Structured Review

Thermo Fisher fastap
Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a <t>DNA</t> oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and <t>FastAP.</t> ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.
Fastap, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fastap/product/Thermo Fisher
Average 99 stars, based on 97 article reviews
Price from $9.99 to $1999.99
fastap - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7"

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky644

Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.
Figure Legend Snippet: Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

Techniques Used: Generated, Polyacrylamide Gel Electrophoresis, Migration, Electrophoretic Mobility Shift Assay, Isolation, Fluorescence, Marker, Ligation

2) Product Images from "Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7"

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky644

Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.
Figure Legend Snippet: Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

Techniques Used: Generated, Polyacrylamide Gel Electrophoresis, Migration, Electrophoretic Mobility Shift Assay, Isolation, Fluorescence, Marker, Ligation

Related Articles

Clone Assay:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. Amplicons that appeared specific for the Sll7003-treated sample were gel-excised and cloned into pGEM-T (Promega).

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: The sgRNA guide sequences (T1-T4) were cloned into the expression vector as follows ( ). .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells.

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The 3′RACE products generated by the PCR were cloned into pCR-4 TOPO TA vector using the TOPO TA Cloning Kit (Life Technologies) and transfected into E. coli DH5α. .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: All other antigens were cloned in the pGEX-KG vector. .. Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific).

Article Title: LINE-1 derepression in senescent cells triggers interferon and inflammaging
Article Snippet: Both contain luciferase as the reporter cloned in the sense orientation. .. Plasmids L1WT and L1del were digested with XbaI, blunted and treated with FastAP (Fermentas).

Amplification:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. After transformation into E. coli Top10F′, plasmid inserts were amplified by colony PCR and sequenced.

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: Oligonucleotides or PCR primers for vector construction and PCR amplification were from Integrated DNA Technologies ( ). .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells.

Article Title: First microsatellite markers for the pine catkin sawfly Xyela concava (Hymenoptera, Xyelidae) and their application in phylogeography and population genetics
Article Snippet: The PCR protocol consisted of an initial DNA polymerase (HotStar Taq) activation step at 95 °C for 5 min, followed by 38–40 cycles of 30 s at 95 °C, 90 s at 49–59 °C depending on the primer set used, and 50–120 s (depending on the amplicon size) at 72 °C; the last cycle was followed by a final 30 min extension step at 68 °C. .. Primers and dNTPs were inactivated with FastAP and Exonuclease I (Thermo Fisher Scientific).

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: COI (primers symF4 [or symF1] + A2590), NaK (NaK_263F + 1918R) and TPI (TPI_29Fi + TPI706R) were in most cases amplified in one fragment, POL2 in one to three fragments, and TRRAP in two fragments (TRRAP_833F + 3046R and TRRAP_2648Fi + 4213Ri). .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific).

Article Title: Translating Niphargus barcodes from Switzerland into taxonomy with a description of two new species ( Amphipoda, Niphargidae)
Article Snippet: For one of the focal species in this study, a subset of samples was selected for which about 2100 bp long fragments of the complete ITS region, including the flanking proportions of the 18S and 28S genes, were amplified using primers and procedures described by . .. PCR products were purified using Exonuclease I and FastAP (Thermo Fisher Scientific Inc., United States) according to the manufacturer’s instructions.

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The cDNA synthesis was performed at 50°C for 1 h followed by incubation with 2.5 U of RNase H for 20 min at 37°C. cDNA (1 µL) was amplified by PCR with oligos C1031 and C959 using Taq polymerase (Fermentas) in the presence of 3 mM MgCl2 . .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: A portion of the 16S rDNA gene was amplified for all the pure bacterial colonies through PCR reactions using the primers: 27F (5′ AGA GTT TGA TCC TGG CTC AG 3′) ( ) and 1492R (5′ GGT TAC CTT GTT ACG ACT T3′) ( ). .. Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used.

Article Title: Bayesian Tests of Topology Hypotheses with an Example from Diving Beetles
Article Snippet: Most CO1 sequences were amplified with Bioline Taq instead of beads but with the same primer and DNA concentration. .. Most PCR products were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver.

Polyacrylamide Gel Electrophoresis:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: Samples were heated for 5 min at 95 °C prior to 6–10% 7 m urea PAGE separation. .. 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation.

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C. .. Sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and phosphate affinity SDS-PAGE ( ) were conducted according to standard methods.

DNA Ligation:

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells. .. To verify that transformed plasmids had the correct inserted sequences, each colony was sequenced from the U6 promoter using primer hU6-F ( ).

Molecular Cloning:

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: Paragraph title: Molecular cloning ... Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific).

TA Cloning:

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The 3′RACE products generated by the PCR were cloned into pCR-4 TOPO TA vector using the TOPO TA Cloning Kit (Life Technologies) and transfected into E. coli DH5α. .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Blocking Assay:

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: .. Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used. .. Thereafter, the cleaned amplicons were included in a sequencing PCR with a cycle of 96 °C for 5 s, 25 cycles of denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s and extension at 60 °C for 4 min 15 s. Each sequencing reaction contained: 2 μL Big Dye solution, 1 μL 5× Sequencing Buffer, 1 μL of the respective primer and 6 μL DNA.

Incubation:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: In vitro transcripts were treated with DNase (2 units of Turbo DNase, Invitrogen), purified with phenol/chloroform, and incubated with elution buffer and purified protein Sll7003 for 30 min at 37 °C. .. 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation.

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: .. To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. In the next step, the RNA was isolated via phenol-chloroform extraction and EtOH precipitation with 0.3 M NaOAc.

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: .. DNase treatment and purification of RNA fragments To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. In the next step, the RNA was isolated via phenol-chloroform extraction and EtOH precipitation with 0.3 M NaOAc.

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: .. FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C. .. Sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and phosphate affinity SDS-PAGE ( ) were conducted according to standard methods.

Article Title: First microsatellite markers for the pine catkin sawfly Xyela concava (Hymenoptera, Xyelidae) and their application in phylogeography and population genetics
Article Snippet: Primers and dNTPs were inactivated with FastAP and Exonuclease I (Thermo Fisher Scientific). .. 1.7–2.2 U of both enzymes were added to 17–22 µl of PCR solution and incubated for 15 min at 37 °C, followed by 15 min at 85 °C.

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific). .. 1.0–2.2 U of both enzymes were added to 12–32 μl of PCR solution and incubated for 15 min at 37 °C, followed by 15 min at 85 °C.

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The cDNA synthesis was performed at 50°C for 1 h followed by incubation with 2.5 U of RNase H for 20 min at 37°C. cDNA (1 µL) was amplified by PCR with oligos C1031 and C959 using Taq polymerase (Fermentas) in the presence of 3 mM MgCl2 . .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Luciferase:

Article Title: LINE-1 derepression in senescent cells triggers interferon and inflammaging
Article Snippet: Both contain luciferase as the reporter cloned in the sense orientation. .. Plasmids L1WT and L1del were digested with XbaI, blunted and treated with FastAP (Fermentas).

Expressing:

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: The sgRNA guide sequences (T1-T4) were cloned into the expression vector as follows ( ). .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells.

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: Cultures expressing the different VGLUT1 mutants were collected on DIV 17 with 1 × PBS. .. FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C.

Western Blot:

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C. .. Western blotting was performed according to standard procedures using HRP-coupled secondary antibodies for qualitative detection.

Transformation Assay:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. After transformation into E. coli Top10F′, plasmid inserts were amplified by colony PCR and sequenced.

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells. .. To verify that transformed plasmids had the correct inserted sequences, each colony was sequenced from the U6 promoter using primer hU6-F ( ).

Derivative Assay:

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: Gene sequences were derived from GenBank and primers containing unique restriction enzymes sites were designed using Primer3Plus (Table S1 in Supplementary Material) . .. Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific).

Transfection:

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The 3′RACE products generated by the PCR were cloned into pCR-4 TOPO TA vector using the TOPO TA Cloning Kit (Life Technologies) and transfected into E. coli DH5α. .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Ligation:

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: .. Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific). ..

Protease Inhibitor:

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: Both buffers were supplemented with protease inhibitor cocktail (539134, Millipore) and Halt phosphatase Inhibitor Cocktail (78420, Thermo Fisher Scientific). .. FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C.

Generated:

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The 3′RACE products generated by the PCR were cloned into pCR-4 TOPO TA vector using the TOPO TA Cloning Kit (Life Technologies) and transfected into E. coli DH5α. .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Polymerase Chain Reaction:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. A 5′-monophosphorylated synthetic RNA oligonucleotide, with a 3′-dideoxynucleotide-blocked end, was ligated to elution buffer- and Sll7003-treated RNA as described under “5′-RACE.” Reverse transcription and PCR were executed as described above.

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: Oligonucleotides or PCR primers for vector construction and PCR amplification were from Integrated DNA Technologies ( ). .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells.

Article Title: First microsatellite markers for the pine catkin sawfly Xyela concava (Hymenoptera, Xyelidae) and their application in phylogeography and population genetics
Article Snippet: Paragraph title: COI and NaK polymerase chain reaction analysis ... Primers and dNTPs were inactivated with FastAP and Exonuclease I (Thermo Fisher Scientific).

Article Title: Species delimitation of the Hyphydrusovatus complex in western Palaearctic with an update of species distributions ( Coleoptera, Dytiscidae)
Article Snippet: .. PCR reactions were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver. .. 1.1 Cycle Sequencing Kit (Applied Biosystems), cleaned with a DyeEx 96 kit (QIAGEN) and run on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems).

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific). .. 1.0–2.2 U of both enzymes were added to 12–32 μl of PCR solution and incubated for 15 min at 37 °C, followed by 15 min at 85 °C.

Article Title: Translating Niphargus barcodes from Switzerland into taxonomy with a description of two new species ( Amphipoda, Niphargidae)
Article Snippet: .. PCR products were purified using Exonuclease I and FastAP (Thermo Fisher Scientific Inc., United States) according to the manufacturer’s instructions. .. Each fragment was sequenced in both directions using PCR amplifications primers by Macrogen Europe (Amsterdam, Netherlands).

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer. .. The sequencing reactions were analyzed on an ABI 3130XL Genetic Analyzer, and data handling was performed using Sequencing Analysis 5.2 software (Applied Biosystems).

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: PCR products and plasmids were digested with the relevant pair of FastDigest restriction enzymes (Table S1 in Supplementary Material). .. Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific).

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: .. Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used. .. Thereafter, the cleaned amplicons were included in a sequencing PCR with a cycle of 96 °C for 5 s, 25 cycles of denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s and extension at 60 °C for 4 min 15 s. Each sequencing reaction contained: 2 μL Big Dye solution, 1 μL 5× Sequencing Buffer, 1 μL of the respective primer and 6 μL DNA.

Article Title: LINE-1 derepression in senescent cells triggers interferon and inflammaging
Article Snippet: Plasmids L1WT and L1del were digested with XbaI, blunted and treated with FastAP (Fermentas). .. Successful insertion of anti-sense EYFP was verified using PCR primers AAAGTTTCTTATGGCCGGGC (in EYFP) and GCTGAACTTGTGGCCGTTTA (in L1 promoter) and Sanger sequencing.

Article Title: Bayesian Tests of Topology Hypotheses with an Example from Diving Beetles
Article Snippet: .. Most PCR products were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver. .. 3.1 Cycle Sequencing Kit (Applied Biosystems), cleaned with a DyeEx 96 kit (Qiagen) and run on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems).

Binding Assay:

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: Numbers in the new POL2 and TRRAP primer names refer to the binding position of the 3’ end of each primer in the coding region of Athalia rosae mRNA (accessions XM_012395805 and XM_012406083). .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific).

De-Phosphorylation Assay:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: .. 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. A 5′-monophosphorylated synthetic RNA oligonucleotide, with a 3′-dideoxynucleotide-blocked end, was ligated to elution buffer- and Sll7003-treated RNA as described under “5′-RACE.” Reverse transcription and PCR were executed as described above.

DNA Extraction:

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: Paragraph title: Bacterial DNA extraction and sequencing ... Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used.

Article Title: Bayesian Tests of Topology Hypotheses with an Example from Diving Beetles
Article Snippet: Paragraph title: DNA Extraction, PCR, and Sequencing ... Most PCR products were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver.

Nucleic Acid Electrophoresis:

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: .. Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used. .. Thereafter, the cleaned amplicons were included in a sequencing PCR with a cycle of 96 °C for 5 s, 25 cycles of denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s and extension at 60 °C for 4 min 15 s. Each sequencing reaction contained: 2 μL Big Dye solution, 1 μL 5× Sequencing Buffer, 1 μL of the respective primer and 6 μL DNA.

Isolation:

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. In the next step, the RNA was isolated via phenol-chloroform extraction and EtOH precipitation with 0.3 M NaOAc.

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: DNase treatment and purification of RNA fragments To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. In the next step, the RNA was isolated via phenol-chloroform extraction and EtOH precipitation with 0.3 M NaOAc.

Article Title: Translating Niphargus barcodes from Switzerland into taxonomy with a description of two new species ( Amphipoda, Niphargidae)
Article Snippet: Molecular and phylogenetic analysis Genomic DNA was isolated from one of the pereiopods or the whole animal (depending on specimen size) using the GenElute Mammalian Genomic DNA (Sigma-Aldrich, United States). .. PCR products were purified using Exonuclease I and FastAP (Thermo Fisher Scientific Inc., United States) according to the manufacturer’s instructions.

Labeling:

Article Title: The NHL domain of BRAT is an RNA-binding domain that directly contacts the hunchback mRNA for regulation
Article Snippet: Paragraph title: 32 P labeling of RNA ... In vitro transcribed RNA (30 pmol) was dephosphorylated by 0.1 U/µL FASTAP (Fermentas) in 1× PNK A buffer (Fermentas) for 30 min at 37°C before FASTAP was heat-inactivated for 20 min at 75°C.

Mouse Assay:

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: Brains of wild type adult mice were dissected for the collection of brain regions. .. FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C.

Sequencing:

Article Title: First microsatellite markers for the pine catkin sawfly Xyela concava (Hymenoptera, Xyelidae) and their application in phylogeography and population genetics
Article Snippet: Primers and dNTPs were inactivated with FastAP and Exonuclease I (Thermo Fisher Scientific). .. Purified PCR products were sent to Macrogen Europe (Amsterdam, the Netherlands) for sequencing.

Article Title: Species delimitation of the Hyphydrusovatus complex in western Palaearctic with an update of species distributions ( Coleoptera, Dytiscidae)
Article Snippet: PatDyt and Jerry were used as sequencing primers. .. PCR reactions were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver.

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific). .. 2–5 μl of purified PCR product per primer in a total volume of 10 μl (5–8 μl of sequencing primer at concentration 5 pmol/μl) were sent to Macrogen Europe (Netherlands) for sequencing.

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer. .. The sequencing reactions were analyzed on an ABI 3130XL Genetic Analyzer, and data handling was performed using Sequencing Analysis 5.2 software (Applied Biosystems).

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific). .. Sanger sequencing was used to characterize cloned sequences.

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: Paragraph title: Bacterial DNA extraction and sequencing ... Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used.

Article Title: LINE-1 derepression in senescent cells triggers interferon and inflammaging
Article Snippet: The EYFP sequence was excised from pEYFP-N1 (Clontech, Cat. # 6006–1) with AgeI and NotI and blunt ended. .. Plasmids L1WT and L1del were digested with XbaI, blunted and treated with FastAP (Fermentas).

Article Title: Bayesian Tests of Topology Hypotheses with an Example from Diving Beetles
Article Snippet: Paragraph title: DNA Extraction, PCR, and Sequencing ... Most PCR products were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver.

Cotransfection:

Article Title: LINE-1 derepression in senescent cells triggers interferon and inflammaging
Article Snippet: Plasmids L1WT and L1del were digested with XbaI, blunted and treated with FastAP (Fermentas). .. Plasmid pcDNA3.1/LacZ was used as the co-transfection control.

CRISPR:

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: CRISPR Design Tool ( http://tools.genome-engineering.org ) was used to predict the suitable MTH1-targeting sgRNA guide sequences. .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells.

Concentration Assay:

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. The concentration of the received fragment in RNase-free water was then checked by UV absorbance.

Article Title: The NHL domain of BRAT is an RNA-binding domain that directly contacts the hunchback mRNA for regulation
Article Snippet: In vitro transcribed RNA (30 pmol) was dephosphorylated by 0.1 U/µL FASTAP (Fermentas) in 1× PNK A buffer (Fermentas) for 30 min at 37°C before FASTAP was heat-inactivated for 20 min at 75°C. .. Subsequently, 30 µCi γ32 P-ATP (Hartmann Analytic) and T4 PNK (final concentration 0.5 U/µL; Fermentas) were added, and the 5′ phosphorylation reaction was carried out in 1× PNK A buffer for 30 min at 37°C.

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: DNase treatment and purification of RNA fragments To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. The concentration of the received fragment in RNase-free water was then checked by UV absorbance.

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific). .. 2–5 μl of purified PCR product per primer in a total volume of 10 μl (5–8 μl of sequencing primer at concentration 5 pmol/μl) were sent to Macrogen Europe (Netherlands) for sequencing.

Article Title: Bayesian Tests of Topology Hypotheses with an Example from Diving Beetles
Article Snippet: Most CO1 sequences were amplified with Bioline Taq instead of beads but with the same primer and DNA concentration. .. Most PCR products were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver.

Activated Clotting Time Assay:

Article Title: Differential patterns of nitrogen nutrition and growth cost of the indigenous Vachellia sieberiana and the introduced Chromolaena odorata in the savannah environment
Article Snippet: A portion of the 16S rDNA gene was amplified for all the pure bacterial colonies through PCR reactions using the primers: 27F (5′ AGA GTT TGA TCC TGG CTC AG 3′) ( ) and 1492R (5′ GGT TAC CTT GTT ACG ACT T3′) ( ). .. Enzymatic clean-up of the PCR products was performed using Exonuclease I (0.5 μL), placing the reaction on the heating block at 37 °C for 15 min, thereafter 2 μL FastAP (ThermoFischer Scientific, South Africa) was added and the heating block set higher to 85 °C for another 15 min. To view the results of the clean-up gel electrophoresis was once again used.

Purification:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: In vitro transcripts were treated with DNase (2 units of Turbo DNase, Invitrogen), purified with phenol/chloroform, and incubated with elution buffer and purified protein Sll7003 for 30 min at 37 °C. .. 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation.

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: .. To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. In the next step, the RNA was isolated via phenol-chloroform extraction and EtOH precipitation with 0.3 M NaOAc.

Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7
Article Snippet: .. DNase treatment and purification of RNA fragments To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C. .. In the next step, the RNA was isolated via phenol-chloroform extraction and EtOH precipitation with 0.3 M NaOAc.

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells. .. To verify that transformed plasmids had the correct inserted sequences, each colony was sequenced from the U6 promoter using primer hU6-F ( ).

Article Title: First microsatellite markers for the pine catkin sawfly Xyela concava (Hymenoptera, Xyelidae) and their application in phylogeography and population genetics
Article Snippet: Primers and dNTPs were inactivated with FastAP and Exonuclease I (Thermo Fisher Scientific). .. Purified PCR products were sent to Macrogen Europe (Amsterdam, the Netherlands) for sequencing.

Article Title: Species delimitation of the Hyphydrusovatus complex in western Palaearctic with an update of species distributions ( Coleoptera, Dytiscidae)
Article Snippet: .. PCR reactions were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver. .. 1.1 Cycle Sequencing Kit (Applied Biosystems), cleaned with a DyeEx 96 kit (QIAGEN) and run on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems).

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific). .. 1.0–2.2 U of both enzymes were added to 12–32 μl of PCR solution and incubated for 15 min at 37 °C, followed by 15 min at 85 °C.

Article Title: Translating Niphargus barcodes from Switzerland into taxonomy with a description of two new species ( Amphipoda, Niphargidae)
Article Snippet: .. PCR products were purified using Exonuclease I and FastAP (Thermo Fisher Scientific Inc., United States) according to the manufacturer’s instructions. .. Each fragment was sequenced in both directions using PCR amplifications primers by Macrogen Europe (Amsterdam, Netherlands).

Article Title: Bayesian Tests of Topology Hypotheses with an Example from Diving Beetles
Article Snippet: .. Most PCR products were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver. .. 3.1 Cycle Sequencing Kit (Applied Biosystems), cleaned with a DyeEx 96 kit (Qiagen) and run on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems).

SDS Page:

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C. .. Sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and phosphate affinity SDS-PAGE ( ) were conducted according to standard methods.

Plasmid Preparation:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. After transformation into E. coli Top10F′, plasmid inserts were amplified by colony PCR and sequenced.

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells. .. To verify that transformed plasmids had the correct inserted sequences, each colony was sequenced from the U6 promoter using primer hU6-F ( ).

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: The 3′RACE products generated by the PCR were cloned into pCR-4 TOPO TA vector using the TOPO TA Cloning Kit (Life Technologies) and transfected into E. coli DH5α. .. Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer.

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: All other antigens were cloned in the pGEX-KG vector. .. Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific).

Article Title: LINE-1 derepression in senescent cells triggers interferon and inflammaging
Article Snippet: To determine antisense transcription from the same plasmid EYFP was inserted in the inverse orientation upstream of the L1 5’ UTR as follows. .. Plasmids L1WT and L1del were digested with XbaI, blunted and treated with FastAP (Fermentas).

Software:

Article Title: Lariat capping as a tool to manipulate the 5′ end of individual yeast mRNA species in vivo
Article Snippet: Colony PCR using Taq polymerase (Fermentas) with oligos C1031 and C959 was performed on single colonies, and 1 µL of the PCR products were subsequently treated with 5 U of Exonuclease I and 0.25 U of FastAP (Thermo Scientific) prior to sequencing with C1031 using the BigDye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer. .. The sequencing reactions were analyzed on an ABI 3130XL Genetic Analyzer, and data handling was performed using Sequencing Analysis 5.2 software (Applied Biosystems).

Multiplex Assay:

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: PCR reactions were carried out in a total volume of 15–35 μl containing 1.0–2.5 μl of extracted DNA, 1.5–3.5 μl (5.0–15 pmol) of primers and 7.5–17.5 μl of 2× Multiplex PCR Plus Master mix (QIAGEN). .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific).

Positron Emission Tomography:

Article Title: Known Allergen Structures Predict Schistosoma mansoni IgE-Binding Antigens in Human Infection
Article Snippet: The SmVAL-6 CAP domain (amino acids 1–145 of full-length SmVAL-6, GenBank AY953433) was cloned into the pET-30a vector. .. Additionally, plasmids were treated with FastAP (Thermo Fisher Scientific) to prevent self-ligation and ligation was performed using T4 DNA ligase (Thermo Fisher Scientific).

Agarose Gel Electrophoresis:

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific). .. 1.0–2.2 U of both enzymes were added to 12–32 μl of PCR solution and incubated for 15 min at 37 °C, followed by 15 min at 85 °C.

In Vitro:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: In vitro transcripts were treated with DNase (2 units of Turbo DNase, Invitrogen), purified with phenol/chloroform, and incubated with elution buffer and purified protein Sll7003 for 30 min at 37 °C. .. 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation.

Article Title: The NHL domain of BRAT is an RNA-binding domain that directly contacts the hunchback mRNA for regulation
Article Snippet: .. In vitro transcribed RNA (30 pmol) was dephosphorylated by 0.1 U/µL FASTAP (Fermentas) in 1× PNK A buffer (Fermentas) for 30 min at 37°C before FASTAP was heat-inactivated for 20 min at 75°C. .. Subsequently, 30 µCi γ32 P-ATP (Hartmann Analytic) and T4 PNK (final concentration 0.5 U/µL; Fermentas) were added, and the 5′ phosphorylation reaction was carried out in 1× PNK A buffer for 30 min at 37°C.

Homogenization:

Article Title: A proline-rich motif on VGLUT1 reduces synaptic vesicle super-pool and spontaneous release frequency
Article Snippet: The samples were treated with homogenization buffer (0.32 M sucrose, 4 mM HEPES pH 7.4). .. FastAP Thermosensitive Alkaline Phosphatase (one unit/µl) and FastAP 10 × buffer (EF0654, Thermo Scientific) were added to samples and incubated for 1 hr at 37°C.

Ethanol Precipitation:

Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
Article Snippet: .. 5′ ends were blocked by dephosphorylation with FastAP (Fermentas) followed by phenol/chloroform extraction and ethanol precipitation. .. A 5′-monophosphorylated synthetic RNA oligonucleotide, with a 3′-dideoxynucleotide-blocked end, was ligated to elution buffer- and Sll7003-treated RNA as described under “5′-RACE.” Reverse transcription and PCR were executed as described above.

Knock-Out:

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: Paragraph title: Lentiviral vector construction for MTH1 knockout ... The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells.

Activation Assay:

Article Title: First microsatellite markers for the pine catkin sawfly Xyela concava (Hymenoptera, Xyelidae) and their application in phylogeography and population genetics
Article Snippet: The PCR protocol consisted of an initial DNA polymerase (HotStar Taq) activation step at 95 °C for 5 min, followed by 38–40 cycles of 30 s at 95 °C, 90 s at 49–59 °C depending on the primer set used, and 50–120 s (depending on the amplicon size) at 72 °C; the last cycle was followed by a final 30 min extension step at 68 °C. .. Primers and dNTPs were inactivated with FastAP and Exonuclease I (Thermo Fisher Scientific).

Article Title: The West Palaearctic genera of Nematinae ( Hymenoptera, Tenthredinidae)
Article Snippet: The PCR protocol consisted of an initial DNA polymerase (HotStar Taq) activation step at 95 °C for 5 min, followed by 38–40 cycles of 30 s at 95 °C, 90–120 s at 49–60 °C (depending on the primer set used), and 70–180 s (depending on the amplicon size) at 72 °C; the last cycle was followed by a final 30 min extension step at 68 °C. .. Three μl of PCR product was visualised on a 1.4% agarose gel and the remaining product was then purified with FastAP and Exonuclease I (Thermo Scientific).

Gel Extraction:

Article Title: Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Article Snippet: .. The Lenti-eSpCas9 plasmid was cut and dephosporylated with FastDigest BsmBI and FastAP (Fermentas) at 37 °C for 2 h. After purification with the QIAEX Gel Extraction kit (Qiagen), 50 ng of vector was ligated to 50 ng of pre-annealed sgRNA oligonucleotide using a DNA ligation kit (Takara Bio) at 16 °C for 30 min. Then, the mixture was transformed into the E. coli competent strain Stbl3 (Invitrogen) according to the protocol supplied with the cells. .. To verify that transformed plasmids had the correct inserted sequences, each colony was sequenced from the U6 promoter using primer hU6-F ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    Filter up to 5 liters of fluid with Thermo Scientific Nalgene Large Volume FastCap Bottle Top Filter with 0 2μm PES Membrane Simply place on a bottle mouth apply vacuum
      Buy from Supplier

    75
    Thermo Fisher dbsnp sap refseq crap fasta files
    Comparison of average XCorr scores for peptides matching the <t>RefSeq</t> protein, <t>dbSNP-SAP,</t> or custom (RNA-Seq) SAP database. SAP peptides identified from the custom database tended to have higher XCorr scores than those identified from the dbSNP database.
    Dbsnp Sap Refseq Crap Fasta Files, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dbsnp sap refseq crap fasta files/product/Thermo Fisher
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dbsnp sap refseq crap fasta files - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    99
    Thermo Fisher fastap
    Exonuclease III steady state kinetics with increasing concentration of substrate by phosphate release assay. 1.5 nM ExoIII was incubated with 1μM <t>MDCC-PBP,</t> 0.0004u/μl <t>FastAP</t> and varying concentrations (5, 10, 20, 40, 60, 100 and 200 nM) of dsDNA substrate in 66mM Tris-HCl (pH 8.0) and 0.66mM MgCl 2 at 37°C. (A) Fluorescence increase was measured over time from the ExoIII reaction coupled to FastAP dephosphorylation of products and subsequent P i binding to MDCC-PBP. Background measured in parallel of a reaction without enzyme was subtracted from each data set. Fluorescence increase was converted to [P i ] by interpolation from standard curve ( S5 Fig ). Data points are shown as bars of standard error of the mean of three independent experiments. Arrow (↑) refers to the increasing concentration of substrate in the different data sets. (B) Michaelis-Menten saturation curve by plotting initial velocity (v 0 ) obtained from (A) against 3’-end concentration. Constants derived from plot were V max = 0.5947 ± 0.0380 nM s -1 and K M = 140.9 ± 20.3 nM.
    Fastap, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastap/product/Thermo Fisher
    Average 99 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    fastap - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of average XCorr scores for peptides matching the RefSeq protein, dbSNP-SAP, or custom (RNA-Seq) SAP database. SAP peptides identified from the custom database tended to have higher XCorr scores than those identified from the dbSNP database.

    Journal: Journal of proteome research

    Article Title: Large-scale mass spectrometric detection of variant peptides resulting from non-synonymous nucleotide differences

    doi: 10.1021/pr4009207

    Figure Lengend Snippet: Comparison of average XCorr scores for peptides matching the RefSeq protein, dbSNP-SAP, or custom (RNA-Seq) SAP database. SAP peptides identified from the custom database tended to have higher XCorr scores than those identified from the dbSNP database.

    Article Snippet: Raw mass spectrometry files were searched against the customized SAP+RefSeq+cRAP and the dbSNP-SAP+RefSeq+cRAP FASTA files using the SEQUEST/Percolator search algorithm within ProteomeDiscoverer (v1.3.0.339, Thermo Fisher Scientific, San Jose, CA).

    Techniques: RNA Sequencing Assay

    Exonuclease III steady state kinetics with increasing concentration of substrate by phosphate release assay. 1.5 nM ExoIII was incubated with 1μM MDCC-PBP, 0.0004u/μl FastAP and varying concentrations (5, 10, 20, 40, 60, 100 and 200 nM) of dsDNA substrate in 66mM Tris-HCl (pH 8.0) and 0.66mM MgCl 2 at 37°C. (A) Fluorescence increase was measured over time from the ExoIII reaction coupled to FastAP dephosphorylation of products and subsequent P i binding to MDCC-PBP. Background measured in parallel of a reaction without enzyme was subtracted from each data set. Fluorescence increase was converted to [P i ] by interpolation from standard curve ( S5 Fig ). Data points are shown as bars of standard error of the mean of three independent experiments. Arrow (↑) refers to the increasing concentration of substrate in the different data sets. (B) Michaelis-Menten saturation curve by plotting initial velocity (v 0 ) obtained from (A) against 3’-end concentration. Constants derived from plot were V max = 0.5947 ± 0.0380 nM s -1 and K M = 140.9 ± 20.3 nM.

    Journal: PLoS ONE

    Article Title: Quantitative Microplate Assay for Real-Time Nuclease Kinetics

    doi: 10.1371/journal.pone.0154099

    Figure Lengend Snippet: Exonuclease III steady state kinetics with increasing concentration of substrate by phosphate release assay. 1.5 nM ExoIII was incubated with 1μM MDCC-PBP, 0.0004u/μl FastAP and varying concentrations (5, 10, 20, 40, 60, 100 and 200 nM) of dsDNA substrate in 66mM Tris-HCl (pH 8.0) and 0.66mM MgCl 2 at 37°C. (A) Fluorescence increase was measured over time from the ExoIII reaction coupled to FastAP dephosphorylation of products and subsequent P i binding to MDCC-PBP. Background measured in parallel of a reaction without enzyme was subtracted from each data set. Fluorescence increase was converted to [P i ] by interpolation from standard curve ( S5 Fig ). Data points are shown as bars of standard error of the mean of three independent experiments. Arrow (↑) refers to the increasing concentration of substrate in the different data sets. (B) Michaelis-Menten saturation curve by plotting initial velocity (v 0 ) obtained from (A) against 3’-end concentration. Constants derived from plot were V max = 0.5947 ± 0.0380 nM s -1 and K M = 140.9 ± 20.3 nM.

    Article Snippet: MDCC-PBP (commercial name Phosphate Sensor), T4 polynucleotide kinase, FastAP and Exonuclease III (ThermoFisher).

    Techniques: Concentration Assay, Phosphate Release Assay, Incubation, Fluorescence, De-Phosphorylation Assay, Binding Assay, Derivative Assay

    Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

    Journal: Nucleic Acids Research

    Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7

    doi: 10.1093/nar/gky644

    Figure Lengend Snippet: Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

    Article Snippet: DNase treatment and purification of RNA fragments To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C.

    Techniques: Generated, Polyacrylamide Gel Electrophoresis, Migration, Electrophoretic Mobility Shift Assay, Isolation, Fluorescence, Marker, Ligation

    Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

    Journal: Nucleic Acids Research

    Article Title: Double methylation of tRNA-U54 to 2′-O-methylthymidine (Tm) synergistically decreases immune response by Toll-like receptor 7

    doi: 10.1093/nar/gky644

    Figure Lengend Snippet: Colicin D-based molecular surgery and preparation of Lys3-modivariants. ( A ) Treatment of native tRNA Lys 3 (gray line, modifications indicated as gray dots) with Colicin D generated two fragments with 38 nt length (see PAGE analysis). Differences in migration distance were caused by 2′-3′-cyclic phosphates at the 3′ end of the 5′ fragment. ( B ) Due to similar fragment lengths, a DNA oligonucleotide (darker gray) was hybridized to the 3′ fragment. The corresponding band shift of the double-stranded RNA/DNA hybrid enabled separation and isolation of both tRNA fragments. RNAs were then treated with DNaseI and FastAP. ( C ) Prephosphorylated 5′ and 3′ fragments were subsequently annealed together with unmodified RNAs (black lines) on splint DNA (indicated by the darker gray line, fluorescence marker displayed as a star) which contains a 3′ fluorescein residue. Ligation and DNase treatment yielded mv#1 and mv#2 as shown in the respective PAGE analysis. Evaluation of the fluorescence channel revealed successful digestion of DNA splint in modivariant preparations.

    Article Snippet: To obtain the purified, dephosphorylated native fragment, the DNA/RNA hybrid solution was incubated with 0.1 U/μl FastAP (Thermo Scientific) and 1.25 U/μl DNaseI (Thermo Scientific) for 1 h at 37°C.

    Techniques: Generated, Polyacrylamide Gel Electrophoresis, Migration, Electrophoretic Mobility Shift Assay, Isolation, Fluorescence, Marker, Ligation