Structured Review

Thermo Fisher fgfr4
Schematic representations of: (A) Wild type and (−16) splice form of mouse <t>FGFR4</t> cDNA; the positions of PCR primers used to identify different portions of the corresponding RNA transcripts are indicated with colored arrows and product sizes are
Fgfr4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fgfr4/product/Thermo Fisher
Average 99 stars, based on 3 article reviews
Price from $9.99 to $1999.99
fgfr4 - by Bioz Stars, 2020-05
99/100 stars

Images

1) Product Images from "FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation"

Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

Journal:

doi: 10.1002/jcp.21365

Schematic representations of: (A) Wild type and (−16) splice form of mouse FGFR4 cDNA; the positions of PCR primers used to identify different portions of the corresponding RNA transcripts are indicated with colored arrows and product sizes are
Figure Legend Snippet: Schematic representations of: (A) Wild type and (−16) splice form of mouse FGFR4 cDNA; the positions of PCR primers used to identify different portions of the corresponding RNA transcripts are indicated with colored arrows and product sizes are

Techniques Used: Polymerase Chain Reaction

RT-PCR analysis of mouse FGFR4 forms expressed in: (A) primary myogenic cells cultured for 7 days; MyoD gene expression served as a reference for the myogenic characteristic of the cultures. (B) Organs from 4-day old mice. cDNA templates were made from
Figure Legend Snippet: RT-PCR analysis of mouse FGFR4 forms expressed in: (A) primary myogenic cells cultured for 7 days; MyoD gene expression served as a reference for the myogenic characteristic of the cultures. (B) Organs from 4-day old mice. cDNA templates were made from

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Cell Culture, Expressing, Mouse Assay

Detection of endogenous and overexpressed forms of mouse FGFR4 by Western blotting. FGFR4 bands were detected directly in the initial lysates or following immunoprecipitation (IP) with the same anti-FGFR4 antibody used for developing the blots. (A) Primary
Figure Legend Snippet: Detection of endogenous and overexpressed forms of mouse FGFR4 by Western blotting. FGFR4 bands were detected directly in the initial lysates or following immunoprecipitation (IP) with the same anti-FGFR4 antibody used for developing the blots. (A) Primary

Techniques Used: Western Blot, Immunoprecipitation

FGFR4 expression during myogenic differentiation of C2C12 cells. Cells were switched to differentiation medium at time 0 and harvested at different days as indicated at the top of the panels. (A) RT-PCR analysis on templates made from total RNA; GAPDH
Figure Legend Snippet: FGFR4 expression during myogenic differentiation of C2C12 cells. Cells were switched to differentiation medium at time 0 and harvested at different days as indicated at the top of the panels. (A) RT-PCR analysis on templates made from total RNA; GAPDH

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

Outcome of co-expression of FGFR4 (or FGFR4(−16)) and FGFR3-1 in 293T cells. Schematics of expressed constructs are depicted in . (A, B) Western blot analysis of tyrosine phosphorylation of FGFR4 and FGFR4(−16) HA-tagged constructs
Figure Legend Snippet: Outcome of co-expression of FGFR4 (or FGFR4(−16)) and FGFR3-1 in 293T cells. Schematics of expressed constructs are depicted in . (A, B) Western blot analysis of tyrosine phosphorylation of FGFR4 and FGFR4(−16) HA-tagged constructs

Techniques Used: Expressing, Construct, Western Blot

RT-PCR analysis of FGFR4 and FGFR4(−16) expression during myogenic differentiation of the 10T½-MyoD-ER cell line. Cells were maintained in growth medium (10% FBS) or in 2% horse serum (HS) with or without the β-estradiol (10 −7
Figure Legend Snippet: RT-PCR analysis of FGFR4 and FGFR4(−16) expression during myogenic differentiation of the 10T½-MyoD-ER cell line. Cells were maintained in growth medium (10% FBS) or in 2% horse serum (HS) with or without the β-estradiol (10 −7

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

2) Product Images from "A Polymorphism in the FGFR4 Gene is associated with Risk of Neuroblastoma and Altered Receptor Degradation"

Article Title: A Polymorphism in the FGFR4 Gene is associated with Risk of Neuroblastoma and Altered Receptor Degradation

Journal: Journal of pediatric hematology/oncology

doi: 10.1097/MPH.0000000000000506

Effects of Glycine-to-Arginine substitution at position 388 of FGFR4 on sorting of FGFR4 into internal MVB vesicles
Figure Legend Snippet: Effects of Glycine-to-Arginine substitution at position 388 of FGFR4 on sorting of FGFR4 into internal MVB vesicles

Techniques Used:

Effects of Glycine-to-Arginine substitution at position 388 of FGFR4 on receptor degradation
Figure Legend Snippet: Effects of Glycine-to-Arginine substitution at position 388 of FGFR4 on receptor degradation

Techniques Used:

FGFR4 Polymorphism Distribution Among Cases and Controls
Figure Legend Snippet: FGFR4 Polymorphism Distribution Among Cases and Controls

Techniques Used:

FGFR4 Genotype and Neuroblastoma Patient Outcomes and Prognostic Factors
Figure Legend Snippet: FGFR4 Genotype and Neuroblastoma Patient Outcomes and Prognostic Factors

Techniques Used:

EGFR and FGFR4 degradation after ligand exposure
Figure Legend Snippet: EGFR and FGFR4 degradation after ligand exposure

Techniques Used:

FGFR4 Polymorphism Distribution Among Cases and Controls
Figure Legend Snippet: FGFR4 Polymorphism Distribution Among Cases and Controls

Techniques Used:

3) Product Images from "Fibroblast growth factor receptor 1 is principally responsible for fibroblast growth factor 2-induced catabolic activities in human articular chondrocytes"

Article Title: Fibroblast growth factor receptor 1 is principally responsible for fibroblast growth factor 2-induced catabolic activities in human articular chondrocytes

Journal: Arthritis Research & Therapy

doi: 10.1186/ar3441

Abundant FGFR1 and FGFR3 expression in articular chondrocytes . (A) Human articular chondrocytes were incubated with anti-CD32/CD16 monoclonal antibody to block nonspecific antibody binding. FGFR1, FGFR2, FGFR3, and FGFR4 antibodies were incubated with cells, followed by incubation with a secondary antibody, goat-anti-rabbit Alexa Fluor 488. Cells were also incubated with goat-anti-rabbit Alexa 488, or non-immune rabbit serum plus goat-anti-rabbit Alexa Fluor 488 as controls. FGFRs on the plasma membrane of chondrocytes were analyzed with a FACS Calibur instrument and CellQuest software. (B) Human articular chondrocytes in monolayer were subjected to RNA extraction, cDNA synthesis, and qPCR quantification of FGFR isoform expression. * P
Figure Legend Snippet: Abundant FGFR1 and FGFR3 expression in articular chondrocytes . (A) Human articular chondrocytes were incubated with anti-CD32/CD16 monoclonal antibody to block nonspecific antibody binding. FGFR1, FGFR2, FGFR3, and FGFR4 antibodies were incubated with cells, followed by incubation with a secondary antibody, goat-anti-rabbit Alexa Fluor 488. Cells were also incubated with goat-anti-rabbit Alexa 488, or non-immune rabbit serum plus goat-anti-rabbit Alexa Fluor 488 as controls. FGFRs on the plasma membrane of chondrocytes were analyzed with a FACS Calibur instrument and CellQuest software. (B) Human articular chondrocytes in monolayer were subjected to RNA extraction, cDNA synthesis, and qPCR quantification of FGFR isoform expression. * P

Techniques Used: Expressing, Incubation, Blocking Assay, Binding Assay, FACS, Software, RNA Extraction, Real-time Polymerase Chain Reaction

4) Product Images from "Molecular Subclasses of Hepatocellular Carcinoma Predict Sensitivity to Fibroblast Growth Factor Receptor Inhibition"

Article Title: Molecular Subclasses of Hepatocellular Carcinoma Predict Sensitivity to Fibroblast Growth Factor Receptor Inhibition

Journal: International journal of cancer

doi: 10.1002/ijc.29893

FGFR4 knockdown suppresses S2 HCC cell proliferation
Figure Legend Snippet: FGFR4 knockdown suppresses S2 HCC cell proliferation

Techniques Used:

5) Product Images from "Fibroblast growth factor 19 expression correlates with tumor progression and poorer prognosis of hepatocellular carcinoma"

Article Title: Fibroblast growth factor 19 expression correlates with tumor progression and poorer prognosis of hepatocellular carcinoma

Journal: BMC Cancer

doi: 10.1186/1471-2407-12-56

(A) FGF19 mRNA expression in cell extracts from HuH7, HepG2, PLC/PRF/5, HLE, HLF, JHH1, JHH2, JHH5, JHH6, and JHH7 cell lines was examined using quantitative RT-PCR ( n = 8) . FGF19 was expressed in all cell lines. ( B ) FGF19 protein levels in the supernatant media from ten cell lines and normal hepatocytes (normal HC) were assayed by ELISA. FGF19 was detected in the supernatant of all of them. ( C ) Using anti-FGF19 monoclonal antibodies, diffuse positive staining was demonstrated in the cytoplasm of HuH7, HepG2, HLE, HLF, and JHH7 cells. The closed rectangles indicate the same cells stained Immunohistochemically using control antibody. ( D ) FGFR4 mRNA expression in cell extracts from HuH7, HepG2, PLC/PRF/5, HLE, HLF, JHH1, JHH2, JHH5, JHH6, and JHH7 cell lines was examined using quantitative RT-PCR ( n = 8). FGFR4 was expressed in all cell lines. ( E ) Using anti-FGFR4 monoclonal antibodies, positive staining was demonstrated in the cell membranes of all of the above HCC lines. (Original magnifications ( C ) × 400), ( E ) × 400)) The closed rectangles indicate the same cells stained Immunohistochemically using control antibody.
Figure Legend Snippet: (A) FGF19 mRNA expression in cell extracts from HuH7, HepG2, PLC/PRF/5, HLE, HLF, JHH1, JHH2, JHH5, JHH6, and JHH7 cell lines was examined using quantitative RT-PCR ( n = 8) . FGF19 was expressed in all cell lines. ( B ) FGF19 protein levels in the supernatant media from ten cell lines and normal hepatocytes (normal HC) were assayed by ELISA. FGF19 was detected in the supernatant of all of them. ( C ) Using anti-FGF19 monoclonal antibodies, diffuse positive staining was demonstrated in the cytoplasm of HuH7, HepG2, HLE, HLF, and JHH7 cells. The closed rectangles indicate the same cells stained Immunohistochemically using control antibody. ( D ) FGFR4 mRNA expression in cell extracts from HuH7, HepG2, PLC/PRF/5, HLE, HLF, JHH1, JHH2, JHH5, JHH6, and JHH7 cell lines was examined using quantitative RT-PCR ( n = 8). FGFR4 was expressed in all cell lines. ( E ) Using anti-FGFR4 monoclonal antibodies, positive staining was demonstrated in the cell membranes of all of the above HCC lines. (Original magnifications ( C ) × 400), ( E ) × 400)) The closed rectangles indicate the same cells stained Immunohistochemically using control antibody.

Techniques Used: Expressing, Planar Chromatography, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Staining

Real-time quantitative RT-PCR analysis, immunohistochemical staining of representative specimens from HCC patients of 40 HCC samples . ( A ): Ratio of average FGF19/GAPDH expression in HCC (T) compared with corresponding noncancerous hepatic tissues (N). The average FGF19/GAPDH level in HCCs. ( B ): The average FGFR4/GAPDH level in HCCs. ( C ): Immunohistochemistry using anti-FGF19 monoclonal antibodies; HCC tissue (lower) and noncancerous hepatocytes (upper). ( D ): Immunohistochemistry using anti-FGFR4 monoclonal antibodies; HCC tissue (lower) and noncancerous tissue (upper). (Original magnifications: ×40 (upper); ×40 (lower)). RT-PCR; reverse transcription polymerase chain reaction; HCC, hepatocellular carcinoma.
Figure Legend Snippet: Real-time quantitative RT-PCR analysis, immunohistochemical staining of representative specimens from HCC patients of 40 HCC samples . ( A ): Ratio of average FGF19/GAPDH expression in HCC (T) compared with corresponding noncancerous hepatic tissues (N). The average FGF19/GAPDH level in HCCs. ( B ): The average FGFR4/GAPDH level in HCCs. ( C ): Immunohistochemistry using anti-FGF19 monoclonal antibodies; HCC tissue (lower) and noncancerous hepatocytes (upper). ( D ): Immunohistochemistry using anti-FGFR4 monoclonal antibodies; HCC tissue (lower) and noncancerous tissue (upper). (Original magnifications: ×40 (upper); ×40 (lower)). RT-PCR; reverse transcription polymerase chain reaction; HCC, hepatocellular carcinoma.

Techniques Used: Quantitative RT-PCR, Immunohistochemistry, Staining, Expressing, Reverse Transcription Polymerase Chain Reaction

6) Product Images from "Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis"

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

Journal: Cancer research

doi: 10.1158/0008-5472.CAN-11-3654

FGFR4 -dependent downstream signaling. A and B, semiconfluent cultures of SW480 transfectants were starved and cell membranes were prepared and extracted. Protein amount and phosphorylation of PLCγ and FRS2α was analyzed by Western blot analysis. C and D, from parallel cultures, protein lysates were prepared after 24 hours for analysis of signaling molecules using phospho-specific antibodies. Photographs of Western blot analysis show results of representative gel runs. Quantification was conducted from 2 independent experiments using duplicate samples.
Figure Legend Snippet: FGFR4 -dependent downstream signaling. A and B, semiconfluent cultures of SW480 transfectants were starved and cell membranes were prepared and extracted. Protein amount and phosphorylation of PLCγ and FRS2α was analyzed by Western blot analysis. C and D, from parallel cultures, protein lysates were prepared after 24 hours for analysis of signaling molecules using phospho-specific antibodies. Photographs of Western blot analysis show results of representative gel runs. Quantification was conducted from 2 independent experiments using duplicate samples.

Techniques Used: Western Blot

Impact of FGFR4 knockdown on clonogenicity and migration in vitro . siRNA oligonucleotides were introduced by lipofection into HCT116 and HT29 cells. Controls were transfected with scrambled control siRNA. A, five days after knockdown, cell viability was measured by MTT assay. B, 24 hours after knockdown, proliferation was determined by 3 H-thymidine uptake. From parallel cultures, cells were harvested 24 hours after transfection and plated at 100 and 200 cells/6-well for colony formation assays (C) and 2 × 10 4 cells/filter for migration assays (D). Results were pooled from at least 3 independent experiments and presented as mean ± SD. # and ## indicate a decrease as compared with control at P
Figure Legend Snippet: Impact of FGFR4 knockdown on clonogenicity and migration in vitro . siRNA oligonucleotides were introduced by lipofection into HCT116 and HT29 cells. Controls were transfected with scrambled control siRNA. A, five days after knockdown, cell viability was measured by MTT assay. B, 24 hours after knockdown, proliferation was determined by 3 H-thymidine uptake. From parallel cultures, cells were harvested 24 hours after transfection and plated at 100 and 200 cells/6-well for colony formation assays (C) and 2 × 10 4 cells/filter for migration assays (D). Results were pooled from at least 3 independent experiments and presented as mean ± SD. # and ## indicate a decrease as compared with control at P

Techniques Used: Migration, In Vitro, Transfection, MTT Assay

Impact of FGFR4 overexpression on tumor cell growth and migration in vitro . Stable transfectants overexpressing FGFR4 arg or FGFR4 gly in SW480, HCT116, or HT29 cells were used to assess growth and malignant characteristics in vitro . Stable transfectants with the pcDNA3 vector were used as controls. A, 100 and 200 cells were seeded/6-well, medium was changed after 24 hours, and the number of colonies counted after 10 days of growth. B, five thousand cells each were suspended in soft agar medium and plated in 6-well plates. The number of colonies was counted at a magnification of 10-fold after 3 weeks of growth. C, cell migration was determined by filter migration assay from 2 × 10 4 cells/24-well. Photographs of cultures show representative results from SW480 transfectants. Quantitative results from all cell lines were calculated as % of control, pooled from at least 3 independent experiments, and presented as mean ± SD. *, **, *** indicate an increase as compared with the control at P
Figure Legend Snippet: Impact of FGFR4 overexpression on tumor cell growth and migration in vitro . Stable transfectants overexpressing FGFR4 arg or FGFR4 gly in SW480, HCT116, or HT29 cells were used to assess growth and malignant characteristics in vitro . Stable transfectants with the pcDNA3 vector were used as controls. A, 100 and 200 cells were seeded/6-well, medium was changed after 24 hours, and the number of colonies counted after 10 days of growth. B, five thousand cells each were suspended in soft agar medium and plated in 6-well plates. The number of colonies was counted at a magnification of 10-fold after 3 weeks of growth. C, cell migration was determined by filter migration assay from 2 × 10 4 cells/24-well. Photographs of cultures show representative results from SW480 transfectants. Quantitative results from all cell lines were calculated as % of control, pooled from at least 3 independent experiments, and presented as mean ± SD. *, **, *** indicate an increase as compared with the control at P

Techniques Used: Over Expression, Migration, In Vitro, Plasmid Preparation

Related Articles

Sequencing:

Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation
Article Snippet: .. The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen). .. The sequencing of the clones revealed two FGFR4 forms, a wildtype (referred to as FGFR4) and a form that lacks exon 16 (referred to as FGFR4(−16)).

Polymerase Chain Reaction:

Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation
Article Snippet: .. The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen). .. The sequencing of the clones revealed two FGFR4 forms, a wildtype (referred to as FGFR4) and a form that lacks exon 16 (referred to as FGFR4(−16)).

Incubation:

Article Title: Fibroblast growth factor receptor 1 is principally responsible for fibroblast growth factor 2-induced catabolic activities in human articular chondrocytes
Article Snippet: .. Primary antibodies against FGFR1, FGFR2, FGFR3, and FGFR4 were incubated with cells, followed by addition of secondary antibody, goat-anti-rabbit Alexa Fluor 488 (Invitrogen). .. Cells were also incubated with goat-anti-rabbit Alexa Fluor 488, or non-immune rabbit serum plus goat-anti-rabbit Alexa Fluor 488 as controls.

Plasmid Preparation:

Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation
Article Snippet: .. The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen). .. The sequencing of the clones revealed two FGFR4 forms, a wildtype (referred to as FGFR4) and a form that lacks exon 16 (referred to as FGFR4(−16)).

Clone Assay:

Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation
Article Snippet: .. The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen). .. The sequencing of the clones revealed two FGFR4 forms, a wildtype (referred to as FGFR4) and a form that lacks exon 16 (referred to as FGFR4(−16)).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher gene exp fgfr4 mm01341852 m1
    Abundance and location of FGF receptors (FGFRs) in F subpopulations determined by flow cytometry. F isolated on P8 were fixed immediately after isolation and were either permeabilized (total) or not (surface) before staining for FGFR2 (CD332, n = 5) ( A ). B : representative dot plots for FGFR3 (CD333) showing isotype controls ( b and c ) and CD333 ( e and f ) in permeabilized ( b and e ) or unpermeabilized ( c and f ) groups. Combined data for FGFR3 ( n = 4) ( C ) or <t>FGFR4</t> (CD334, n = 4) ( D ) are shown. CD45+ cells were gated out, and data were expressed relative to the total number of cells in the respective subpopulations, based on the intensity of the PDGFR-α-GFP tag. Comparisons were made among the intracellular pools (open portion of bar) or for the extracellular receptors across (closed portions) the 3 subpopulations. Means ± SE, 2-way ANOVA, Student-Newman-Keuls post hoc test. * P
    Gene Exp Fgfr4 Mm01341852 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 mm01341852 m1/product/Thermo Fisher
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 mm01341852 m1 - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    88
    Thermo Fisher fgfr4 knockdown
    <t>FGFR4</t> expression in non-small-cell lung cancer. Notes: ( A ) Lower FGFR4 expression in lung adenocarcinoma. ( B ) Higher FGFR4 expression in lung adenocarcinoma. ( C ) Lower FGFR4 expression in squamous cell carcinoma. ( D ) Higher FGFR4 expression in squamous cell carcinoma. Scale bar: 50 μm. ( E ) FGFR4 mRNA level in tumor tissue and adjacent normal tissue (n=12). Abbreviation: FGFR4, fibroblast growth factor receptor 4.
    Fgfr4 Knockdown, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fgfr4 knockdown/product/Thermo Fisher
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fgfr4 knockdown - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    86
    Thermo Fisher gene exp fgfr4 rn01441815 m1
    Expression of FGF receptors and Klotho co factors in cell culture models. In 3T3-L1 cells we found a high level of FGFR1 expression along with modest levels of FGFR2 and FGFR3. In these cells <t>FGFR4,</t> KL and KLB were not detectable (A). In Hep3B cells there was detectable expression of all 4 FGF receptor subtypes, however, we detected especially high levels of FGFR4. Hep3B cells were also found have appreciable expression of KLB while KL was not detectable (B). In L6 cells expression of all FGFRs was extremely low in comparison to other cells lines we screened in addition to undetectable levels of KLB at baseline (C).
    Gene Exp Fgfr4 Rn01441815 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 rn01441815 m1/product/Thermo Fisher
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 rn01441815 m1 - by Bioz Stars, 2020-05
    86/100 stars
      Buy from Supplier

    Image Search Results


    Abundance and location of FGF receptors (FGFRs) in F subpopulations determined by flow cytometry. F isolated on P8 were fixed immediately after isolation and were either permeabilized (total) or not (surface) before staining for FGFR2 (CD332, n = 5) ( A ). B : representative dot plots for FGFR3 (CD333) showing isotype controls ( b and c ) and CD333 ( e and f ) in permeabilized ( b and e ) or unpermeabilized ( c and f ) groups. Combined data for FGFR3 ( n = 4) ( C ) or FGFR4 (CD334, n = 4) ( D ) are shown. CD45+ cells were gated out, and data were expressed relative to the total number of cells in the respective subpopulations, based on the intensity of the PDGFR-α-GFP tag. Comparisons were made among the intracellular pools (open portion of bar) or for the extracellular receptors across (closed portions) the 3 subpopulations. Means ± SE, 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: Fibroblast growth factor signaling in myofibroblasts differs from lipofibroblasts during alveolar septation in mice

    doi: 10.1152/ajplung.00013.2015

    Figure Lengend Snippet: Abundance and location of FGF receptors (FGFRs) in F subpopulations determined by flow cytometry. F isolated on P8 were fixed immediately after isolation and were either permeabilized (total) or not (surface) before staining for FGFR2 (CD332, n = 5) ( A ). B : representative dot plots for FGFR3 (CD333) showing isotype controls ( b and c ) and CD333 ( e and f ) in permeabilized ( b and e ) or unpermeabilized ( c and f ) groups. Combined data for FGFR3 ( n = 4) ( C ) or FGFR4 (CD334, n = 4) ( D ) are shown. CD45+ cells were gated out, and data were expressed relative to the total number of cells in the respective subpopulations, based on the intensity of the PDGFR-α-GFP tag. Comparisons were made among the intracellular pools (open portion of bar) or for the extracellular receptors across (closed portions) the 3 subpopulations. Means ± SE, 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Article Snippet: RNA was isolated and subjected to real-time qRT-PCR using the following TaqMan probes ( ): β2-microglobulin (Mm00437762_m1), Spry2 (Mm00442344_m1), Spry4 (Mm00442345_m1), FGFR3 (Mm00433294_m1), FGFR4 (Mm01341852_m1), FGF10 (Mm00433275_m1), and FGF18 (Mm00433286_m1).

    Techniques: Flow Cytometry, Cytometry, Isolation, Staining

    Quantitative real-time PCR showing abundance of FGFR mRNA in F. F were isolated and separated into 3 subpopulations by flow cytometric sorting based on the intensity of GFP and absence of CD45. Means ± SE. A : FGFR3, n = 6; FGFR4 n = 4. FGFR2IIIb ( B , n = 5) and FGFR2IIIc ( A , n = 5) splice forms were distinguished and are shown separately, whereas the splice forms of FGFR3 were not distinguished. 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: Fibroblast growth factor signaling in myofibroblasts differs from lipofibroblasts during alveolar septation in mice

    doi: 10.1152/ajplung.00013.2015

    Figure Lengend Snippet: Quantitative real-time PCR showing abundance of FGFR mRNA in F. F were isolated and separated into 3 subpopulations by flow cytometric sorting based on the intensity of GFP and absence of CD45. Means ± SE. A : FGFR3, n = 6; FGFR4 n = 4. FGFR2IIIb ( B , n = 5) and FGFR2IIIc ( A , n = 5) splice forms were distinguished and are shown separately, whereas the splice forms of FGFR3 were not distinguished. 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Article Snippet: RNA was isolated and subjected to real-time qRT-PCR using the following TaqMan probes ( ): β2-microglobulin (Mm00437762_m1), Spry2 (Mm00442344_m1), Spry4 (Mm00442345_m1), FGFR3 (Mm00433294_m1), FGFR4 (Mm01341852_m1), FGF10 (Mm00433275_m1), and FGF18 (Mm00433286_m1).

    Techniques: Real-time Polymerase Chain Reaction, Isolation, Flow Cytometry

    FGFR4 expression in non-small-cell lung cancer. Notes: ( A ) Lower FGFR4 expression in lung adenocarcinoma. ( B ) Higher FGFR4 expression in lung adenocarcinoma. ( C ) Lower FGFR4 expression in squamous cell carcinoma. ( D ) Higher FGFR4 expression in squamous cell carcinoma. Scale bar: 50 μm. ( E ) FGFR4 mRNA level in tumor tissue and adjacent normal tissue (n=12). Abbreviation: FGFR4, fibroblast growth factor receptor 4.

    Journal: OncoTargets and therapy

    Article Title: The prognostic significance of fibroblast growth factor receptor 4 in non-small-cell lung cancer

    doi: 10.2147/OTT.S81659

    Figure Lengend Snippet: FGFR4 expression in non-small-cell lung cancer. Notes: ( A ) Lower FGFR4 expression in lung adenocarcinoma. ( B ) Higher FGFR4 expression in lung adenocarcinoma. ( C ) Lower FGFR4 expression in squamous cell carcinoma. ( D ) Higher FGFR4 expression in squamous cell carcinoma. Scale bar: 50 μm. ( E ) FGFR4 mRNA level in tumor tissue and adjacent normal tissue (n=12). Abbreviation: FGFR4, fibroblast growth factor receptor 4.

    Article Snippet: FGFR4 knockdown, overexpression, and transfection FGFR4 small interfering RNA (Thermo Fisher Scientific) was used for FGFR4 knockdown.

    Techniques: Expressing

    Role of FGFR4 in non-small-cell lung cancer cell line proliferation. Notes: ( A ) FGFR4 expression in adenocarcinoma cell lines A549 and H1299 and squamous carcinomas cell lines SK-MES-1 and H520, with hepatocellular carcinoma HepG2 cells as positive control and HEK 293 cells as negative control. ( B ) Semi-quantitative analysis of signals from ( A ) using ImageJ software. ( C and D ) With FGFR4 knockdown or overexpression, FGFR4 was proved to be able to promote cell proliferation in cell line SK-MES-1 ( C ) or A549 ( D ). * P

    Journal: OncoTargets and therapy

    Article Title: The prognostic significance of fibroblast growth factor receptor 4 in non-small-cell lung cancer

    doi: 10.2147/OTT.S81659

    Figure Lengend Snippet: Role of FGFR4 in non-small-cell lung cancer cell line proliferation. Notes: ( A ) FGFR4 expression in adenocarcinoma cell lines A549 and H1299 and squamous carcinomas cell lines SK-MES-1 and H520, with hepatocellular carcinoma HepG2 cells as positive control and HEK 293 cells as negative control. ( B ) Semi-quantitative analysis of signals from ( A ) using ImageJ software. ( C and D ) With FGFR4 knockdown or overexpression, FGFR4 was proved to be able to promote cell proliferation in cell line SK-MES-1 ( C ) or A549 ( D ). * P

    Article Snippet: FGFR4 knockdown, overexpression, and transfection FGFR4 small interfering RNA (Thermo Fisher Scientific) was used for FGFR4 knockdown.

    Techniques: Expressing, Positive Control, Negative Control, Software, Over Expression

    Correlations between overall survival rate and FGFR4 expression and lymph invasion status. Notes: Higher FGFR4 expression ( A ) and positive lymphatic invasion ( B ) can predict unfavorable prognosis of serous ovarian cancer. Abbreviation: FGFR4, fibroblast growth factor receptor 4.

    Journal: OncoTargets and therapy

    Article Title: The prognostic significance of fibroblast growth factor receptor 4 in non-small-cell lung cancer

    doi: 10.2147/OTT.S81659

    Figure Lengend Snippet: Correlations between overall survival rate and FGFR4 expression and lymph invasion status. Notes: Higher FGFR4 expression ( A ) and positive lymphatic invasion ( B ) can predict unfavorable prognosis of serous ovarian cancer. Abbreviation: FGFR4, fibroblast growth factor receptor 4.

    Article Snippet: FGFR4 knockdown, overexpression, and transfection FGFR4 small interfering RNA (Thermo Fisher Scientific) was used for FGFR4 knockdown.

    Techniques: Expressing

    Expression of FGF receptors and Klotho co factors in cell culture models. In 3T3-L1 cells we found a high level of FGFR1 expression along with modest levels of FGFR2 and FGFR3. In these cells FGFR4, KL and KLB were not detectable (A). In Hep3B cells there was detectable expression of all 4 FGF receptor subtypes, however, we detected especially high levels of FGFR4. Hep3B cells were also found have appreciable expression of KLB while KL was not detectable (B). In L6 cells expression of all FGFRs was extremely low in comparison to other cells lines we screened in addition to undetectable levels of KLB at baseline (C).

    Journal: PLoS ONE

    Article Title: Fundamentals of FGF19 & FGF21 Action In Vitro and In Vivo

    doi: 10.1371/journal.pone.0038438

    Figure Lengend Snippet: Expression of FGF receptors and Klotho co factors in cell culture models. In 3T3-L1 cells we found a high level of FGFR1 expression along with modest levels of FGFR2 and FGFR3. In these cells FGFR4, KL and KLB were not detectable (A). In Hep3B cells there was detectable expression of all 4 FGF receptor subtypes, however, we detected especially high levels of FGFR4. Hep3B cells were also found have appreciable expression of KLB while KL was not detectable (B). In L6 cells expression of all FGFRs was extremely low in comparison to other cells lines we screened in addition to undetectable levels of KLB at baseline (C).

    Article Snippet: Reactions were performed in triplicate on an ABI Prism 7900HT (PE Applied Biosystems) and were normalized to either 36B4 mRNA or 18S rRNA. ssays-on-Demand Gene Expression Products (PE Applied Biosystems) were as follows: hEGR1, Hs00152928_m1; hFGFR1, Hs00915142_m1; hFGFR2, Hs01552926_m1; hFGFR3, Hs00179829_m1; hFGFR4, Hs01106908_m1; hKL, Hs00183100_m1; hKLB, Hs00545621_m1; mFGFR1, Mm00438930_m1; mFGFR2, Mm01269930_m1; mFGFR3, Mm00433294_m1; mFGFR4, Mm01341852_m1; mKL, Mm00473122_m1; mKLB, Mm00502002_m1; rFGFR1, Rn00577234_m1, rFGFR2, Rn01269940_m1; rFGFR3, Rn00584799_m1; rFGFR4, Rn01441815_m1; rKL, Rn00580123_m1.

    Techniques: Expressing, Cell Culture

    The “hormone like” FGFs exhibit different signaling properties in vitro. Panel 1. In 3T3-L1 fibroblasts over-expressing KL we saw phosphorylation of the FGF target ERK upon treatment with FGF23, while FGF19 and 21 had no effect (A). Conversely, in 3T3-L1/KLB cells we saw no effect of FGF23 but potent signaling with FGF19 or FGF21 treatment (B). When we examined glucose uptake in the 3T3-L1/KL cells we found that only FGF23 lead to its stimulation (C). As we saw with pERK in 3T3-L1/KLB cells FGF19 and FGF21 both increased glucose uptake significantly (D). In 3T3-L1 fibroblasts expressing FGFR4 in the absence of KLB only FGF19 was able to increase glucose uptake (E). Furthermore, in Hep3B cells which show a relative enrichment of FGFR4, FGF19 was significantly more potent than FGF21 in inducing expression of the immediate early gene EGR1 (F). When 3T3-L1 cells were differentiated to become mature adipocytes FGF19 was also more potent than FGF21 even in the absence of FGFR4 expression suggesting a possible unknown factor which is not present on fibroblasts may be affecting FGF19's action in these cells, or vice versa (G). In 3T3-L1 adipocytes treated with either FGF19, FGF21 or a combination of both we did not see any additive or synergistic effects of combination treatment over individual therapy suggesting FGF19 and FGF21 share a common mechanism of action (H). To confirm our initial results regarding the specificity of FGF19 for FGFR4 we turned to L6 cells which have been reported to have extremely low expression of FGFRs and KLs. In parental L6 cells treatment with FGF19 had no effect on the level of ERK phosphorylation, however, when cells were transfected with KLB a small but significant increase in pERK was detected. Furthermore, when FGFR4 was added the response to FGF19 stimulation was magnified. Interestingly, we saw again that in cells transfected with FGFR4 alone FGF19 was also able to induce pERK confirming KLB independent signaling with this ligand can occur (I). In contrast to FGF19, cells treated with FGF21 showed pERK induction only in the presence of KLB with the level of this baseline induction similar to that seen with FGF19 treatment (J).

    Journal: PLoS ONE

    Article Title: Fundamentals of FGF19 & FGF21 Action In Vitro and In Vivo

    doi: 10.1371/journal.pone.0038438

    Figure Lengend Snippet: The “hormone like” FGFs exhibit different signaling properties in vitro. Panel 1. In 3T3-L1 fibroblasts over-expressing KL we saw phosphorylation of the FGF target ERK upon treatment with FGF23, while FGF19 and 21 had no effect (A). Conversely, in 3T3-L1/KLB cells we saw no effect of FGF23 but potent signaling with FGF19 or FGF21 treatment (B). When we examined glucose uptake in the 3T3-L1/KL cells we found that only FGF23 lead to its stimulation (C). As we saw with pERK in 3T3-L1/KLB cells FGF19 and FGF21 both increased glucose uptake significantly (D). In 3T3-L1 fibroblasts expressing FGFR4 in the absence of KLB only FGF19 was able to increase glucose uptake (E). Furthermore, in Hep3B cells which show a relative enrichment of FGFR4, FGF19 was significantly more potent than FGF21 in inducing expression of the immediate early gene EGR1 (F). When 3T3-L1 cells were differentiated to become mature adipocytes FGF19 was also more potent than FGF21 even in the absence of FGFR4 expression suggesting a possible unknown factor which is not present on fibroblasts may be affecting FGF19's action in these cells, or vice versa (G). In 3T3-L1 adipocytes treated with either FGF19, FGF21 or a combination of both we did not see any additive or synergistic effects of combination treatment over individual therapy suggesting FGF19 and FGF21 share a common mechanism of action (H). To confirm our initial results regarding the specificity of FGF19 for FGFR4 we turned to L6 cells which have been reported to have extremely low expression of FGFRs and KLs. In parental L6 cells treatment with FGF19 had no effect on the level of ERK phosphorylation, however, when cells were transfected with KLB a small but significant increase in pERK was detected. Furthermore, when FGFR4 was added the response to FGF19 stimulation was magnified. Interestingly, we saw again that in cells transfected with FGFR4 alone FGF19 was also able to induce pERK confirming KLB independent signaling with this ligand can occur (I). In contrast to FGF19, cells treated with FGF21 showed pERK induction only in the presence of KLB with the level of this baseline induction similar to that seen with FGF19 treatment (J).

    Article Snippet: Reactions were performed in triplicate on an ABI Prism 7900HT (PE Applied Biosystems) and were normalized to either 36B4 mRNA or 18S rRNA. ssays-on-Demand Gene Expression Products (PE Applied Biosystems) were as follows: hEGR1, Hs00152928_m1; hFGFR1, Hs00915142_m1; hFGFR2, Hs01552926_m1; hFGFR3, Hs00179829_m1; hFGFR4, Hs01106908_m1; hKL, Hs00183100_m1; hKLB, Hs00545621_m1; mFGFR1, Mm00438930_m1; mFGFR2, Mm01269930_m1; mFGFR3, Mm00433294_m1; mFGFR4, Mm01341852_m1; mKL, Mm00473122_m1; mKLB, Mm00502002_m1; rFGFR1, Rn00577234_m1, rFGFR2, Rn01269940_m1; rFGFR3, Rn00584799_m1; rFGFR4, Rn01441815_m1; rKL, Rn00580123_m1.

    Techniques: In Vitro, Expressing, Transfection