), moderate (42286), and strong (53264) biofilms compared with reference strain SC5314. (B) Scanning electron microscopy view of pit-like cell surface structures identified on select C. albicans fks1 mutants.

    Article Snippet: Two fks1 mutant strains (32746 and 5415) were categorized as poor biofilm producers, four (2762, 4254, 4715, and 42286) and the three ATCC reference strains were moderate biofilm producers, and six fks1 mutant strains (41509, 42379, 42996, 43001, 53264, and 41301) were categorized as strong biofilm producers.

    Techniques: Electron Microscopy

    Strain characteristics of the pan-echinocandin resistant C. parapsilosis clinical isolate. (A) In vitro susceptibility to nine common antifungal drugs. The dashed red line indicates the breakpoints for defining drug resistance or cut-off values for non-wild type. (B) Transmembrane helix predictions for Fks1 of C. parapsilosis. The location of the amino acid 656 is labelled.

    Journal: Emerging Microbes & Infections

    Article Title: Decreased echinocandin susceptibility in Candida parapsilosis causing candidemia and emergence of a pan-echinocandin resistant case in China

    doi: 10.1080/22221751.2022.2153086

    Figure Lengend Snippet: Strain characteristics of the pan-echinocandin resistant C. parapsilosis clinical isolate. (A) In vitro susceptibility to nine common antifungal drugs. The dashed red line indicates the breakpoints for defining drug resistance or cut-off values for non-wild type. (B) Transmembrane helix predictions for Fks1 of C. parapsilosis. The location of the amino acid 656 is labelled.

    Article Snippet: Structural and functional effect of the S656P substitution in Fks1. (A) The predicted structural model for the variants of the Fks1 protein (amino acids 400∼900), the S656P substitution would result in the helix-to-coil transition, disrupting conformation of this ɑ-helix. (B) Echinocandin MICs for susceptible C. parapsilosis strain ATCC 22019 and its mutant harbouring Fks1 S656P, and the pan-echinocandin resistant clinical isolate TJ1197 and its mutant with WT of Fks1. (C) Changes in expression of the FKS1 and CHS3 genes in response to micafungin at the sub-MICs. (D) Echinocandin MICs for susceptible C. orthopsilosis ATCC 96139, C. metapsilosis ATCC 96143, and their mutants carrying homologous modifications, S649P and S656P, respectively.

    Techniques: In Vitro

    Structural and functional effect of the S656P substitution in Fks1. (A) The predicted structural model for the variants of the Fks1 protein (amino acids 400∼900), the S656P substitution would result in the helix-to-coil transition, disrupting conformation of this ɑ-helix. (B) Echinocandin MICs for susceptible C. parapsilosis strain ATCC 22019 and its mutant harbouring Fks1 S656P, and the pan-echinocandin resistant clinical isolate TJ1197 and its mutant with WT of Fks1. (C) Changes in expression of the FKS1 and CHS3 genes in response to micafungin at the sub-MICs. (D) Echinocandin MICs for susceptible C. orthopsilosis ATCC 96139, C. metapsilosis ATCC 96143, and their mutants carrying homologous modifications, S649P and S656P, respectively. Dashed red lines indicate the breakpoints for defining drug resistance or cut-off values for non-wild type. AND, anidulafungin; CAS, caspofungin; MF, micafungin. **, P < 0.01; ***, P < 0.001.

    Journal: Emerging Microbes & Infections

    Article Title: Decreased echinocandin susceptibility in Candida parapsilosis causing candidemia and emergence of a pan-echinocandin resistant case in China

    doi: 10.1080/22221751.2022.2153086

    Figure Lengend Snippet: Structural and functional effect of the S656P substitution in Fks1. (A) The predicted structural model for the variants of the Fks1 protein (amino acids 400∼900), the S656P substitution would result in the helix-to-coil transition, disrupting conformation of this ɑ-helix. (B) Echinocandin MICs for susceptible C. parapsilosis strain ATCC 22019 and its mutant harbouring Fks1 S656P, and the pan-echinocandin resistant clinical isolate TJ1197 and its mutant with WT of Fks1. (C) Changes in expression of the FKS1 and CHS3 genes in response to micafungin at the sub-MICs. (D) Echinocandin MICs for susceptible C. orthopsilosis ATCC 96139, C. metapsilosis ATCC 96143, and their mutants carrying homologous modifications, S649P and S656P, respectively. Dashed red lines indicate the breakpoints for defining drug resistance or cut-off values for non-wild type. AND, anidulafungin; CAS, caspofungin; MF, micafungin. **, P < 0.01; ***, P < 0.001.

    Article Snippet: Structural and functional effect of the S656P substitution in Fks1. (A) The predicted structural model for the variants of the Fks1 protein (amino acids 400∼900), the S656P substitution would result in the helix-to-coil transition, disrupting conformation of this ɑ-helix. (B) Echinocandin MICs for susceptible C. parapsilosis strain ATCC 22019 and its mutant harbouring Fks1 S656P, and the pan-echinocandin resistant clinical isolate TJ1197 and its mutant with WT of Fks1. (C) Changes in expression of the FKS1 and CHS3 genes in response to micafungin at the sub-MICs. (D) Echinocandin MICs for susceptible C. orthopsilosis ATCC 96139, C. metapsilosis ATCC 96143, and their mutants carrying homologous modifications, S649P and S656P, respectively.

    Techniques: Functional Assay, Mutagenesis, Expressing

    (A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric FKS1, and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Molecular Confirmation of the Relationship between Candida guilliermondii Fks1p Naturally Occurring Amino Acid Substitutions and Its Intrinsic Reduced Echinocandin Susceptibility

    doi: 10.1128/AAC.02644-16

    Figure Lengend Snippet: (A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric FKS1, and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).

    Article Snippet: Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines ( 11 ), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Target organism Orientation (5′→3′) Sequence (5′→3′) Purpose Reference FKS1-453-URA3F S. cerevisiae Sense AAAGAGACCCGTACTTGGTTACATTTGGTCACCAACTTCAGAGTGCACCATACCACAGCT Generation of S. cerevisiae FKS1 -deleted mutant 8 FKS1-649-URA3R S. cerevisiae Antisense GTATTCACCTGTACACCTCATTGCAGTGGTGGACAAAATTGGTATTTCACACCGCATAGG Generation of S. cerevisiae FKS1 -deleted mutant 8 URA3iR S. cerevisiae Antisense TGCCTTTAGCGGCTTAACTG Confirmation of S. cerevisiae FKS1 deletion 8 FKS1-375 S. cerevisiae Sense GGTCGTTTTGTCAAGCGTGA Confirmation of S. cerevisiae FKS1 deletion, chimeric FKS1 construction, and S. cerevisiae FKS1 reconstruction 8 FKS1-707R S. cerevisiae Antisense ATTTCCCAACAGAGAAAATGG S. cerevisiae FKS1 reconstruction 8 LMDM85 S. cerevisiae Antisense CGTAGTGAGGAGTCAATACTGTG Chimeric FKS1 construction This study Fus5-FKS1-Sc-CguiF S. cerevisiae and C. guilliermondii Sense CGTAGATTCTGGTTTTTATGCATCATCTTCGTGGTTAACTTGGCCCC Chimeric FKS1 construction This study Fus5-FKS1-Sc-CguiR S. cerevisiae and C. guilliermondii Antisense GGGGCCAAGTTAACCACGAAGATGATGCATAAAAACCAGAATCTACG Chimeric FKS1 construction This study Fus3-FKS1-Sc-CguiF S. cerevisiae and C. guilliermondii Sense GTACAGAGAACATTTGTTGGCTATTGACCATGTACAAAAATTACTATATC Chimeric FKS1 construction This study Fus3-FKS1-Sc-CguiR S. cerevisiae and C. guilliermondii Antisense GATATAGTAATTTTTGTACATGGTCAATAGCCAACAAATGTTCTCTGTAC Chimeric FKS1 construction This study FKS1-305F S. cerevisiae Sense CCCTGGAAAGAGTTCGTCATATC Confirmation of FKS1 chimeric reconstitution This study Cg/h-R C. guilliermondii Antisense CAAACCACCCAAAGGCATAAC Confirmation of FKS1 chimeric reconstitution This study Open in a separate window Primers used in this study Parental and revertant S. cerevisiae strains (BY4742 and LMDM 537R, respectively) showed very low CSF and ANF MIC values (0.008 μg/ml), while the seven chimeric strains showed 32-fold higher MICs for both echinocandins (0.25 μg/ml).

    Techniques: Isolation, Diffusion-based Assay

    Primers used in this study

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Molecular Confirmation of the Relationship between Candida guilliermondii Fks1p Naturally Occurring Amino Acid Substitutions and Its Intrinsic Reduced Echinocandin Susceptibility

    doi: 10.1128/AAC.02644-16

    Figure Lengend Snippet: Primers used in this study

    Article Snippet: Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines ( 11 ), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Target organism Orientation (5′→3′) Sequence (5′→3′) Purpose Reference FKS1-453-URA3F S. cerevisiae Sense AAAGAGACCCGTACTTGGTTACATTTGGTCACCAACTTCAGAGTGCACCATACCACAGCT Generation of S. cerevisiae FKS1 -deleted mutant 8 FKS1-649-URA3R S. cerevisiae Antisense GTATTCACCTGTACACCTCATTGCAGTGGTGGACAAAATTGGTATTTCACACCGCATAGG Generation of S. cerevisiae FKS1 -deleted mutant 8 URA3iR S. cerevisiae Antisense TGCCTTTAGCGGCTTAACTG Confirmation of S. cerevisiae FKS1 deletion 8 FKS1-375 S. cerevisiae Sense GGTCGTTTTGTCAAGCGTGA Confirmation of S. cerevisiae FKS1 deletion, chimeric FKS1 construction, and S. cerevisiae FKS1 reconstruction 8 FKS1-707R S. cerevisiae Antisense ATTTCCCAACAGAGAAAATGG S. cerevisiae FKS1 reconstruction 8 LMDM85 S. cerevisiae Antisense CGTAGTGAGGAGTCAATACTGTG Chimeric FKS1 construction This study Fus5-FKS1-Sc-CguiF S. cerevisiae and C. guilliermondii Sense CGTAGATTCTGGTTTTTATGCATCATCTTCGTGGTTAACTTGGCCCC Chimeric FKS1 construction This study Fus5-FKS1-Sc-CguiR S. cerevisiae and C. guilliermondii Antisense GGGGCCAAGTTAACCACGAAGATGATGCATAAAAACCAGAATCTACG Chimeric FKS1 construction This study Fus3-FKS1-Sc-CguiF S. cerevisiae and C. guilliermondii Sense GTACAGAGAACATTTGTTGGCTATTGACCATGTACAAAAATTACTATATC Chimeric FKS1 construction This study Fus3-FKS1-Sc-CguiR S. cerevisiae and C. guilliermondii Antisense GATATAGTAATTTTTGTACATGGTCAATAGCCAACAAATGTTCTCTGTAC Chimeric FKS1 construction This study FKS1-305F S. cerevisiae Sense CCCTGGAAAGAGTTCGTCATATC Confirmation of FKS1 chimeric reconstitution This study Cg/h-R C. guilliermondii Antisense CAAACCACCCAAAGGCATAAC Confirmation of FKS1 chimeric reconstitution This study Open in a separate window Primers used in this study Parental and revertant S. cerevisiae strains (BY4742 and LMDM 537R, respectively) showed very low CSF and ANF MIC values (0.008 μg/ml), while the seven chimeric strains showed 32-fold higher MICs for both echinocandins (0.25 μg/ml).

    Techniques: Sequencing, Mutagenesis