faststart taq dna polymerase  (Roche)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    FastStart Taq DNA Polymerase
    Description:

    Catalog Number:
    FTDPU2791696
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Roche faststart taq dna polymerase
    A comparison of potential enhancers on the PCR of α/β-tryptase gDNA using DY682-labeled (left panels) or digoxigenin-labeled (right panels) 3′-primer. The effects of ethylene glycol (0.5 to 2.5 M), betaine (0.5 to 2.5 M), glycerol (0.5 to 2.5 M), DMSO (0.5 to 10%) or no additive was examined on PCRs performed with gDNA amounts of 0.3-0.5 ng and <t>Taq</t> <t>DNA</t> polymerase of 0.75 U per PCR with ethylene glycol or betaine, or 1.2–2.0 ng of gDNA and 1.25 U of Taq DNA polymerase per PCR with glycerol or DMSO. Representative images of the 1017-28 bp amplimers from three independent experiments are shown. Band intensity data is stored in S3 Table .

    https://www.bioz.com/result/faststart taq dna polymerase/product/Roche
    Average 99 stars, based on 260 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "A Simple, Sensitive and Safe Method to Determine the Human α/β-Tryptase Genotype"

    Article Title: A Simple, Sensitive and Safe Method to Determine the Human α/β-Tryptase Genotype

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0114944

    A comparison of potential enhancers on the PCR of α/β-tryptase gDNA using DY682-labeled (left panels) or digoxigenin-labeled (right panels) 3′-primer. The effects of ethylene glycol (0.5 to 2.5 M), betaine (0.5 to 2.5 M), glycerol (0.5 to 2.5 M), DMSO (0.5 to 10%) or no additive was examined on PCRs performed with gDNA amounts of 0.3-0.5 ng and Taq DNA polymerase of 0.75 U per PCR with ethylene glycol or betaine, or 1.2–2.0 ng of gDNA and 1.25 U of Taq DNA polymerase per PCR with glycerol or DMSO. Representative images of the 1017-28 bp amplimers from three independent experiments are shown. Band intensity data is stored in S3 Table .
    Figure Legend Snippet: A comparison of potential enhancers on the PCR of α/β-tryptase gDNA using DY682-labeled (left panels) or digoxigenin-labeled (right panels) 3′-primer. The effects of ethylene glycol (0.5 to 2.5 M), betaine (0.5 to 2.5 M), glycerol (0.5 to 2.5 M), DMSO (0.5 to 10%) or no additive was examined on PCRs performed with gDNA amounts of 0.3-0.5 ng and Taq DNA polymerase of 0.75 U per PCR with ethylene glycol or betaine, or 1.2–2.0 ng of gDNA and 1.25 U of Taq DNA polymerase per PCR with glycerol or DMSO. Representative images of the 1017-28 bp amplimers from three independent experiments are shown. Band intensity data is stored in S3 Table .

    Techniques Used: Polymerase Chain Reaction, Labeling

    2) Product Images from "An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications"

    Article Title: An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0013042

    Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.
    Figure Legend Snippet: Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.

    Techniques Used: Incubation, Real-time Polymerase Chain Reaction

    3) Product Images from "Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition"

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0077771

    Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.
    Figure Legend Snippet: Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Techniques Used: Polymerase Chain Reaction, Inhibition, Real-time Polymerase Chain Reaction, Formalin-fixed Paraffin-Embedded, Amplification

    Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.
    Figure Legend Snippet: Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Techniques Used: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.
    Figure Legend Snippet: Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Techniques Used: Polymerase Chain Reaction, Amplification, Inhibition, Formalin-fixed Paraffin-Embedded

    Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.
    Figure Legend Snippet: Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Techniques Used: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Real-time Polymerase Chain Reaction, Molecular Weight

    Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.
    Figure Legend Snippet: Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Formalin-fixed Paraffin-Embedded

    PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.
    Figure Legend Snippet: PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Techniques Used: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Real-time Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis

    PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.
    Figure Legend Snippet: PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Techniques Used: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Concentration Assay, Real-time Polymerase Chain Reaction

    4) Product Images from "Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms"

    Article Title: Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

    Journal: Retrovirology

    doi: 10.1186/1742-4690-2-64

    DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.
    Figure Legend Snippet: DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.

    Techniques Used: DNA Methylation Assay, Methylation Sequencing, Combined Bisulfite Restriction Analysis Assay, Expressing, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Methylation

    5) Product Images from "A comprehensive look at transcription factor gene expression changes in colorectal adenomas"

    Article Title: A comprehensive look at transcription factor gene expression changes in colorectal adenomas

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-14-46

    Methylation analysis of the CpG island in the DACH1 promoter. (A) : Schematic depiction of the CpG islands located respectively 5’ upstream from the DACH1 transcription start site (CpG I) and in the first intron of the DACH1 gene (CpG II). (B) : Examples of CpG I COBRA analysis in colorectal cancers with intense (red), patchy (green), or no (blue) DACH1 protein immunostaining and in 4 colon cancer cell lines characterized by low (HT29 and Caco2) or very low (HCT116 and CO115) DACH1 expression (based on microarray-documented DACH1 mRNA expression levels - see also Additional file 9 ). Asterisks indicate Taq α I -digested DNA fragments representing methylated alleles; slower-migrating fragments correspond to undigested, unmethylated DNA. MW, molecular weight; bp, base pair.
    Figure Legend Snippet: Methylation analysis of the CpG island in the DACH1 promoter. (A) : Schematic depiction of the CpG islands located respectively 5’ upstream from the DACH1 transcription start site (CpG I) and in the first intron of the DACH1 gene (CpG II). (B) : Examples of CpG I COBRA analysis in colorectal cancers with intense (red), patchy (green), or no (blue) DACH1 protein immunostaining and in 4 colon cancer cell lines characterized by low (HT29 and Caco2) or very low (HCT116 and CO115) DACH1 expression (based on microarray-documented DACH1 mRNA expression levels - see also Additional file 9 ). Asterisks indicate Taq α I -digested DNA fragments representing methylated alleles; slower-migrating fragments correspond to undigested, unmethylated DNA. MW, molecular weight; bp, base pair.

    Techniques Used: Methylation, Combined Bisulfite Restriction Analysis Assay, Immunostaining, Expressing, Microarray, Molecular Weight

    6) Product Images from "Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms"

    Article Title: Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

    Journal: Retrovirology

    doi: 10.1186/1742-4690-2-64

    DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.
    Figure Legend Snippet: DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.

    Techniques Used: DNA Methylation Assay, Methylation Sequencing, Combined Bisulfite Restriction Analysis Assay, Expressing, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Methylation

    7) Product Images from "An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications"

    Article Title: An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0013042

    Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.
    Figure Legend Snippet: Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.

    Techniques Used: Incubation, Real-time Polymerase Chain Reaction

    8) Product Images from "Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms"

    Article Title: Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

    Journal: Retrovirology

    doi: 10.1186/1742-4690-2-64

    DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.
    Figure Legend Snippet: DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.

    Techniques Used: DNA Methylation Assay, Methylation Sequencing, Combined Bisulfite Restriction Analysis Assay, Expressing, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Methylation

    9) Product Images from "An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications"

    Article Title: An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0013042

    Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.
    Figure Legend Snippet: Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.

    Techniques Used: Incubation, Real-time Polymerase Chain Reaction

    10) Product Images from "Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms"

    Article Title: Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms

    Journal: Retrovirology

    doi: 10.1186/1742-4690-2-64

    DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.
    Figure Legend Snippet: DNA methylation of the HTLV-I provirus assessed by sodium bisulfite sequencing and COBRA. A. DNA methylation in the HTLV-I provirus was analyzed by sodium bisulfite sequencing in a case of acute ATL and a tax gene-expressing cell line, ATL-48T. Eight DNA regions, which were represented as bars in A, were amplified with sodium bisulfite treated DNA. The PCR products were subcloned into plasmid DNA, and then the sequences of each clone were determined for at least ten clones of each region. Arrowheads indicate the CpG sites that were target sites for COBRA. Closed circle indicates methylated CpG, and open circle means unmethylated CpG. The number of integrated provirus has been shown in parenthesis. B. Representative data of COBRA has been shown. PCR products, which were amplified with sodium bisulfite treated DNAs, were digested with Taq I or Acc II. The extent of methylation in each CpG site was measured as described in Methods, and presented as percentages of methylated CpG. The number in parenthesis represents the position of cytidine residue in analyzed CpG site by COBRA according to Seiki et al. [41]. C. DNA methylation studied by COBRA at eight points in the provirus as shown by arrowheads. Each bar represented the extent of DNA methylation at the points shown by arrowhead. The analyses by COBRA were performed three times independently, and the extents of DNA methylation are shown by the mean ± SD. The number in parenthesis shows the position of cytidine residue of CpG site analyzed by COBRA.

    Techniques Used: DNA Methylation Assay, Methylation Sequencing, Combined Bisulfite Restriction Analysis Assay, Expressing, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Methylation

    Related Articles

    Diagnostic Assay:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene. .. The relative quantity of the bands corresponding to exon inclusion/exon skipping was estimated by laser densitometry using ImageLab software and reported as percent exon skipping (relative to the sum of both bands in each lane).

    Clone Assay:

    Article Title: Functional screening for anti-CMV biologics identifies a broadly neutralizing epitope of an essential envelope protein
    Article Snippet: PCR with FastStart Taq DNA polymerase (Roche) was performed according to factory supplier using degenerate broad primers specific for 5′ UTR ends of heavy and kappa mouse V genes and specific IgG constant and kappa constant 3′ primers . .. For 5C3, sequence blasted as a mouse VH1–61/JH3 for heavy and mouse VK 3–12/JK2 for kappa.

    Article Title: Stability of the CpG island methylator phenotype during glioma progression and identification of methylated loci in secondary glioblastomas
    Article Snippet: PCR reactions were performed using FastStart Taq DNA polymerase (Roche, West Sussex, UK) on a semi-nested basis for all genes using the primers listed in Additional file . .. A touchdown PCR program for primary and secondary reactions using gene specific annealing temperatures was performed.

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. PCR reactions consisted of a heat activation step for 5 min at 95 °C, 35 cycles of 15 s at 95 °C, 15 s at 55, 58, 60 and 62 °C, and 30 s at 72 °C, with a final elongation step of 10 min at 72 °C.

    Article Title: Characterization of Glycosomal RING Finger Proteins of Trypanosomatids
    Article Snippet: For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system). .. For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system).

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer. .. PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer.

    Amplification:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Cells were harvested by trypsinization after 48 h. Total RNA was isolated using Trizol Reagent (ThermoFisher) and phenol-chloroform extraction. cDNA synthesis was performed using NZY First-Strand cDNA Synthesis Kit (NZYtech). .. Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene. .. The end-point PCR amplification products were analyzed by 2% agarose gel electrophoresis and/or by capillary gel electrophoresis using the Fragment AnalyzerTM (Advanced Analytical), and their identity was confirmed by Sanger sequencing.

    Article Title: Preferential MGMT methylation could predispose a subset of KIT/PDGFRA-WT GISTs, including SDH-deficient ones, to respond to alkylating agents
    Article Snippet: Each exon was amplified with polymerase chain reaction (PCR) amplification using specific primer pairs, as previously reported [ ]. .. PCR was carried out in a total volume of 25 μl consisting in 20 ng of DNA, 10 × PCR buffer, MgCl2, dNTP, primers (10 pM each), and 1 U FastStart DNA Taq polymerase (Roche).

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Complementary DNA was synthesized using ThermoScript™ reverse transcriptase (Invitrogen) and oligo (dT)20 (Invitrogen) according to the manufacturer’s recommendation. .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany). .. The primer pairs used were as follows: V1-forward: ATGTTTGGCCGCTCGCGGAG, reverse: TGTGTCTTGCCAGTCAGCGGC; V2-forward: ATGTTTGGCCGCTCGCGGAG, reverse: CTAAGAAGCTGGTGCTGCCAG; GAPDH-forward: CATGTTCCAATATGATTCCACCCA, reverse: TTACTCCTTGGAGGCCATGTG.

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: The resulting cDNA was frozen at −20 °C for mRNA detection. .. The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany). .. A volume of 1.5 μl cDNA from reverse transcription was replicated in PCR reactions in a total volume of 25 μl containing Taq DNA Polymerase (0.63 units), buffer supplied with enzymes, MgCl2 (50 pmol), dNTP (200 μmol) and primers (20 pmol).

    Article Title: Next-generation sequencing analysis of a cluster of hepatitis C virus infections in a haematology and oncology center
    Article Snippet: Next, RNA was subjected to reverse transcription at 42°C for 60 minutes using AccuScript High Fidelity Reverse Transcriptase (Agilent Technologies, Santa Clara, CA, USA) and random hexamers. .. A region of 175 nt length encompassing HVR1 was amplified in two-step PCR using FastStart High Fidelity Taq DNA Polymerase (Roche, Indianapolis, IN, USA). .. Primers used for the first round amplification were as follows: 5′-CATTGCAGTTCAGGGCCGTGCTA-3′ (nt 1632–1610) and 5′-GGTGCTCACTGGGGAGTCCT-3′ (nt 1389–1408), according to the sequence of reference strain H77 (GenBank accession no. ).

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Previously described oligonucleotides were used to amplify a 773 bp fragment of the EAAT2 promoter [ ]. .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK). .. Amplification was performed as follows: 1 cycle at 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 65 °C for 30 s, 72 °C for 1 min and final extension at 72 °C for 10 min.

    Article Title: Comparing 16S rDNA amplicon sequencing and hybridization capture for pea aphid microbiota diversity analysis
    Article Snippet: Paragraph title: DNA source, 16S rDNA amplification and sequencing ... PCR was performed in a 25 µl reaction volume, using 0.6 units of Taq DNA polymerase (Expand High Fidelity PCR System, Roche, ref: 11732650001) and 1 µl of DNA template, in the following conditions: 1.5 mM MgCl2 , 0.125 mM of each dNTP, 0.4 µM reverse and forward primers.

    Article Title: Characterization of Glycosomal RING Finger Proteins of Trypanosomatids
    Article Snippet: To select for cells bearing the latter construct, puromycin (PAC) was added to a final concentration of 1 μg/ml. .. For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system). .. Forward and reverse primers (all sequences are 5′ to 3′), respectively, were CTTAAGATGCAGCCGGCGACGGCACC and CTCGAGTGCAGACGTGTCATGAAC for TcPEX10, CTTAAGATGCAACCGGCCACTGC and CTCGAGTGACGCACCGCTGTCGC for TbPEX10, CTTAAGATGTTCGAGAGCAACCTCCTC and CTCGAGGCACTCGAAAACTCGGCGGATC for LmPEX12 and CTTAAGATGATAGAGAGTAACTTGCTCTCG and CTCGAGGCACTCATAAATACGTCGAAC for TbPEX12.

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: SCF cDNA was amplified from total cDNA obtained after reverse transcription by online fluorescent PCR (LightCycler™-SYBR Green I, ROCHE Diagnostics), with primers that lead to a single 149 bp PCR product. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles.

    Article Title: Minimal evidence for a direct involvement of Twisted Gastrulation Homolog 1 (TWSG1) gene in human holoprosencephaly
    Article Snippet: The same primers were used for HRM, direct PCR amplification, and sequencing. .. Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer. .. All reactions were done using a Roche LightCycler® 480 (Roche, Ind.).

    Article Title: A Hypomorphic Allele in the FGF8 Gene Contributes to Holoprosencephaly and Is Allelic to Gonadotropin-Releasing Hormone Deficiency in Humans
    Article Snippet: Investigation of all samples was in accordance with a National Human Genome Research Institute (NHGRI) Institutional Review Board-approved research protocol. .. Roche LightCycler ® 480: All exons, except exon 1 (see below), were amplified in a 7.5-μl reaction volume using 5–10 ng DNA template, 3.5 μl of Roche High-resolution melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye (Roche)), 0.6 μl of magnesium chloride (Roche) and 0.3 m M of each primer. .. All reactions were done employing a Roche LightCycler® 480 (Roche, Ind.).

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: nbs1 from genomic DNA of Java 6 and strains of the rad3 complementation groups were amplified using the primers from Table S1 . .. The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System).

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: The blaB open reading frame was amplified with oligonucleotides C.BlaB-FOR (5′-GC T CTA GA A GGA GAA TAA GAA ATG TTG AAA AAA ATA AAA ATA AGC TTG), which added an Xba I linker (underlined) and a ribosomal-binding site located 8 bp upstream of the blaB start codon, and C.BlaB-REV (5′-GGC GGA TCC GGA AAA AGG CTT CAT TAA TTT G), which added a Bam HI linker (underlined) downstream from the blaB stop codon. .. PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer.

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: Next, 2 μg of total RNA from each sample was reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA) in a 20 μL reaction according to the manufacturer’s protocol. .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. Primer sequences were as follows: rat GAPDH (NCBI RefSeq NM_017008.4), F: 5′-TACAGCAACAGGGTGGTGGAC-3′, R: 5′-GGGATGGAATTGTGAGGGAGA-3′; rat GLUT4 (NCBI RefSeq NM_012751.1), F: 5′-CTTCCTTCTATTTGCCGTCCTC-3′, R: 5′-GCTGCTGTTTCCTTCATCCTG-3′; rat IRAP (NCBI Refseq NM_001113403.2), F: 5′-GTGGGGACTAAGGGCGAAAA-3′ R:5′-CATACATCCGGACCTCCACG-3′.

    Article Title: Expression of Human ?-Defensins in Conjunctival Epithelium: Relevance to Dry Eye Disease
    Article Snippet: Duplex PCR (Fast- Taq kit; Roche Diagnostics Inc., Indianapolis, IN) was performed for GAPDH+hBD-1 and for GAPDH+hBD-2. .. Duplex PCR (Fast- Taq kit; Roche Diagnostics Inc., Indianapolis, IN) was performed for GAPDH+hBD-1 and for GAPDH+hBD-2.

    Synthesized:

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Complementary DNA was synthesized using ThermoScript™ reverse transcriptase (Invitrogen) and oligo (dT)20 (Invitrogen) according to the manufacturer’s recommendation. .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany).

    TA Cloning:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. PCR reactions consisted of a heat activation step for 5 min at 95 °C, 35 cycles of 15 s at 95 °C, 15 s at 55, 58, 60 and 62 °C, and 30 s at 72 °C, with a final elongation step of 10 min at 72 °C.

    Construct:

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Paragraph title: Primary Astrocyte Cultures and Preparation of the EAAT2 Promoter Constructs ... Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Article Title: Characterization of Glycosomal RING Finger Proteins of Trypanosomatids
    Article Snippet: To select for cells bearing the latter construct, puromycin (PAC) was added to a final concentration of 1 μg/ml. .. For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system). .. Forward and reverse primers (all sequences are 5′ to 3′), respectively, were CTTAAGATGCAGCCGGCGACGGCACC and CTCGAGTGCAGACGTGTCATGAAC for TcPEX10, CTTAAGATGCAACCGGCCACTGC and CTCGAGTGACGCACCGCTGTCGC for TbPEX10, CTTAAGATGTTCGAGAGCAACCTCCTC and CTCGAGGCACTCGAAAACTCGGCGGATC for LmPEX12 and CTTAAGATGATAGAGAGTAACTTGCTCTCG and CTCGAGGCACTCATAAATACGTCGAAC for TbPEX12.

    Real-time Polymerase Chain Reaction:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: Paragraph title: IS900 quantitative PCR ... All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany). .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany).

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: Next, 2 μg of total RNA from each sample was reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA) in a 20 μL reaction according to the manufacturer’s protocol. .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. Primer sequences were as follows: rat GAPDH (NCBI RefSeq NM_017008.4), F: 5′-TACAGCAACAGGGTGGTGGAC-3′, R: 5′-GGGATGGAATTGTGAGGGAGA-3′; rat GLUT4 (NCBI RefSeq NM_012751.1), F: 5′-CTTCCTTCTATTTGCCGTCCTC-3′, R: 5′-GCTGCTGTTTCCTTCATCCTG-3′; rat IRAP (NCBI Refseq NM_001113403.2), F: 5′-GTGGGGACTAAGGGCGAAAA-3′ R:5′-CATACATCCGGACCTCCACG-3′.

    Multiplex Assay:

    Article Title: Next-generation sequencing analysis of a cluster of hepatitis C virus infections in a haematology and oncology center
    Article Snippet: A region of 175 nt length encompassing HVR1 was amplified in two-step PCR using FastStart High Fidelity Taq DNA Polymerase (Roche, Indianapolis, IN, USA). .. Primers used for the first round amplification were as follows: 5′-CATTGCAGTTCAGGGCCGTGCTA-3′ (nt 1632–1610) and 5′-GGTGCTCACTGGGGAGTCCT-3′ (nt 1389–1408), according to the sequence of reference strain H77 (GenBank accession no. ).

    Incubation:

    Article Title: Minimal evidence for a direct involvement of Twisted Gastrulation Homolog 1 (TWSG1) gene in human holoprosencephaly
    Article Snippet: Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer. .. Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer.

    Article Title: A Hypomorphic Allele in the FGF8 Gene Contributes to Holoprosencephaly and Is Allelic to Gonadotropin-Releasing Hormone Deficiency in Humans
    Article Snippet: Roche LightCycler ® 480: All exons, except exon 1 (see below), were amplified in a 7.5-μl reaction volume using 5–10 ng DNA template, 3.5 μl of Roche High-resolution melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye (Roche)), 0.6 μl of magnesium chloride (Roche) and 0.3 m M of each primer. .. Roche LightCycler ® 480: All exons, except exon 1 (see below), were amplified in a 7.5-μl reaction volume using 5–10 ng DNA template, 3.5 μl of Roche High-resolution melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye (Roche)), 0.6 μl of magnesium chloride (Roche) and 0.3 m M of each primer.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Preferential MGMT methylation could predispose a subset of KIT/PDGFRA-WT GISTs, including SDH-deficient ones, to respond to alkylating agents
    Article Snippet: Briefly, FFPE slices (three 10-μm-thick slices for each sample) were digested overnight at 56 °C in ATL buffer with the addition of proteinase K (Qiagen). .. PCR was carried out in a total volume of 25 μl consisting in 20 ng of DNA, 10 × PCR buffer, MgCl2, dNTP, primers (10 pM each), and 1 U FastStart DNA Taq polymerase (Roche).

    Infection:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. PCR products were analysed on a 2% agarose gel electrophoresis, purified with a MinElute Gel Extraction Kit (Qiagen, UK) according to the manufacturer’s instructions; cloned using a TOPO TA cloning kit for sequencing (Invitrogen) and sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit and 3730 DNA Analyser (Applied Biosystems).

    Expressing:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Cells were harvested by trypsinization after 48 h. Total RNA was isolated using Trizol Reagent (ThermoFisher) and phenol-chloroform extraction. cDNA synthesis was performed using NZY First-Strand cDNA Synthesis Kit (NZYtech). .. Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene. .. The end-point PCR amplification products were analyzed by 2% agarose gel electrophoresis and/or by capillary gel electrophoresis using the Fragment AnalyzerTM (Advanced Analytical), and their identity was confirmed by Sanger sequencing.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Paragraph title: 3.3. Expression Analyses ... Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany).

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: Paragraph title: Isolation of RNA in spinal cord tissue and detection of nitric oxide synthase mRNA expression using semiquantitative reverse transcription-PCR ... The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany).

    Article Title: Characterization of Glycosomal RING Finger Proteins of Trypanosomatids
    Article Snippet: For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system). .. Each PCR product was cloned into pGEM-Teasy (Promega).

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: Construction of the expression vectors pET9-Chryseo and pET24-Chryseo was performed as follows. .. PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer.

    Modification:

    Article Title: Stability of the CpG island methylator phenotype during glioma progression and identification of methylated loci in secondary glioblastomas
    Article Snippet: 0.5 μg of DNA for each sample was bisulfite modified using the Qiagen EpiTect kit (Qiagen, Heidelberg, Germany) according to manufacturers’ instructions. .. PCR reactions were performed using FastStart Taq DNA polymerase (Roche, West Sussex, UK) on a semi-nested basis for all genes using the primers listed in Additional file .

    Article Title: Next-generation sequencing analysis of a cluster of hepatitis C virus infections in a haematology and oncology center
    Article Snippet: In brief, total RNA was extracted from 250 μl of serum by a modified guanidinium thiocyanate-phenol/chlorophorm method using Trizol (Life Technologies, Carlsbad, CA, USA). .. A region of 175 nt length encompassing HVR1 was amplified in two-step PCR using FastStart High Fidelity Taq DNA Polymerase (Roche, Indianapolis, IN, USA).

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Cells were cultured in Dulbecco’s modified Eagle’s medium (Sigma Aldrich, MO, USA) containing 4.5 g/l glucose, 29 mM sodium bicarbonate, 50 U/ml penicillin, 50 μg/ml streptomycin (Sigma Aldrich, MO, USA) and 10% (v /v ) foetal bovine serum (Life Technologies Ltd., Paisley, UK). .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Article Title: Expression of Human ?-Defensins in Conjunctival Epithelium: Relevance to Dry Eye Disease
    Article Snippet: A modified phenol-chloroform extraction procedure was used for total RNA extraction from the impression cytology specimens. .. Duplex PCR (Fast- Taq kit; Roche Diagnostics Inc., Indianapolis, IN) was performed for GAPDH+hBD-1 and for GAPDH+hBD-2.

    Western Blot:

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: The L6 cells were subjected to the same western blotting operation described above and divided into control, insulin, and FSE groups. .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA).

    Over Expression:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: For U1 snRNA overexpression experiments cells were transfected with 1 μg of wild type or mutant minigenes and co-transfected with 1 μg of U1 snRNA variants. .. Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene.

    Gel Purification:

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System). .. Thermocycler conditions were 90° for 5 min, then 35 cycles of 95° for 30 sec, 55° for 30 sec, and 72° for 30 sec per kilobase of target fragment, then a final extension at 72° for 10 min, followed by a hold at 10°.

    Electron Microscopy:

    Article Title: Comparing 16S rDNA amplicon sequencing and hybridization capture for pea aphid microbiota diversity analysis
    Article Snippet: Two PCR primer pairs for next-generation sequencing-based diversity studies were used (Fig. ): the earth microbiome primer pair (EM) [ ] producing a 292 bp amplicon targeting the hypervariable V4 region (515F: GTGCCAGCMGCCGCGGTAA, 806R: GGACTACHVGGGTWTCTAAT); and the NAR primer pair selected by Klindworth et al. [ ] producing a 464 bp amplicon targeting the hypervariable V3 and V4 regions (S-D-Bact-0341-b-S-17: CCTACGGGNGGCWGCAG, S-D-Bact-0785-a-A-21: GACTACHVGGGTATCTAATCC). .. PCR was performed in a 25 µl reaction volume, using 0.6 units of Taq DNA polymerase (Expand High Fidelity PCR System, Roche, ref: 11732650001) and 1 µl of DNA template, in the following conditions: 1.5 mM MgCl2 , 0.125 mM of each dNTP, 0.4 µM reverse and forward primers.

    Transfection:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Paragraph title: Transient transfections and splicing analysis ... Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene.

    Activation Assay:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: Next, 2 μg of total RNA from each sample was reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA) in a 20 μL reaction according to the manufacturer’s protocol. .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. Primer sequences were as follows: rat GAPDH (NCBI RefSeq NM_017008.4), F: 5′-TACAGCAACAGGGTGGTGGAC-3′, R: 5′-GGGATGGAATTGTGAGGGAGA-3′; rat GLUT4 (NCBI RefSeq NM_012751.1), F: 5′-CTTCCTTCTATTTGCCGTCCTC-3′, R: 5′-GCTGCTGTTTCCTTCATCCTG-3′; rat IRAP (NCBI Refseq NM_001113403.2), F: 5′-GTGGGGACTAAGGGCGAAAA-3′ R:5′-CATACATCCGGACCTCCACG-3′.

    Cell Culture:

    Article Title: Stability of the CpG island methylator phenotype during glioma progression and identification of methylated loci in secondary glioblastomas
    Article Snippet: PCR reactions were performed using FastStart Taq DNA polymerase (Roche, West Sussex, UK) on a semi-nested basis for all genes using the primers listed in Additional file . .. A touchdown PCR program for primary and secondary reactions using gene specific annealing temperatures was performed.

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Cells were cultured in Dulbecco’s modified Eagle’s medium (Sigma Aldrich, MO, USA) containing 4.5 g/l glucose, 29 mM sodium bicarbonate, 50 U/ml penicillin, 50 μg/ml streptomycin (Sigma Aldrich, MO, USA) and 10% (v /v ) foetal bovine serum (Life Technologies Ltd., Paisley, UK). .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Generated:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Polymerase Chain Reaction:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Cells were harvested by trypsinization after 48 h. Total RNA was isolated using Trizol Reagent (ThermoFisher) and phenol-chloroform extraction. cDNA synthesis was performed using NZY First-Strand cDNA Synthesis Kit (NZYtech). .. Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene. .. The end-point PCR amplification products were analyzed by 2% agarose gel electrophoresis and/or by capillary gel electrophoresis using the Fragment AnalyzerTM (Advanced Analytical), and their identity was confirmed by Sanger sequencing.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Assays were established using standard DNAs with 0, 25, 50, 75, and 100% methylation. .. PCR was performed in 25 µl reactions consisting of 2.5 µl 10x PCR buffer with MgCl2 , 0.5 µl dNTPs, 1.25 µl (10 pmol/ml) of each forward and reverse primer, 0.2 µl FastStart Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany), and 1 µl (∼25 ng) bisulfite converted DNA. .. Pyrosequencing was performed on a PyroMark Q96 MD system using the PyroMark Gold Q96 CDT reagent kit and Pyro Q-CpG software (Qiagen, Hilden, Germany).

    Article Title: Functional screening for anti-CMV biologics identifies a broadly neutralizing epitope of an essential envelope protein
    Article Snippet: Briefly, RNA was extracted from the 5C3 hybridoma using Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA), followed by first stand cDNA synthesis using random hexamers and poly-T primers (Integrated DNA Technologies, Caralville, IA) and SuperScript 3 reverse transcriptase (ThermoFisher Scientific, NY, NY). .. PCR with FastStart Taq DNA polymerase (Roche) was performed according to factory supplier using degenerate broad primers specific for 5′ UTR ends of heavy and kappa mouse V genes and specific IgG constant and kappa constant 3′ primers . .. Purified PCR product was then submitted for Sanger sequencing in both directions using same primers as PCR (GeneWiz, South Plainfield, NJ).

    Article Title: Stability of the CpG island methylator phenotype during glioma progression and identification of methylated loci in secondary glioblastomas
    Article Snippet: 0.5 μg of DNA for each sample was bisulfite modified using the Qiagen EpiTect kit (Qiagen, Heidelberg, Germany) according to manufacturers’ instructions. .. PCR reactions were performed using FastStart Taq DNA polymerase (Roche, West Sussex, UK) on a semi-nested basis for all genes using the primers listed in Additional file . .. A touchdown PCR program for primary and secondary reactions using gene specific annealing temperatures was performed.

    Article Title: Preferential MGMT methylation could predispose a subset of KIT/PDGFRA-WT GISTs, including SDH-deficient ones, to respond to alkylating agents
    Article Snippet: Each exon was amplified with polymerase chain reaction (PCR) amplification using specific primer pairs, as previously reported [ ]. .. PCR was carried out in a total volume of 25 μl consisting in 20 ng of DNA, 10 × PCR buffer, MgCl2, dNTP, primers (10 pM each), and 1 U FastStart DNA Taq polymerase (Roche). .. PCR conditions were an initial denaturation of 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 52–64 °C for 30 s, and 72 °C for 30 s. PCR products were purified with the Qiaquick PCR purification kit (Qiagen) and sequenced on both strands using the Big Dye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems).

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: ICLN of all animals was tested for the presence of MAP by PCR for insertion sequence IS900 . .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Complementary DNA was synthesized using ThermoScript™ reverse transcriptase (Invitrogen) and oligo (dT)20 (Invitrogen) according to the manufacturer’s recommendation. .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany). .. The primer pairs used were as follows: V1-forward: ATGTTTGGCCGCTCGCGGAG, reverse: TGTGTCTTGCCAGTCAGCGGC; V2-forward: ATGTTTGGCCGCTCGCGGAG, reverse: CTAAGAAGCTGGTGCTGCCAG; GAPDH-forward: CATGTTCCAATATGATTCCACCCA, reverse: TTACTCCTTGGAGGCCATGTG.

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: The resulting cDNA was frozen at −20 °C for mRNA detection. .. The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany). .. A volume of 1.5 μl cDNA from reverse transcription was replicated in PCR reactions in a total volume of 25 μl containing Taq DNA Polymerase (0.63 units), buffer supplied with enzymes, MgCl2 (50 pmol), dNTP (200 μmol) and primers (20 pmol).

    Article Title: Next-generation sequencing analysis of a cluster of hepatitis C virus infections in a haematology and oncology center
    Article Snippet: Next, RNA was subjected to reverse transcription at 42°C for 60 minutes using AccuScript High Fidelity Reverse Transcriptase (Agilent Technologies, Santa Clara, CA, USA) and random hexamers. .. A region of 175 nt length encompassing HVR1 was amplified in two-step PCR using FastStart High Fidelity Taq DNA Polymerase (Roche, Indianapolis, IN, USA). .. Primers used for the first round amplification were as follows: 5′-CATTGCAGTTCAGGGCCGTGCTA-3′ (nt 1632–1610) and 5′-GGTGCTCACTGGGGAGTCCT-3′ (nt 1389–1408), according to the sequence of reference strain H77 (GenBank accession no. ).

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Previously described oligonucleotides were used to amplify a 773 bp fragment of the EAAT2 promoter [ ]. .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK). .. Amplification was performed as follows: 1 cycle at 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 65 °C for 30 s, 72 °C for 1 min and final extension at 72 °C for 10 min.

    Article Title: Comparing 16S rDNA amplicon sequencing and hybridization capture for pea aphid microbiota diversity analysis
    Article Snippet: Two PCR primer pairs for next-generation sequencing-based diversity studies were used (Fig. ): the earth microbiome primer pair (EM) [ ] producing a 292 bp amplicon targeting the hypervariable V4 region (515F: GTGCCAGCMGCCGCGGTAA, 806R: GGACTACHVGGGTWTCTAAT); and the NAR primer pair selected by Klindworth et al. [ ] producing a 464 bp amplicon targeting the hypervariable V3 and V4 regions (S-D-Bact-0341-b-S-17: CCTACGGGNGGCWGCAG, S-D-Bact-0785-a-A-21: GACTACHVGGGTATCTAATCC). .. PCR was performed in a 25 µl reaction volume, using 0.6 units of Taq DNA polymerase (Expand High Fidelity PCR System, Roche, ref: 11732650001) and 1 µl of DNA template, in the following conditions: 1.5 mM MgCl2 , 0.125 mM of each dNTP, 0.4 µM reverse and forward primers. .. The annealing temperature for EM and NAR primer pairs is 50 and 58 °C, respectively.

    Article Title: Characterization of Glycosomal RING Finger Proteins of Trypanosomatids
    Article Snippet: To select for cells bearing the latter construct, puromycin (PAC) was added to a final concentration of 1 μg/ml. .. For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system). .. Forward and reverse primers (all sequences are 5′ to 3′), respectively, were CTTAAGATGCAGCCGGCGACGGCACC and CTCGAGTGCAGACGTGTCATGAAC for TcPEX10, CTTAAGATGCAACCGGCCACTGC and CTCGAGTGACGCACCGCTGTCGC for TbPEX10, CTTAAGATGTTCGAGAGCAACCTCCTC and CTCGAGGCACTCGAAAACTCGGCGGATC for LmPEX12 and CTTAAGATGATAGAGAGTAACTTGCTCTCG and CTCGAGGCACTCATAAATACGTCGAAC for TbPEX12.

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
    Article Snippet: Each DNA sample was quantified using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA), and the concentration was adjusted to 10 or 30 ng/μl for subsequent PCR amplifications. .. A range of 13 high fidelity, regular, economy and premium Taq polymerase enzymes were selected: Biotaq® (Bioline, London, UK), FastStart® High Fidelity PCR System (Roche, Mannheim, Germany), AmpliTaq Gold® (Applied Biosystems, Warrington, UK), HotStarTaq® DNA Polymerase (Qiagen, Hilden, Gernamy), Phusion® High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), Taq DNA Polymerase (Roche, Maylan, France), i-MaxTM II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea), KAPA HiFi™ (Kapa Biosystems, Boston, USA), OneTaq ™ DNA Polymerase (New England Biolabs, Hitchin, UK), Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Deep Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Pwo® DNA Polymerase (Roche, Maylan, France) and Velocity DNA Polymerase (Bioline, London, UK) (abbreviated names in ). .. The list price of these enzymes for the amount recommended for a single 10 μl reaction (not including tax, handling or shipping) ranged from €0.01 to €0.63 (Spain, June 2013).

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: SCF cDNA was amplified from total cDNA obtained after reverse transcription by online fluorescent PCR (LightCycler™-SYBR Green I, ROCHE Diagnostics), with primers that lead to a single 149 bp PCR product. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. Amplified SCF cDNA was analysed on-line by fluorescence, and quantified during the exponential state.

    Article Title: Minimal evidence for a direct involvement of Twisted Gastrulation Homolog 1 (TWSG1) gene in human holoprosencephaly
    Article Snippet: Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer. .. Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer.

    Article Title: A Hypomorphic Allele in the FGF8 Gene Contributes to Holoprosencephaly and Is Allelic to Gonadotropin-Releasing Hormone Deficiency in Humans
    Article Snippet: Paragraph title: PCR Amplification ... Roche LightCycler ® 480: All exons, except exon 1 (see below), were amplified in a 7.5-μl reaction volume using 5–10 ng DNA template, 3.5 μl of Roche High-resolution melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye (Roche)), 0.6 μl of magnesium chloride (Roche) and 0.3 m M of each primer.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: PCR conditions were as follows. .. The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System). .. Thermocycler conditions were 90° for 5 min, then 35 cycles of 95° for 30 sec, 55° for 30 sec, and 72° for 30 sec per kilobase of target fragment, then a final extension at 72° for 10 min, followed by a hold at 10°.

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: The blaB open reading frame was amplified with oligonucleotides C.BlaB-FOR (5′-GC T CTA GA A GGA GAA TAA GAA ATG TTG AAA AAA ATA AAA ATA AGC TTG), which added an Xba I linker (underlined) and a ribosomal-binding site located 8 bp upstream of the blaB start codon, and C.BlaB-REV (5′-GGC GGA TCC GGA AAA AGG CTT CAT TAA TTT G), which added a Bam HI linker (underlined) downstream from the blaB stop codon. .. PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer. .. Cycling conditions were as follows: 94°C, 1 min; 47°C (with an increment of 0.6°C/cycle, until 53°C), 1 min; 72°C, 1 min; repeated for 35 cycles, and followed by a final extension step of 10 min at 72°C.

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: Next, 2 μg of total RNA from each sample was reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA) in a 20 μL reaction according to the manufacturer’s protocol. .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. Primer sequences were as follows: rat GAPDH (NCBI RefSeq NM_017008.4), F: 5′-TACAGCAACAGGGTGGTGGAC-3′, R: 5′-GGGATGGAATTGTGAGGGAGA-3′; rat GLUT4 (NCBI RefSeq NM_012751.1), F: 5′-CTTCCTTCTATTTGCCGTCCTC-3′, R: 5′-GCTGCTGTTTCCTTCATCCTG-3′; rat IRAP (NCBI Refseq NM_001113403.2), F: 5′-GTGGGGACTAAGGGCGAAAA-3′ R:5′-CATACATCCGGACCTCCACG-3′.

    Article Title: Expression of Human ?-Defensins in Conjunctival Epithelium: Relevance to Dry Eye Disease
    Article Snippet: A constitutively expressed gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control to ensure equal amounts of starting cDNA in each reaction. .. Duplex PCR (Fast- Taq kit; Roche Diagnostics Inc., Indianapolis, IN) was performed for GAPDH+hBD-1 and for GAPDH+hBD-2. .. The primer sequences used and expected product sizes were as follows: GAPDH forward 5′-GTGAAGGTCGGAGTCAACGGATTT-3′, reverse 5′-CACAGTCTTCTGGGTGGCAGTGAT-3′, 555 bp; hBD-127 forward 5′-CCCAGTTCCTGAAATCCTGA-3′, reverse 5′-CAGGTGCCTTGAATTTTGGT-3′, 215 bp; hBD-230 forward 5′-CCAGCCATCAGCCATGAGGGT-3′, reverse 5′-GGAGCCCTTTCTGAATCCGCA-3′, 257 bp; hBD-314 forward 5′-AGCCTAGCAGCTATGAGGATC-3′, reverse 5′-CTTCGGCAGCATTTTCGGCCA-3′, 206 bp.

    Sequencing:

    Article Title: Functional screening for anti-CMV biologics identifies a broadly neutralizing epitope of an essential envelope protein
    Article Snippet: Sequencing and chimerization for 5C3 variable heavy and kappa chains were obtained by an adaptation of methods previously published for single mouse cells . .. PCR with FastStart Taq DNA polymerase (Roche) was performed according to factory supplier using degenerate broad primers specific for 5′ UTR ends of heavy and kappa mouse V genes and specific IgG constant and kappa constant 3′ primers .

    Article Title: Stability of the CpG island methylator phenotype during glioma progression and identification of methylated loci in secondary glioblastomas
    Article Snippet: Paragraph title: Clone sequencing ... PCR reactions were performed using FastStart Taq DNA polymerase (Roche, West Sussex, UK) on a semi-nested basis for all genes using the primers listed in Additional file .

    Article Title: Preferential MGMT methylation could predispose a subset of KIT/PDGFRA-WT GISTs, including SDH-deficient ones, to respond to alkylating agents
    Article Snippet: The exons of the subunits of SDH complex were sequenced on tumor and normal tissue using the Sanger sequencing method on ABI 310 Genetic Analyzer (Applied Biosystems). .. PCR was carried out in a total volume of 25 μl consisting in 20 ng of DNA, 10 × PCR buffer, MgCl2, dNTP, primers (10 pM each), and 1 U FastStart DNA Taq polymerase (Roche).

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: ICLN of all animals was tested for the presence of MAP by PCR for insertion sequence IS900 . .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Article Title: Next-generation sequencing analysis of a cluster of hepatitis C virus infections in a haematology and oncology center
    Article Snippet: A region of 175 nt length encompassing HVR1 was amplified in two-step PCR using FastStart High Fidelity Taq DNA Polymerase (Roche, Indianapolis, IN, USA). .. Primers used for the first round amplification were as follows: 5′-CATTGCAGTTCAGGGCCGTGCTA-3′ (nt 1632–1610) and 5′-GGTGCTCACTGGGGAGTCCT-3′ (nt 1389–1408), according to the sequence of reference strain H77 (GenBank accession no. ).

    Article Title: Comparing 16S rDNA amplicon sequencing and hybridization capture for pea aphid microbiota diversity analysis
    Article Snippet: Paragraph title: DNA source, 16S rDNA amplification and sequencing ... PCR was performed in a 25 µl reaction volume, using 0.6 units of Taq DNA polymerase (Expand High Fidelity PCR System, Roche, ref: 11732650001) and 1 µl of DNA template, in the following conditions: 1.5 mM MgCl2 , 0.125 mM of each dNTP, 0.4 µM reverse and forward primers.

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer. .. The resulting amplimer was digested with Xba I and Bam HI and cloned in pBC-SK, digested with the same enzymes, to obtain recombinant plasmid pJDD-1.

    Recombinant:

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: Paragraph title: Recombinant DNA methodology. ... PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer.

    Pyromark Assay:

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: The PyroMark Assay Design 2.0 software (Qiagen, Hilden, Germany) was used for primer design ( ). .. PCR was performed in 25 µl reactions consisting of 2.5 µl 10x PCR buffer with MgCl2 , 0.5 µl dNTPs, 1.25 µl (10 pmol/ml) of each forward and reverse primer, 0.2 µl FastStart Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany), and 1 µl (∼25 ng) bisulfite converted DNA.

    DNA Extraction:

    Article Title: Preferential MGMT methylation could predispose a subset of KIT/PDGFRA-WT GISTs, including SDH-deficient ones, to respond to alkylating agents
    Article Snippet: DNA extraction was then continued with QIAamp DNA micro kit (Qiagen). .. PCR was carried out in a total volume of 25 μl consisting in 20 ng of DNA, 10 × PCR buffer, MgCl2, dNTP, primers (10 pM each), and 1 U FastStart DNA Taq polymerase (Roche).

    Fluorescence:

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles.

    Methylation:

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Assays were established using standard DNAs with 0, 25, 50, 75, and 100% methylation. .. PCR was performed in 25 µl reactions consisting of 2.5 µl 10x PCR buffer with MgCl2 , 0.5 µl dNTPs, 1.25 µl (10 pmol/ml) of each forward and reverse primer, 0.2 µl FastStart Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany), and 1 µl (∼25 ng) bisulfite converted DNA.

    Mutagenesis:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: For U1 snRNA overexpression experiments cells were transfected with 1 μg of wild type or mutant minigenes and co-transfected with 1 μg of U1 snRNA variants. .. Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene.

    Isolation:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Cells were harvested by trypsinization after 48 h. Total RNA was isolated using Trizol Reagent (ThermoFisher) and phenol-chloroform extraction. cDNA synthesis was performed using NZY First-Strand cDNA Synthesis Kit (NZYtech). .. Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Total RNA from purified PBMCs was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany).

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: Paragraph title: Isolation of RNA in spinal cord tissue and detection of nitric oxide synthase mRNA expression using semiquantitative reverse transcription-PCR ... The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany).

    Luciferase:

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK). .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Size-exclusion Chromatography:

    Article Title: Minimal evidence for a direct involvement of Twisted Gastrulation Homolog 1 (TWSG1) gene in human holoprosencephaly
    Article Snippet: Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer. .. Each sample was amplified in a reaction volume of 7.5 μl, using 10 ng of DNA template, 3.75 μl of Roche High-Resolution Melting Master (containing FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and HRM dye), 0.9 μl of magnesium chloride (Roche), 1.7 μl of molecular grade water (Cellgro), and 0.2 μM of each primer.

    Purification:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: Genomic DNA (gDNA) was purified using the Wizard® Genomic DNA Purification Kit (Promega, UK). .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Total RNA from purified PBMCs was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany).

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK). .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System). .. Thermocycler conditions were 90° for 5 min, then 35 cycles of 95° for 30 sec, 55° for 30 sec, and 72° for 30 sec per kilobase of target fragment, then a final extension at 72° for 10 min, followed by a hold at 10°.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: Paragraph title: 4.6. RT-PCR ... The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA).

    Gel Extraction:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. PCR reactions consisted of a heat activation step for 5 min at 95 °C, 35 cycles of 15 s at 95 °C, 15 s at 55, 58, 60 and 62 °C, and 30 s at 72 °C, with a final elongation step of 10 min at 72 °C.

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System). .. Thermocycler conditions were 90° for 5 min, then 35 cycles of 95° for 30 sec, 55° for 30 sec, and 72° for 30 sec per kilobase of target fragment, then a final extension at 72° for 10 min, followed by a hold at 10°.

    IA:

    Article Title: Functional screening for anti-CMV biologics identifies a broadly neutralizing epitope of an essential envelope protein
    Article Snippet: Briefly, RNA was extracted from the 5C3 hybridoma using Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA), followed by first stand cDNA synthesis using random hexamers and poly-T primers (Integrated DNA Technologies, Caralville, IA) and SuperScript 3 reverse transcriptase (ThermoFisher Scientific, NY, NY). .. PCR with FastStart Taq DNA polymerase (Roche) was performed according to factory supplier using degenerate broad primers specific for 5′ UTR ends of heavy and kappa mouse V genes and specific IgG constant and kappa constant 3′ primers .

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: The blaB open reading frame was amplified with oligonucleotides C.BlaB-FOR (5′-GC T CTA GA A GGA GAA TAA GAA ATG TTG AAA AAA ATA AAA ATA AGC TTG), which added an Xba I linker (underlined) and a ribosomal-binding site located 8 bp upstream of the blaB start codon, and C.BlaB-REV (5′-GGC GGA TCC GGA AAA AGG CTT CAT TAA TTT G), which added a Bam HI linker (underlined) downstream from the blaB stop codon. .. PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer.

    Plasmid Preparation:

    Article Title: Stability of the CpG island methylator phenotype during glioma progression and identification of methylated loci in secondary glioblastomas
    Article Snippet: PCR reactions were performed using FastStart Taq DNA polymerase (Roche, West Sussex, UK) on a semi-nested basis for all genes using the primers listed in Additional file . .. A touchdown PCR program for primary and secondary reactions using gene specific annealing temperatures was performed.

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK). .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Article Title: Characterization of Glycosomal RING Finger Proteins of Trypanosomatids
    Article Snippet: Paragraph title: 2.2. Plasmid contruction ... For creation of GFP fusion constructs, PEX10 and PEX12 were each amplified from genomic DNA from T. brucei TREU667, T. cruzi CL Brener and L. major Friedlin by polymerase chain reaction (PCR) using Taq DNA polymerase (Roche Diagnostics Expand High Fidelity PCR system).

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: The blaB open reading frame was amplified with oligonucleotides C.BlaB-FOR (5′-GC T CTA GA A GGA GAA TAA GAA ATG TTG AAA AAA ATA AAA ATA AGC TTG), which added an Xba I linker (underlined) and a ribosomal-binding site located 8 bp upstream of the blaB start codon, and C.BlaB-REV (5′-GGC GGA TCC GGA AAA AGG CTT CAT TAA TTT G), which added a Bam HI linker (underlined) downstream from the blaB stop codon. .. PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer. .. Cycling conditions were as follows: 94°C, 1 min; 47°C (with an increment of 0.6°C/cycle, until 53°C), 1 min; 72°C, 1 min; repeated for 35 cycles, and followed by a final extension step of 10 min at 72°C.

    Software:

    Article Title: Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5’ splice site
    Article Snippet: Splicing analysis was carried out by PCR amplification with FastStart Taq Polymerase (Roche) using specific primers to exclude detection of endogenous PAH gene expression: SD6 (5’-TCTGAGTCACCTGGACAACC-3’) and SA2 (5’-ATCTCAGTGGTATTTGTGAGC-3’) for pSPL3 minigene, and PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) and PAH 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’) for pcDNA3.1 minigene. .. The end-point PCR amplification products were analyzed by 2% agarose gel electrophoresis and/or by capillary gel electrophoresis using the Fragment AnalyzerTM (Advanced Analytical), and their identity was confirmed by Sanger sequencing.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: The PyroMark Assay Design 2.0 software (Qiagen, Hilden, Germany) was used for primer design ( ). .. PCR was performed in 25 µl reactions consisting of 2.5 µl 10x PCR buffer with MgCl2 , 0.5 µl dNTPs, 1.25 µl (10 pmol/ml) of each forward and reverse primer, 0.2 µl FastStart Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany), and 1 µl (∼25 ng) bisulfite converted DNA.

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany). .. The PCR conditions were 94 °C for 1 min followed by 30 cycles of 60 °C (GAPDH and iNOS) or 69 °C (eNOS) for 30 s, and extension at 72 °C for 1 min.

    SYBR Green Assay:

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: SCF cDNA was amplified from total cDNA obtained after reverse transcription by online fluorescent PCR (LightCycler™-SYBR Green I, ROCHE Diagnostics), with primers that lead to a single 149 bp PCR product. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. Amplified SCF cDNA was analysed on-line by fluorescence, and quantified during the exponential state.

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: Next, 2 μg of total RNA from each sample was reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA) in a 20 μL reaction according to the manufacturer’s protocol. .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. Primer sequences were as follows: rat GAPDH (NCBI RefSeq NM_017008.4), F: 5′-TACAGCAACAGGGTGGTGGAC-3′, R: 5′-GGGATGGAATTGTGAGGGAGA-3′; rat GLUT4 (NCBI RefSeq NM_012751.1), F: 5′-CTTCCTTCTATTTGCCGTCCTC-3′, R: 5′-GCTGCTGTTTCCTTCATCCTG-3′; rat IRAP (NCBI Refseq NM_001113403.2), F: 5′-GTGGGGACTAAGGGCGAAAA-3′ R:5′-CATACATCCGGACCTCCACG-3′.

    RNA Extraction:

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA).

    Article Title: Expression of Human ?-Defensins in Conjunctival Epithelium: Relevance to Dry Eye Disease
    Article Snippet: A modified phenol-chloroform extraction procedure was used for total RNA extraction from the impression cytology specimens. .. Duplex PCR (Fast- Taq kit; Roche Diagnostics Inc., Indianapolis, IN) was performed for GAPDH+hBD-1 and for GAPDH+hBD-2.

    Positron Emission Tomography:

    Article Title: Overproduction and Biochemical Characterization of the Chryseobacterium meningosepticum BlaB Metallo-?-Lactamase
    Article Snippet: PCR was performed with 5 ng of template DNA (plasmid pSK16CR), 100 pmol of each primer, and 3.5 U of DNA polymerase (Expand High Fidelity PCR System; Roche Molecular Biochemicals, Mannheim, Germany) in a final volume of 100 μl in the buffer system provided by the manufacturer. .. The resulting amplimer was digested with Xba I and Bam HI and cloned in pBC-SK, digested with the same enzymes, to obtain recombinant plasmid pJDD-1.

    Agarose Gel Electrophoresis:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. .. PCR reactions consisted of a heat activation step for 5 min at 95 °C, 35 cycles of 15 s at 95 °C, 15 s at 55, 58, 60 and 62 °C, and 30 s at 72 °C, with a final elongation step of 10 min at 72 °C.

    Article Title: Systemic Lupus Erythematosus Patients Exhibit Reduced Expression of CLEC16A Isoforms in Peripheral Leukocytes
    Article Snippet: Integrity of RNA was checked by agarose gel electrophoresis. .. Conventional polymerase chain reaction (PCR) amplification of the full length transcripts of the long isoform of CLEC16A (V1, 24 exons, NM_015226), short isoform (V2, 21 exons, NM_001243403.1) and GAPDH were performed with FastStart Taq DNA Polymerase (Roche, Penzberg, Germany).

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: The integrity of the isolated RNA was confirmed by agarose gel electrophoresis. .. The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany).

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System). .. Thermocycler conditions were 90° for 5 min, then 35 cycles of 95° for 30 sec, 55° for 30 sec, and 72° for 30 sec per kilobase of target fragment, then a final extension at 72° for 10 min, followed by a hold at 10°.

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA).

    In Vitro:

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Following separation at day 10 in vitro, astrocytes were maintained in T75 cell culture flasks (Corning Incorporated, New York, USA) at 37 °C in a humidified 5% CO2 : 95% air atmosphere. .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Electrophoresis:

    Article Title: Ethanolic Extract of Folium Sennae Mediates the Glucose Uptake of L6 Cells by GLUT4 and Ca2+
    Article Snippet: The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA). .. The PCR conditions were set as follows: initial activation of Taq polymerase at 95 °C for 10 min, 35 cycles of PCR amplification at 95 °C for 15 s, and annealing/elongation at 60 °C for 1 min. cDNA products were diluted with RNAse-free water, and then real-time PCR was performed using the FastStart Universal SYBR Green PCR Master ROX (Roche) system on the 7500 Fast Real-Time PCR System instrument (Applied Biosystems, Foster City, CA, USA).

    Spectrophotometry:

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: The RNA concentration was determined by spectrophotometry. .. The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany).

    Article Title: Comparing 16S rDNA amplicon sequencing and hybridization capture for pea aphid microbiota diversity analysis
    Article Snippet: DNA extractions were then quantified using a Nanodrop spectrophotometer and DNA from 20 individuals (collected in a single field of pea Pisum sativum ) were normalized and combined to create a DNA pool (App1), that was used in the present study. .. PCR was performed in a 25 µl reaction volume, using 0.6 units of Taq DNA polymerase (Expand High Fidelity PCR System, Roche, ref: 11732650001) and 1 µl of DNA template, in the following conditions: 1.5 mM MgCl2 , 0.125 mM of each dNTP, 0.4 µM reverse and forward primers.

    Concentration Assay:

    Article Title: A modified compression model of spinal cord injury in rats: functional assessment and the expression of nitric oxide synthases
    Article Snippet: The RNA concentration was determined by spectrophotometry. .. The target genes were amplified by PCR using a Taq DNA Polymerase Kit (FastStart Taq DNA Polymerase; Roche Diagnostics GmbH, Mannheim, Germany).

    DNA Purification:

    Article Title: Variations in IL-23 and IL-25 receptor gene structure, sequence and expression associated with the two disease forms of sheep paratuberculosis
    Article Snippet: Genomic DNA (gDNA) was purified using the Wizard® Genomic DNA Purification Kit (Promega, UK). .. All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer.

    Staining:

    Article Title: Variants of the EAAT2 Glutamate Transporter Gene Promoter Are Associated with Cerebral Palsy in Preterm Infants
    Article Snippet: Glial fibrillary acidic protein immuno-labelling and trypan blue staining [ , ] were used to confirm the purity and viability of the astrocyte cultures. .. Genomic DNA of genotype 1 and genotype 3 was amplified in 25 μl reactions containing 2 μl genomic DNA, 1X High Fidelity PCR buffer (100 mM Tris-HCl, 500 mM KCl pH 8.3), 1.5 mM MgCl2 , 200 μM of each dNTP, 100 pmol of each oligonucleotide and 1 unit of high-fidelity Taq polymerase (FastStart High Fidelity Taq Polymerase, Roche Diagnostics Limited, West Sussex, UK).

    Article Title: Inhibition by glucocorticoids of the interleukin-1?-enhanced expression of the mast cell growth factor SCF
    Article Snippet: PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles. .. PCR reactions were performed in 1× PCR reaction buffer (2 μl of the reaction mix containing FastStart Taq DNA polymerase, dNTP mix, SYBR Green I, 3 m M MgCl2 ) (all from ROCHE Diagnostics), and 10 pmol of each primer: sense primer: 5′-TGGATAAGCGAGATGGTAGT-3′, antisense primer: 5′-TTTTCTTTCACGCACTCCAC-3′, in a 20 μl final volume for 35 cycles.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: The reaction mixture contained 34 µl water, 10 µl 5× reaction buffer, 2.5 µl 2.5-mM stock solutions of each dNTP, 1 µl of each primer (100 µM), 1 µl DNA (30–500 ng/µl, depending on reaction), and 0.5 µl Taq (Roche Expand High Fidelity Plus PCR System). .. Thermocycler conditions were 90° for 5 min, then 35 cycles of 95° for 30 sec, 55° for 30 sec, and 72° for 30 sec per kilobase of target fragment, then a final extension at 72° for 10 min, followed by a hold at 10°.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche faststart taq dna polymerase
    Reduction of PCR Inhibition by Increased Amounts of <t>Taq</t> Polymerase. qPCR with HMW and template <t>DNA</t> from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.
    Faststart Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 288 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase/product/Roche
    Average 99 stars, based on 288 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Real-time Polymerase Chain Reaction, Formalin-fixed Paraffin-Embedded, Amplification

    Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Amplification, Inhibition, Formalin-fixed Paraffin-Embedded

    Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Real-time Polymerase Chain Reaction, Molecular Weight

    Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Formalin-fixed Paraffin-Embedded

    PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Real-time Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis

    PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Concentration Assay, Real-time Polymerase Chain Reaction

    PTPN11 mutations identified in MC participants. (A) Schematic of the exonic structure of PTPN11 (above) and the corresponding protein structure of SHP2 (below). The locations of mutations that were identified in MC are indicated with black lines. Predicted protein changes are indicated for the nonsense (blue) and frameshift (red) mutations, while the cDNA designation is indicated for the splice-site mutations (green). (B) Log2 values of the number of Illumina reads obtained per 50 bp window in participant S, divided by the average number of reads obtained in other participants whose DNA was captured simultaneously using the second capture array. Shown are all 50 bp windows spanning regions of PTPN11 targeted by the array, with the corresponding exonic structure of PTPN11 shown below. The red bar indicates a region spanning exon 7, in which the average log2 value is approximately −1, suggesting a heterozygous deletion. PCR amplification and sequencing of the breakpoint, using primers on either end of the deletion, indicate that 14,629 bp of sequence have been deleted and replaced with a single CA dinucleotide.

    Journal: PLoS Genetics

    Article Title: Loss-of-Function Mutations in PTPN11 Cause Metachondromatosis, but Not Ollier Disease or Maffucci Syndrome

    doi: 10.1371/journal.pgen.1002050

    Figure Lengend Snippet: PTPN11 mutations identified in MC participants. (A) Schematic of the exonic structure of PTPN11 (above) and the corresponding protein structure of SHP2 (below). The locations of mutations that were identified in MC are indicated with black lines. Predicted protein changes are indicated for the nonsense (blue) and frameshift (red) mutations, while the cDNA designation is indicated for the splice-site mutations (green). (B) Log2 values of the number of Illumina reads obtained per 50 bp window in participant S, divided by the average number of reads obtained in other participants whose DNA was captured simultaneously using the second capture array. Shown are all 50 bp windows spanning regions of PTPN11 targeted by the array, with the corresponding exonic structure of PTPN11 shown below. The red bar indicates a region spanning exon 7, in which the average log2 value is approximately −1, suggesting a heterozygous deletion. PCR amplification and sequencing of the breakpoint, using primers on either end of the deletion, indicate that 14,629 bp of sequence have been deleted and replaced with a single CA dinucleotide.

    Article Snippet: Libraries used for hybridization to the first capture array were amplified according to two strategies: 3 µl amplified for 18 cycles in four 50 µl PCR reactions (Phusion High-Fidelity DNA polymerase, Finnzymes), or 2 µl amplified for 11 cycles in one 50 µl PCR reaction that was then purified and amplified for 17 cycles in ten 50 µl PCR reactions (FastStart Taq DNA polymerase, Roche).

    Techniques: Polymerase Chain Reaction, Amplification, Sequencing

    Loss of the wild-type PTPN11 allele in the cartilage of two exostoses. (A) Electropherograms of PCR amplified template DNA that had been extracted from whole blood, a section of an exostosis, or the cartilage core of the same exostosis. Exostoses were available from patients A-IV-5 and A-IV-8. The site of the 5 bp deletion in exon 4 of PTPN11 in both patients is indicated with a box. Note that that the heights of the peaks corresponding to the mutant sequence are markedly reduced in amplimers from the cartilage-core compared to amplimers from blood or from a section that contains cartilage, bone and fibrous tissue. This is consistent with loss-of-heterozygosity in the cartilage component of the exostoses. (B) Electropherograms of PCR amplified template DNA extracted from blood from participants A-III-9, A-III-10 and A-IV-5, as well as DNA extracted from the cartilage core of the exostosis from participant A-IV-5 shown in (A). Blood DNA electropherograms indicate that participants A-III-9 and A-IV-10 are heterozygous at a position (asterisk) in intron 11 of PTPN11 . This is the site of a known common polymorphism (rs41279092). Exostosis cartilage DNA electropherograms have a reduced adenine peak height at this position. This suggests that the wild-type PTPN11 allele inherited from the unaffected parent (A-III-9), which carries an adenine at this position, has been lost in cells that contribute to formation of the exostosis' cartilage core.

    Journal: PLoS Genetics

    Article Title: Loss-of-Function Mutations in PTPN11 Cause Metachondromatosis, but Not Ollier Disease or Maffucci Syndrome

    doi: 10.1371/journal.pgen.1002050

    Figure Lengend Snippet: Loss of the wild-type PTPN11 allele in the cartilage of two exostoses. (A) Electropherograms of PCR amplified template DNA that had been extracted from whole blood, a section of an exostosis, or the cartilage core of the same exostosis. Exostoses were available from patients A-IV-5 and A-IV-8. The site of the 5 bp deletion in exon 4 of PTPN11 in both patients is indicated with a box. Note that that the heights of the peaks corresponding to the mutant sequence are markedly reduced in amplimers from the cartilage-core compared to amplimers from blood or from a section that contains cartilage, bone and fibrous tissue. This is consistent with loss-of-heterozygosity in the cartilage component of the exostoses. (B) Electropherograms of PCR amplified template DNA extracted from blood from participants A-III-9, A-III-10 and A-IV-5, as well as DNA extracted from the cartilage core of the exostosis from participant A-IV-5 shown in (A). Blood DNA electropherograms indicate that participants A-III-9 and A-IV-10 are heterozygous at a position (asterisk) in intron 11 of PTPN11 . This is the site of a known common polymorphism (rs41279092). Exostosis cartilage DNA electropherograms have a reduced adenine peak height at this position. This suggests that the wild-type PTPN11 allele inherited from the unaffected parent (A-III-9), which carries an adenine at this position, has been lost in cells that contribute to formation of the exostosis' cartilage core.

    Article Snippet: Libraries used for hybridization to the first capture array were amplified according to two strategies: 3 µl amplified for 18 cycles in four 50 µl PCR reactions (Phusion High-Fidelity DNA polymerase, Finnzymes), or 2 µl amplified for 11 cycles in one 50 µl PCR reaction that was then purified and amplified for 17 cycles in ten 50 µl PCR reactions (FastStart Taq DNA polymerase, Roche).

    Techniques: Polymerase Chain Reaction, Amplification, Mutagenesis, Sequencing

    Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.

    Journal: PLoS ONE

    Article Title: An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications

    doi: 10.1371/journal.pone.0013042

    Figure Lengend Snippet: Efficiency of hl-dsDNase treatment. 1.3 pg of λ DNA was incubated with various quantities of hl-dsDNase in 90% Taq DNA polymerase storage buffer for 30 minutes at 25°C and qPCR quantification of a 73 bp fragment was performed. The average of the percentage of remaining DNA is plotted as a function of the quantities of hl-dsDNase.

    Article Snippet: The tests were carried out in the storage buffer of the FastStart® Taq DNA polymerase (Roche Applied Science, Mannheim, Germany), supplemented with 10 mM MgCl2 , 1 mM CaCl2 and 1 mM DTT that are required by the dsDNases to be active or to be efficiently inactivated.

    Techniques: Incubation, Real-time Polymerase Chain Reaction

    Methylation analysis of the CpG island in the DACH1 promoter. (A) : Schematic depiction of the CpG islands located respectively 5’ upstream from the DACH1 transcription start site (CpG I) and in the first intron of the DACH1 gene (CpG II). (B) : Examples of CpG I COBRA analysis in colorectal cancers with intense (red), patchy (green), or no (blue) DACH1 protein immunostaining and in 4 colon cancer cell lines characterized by low (HT29 and Caco2) or very low (HCT116 and CO115) DACH1 expression (based on microarray-documented DACH1 mRNA expression levels - see also Additional file 9 ). Asterisks indicate Taq α I -digested DNA fragments representing methylated alleles; slower-migrating fragments correspond to undigested, unmethylated DNA. MW, molecular weight; bp, base pair.

    Journal: BMC Cancer

    Article Title: A comprehensive look at transcription factor gene expression changes in colorectal adenomas

    doi: 10.1186/1471-2407-14-46

    Figure Lengend Snippet: Methylation analysis of the CpG island in the DACH1 promoter. (A) : Schematic depiction of the CpG islands located respectively 5’ upstream from the DACH1 transcription start site (CpG I) and in the first intron of the DACH1 gene (CpG II). (B) : Examples of CpG I COBRA analysis in colorectal cancers with intense (red), patchy (green), or no (blue) DACH1 protein immunostaining and in 4 colon cancer cell lines characterized by low (HT29 and Caco2) or very low (HCT116 and CO115) DACH1 expression (based on microarray-documented DACH1 mRNA expression levels - see also Additional file 9 ). Asterisks indicate Taq α I -digested DNA fragments representing methylated alleles; slower-migrating fragments correspond to undigested, unmethylated DNA. MW, molecular weight; bp, base pair.

    Article Snippet: Amplifications were carried out with FastStart Taq DNA Polymerase (Roche, Basel, Switzerland) with the following primers: CpG I: 5’-GTAGTAGTAGAAGAGAAGTAGATGA-3’ (sense) and 5’- ACCCAAATTATCCAACCAAAAACTC-3’ (antisense); CpG II: 5’-GGGTGAGGGTTTIGTTGGGA-3’ (sense) and 5’-CCCTCCCCTCIACTAACTTC-3’ (antisense).

    Techniques: Methylation, Combined Bisulfite Restriction Analysis Assay, Immunostaining, Expressing, Microarray, Molecular Weight