fast sybr green master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher fast sybr green master mix
    Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2470 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 2470 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Cell Isolation:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Lin- BM cells (~1 × 106 ) were purified by an EasySep™ Mouse Hematopoietic Progenitor Cell Isolation Kit (StemCell, Cat # 19856) according to manufacturer’s instruction. .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Amplification:

    Article Title: Productive and physiological responses of feeder cattle supplemented with Yucca schidigera extract during feedlot receiving
    Article Snippet: Real-time reverse transcription-PCR was completed using the Fast SYBR Green Master Mix (Applied Biosystems) and gene-specific primers (20 pM each; ) with the StepOne Real-time PCR system (Applied Biosystems). .. At the end of each reverse transcription-PCR, amplified products were subjected to a dissociation gradient (95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s) to verify the amplification of a single product by denaturation at the anticipated temperature.

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: .. Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). ..

    Synthesized:

    Article Title: Prevention of ESKAPE pathogen biofilm formation by antimicrobial peptides WLBU2 and LL37
    Article Snippet: The cDNA was synthesized by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). .. Fast SYBR Green Master Mix (Applied Biosystems) and 7900HT Fast Real-Time PCR System (Applied Biosystems) were used for quantification.

    Article Title: Urea Cycle Dysregulation Generates Clinically Relevant Genomic and Biochemical Signatures
    Article Snippet: RNA was extracted from cells by using RNeasy Mini Kit (QIAGENe #74104. cDNA was synthesized from 1 μg RNA by using qScript cDNA Synthesis Kit (Quanta #95749). .. Detection on cDNAs was performed using either SYBR green PCR master mix (Thermo Fisher scientific #4385612) or TaqMan Fast Advanced Master Mix (Thermofisher scientific #4444557), with the required primers.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: Total RNAs from the brain tissue containing the right prefrontal cortex (PFC) were isolated and cDNAs were synthesized with the high-capacity cDNA reverse transcription kit (Life Technologies). .. Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles.

    Quantitative RT-PCR:

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: Paragraph title: 2.7. Real-Time RT-PCR ... Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific).

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Paragraph title: Isolation of Lin-negative BM cells, LSK cells and qRT-PCR assays ... Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Article Title: miR-200a Attenuated Doxorubicin-Induced Cardiotoxicity through Upregulation of Nrf2 in Mice
    Article Snippet: Paragraph title: 2.4. RNA Extraction and Real-Time RT-PCR ... Gene expression analysis was carried out using the Fast SYBR Green master mix (Applied Biosystems) and the QuantStudio 12k Flex real-time PCR system (ThermoFisher, Ecublens, Switzerland).

    Real-time Polymerase Chain Reaction:

    Article Title: Aldosterone induces albuminuria via matrix metalloproteinase-dependent damage of the endothelial glycocalyx
    Article Snippet: .. Once primer specificity and optimal concentrations had been established, a standard protocol was used for all quantitative polymerase chain reaction using the Fast Sybr Green master mix (ref 438612; Applied Biosystems) (sequences are listed in ). ..

    Article Title: Prevention of ESKAPE pathogen biofilm formation by antimicrobial peptides WLBU2 and LL37
    Article Snippet: .. Fast SYBR Green Master Mix (Applied Biosystems) and 7900HT Fast Real-Time PCR System (Applied Biosystems) were used for quantification. ..

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: .. Quantitative evaluation of RNA abundance was performed using Fast SYBR Green Master Mix (Applied Biosystems) in a StepOne PLus Real Time PCR system instrument (Applied Biosystems). .. The following primers were used: A1cf: Fwd: 5′-GCC AGA ATC CTCG CAA TCCA-3′; Rev 5′-AGC ATA CCT CTT CGC TTC ATC C-3′, Rbm47 Fwd: 5′-GCT TCG CCT TTG TGG AGT ATG-3′; Rev: 5′-ATC CGA CCTGGC ATG AG-3′, ApoB Fwd: 5′-CAC TGC CGT GGC CAA AA-3′, Rev: GCT AGA GAG TTG GTC TGA AAA ATC CT-3′.

    Article Title: Productive and physiological responses of feeder cattle supplemented with Yucca schidigera extract during feedlot receiving
    Article Snippet: .. Real-time reverse transcription-PCR was completed using the Fast SYBR Green Master Mix (Applied Biosystems) and gene-specific primers (20 pM each; ) with the StepOne Real-time PCR system (Applied Biosystems). .. Following incubation at 95 °C for 10 min, 40 cycles of denaturation (95 °C for 15 s) and annealing/synthesis (60 °C for 2 min) were completed.

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: .. Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). ..

    Article Title: Urea Cycle Dysregulation Generates Clinically Relevant Genomic and Biochemical Signatures
    Article Snippet: Paragraph title: RNA processing and quantitative PCR ... Detection on cDNAs was performed using either SYBR green PCR master mix (Thermo Fisher scientific #4385612) or TaqMan Fast Advanced Master Mix (Thermofisher scientific #4444557), with the required primers.

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: .. Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems). .. The gene‐specific primer sets were used at a final concentration of 1 μM in a 10 μl final volume.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument. .. Expression of Actin-b was used as an internal control (Forward, 5’-GACGGCCAGGTCATCACTATTG-3’ and Reverse 5’-AGGAAGGCTGGAAAAGAGCC-3’) for calculating fold changes of indicated genes.

    Article Title: miR-200a Attenuated Doxorubicin-Induced Cardiotoxicity through Upregulation of Nrf2 in Mice
    Article Snippet: .. Gene expression analysis was carried out using the Fast SYBR Green master mix (Applied Biosystems) and the QuantStudio 12k Flex real-time PCR system (ThermoFisher, Ecublens, Switzerland). ..

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: .. Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles. .. PCR primers were as follows: 18s (forward, GTAACCCGTTGAACCCCATT; reverse, CCATCCAA TCGGTAGTAGCG), NR1 (forward, TACAAGCGAC ACAAGGATGC; reverse, TCAGTGGGATGGTACTG CTG), NR2A (forward, CTGCTCCAGTTTGTTGGTG A; reverse, AGATGCCCGTAAGCCACA), NR2B (forward, GGGTTACAACCGGTGCCTA; reverse, CTT TGCCGATGGTGAAAGAT), GluR1 (forward, CGGA AATTGCTTATGGGACA; reverse, ACACAGCGATT TTAGACCTCCT), TNF-α (forward, GGAACACGTCG TGGGATAATG; reverse, GGCAGACTTTGGATGC TTCTT), IL-1β (forward, TCGGCCAAGACAGGTCG CTCA; reverse, TGGTTGCCCATCAGAGGCAAGG), IL-6 (forward, TAGTCCTTCCTACCCCAATTTCC; reverse: TTGGTCCTTAGCCACTCCTTC) and IL-10 subunit (forward, CCCATTCCTCGTCACGATCTC; reverse, TCAGACTGGTTTGGGATAGGTTT).

    Article Title: Chondrocytes Promote Vascularization in Fracture Healing Through a FOXO1-Dependent Mechanism
    Article Snippet: .. RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems). .. Analysis was performed using the delta delta threshold cycle (ΔΔCT) method, and statistical tests were run on Prism (GraphPad Software, Inc., La Jolla, CA, USA).

    Incubation:

    Article Title: Prevention of ESKAPE pathogen biofilm formation by antimicrobial peptides WLBU2 and LL37
    Article Snippet: For each treatment group, P. aeruginosa PAOl (accession number: ) was incubated in a mixture of 50% DMEM and 50% PBS with 1/3 MICs of AMPs, consistent with the bacterial attachment/biofilm assays. .. Fast SYBR Green Master Mix (Applied Biosystems) and 7900HT Fast Real-Time PCR System (Applied Biosystems) were used for quantification.

    Article Title: Productive and physiological responses of feeder cattle supplemented with Yucca schidigera extract during feedlot receiving
    Article Snippet: Real-time reverse transcription-PCR was completed using the Fast SYBR Green Master Mix (Applied Biosystems) and gene-specific primers (20 pM each; ) with the StepOne Real-time PCR system (Applied Biosystems). .. Following incubation at 95 °C for 10 min, 40 cycles of denaturation (95 °C for 15 s) and annealing/synthesis (60 °C for 2 min) were completed.

    Expressing:

    Article Title: Prevention of ESKAPE pathogen biofilm formation by antimicrobial peptides WLBU2 and LL37
    Article Snippet: Paragraph title: 2.5. Gene expression ... Fast SYBR Green Master Mix (Applied Biosystems) and 7900HT Fast Real-Time PCR System (Applied Biosystems) were used for quantification.

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). .. For each target gene, relative expression was determined after normalization using the ΔΔCt method.

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems). .. RPLP0 mRNA levels were used as an endogenous control to normalize relative expression values of each target gene.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument. .. Expression of Actin-b was used as an internal control (Forward, 5’-GACGGCCAGGTCATCACTATTG-3’ and Reverse 5’-AGGAAGGCTGGAAAAGAGCC-3’) for calculating fold changes of indicated genes.

    Article Title: miR-200a Attenuated Doxorubicin-Induced Cardiotoxicity through Upregulation of Nrf2 in Mice
    Article Snippet: .. Gene expression analysis was carried out using the Fast SYBR Green master mix (Applied Biosystems) and the QuantStudio 12k Flex real-time PCR system (ThermoFisher, Ecublens, Switzerland). ..

    Western Blot:

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: .. The following chemical reagents were used from the indicated vendors: Protein assay dye (500–0005), PVDF membrane (BioRad), protease inhibitor cocktail (Sigma), Pageruler plus protein ladder (Thermos), Luminata Forte Western HRP substrate (Millipore), agarose powder (Life Technologies), RNAsin RNAse inhibitor (Promega), Fast SYBR Green Master Mix (Applied Biosystems). .. All HRP conjugated secondary antibodies were obtained from Pierce.

    FLAG-tag:

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: The following antibodies were purchased from the indicated vendors: E2F1 KH95 (sc-251) (Santa Cruz); FLAG tag (#2368) (Cell Signaling). .. The following chemical reagents were used from the indicated vendors: Protein assay dye (500–0005), PVDF membrane (BioRad), protease inhibitor cocktail (Sigma), Pageruler plus protein ladder (Thermos), Luminata Forte Western HRP substrate (Millipore), agarose powder (Life Technologies), RNAsin RNAse inhibitor (Promega), Fast SYBR Green Master Mix (Applied Biosystems).

    Protease Inhibitor:

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: .. The following chemical reagents were used from the indicated vendors: Protein assay dye (500–0005), PVDF membrane (BioRad), protease inhibitor cocktail (Sigma), Pageruler plus protein ladder (Thermos), Luminata Forte Western HRP substrate (Millipore), agarose powder (Life Technologies), RNAsin RNAse inhibitor (Promega), Fast SYBR Green Master Mix (Applied Biosystems). .. All HRP conjugated secondary antibodies were obtained from Pierce.

    Cell Culture:

    Article Title: Aldosterone induces albuminuria via matrix metalloproteinase-dependent damage of the endothelial glycocalyx
    Article Snippet: Once primer specificity and optimal concentrations had been established, a standard protocol was used for all quantitative polymerase chain reaction using the Fast Sybr Green master mix (ref 438612; Applied Biosystems) (sequences are listed in ). .. A human syndecan-4 enzyme-linked immunosorbent assay (SEB939Hu; USCN Life Science, Inc., Houston, Texas, USA) was used to quantify the syndecan-4 loss in cell culture.

    Polymerase Chain Reaction:

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). .. The designs of PCR primers are shown in .

    Article Title: Urea Cycle Dysregulation Generates Clinically Relevant Genomic and Biochemical Signatures
    Article Snippet: .. Detection on cDNAs was performed using either SYBR green PCR master mix (Thermo Fisher scientific #4385612) or TaqMan Fast Advanced Master Mix (Thermofisher scientific #4444557), with the required primers. ..

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: .. Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles. .. PCR primers were as follows: 18s (forward, GTAACCCGTTGAACCCCATT; reverse, CCATCCAA TCGGTAGTAGCG), NR1 (forward, TACAAGCGAC ACAAGGATGC; reverse, TCAGTGGGATGGTACTG CTG), NR2A (forward, CTGCTCCAGTTTGTTGGTG A; reverse, AGATGCCCGTAAGCCACA), NR2B (forward, GGGTTACAACCGGTGCCTA; reverse, CTT TGCCGATGGTGAAAGAT), GluR1 (forward, CGGA AATTGCTTATGGGACA; reverse, ACACAGCGATT TTAGACCTCCT), TNF-α (forward, GGAACACGTCG TGGGATAATG; reverse, GGCAGACTTTGGATGC TTCTT), IL-1β (forward, TCGGCCAAGACAGGTCG CTCA; reverse, TGGTTGCCCATCAGAGGCAAGG), IL-6 (forward, TAGTCCTTCCTACCCCAATTTCC; reverse: TTGGTCCTTAGCCACTCCTTC) and IL-10 subunit (forward, CCCATTCCTCGTCACGATCTC; reverse, TCAGACTGGTTTGGGATAGGTTT).

    Cellular Antioxidant Activity Assay:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: Quantitative evaluation of RNA abundance was performed using Fast SYBR Green Master Mix (Applied Biosystems) in a StepOne PLus Real Time PCR system instrument (Applied Biosystems). .. The following primers were used: A1cf: Fwd: 5′-GCC AGA ATC CTCG CAA TCCA-3′; Rev 5′-AGC ATA CCT CTT CGC TTC ATC C-3′, Rbm47 Fwd: 5′-GCT TCG CCT TTG TGG AGT ATG-3′; Rev: 5′-ATC CGA CCTGGC ATG AG-3′, ApoB Fwd: 5′-CAC TGC CGT GGC CAA AA-3′, Rev: GCT AGA GAG TTG GTC TGA AAA ATC CT-3′.

    Staining:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    In Vivo:

    Article Title: Chondrocytes Promote Vascularization in Fracture Healing Through a FOXO1-Dependent Mechanism
    Article Snippet: Paragraph title: In vivo sample preparation ... RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems).

    Fluorescence:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Isolation:

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis, and quantitative PCR ... Quantitative evaluation of RNA abundance was performed using Fast SYBR Green Master Mix (Applied Biosystems) in a StepOne PLus Real Time PCR system instrument (Applied Biosystems).

    Article Title: Productive and physiological responses of feeder cattle supplemented with Yucca schidigera extract during feedlot receiving
    Article Snippet: Quantity and quality of isolated RNA were assessed via UV absorbance (NanoDrop Lite; Thermo Fisher Scientific, Wilmington, DE) at 260 nm and 260/280 nm ratio, respectively ( ). .. Real-time reverse transcription-PCR was completed using the Fast SYBR Green Master Mix (Applied Biosystems) and gene-specific primers (20 pM each; ) with the StepOne Real-time PCR system (Applied Biosystems).

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: Real-Time RT-PCR Total RNA (20 ng) isolated from KN-3 cells with NucleoSpin RNA kit as described above was utilized for each real-time RT-PCR. .. Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific).

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: Paragraph title: RNA isolation and RT–PCR from cell lines ... Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems).

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Paragraph title: Isolation of Lin-negative BM cells, LSK cells and qRT-PCR assays ... Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: Total RNAs from the brain tissue containing the right prefrontal cortex (PFC) were isolated and cDNAs were synthesized with the high-capacity cDNA reverse transcription kit (Life Technologies). .. Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles.

    Article Title: Chondrocytes Promote Vascularization in Fracture Healing Through a FOXO1-Dependent Mechanism
    Article Snippet: Transverse paraffin-embedded sections were prepared as described. To obtain RNA, 16 days postfracture six WT and six KO calluses were snap frozen in liquid nitrogen, ground into powder in the presence of liquid nitrogen using a sterilized mortar and pestle, and isolated with a kit from Ambion (distributed by Thermo Fisher Scientific, Waltham, MA, USA; Cat# AM1912) per the manufacturer’s instructions. .. RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems).

    Purification:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: Paragraph title: RNA isolation and RT–PCR from cell lines ... Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems).

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: Paragraph title: RT-PCR of RNA measurements ... Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles.

    Lysis:

    Article Title: Aldosterone induces albuminuria via matrix metalloproteinase-dependent damage of the endothelial glycocalyx
    Article Snippet: After lysis, RNA was extracted using the Qiagen RNeasy Kit (cat. no. 74104). .. Once primer specificity and optimal concentrations had been established, a standard protocol was used for all quantitative polymerase chain reaction using the Fast Sybr Green master mix (ref 438612; Applied Biosystems) (sequences are listed in ).

    Mouse Assay:

    Article Title: Aldosterone induces albuminuria via matrix metalloproteinase-dependent damage of the endothelial glycocalyx
    Article Snippet: To collect RNA from mice, sections of renal cortex were passed through sequential sieves to extract glomeruli before they were lysed in the supplied buffer. .. Once primer specificity and optimal concentrations had been established, a standard protocol was used for all quantitative polymerase chain reaction using the Fast Sybr Green master mix (ref 438612; Applied Biosystems) (sequences are listed in ).

    Software:

    Article Title: Chondrocytes Promote Vascularization in Fracture Healing Through a FOXO1-Dependent Mechanism
    Article Snippet: RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems). .. RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Aldosterone induces albuminuria via matrix metalloproteinase-dependent damage of the endothelial glycocalyx
    Article Snippet: .. Once primer specificity and optimal concentrations had been established, a standard protocol was used for all quantitative polymerase chain reaction using the Fast Sybr Green master mix (ref 438612; Applied Biosystems) (sequences are listed in ). ..

    Article Title: Prevention of ESKAPE pathogen biofilm formation by antimicrobial peptides WLBU2 and LL37
    Article Snippet: .. Fast SYBR Green Master Mix (Applied Biosystems) and 7900HT Fast Real-Time PCR System (Applied Biosystems) were used for quantification. ..

    Article Title: Apobec1 complementation factor (A1CF) and RBM47 interact in tissue-specific regulation of C to U RNA editing in mouse intestine and liver
    Article Snippet: .. Quantitative evaluation of RNA abundance was performed using Fast SYBR Green Master Mix (Applied Biosystems) in a StepOne PLus Real Time PCR system instrument (Applied Biosystems). .. The following primers were used: A1cf: Fwd: 5′-GCC AGA ATC CTCG CAA TCCA-3′; Rev 5′-AGC ATA CCT CTT CGC TTC ATC C-3′, Rbm47 Fwd: 5′-GCT TCG CCT TTG TGG AGT ATG-3′; Rev: 5′-ATC CGA CCTGGC ATG AG-3′, ApoB Fwd: 5′-CAC TGC CGT GGC CAA AA-3′, Rev: GCT AGA GAG TTG GTC TGA AAA ATC CT-3′.

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: .. The following chemical reagents were used from the indicated vendors: Protein assay dye (500–0005), PVDF membrane (BioRad), protease inhibitor cocktail (Sigma), Pageruler plus protein ladder (Thermos), Luminata Forte Western HRP substrate (Millipore), agarose powder (Life Technologies), RNAsin RNAse inhibitor (Promega), Fast SYBR Green Master Mix (Applied Biosystems). .. All HRP conjugated secondary antibodies were obtained from Pierce.

    Article Title: Productive and physiological responses of feeder cattle supplemented with Yucca schidigera extract during feedlot receiving
    Article Snippet: .. Real-time reverse transcription-PCR was completed using the Fast SYBR Green Master Mix (Applied Biosystems) and gene-specific primers (20 pM each; ) with the StepOne Real-time PCR system (Applied Biosystems). .. Following incubation at 95 °C for 10 min, 40 cycles of denaturation (95 °C for 15 s) and annealing/synthesis (60 °C for 2 min) were completed.

    Article Title: Caffeic Acid Phenethyl Ester (CAPE) Induces VEGF Expression and Production in Rat Odontoblastic Cells
    Article Snippet: .. Reverse transcription and real-time PCR were performed in two steps, as follows. cDNA synthesis was performed using PrimeScript RT Master Mix (TaKaRa), and specific gene transcriptions were amplified using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) and a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). ..

    Article Title: Urea Cycle Dysregulation Generates Clinically Relevant Genomic and Biochemical Signatures
    Article Snippet: .. Detection on cDNAs was performed using either SYBR green PCR master mix (Thermo Fisher scientific #4385612) or TaqMan Fast Advanced Master Mix (Thermofisher scientific #4444557), with the required primers. ..

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: .. Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems). .. The gene‐specific primer sets were used at a final concentration of 1 μM in a 10 μl final volume.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument. .. Expression of Actin-b was used as an internal control (Forward, 5’-GACGGCCAGGTCATCACTATTG-3’ and Reverse 5’-AGGAAGGCTGGAAAAGAGCC-3’) for calculating fold changes of indicated genes.

    Article Title: miR-200a Attenuated Doxorubicin-Induced Cardiotoxicity through Upregulation of Nrf2 in Mice
    Article Snippet: .. Gene expression analysis was carried out using the Fast SYBR Green master mix (Applied Biosystems) and the QuantStudio 12k Flex real-time PCR system (ThermoFisher, Ecublens, Switzerland). ..

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: .. Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles. .. PCR primers were as follows: 18s (forward, GTAACCCGTTGAACCCCATT; reverse, CCATCCAA TCGGTAGTAGCG), NR1 (forward, TACAAGCGAC ACAAGGATGC; reverse, TCAGTGGGATGGTACTG CTG), NR2A (forward, CTGCTCCAGTTTGTTGGTG A; reverse, AGATGCCCGTAAGCCACA), NR2B (forward, GGGTTACAACCGGTGCCTA; reverse, CTT TGCCGATGGTGAAAGAT), GluR1 (forward, CGGA AATTGCTTATGGGACA; reverse, ACACAGCGATT TTAGACCTCCT), TNF-α (forward, GGAACACGTCG TGGGATAATG; reverse, GGCAGACTTTGGATGC TTCTT), IL-1β (forward, TCGGCCAAGACAGGTCG CTCA; reverse, TGGTTGCCCATCAGAGGCAAGG), IL-6 (forward, TAGTCCTTCCTACCCCAATTTCC; reverse: TTGGTCCTTAGCCACTCCTTC) and IL-10 subunit (forward, CCCATTCCTCGTCACGATCTC; reverse, TCAGACTGGTTTGGGATAGGTTT).

    Article Title: Chondrocytes Promote Vascularization in Fracture Healing Through a FOXO1-Dependent Mechanism
    Article Snippet: .. RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems). .. Analysis was performed using the delta delta threshold cycle (ΔΔCT) method, and statistical tests were run on Prism (GraphPad Software, Inc., La Jolla, CA, USA).

    RNA Extraction:

    Article Title: miR-200a Attenuated Doxorubicin-Induced Cardiotoxicity through Upregulation of Nrf2 in Mice
    Article Snippet: Paragraph title: 2.4. RNA Extraction and Real-Time RT-PCR ... Gene expression analysis was carried out using the Fast SYBR Green master mix (Applied Biosystems) and the QuantStudio 12k Flex real-time PCR system (ThermoFisher, Ecublens, Switzerland).

    Sample Prep:

    Article Title: Chondrocytes Promote Vascularization in Fracture Healing Through a FOXO1-Dependent Mechanism
    Article Snippet: Paragraph title: In vivo sample preparation ... RNA was converted to cDNA using Applied Biosystems (ABI) High-Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA; cat# 4387406) and qPCR was performed using ABI Fast SYBR Green Master Mix (Applied Biosystems; cat# 4385612) on StepOne Plus real-time PCR system (Applied Biosystems).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Aldosterone induces albuminuria via matrix metalloproteinase-dependent damage of the endothelial glycocalyx
    Article Snippet: Once primer specificity and optimal concentrations had been established, a standard protocol was used for all quantitative polymerase chain reaction using the Fast Sybr Green master mix (ref 438612; Applied Biosystems) (sequences are listed in ). .. A human syndecan-4 enzyme-linked immunosorbent assay (SEB939Hu; USCN Life Science, Inc., Houston, Texas, USA) was used to quantify the syndecan-4 loss in cell culture.

    Spectrophotometry:

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: RNA quantity and quality were determined using NanoDrop™ One Spectrophotometer (Thermo Scientific). .. Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems).

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Concentration Assay:

    Article Title: UBTD1 is a mechano‐regulator controlling cancer aggressiveness
    Article Snippet: Real‐time quantitative PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems) on a StepOnePlus System (Applied Biosystems). .. The gene‐specific primer sets were used at a final concentration of 1 μM in a 10 μl final volume.

    CTG Assay:

    Article Title: Neuropsychological Deficits Chronically Developed after Focal Ischemic Stroke and Beneficial Effects of Pharmacological Hypothermia in the Mouse
    Article Snippet: Quantitative PCR (qPCR) was performed with Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies), following the instructions of the manufacturer, in a fast-real-time PCR system (Applied Biosystems 7500) for 40 cycles. .. PCR primers were as follows: 18s (forward, GTAACCCGTTGAACCCCATT; reverse, CCATCCAA TCGGTAGTAGCG), NR1 (forward, TACAAGCGAC ACAAGGATGC; reverse, TCAGTGGGATGGTACTG CTG), NR2A (forward, CTGCTCCAGTTTGTTGGTG A; reverse, AGATGCCCGTAAGCCACA), NR2B (forward, GGGTTACAACCGGTGCCTA; reverse, CTT TGCCGATGGTGAAAGAT), GluR1 (forward, CGGA AATTGCTTATGGGACA; reverse, ACACAGCGATT TTAGACCTCCT), TNF-α (forward, GGAACACGTCG TGGGATAATG; reverse, GGCAGACTTTGGATGC TTCTT), IL-1β (forward, TCGGCCAAGACAGGTCG CTCA; reverse, TGGTTGCCCATCAGAGGCAAGG), IL-6 (forward, TAGTCCTTCCTACCCCAATTTCC; reverse: TTGGTCCTTAGCCACTCCTTC) and IL-10 subunit (forward, CCCATTCCTCGTCACGATCTC; reverse, TCAGACTGGTTTGGGATAGGTTT).

    FACS:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher fast sybr green master mix
    HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with <t>SYBR</t> ™ Safe DNA Gel Stain in agarose gels. (C) <t>qRT-PCR</t> was performed to confirm the results in (B).
    Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2470 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 2470 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher fast universal pcr master mix
    Analysis of BMP4 and CST6 mRNA levels following treatment with demethylating agent and histone deacetylase inhibitor. (A) A CpG island (506 bp) spans the transcription start site of the human BMP4 gene. (B) Relative BMP4 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by <t>TaqMan</t> <t>qRT-PCR.</t> Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (C) TaqMan qRT-PCR analysis of BMP4 mRNA expression levels in 5-Aza-2′-deoxycytidine (5azadC)- and Trichostatin A (TSA)-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3). (D) A CpG island (370 bp) spans the transcription start site of the human CST6 gene. (E) Relative CST6 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (F) TaqMan qRT-PCR analysis of CST6 mRNA expression levels in 5azadC- and TSA-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3).
    Fast Universal Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast universal pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    fast universal pcr master mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with SYBR ™ Safe DNA Gel Stain in agarose gels. (C) qRT-PCR was performed to confirm the results in (B).

    Journal: Heart rhythm

    Article Title: HuR-mediated SCN5A mRNA stability reduces arrhythmic risk in heart failure

    doi: 10.1016/j.hrthm.2018.02.018

    Figure Lengend Snippet: HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with SYBR ™ Safe DNA Gel Stain in agarose gels. (C) qRT-PCR was performed to confirm the results in (B).

    Article Snippet: Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR) was carried out using gene-specific primers, Fast SYBR® Green Master Mix and 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Isolation, Synthesized, Polymerase Chain Reaction, Staining, Quantitative RT-PCR

    Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).

    Journal: PLoS ONE

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages

    doi: 10.1371/journal.pone.0174223

    Figure Lengend Snippet: Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).

    Article Snippet: Real-time qPCR assays were performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific) on 7500 Fast Real-Time PCR System (Applied Biosystems, USA).

    Techniques: SYBR Green Assay, Real-time Polymerase Chain Reaction, Generated, Amplification

    Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Article Snippet: Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Quantitation Assay, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Article Snippet: Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    Analysis of BMP4 and CST6 mRNA levels following treatment with demethylating agent and histone deacetylase inhibitor. (A) A CpG island (506 bp) spans the transcription start site of the human BMP4 gene. (B) Relative BMP4 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (C) TaqMan qRT-PCR analysis of BMP4 mRNA expression levels in 5-Aza-2′-deoxycytidine (5azadC)- and Trichostatin A (TSA)-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3). (D) A CpG island (370 bp) spans the transcription start site of the human CST6 gene. (E) Relative CST6 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (F) TaqMan qRT-PCR analysis of CST6 mRNA expression levels in 5azadC- and TSA-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3).

    Journal: Disease Models & Mechanisms

    Article Title: Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer

    doi: 10.1242/dmm.032250

    Figure Lengend Snippet: Analysis of BMP4 and CST6 mRNA levels following treatment with demethylating agent and histone deacetylase inhibitor. (A) A CpG island (506 bp) spans the transcription start site of the human BMP4 gene. (B) Relative BMP4 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (C) TaqMan qRT-PCR analysis of BMP4 mRNA expression levels in 5-Aza-2′-deoxycytidine (5azadC)- and Trichostatin A (TSA)-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3). (D) A CpG island (370 bp) spans the transcription start site of the human CST6 gene. (E) Relative CST6 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (F) TaqMan qRT-PCR analysis of CST6 mRNA expression levels in 5azadC- and TSA-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3).

    Article Snippet: Two-step qPCR was completed (50-250 ng cDNA template/reaction) using either TaqMan gene expression assays (CTSC, ENG, TIE1, BMP2, BMP4, RPL37A) with Fast Universal PCR Master Mix, no AmpErase™ UNG (Thermo Fisher Scientific) or Fast SYBR™ Green Master Mix (50-250 ng cDNA template/reaction) and the following oligonucleotide primers (Integrated DNA Technologies, Singapore).

    Techniques: Histone Deacetylase Assay, Quantitative RT-PCR, Expressing