fast sybr green master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SYBR Green
    Description:

    Catalog Number:
    SG6300
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher fast sybr green master mix
    Detection and quantitation of ChPV using the sensitive <t>fast-qPCR</t> based on <t>SYBR</t> ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 1725 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)"

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    Journal: Veterinary Sciences

    doi: 10.3390/vetsci5030069

    Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.
    Figure Legend Snippet: Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Techniques Used: Quantitation Assay, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.
    Figure Legend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    2) Product Images from "TRPV4 channel activation selectively inhibits tumor endothelial cell proliferation"

    Article Title: TRPV4 channel activation selectively inhibits tumor endothelial cell proliferation

    Journal: Scientific Reports

    doi: 10.1038/srep14257

    TEC express increased levels of proliferation-associated genes. Relative gene expression of cell-cycle associated genes in NEC and TEC. EC were treated with GSK (100 nM) for 24 h and subsequently lysed for RNA isolation. cDNA was prepared and qPCR analysis was performed using Fast SYBR green master mix (Applied Biosystems). Gene expression was first normalized to GAPDH and presented as relative expression to NEC. All the data shown is mean ± SEM from at least three independent experiments.
    Figure Legend Snippet: TEC express increased levels of proliferation-associated genes. Relative gene expression of cell-cycle associated genes in NEC and TEC. EC were treated with GSK (100 nM) for 24 h and subsequently lysed for RNA isolation. cDNA was prepared and qPCR analysis was performed using Fast SYBR green master mix (Applied Biosystems). Gene expression was first normalized to GAPDH and presented as relative expression to NEC. All the data shown is mean ± SEM from at least three independent experiments.

    Techniques Used: Expressing, Isolation, Real-time Polymerase Chain Reaction, SYBR Green Assay

    3) Product Images from "Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation"

    Article Title: Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation

    Journal: Oxidative Medicine and Cellular Longevity

    doi: 10.1155/2018/3704129

    qPCR studies for kidney biopsies taken prior to transplant. For a separate series of kidney transplants, biopsies were collected for qPCR. (a) PCR primers used for qPCR. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1 or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. (b–e) qPCR results for (b) ALDH2, (c) ALDH7A1, (d) ALDH4A1, and (e) ALDH1A1. ALDH2, ALDH7A1, and ALDH4A1 by qPCR were significantly elevated in kidneys that did not develop delayed graft function versus those kidneys that developed delayed graft function ( n = 10/group, ∗ P
    Figure Legend Snippet: qPCR studies for kidney biopsies taken prior to transplant. For a separate series of kidney transplants, biopsies were collected for qPCR. (a) PCR primers used for qPCR. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1 or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. (b–e) qPCR results for (b) ALDH2, (c) ALDH7A1, (d) ALDH4A1, and (e) ALDH1A1. ALDH2, ALDH7A1, and ALDH4A1 by qPCR were significantly elevated in kidneys that did not develop delayed graft function versus those kidneys that developed delayed graft function ( n = 10/group, ∗ P

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, SYBR Green Assay

    4) Product Images from "RBCS1A and RBCS3B, two major members within the Arabidopsis RBCS multigene family, function to yield sufficient Rubisco content for leaf photosynthetic capacity"

    Article Title: RBCS1A and RBCS3B, two major members within the Arabidopsis RBCS multigene family, function to yield sufficient Rubisco content for leaf photosynthetic capacity

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/err434

    Identification of rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 mutants. (A) Genomic structures of RBCS1A and RBCS3B loci and T-DNA insertion sites. White and black boxes represent exons. The white boxes represent the untranslated regions and the black boxes represent the coding regions in exons. Grey boxes represent T-DNA. Arrows represent the positions of primer pairs used for RT-PCR analysis. (B) RT-PCR analysis for investigating RBCS1A and RBCS3B mRNA accumulation in leaves of rbcs mutants. Total RNA was isolated from leaves of wild-type, rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 plants and subjected to RT-PCR analysis using gene-specific primers. PCR products were separated by electrophoresis, stained with SYBR Green I, and detected by a fluorescence image analyser. 18S rRNA was used as an internal control.
    Figure Legend Snippet: Identification of rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 mutants. (A) Genomic structures of RBCS1A and RBCS3B loci and T-DNA insertion sites. White and black boxes represent exons. The white boxes represent the untranslated regions and the black boxes represent the coding regions in exons. Grey boxes represent T-DNA. Arrows represent the positions of primer pairs used for RT-PCR analysis. (B) RT-PCR analysis for investigating RBCS1A and RBCS3B mRNA accumulation in leaves of rbcs mutants. Total RNA was isolated from leaves of wild-type, rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 plants and subjected to RT-PCR analysis using gene-specific primers. PCR products were separated by electrophoresis, stained with SYBR Green I, and detected by a fluorescence image analyser. 18S rRNA was used as an internal control.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Electrophoresis, Staining, SYBR Green Assay, Fluorescence

    5) Product Images from "Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)"

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    Journal: Veterinary Sciences

    doi: 10.3390/vetsci5030069

    Sensitive real time fast-real time PCR (qPCR) based on SYBR® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.
    Figure Legend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    6) Product Images from "Long Interleukin-22 Binding Protein Isoform-1 Is an Intracellular Activator of the Unfolded Protein Response"

    Article Title: Long Interleukin-22 Binding Protein Isoform-1 Is an Intracellular Activator of the Unfolded Protein Response

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2018.02934

    IL-22BP protein and mRNA levels in monocyte-derived DCs. (A) (Upper left) Diagram showing exons with the primer-binding positions for IL22RA2 variant discrimination strategy. (Lower left) Expression of IL22RA2v1, v2 , and v3 in moDC after 6 days of culture in differentiation medium (DM) ± AM580, a retinoic acid receptor agonist, by RT-PCR. IL22RA2v2 expression vector was used as positive control for IL22RA2v2 expression. (Upper right) Expression of IL22RA2 variants in moDC following 6 days of culture in DM ± AM580 by RT-qPCR using the isoform-specific primers indicated in the left diagram (mean ± SEM; n = 3) relative to the housekeeping gene GAPDH . (B) Effect of different maturation stimuli (CpG and LPS + IFN-γ or Poly I:C) on IL22RA2, IL12B , and IL6 expression in moDC after 6 days of culture in DM by RT-qPCR using Taqman probes relative to the housekeeping gene ACTB . Extent of maturation is represented as percentage of CD83 + fluorescence by flow cytometry. Data showing representative experiment of 3 performed. (C) IL-22BP secretion by moDC cultured in DM detected by ELISA corresponds to IL22RA2 mRNA expression levels analyzed by RT-qPCR using Taqman probes and both increase over the cultivation period (mean ± SEM, n = 2). (D) Cell lysates (CL) of moDCs and conditioned media (CM) were harvested after 6 days in DM ± AM580 and immunoblotted for detection of IL-22BP (IL-22BP antibody 1) using tubulin as a loading control, IL22RA2 mRNA expression relative to the mean of the housekeeping genes GAPDH and ACTB was measured by RT-qPCR using pre-designed SYBR Green primers from the same cells. Representative experiment out of three performed. All primers used are listed in Supplementary Table 2 .
    Figure Legend Snippet: IL-22BP protein and mRNA levels in monocyte-derived DCs. (A) (Upper left) Diagram showing exons with the primer-binding positions for IL22RA2 variant discrimination strategy. (Lower left) Expression of IL22RA2v1, v2 , and v3 in moDC after 6 days of culture in differentiation medium (DM) ± AM580, a retinoic acid receptor agonist, by RT-PCR. IL22RA2v2 expression vector was used as positive control for IL22RA2v2 expression. (Upper right) Expression of IL22RA2 variants in moDC following 6 days of culture in DM ± AM580 by RT-qPCR using the isoform-specific primers indicated in the left diagram (mean ± SEM; n = 3) relative to the housekeeping gene GAPDH . (B) Effect of different maturation stimuli (CpG and LPS + IFN-γ or Poly I:C) on IL22RA2, IL12B , and IL6 expression in moDC after 6 days of culture in DM by RT-qPCR using Taqman probes relative to the housekeeping gene ACTB . Extent of maturation is represented as percentage of CD83 + fluorescence by flow cytometry. Data showing representative experiment of 3 performed. (C) IL-22BP secretion by moDC cultured in DM detected by ELISA corresponds to IL22RA2 mRNA expression levels analyzed by RT-qPCR using Taqman probes and both increase over the cultivation period (mean ± SEM, n = 2). (D) Cell lysates (CL) of moDCs and conditioned media (CM) were harvested after 6 days in DM ± AM580 and immunoblotted for detection of IL-22BP (IL-22BP antibody 1) using tubulin as a loading control, IL22RA2 mRNA expression relative to the mean of the housekeeping genes GAPDH and ACTB was measured by RT-qPCR using pre-designed SYBR Green primers from the same cells. Representative experiment out of three performed. All primers used are listed in Supplementary Table 2 .

    Techniques Used: Derivative Assay, Binding Assay, Variant Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Quantitative RT-PCR, Fluorescence, Flow Cytometry, Cytometry, Cell Culture, Enzyme-linked Immunosorbent Assay, SYBR Green Assay

    7) Product Images from "Single-Cell Analysis of Murine Long-Term Hematopoietic Stem Cells Reveals Distinct Patterns of Gene Expression during Fetal Migration"

    Article Title: Single-Cell Analysis of Murine Long-Term Hematopoietic Stem Cells Reveals Distinct Patterns of Gene Expression during Fetal Migration

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0030542

    Validation of single-cell multiplex RT-qPCR. A) Schematic representation of the single cell multiplex RT-qPCR methodology. After lysing single cells by heating, cDNA is obtained by retrotranscription with as many specific primers as genes studied. The cDNA template is subjected to a 10-cycle pre-amplification reaction using a primer pair for each gene studied in order to maintain the linear ratio of the original sample. The pre-amplified product is split into aliquots for qPCR analysis with SYBR®-Green using the same primer pairs as in the pre-amplification step. B) Efficiency of qPCR reactions after pre-amplification using 10-fold dilutions of standards did not show significant differences between the genes studied. C) Similar qPCR Ct values between samples using either single or multiplex RT primers indicate no primer competition during the retrotranscription reaction. D) Similar qPCR Ct values between samples using either single or multiplex primer pairs indicate no primer competition during the 10-cycle pre-amplification reaction. E) Quantification of varied copy number for a particular gene amplified in the presence of a constant number of plasmids for the other genes studied. For each reaction, 10 2 (purple line), 10 4 (blue line), or 10 6 (red line) plasmids were mixed with a constant number (10 4 ) of plasmids for the other eight genes studied. Gene specific multiplex qPCR amplification was then performed. Each reaction was performed in triplicate. F) Regression lines obtained from standard curves for each gene with the single cell RT-qPCR conditions. R 2 -values were greater than 0.990 with detection limit of 100 copies for most genes.
    Figure Legend Snippet: Validation of single-cell multiplex RT-qPCR. A) Schematic representation of the single cell multiplex RT-qPCR methodology. After lysing single cells by heating, cDNA is obtained by retrotranscription with as many specific primers as genes studied. The cDNA template is subjected to a 10-cycle pre-amplification reaction using a primer pair for each gene studied in order to maintain the linear ratio of the original sample. The pre-amplified product is split into aliquots for qPCR analysis with SYBR®-Green using the same primer pairs as in the pre-amplification step. B) Efficiency of qPCR reactions after pre-amplification using 10-fold dilutions of standards did not show significant differences between the genes studied. C) Similar qPCR Ct values between samples using either single or multiplex RT primers indicate no primer competition during the retrotranscription reaction. D) Similar qPCR Ct values between samples using either single or multiplex primer pairs indicate no primer competition during the 10-cycle pre-amplification reaction. E) Quantification of varied copy number for a particular gene amplified in the presence of a constant number of plasmids for the other genes studied. For each reaction, 10 2 (purple line), 10 4 (blue line), or 10 6 (red line) plasmids were mixed with a constant number (10 4 ) of plasmids for the other eight genes studied. Gene specific multiplex qPCR amplification was then performed. Each reaction was performed in triplicate. F) Regression lines obtained from standard curves for each gene with the single cell RT-qPCR conditions. R 2 -values were greater than 0.990 with detection limit of 100 copies for most genes.

    Techniques Used: Multiplex Assay, Quantitative RT-PCR, Amplification, Real-time Polymerase Chain Reaction, SYBR Green Assay

    8) Product Images from "A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages"

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0174223

    Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).
    Figure Legend Snippet: Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).

    Techniques Used: SYBR Green Assay, Real-time Polymerase Chain Reaction, Generated, Amplification

    9) Product Images from "Unusual Five Copies and Dual Forms of nrdB in “Candidatus Liberibacter asiaticus”: Biological Implications and PCR Detection Application"

    Article Title: Unusual Five Copies and Dual Forms of nrdB in “Candidatus Liberibacter asiaticus”: Biological Implications and PCR Detection Application

    Journal: Scientific Reports

    doi: 10.1038/srep39020

    Comparisons of PCR detection sensitivities on “ Candidatus Liberibacter asiaticus” using 57 samples from China (34) and USA (23) among primer sets RNRf/RNRr ( nrdB -based), HLBas/HLBr (16S rRNA gene-based), and LJ900f/LJ900r (prophage-based). ( a ) SYBR Green real-time PCR. ( b ) TaqMan Real-time PCR. Numbers within each bar box are mean Ct values with standard deviation. P values were calculated based on independent-sample T-test. All qPCR assays were performed on the ABI real-time PCR system with the same regent kit (Universal PCR Master Mix, Applied biosystems).
    Figure Legend Snippet: Comparisons of PCR detection sensitivities on “ Candidatus Liberibacter asiaticus” using 57 samples from China (34) and USA (23) among primer sets RNRf/RNRr ( nrdB -based), HLBas/HLBr (16S rRNA gene-based), and LJ900f/LJ900r (prophage-based). ( a ) SYBR Green real-time PCR. ( b ) TaqMan Real-time PCR. Numbers within each bar box are mean Ct values with standard deviation. P values were calculated based on independent-sample T-test. All qPCR assays were performed on the ABI real-time PCR system with the same regent kit (Universal PCR Master Mix, Applied biosystems).

    Techniques Used: Polymerase Chain Reaction, SYBR Green Assay, Real-time Polymerase Chain Reaction, Standard Deviation

    10) Product Images from "Central Resistin Overexposure Induces Insulin Resistance Through Toll-Like Receptor 4"

    Article Title: Central Resistin Overexposure Induces Insulin Resistance Through Toll-Like Receptor 4

    Journal: Diabetes

    doi: 10.2337/db12-0237

    Effect of chronic resistin treatment on SOCS-3, PTP-1B, and IL-6 expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, SOCS-3 ( A ), PTP-1B ( B ), and IL-6 ( C ) mRNA levels were evaluated by SYBR Green real-time RT-PCR (Applied Biosystems) in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, mRNA levels of SOCS-3 and PTP-1B were measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. For protein analysis, protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti–SOCS-3 ( A ), anti–PTP-1B ( B ), and anti–IL-6 ( C ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of SOCS-3/β-tubulin, PTP-1B/β-tubulin, and IL-6/β-tubulin. Data are means ± SEM ( n = 3–6/group). * P
    Figure Legend Snippet: Effect of chronic resistin treatment on SOCS-3, PTP-1B, and IL-6 expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, SOCS-3 ( A ), PTP-1B ( B ), and IL-6 ( C ) mRNA levels were evaluated by SYBR Green real-time RT-PCR (Applied Biosystems) in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, mRNA levels of SOCS-3 and PTP-1B were measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. For protein analysis, protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti–SOCS-3 ( A ), anti–PTP-1B ( B ), and anti–IL-6 ( C ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of SOCS-3/β-tubulin, PTP-1B/β-tubulin, and IL-6/β-tubulin. Data are means ± SEM ( n = 3–6/group). * P

    Techniques Used: Expressing, SYBR Green Assay, Quantitative RT-PCR, Western Blot

    Effect of central chronic resistin infusion on metabolic and endocrine parameters. A – C : Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks, and body weight gain and food intake were measured daily ( A ). At the end of the infusion period, the mRNA levels of POMC and NPY were measured in the hypothalamus ( B ). UCP-2, adipoR1, and adipoR2 mRNA levels also measured in the hypothalamus and peripheral insulin-sensitive tissues using SYBR Green real-time RT-PCR (Applied Biosystems). Results were normalized to 18S RNA. All data are presented as means ± SEM ( n = 3–6/group). * P
    Figure Legend Snippet: Effect of central chronic resistin infusion on metabolic and endocrine parameters. A – C : Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks, and body weight gain and food intake were measured daily ( A ). At the end of the infusion period, the mRNA levels of POMC and NPY were measured in the hypothalamus ( B ). UCP-2, adipoR1, and adipoR2 mRNA levels also measured in the hypothalamus and peripheral insulin-sensitive tissues using SYBR Green real-time RT-PCR (Applied Biosystems). Results were normalized to 18S RNA. All data are presented as means ± SEM ( n = 3–6/group). * P

    Techniques Used: SYBR Green Assay, Quantitative RT-PCR

    Effect of chronic resistin treatment on IR phosphorylation and expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, vehicle and resistin-treated rats received IP human insulin (1 U/kg body weight) or saline bolus 30 min before euthanasia to test insulin sensitivity. Serum-deprived SH-SY5Y cells were incubated for 16 h with resistin (100 ng/mL) and then stimulated for 10 min with or without insulin (100 nmol/L). Protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti– p -IR ( A ) followed by anti-IR antibodies ( B ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of p -IR/β-tubulin and IR/β-tubulin. C : At the end of the experimental period of ICV resistin, SYBR Green real-time RT-PCR (Applied Biosystems) was conducted to measure IR mRNA levels in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, IR mRNA expression was measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. All data are means ± SEM ( n = 3–6/group). a,b,c denote significant differences at P
    Figure Legend Snippet: Effect of chronic resistin treatment on IR phosphorylation and expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, vehicle and resistin-treated rats received IP human insulin (1 U/kg body weight) or saline bolus 30 min before euthanasia to test insulin sensitivity. Serum-deprived SH-SY5Y cells were incubated for 16 h with resistin (100 ng/mL) and then stimulated for 10 min with or without insulin (100 nmol/L). Protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti– p -IR ( A ) followed by anti-IR antibodies ( B ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of p -IR/β-tubulin and IR/β-tubulin. C : At the end of the experimental period of ICV resistin, SYBR Green real-time RT-PCR (Applied Biosystems) was conducted to measure IR mRNA levels in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, IR mRNA expression was measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. All data are means ± SEM ( n = 3–6/group). a,b,c denote significant differences at P

    Techniques Used: Expressing, Incubation, Western Blot, SYBR Green Assay, Quantitative RT-PCR

    Related Articles

    Amplification:

    Article Title: KS-Detect – Validation of Solar Thermal PCR for the Diagnosis of Kaposi’s Sarcoma Using Pseudo-Biopsy Samples
    Article Snippet: Specificity was taken as the ratio of the number of negative results to the number of amplifications performed, considering only the 0% KSHV+ concentration sample. .. 5 μL of SYBR green DNA dye (Life Technologies 10,000X concentrate diluted to 10X in TBE buffer) was combined with 1 μL of amplified sample. .. A 465 nm blue LED was used as an excitation source, and the sample was viewed through a dichroic filter (505–575 nm).

    Article Title: DNA cytosine hydroxymethylation levels are distinct among non-overlapping classes of peripheral blood leukocytes
    Article Snippet: Two to six primer sets were tested for each of the target genes and those having a single sharp dissociation peak, ensuring the specific gene target was being amplified, and the lowest CT values were selected for subsequent use. .. A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel.

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: The primer sequences are shown in . .. The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. .. A dissociation curve (melting) was performed by a gradual increase in temperature (0.3 °C).

    Article Title: Andrographolide Enhances TRAIL-Induced Apoptosis via p53-Mediated Death Receptors Up-Regulation and Suppression of the NF-кB Pathway in Bladder Cancer Cells
    Article Snippet: Briefly, RNA isolated from cells was converted to cDNA using a reverse transcription kit (Transgen Biotech, Beijing, China). .. PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA. .. Primer sequences for glyceraldehyde 3-phosphate dehydrogenase (GAPDH ), Bcl-2 , XIAP , RelA , and p53 are listed in Table .

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Total RNA was purified using the EasyPure® RNA kit from Annagen Biotech (Baltimore, MD) or the High Pure RNA Isolation Kit from Roche Life Science (Indianapolis, IN) The cDNA prepared with TransScript® First Strand cDNA Synthesis Supermix (Annagen Biotech) or First Strand cDNA Synthesis Kit for RT-PCR (Roche Life Science). .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA. .. Primer sequences are listed in .

    Article Title: SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression
    Article Snippet: Accession numbers of the genes analyzed as well as the chromosomal position of the 5′-flanking region amplified, using the position of the TSS as the reference point, were as follows: rKiss1 (accession number NM_181692.1, 91 bp product), rTAC3 (accession number NM_019162.2, 123 bp product) and rProDyn (accession number NM_019374.3, 109 bp product). .. PCR reactions were performed using 1 µl of each immunoprecipitate (IP) or input samples (see below), primer mix (1 µM each primer), and SYBR Green Power Up Master Mix™ (Thermo Fisher, Waltham, MA) in a final volume of 10 µl.

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1
    Article Snippet: Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems). .. Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems).

    Article Title: The Heteroaryldihydropyrimidine Bay 38-7690 Induces Hepatitis B Virus Core Protein Aggregates Associated with Promyelocytic Leukemia Nuclear Bodies in Infected Cells
    Article Snippet: Forward and reverse primers for total HBV DNA quantification were 5′ CCTGGTTATCGCTGGATGTGT 3′ and 5′ GGACAAACGGGCAACATACCTT 3′, respectively ( ). .. DNA in a 10-µl reaction volume was subjected to amplification by denaturation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s using ABsolute qPCR SYBR green mix (Thermo Scientific) in a PikoReal real-time PCR system. .. A standard curve was generated with dilutions of pHBV ( ).

    Article Title: Association of telomere length and mitochondrial DNA copy number with risperidone treatment response in first-episode antipsychotic-naïve schizophrenia
    Article Snippet: Briefly, the qPCR was assayed by using Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). .. The primers for the telomere PCR were 270 nM Tel1 (5′-GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT-3′) and 900 nM Tel2 (5′-TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA-3′) and for single-copy gene (36B4) PCR were 300 nM 36B4u (5′-CAGCAAGTGGGAAGGTGTAATCC-3′) and 500 nM 36B4d (5′-CCCATTCTATCATCAACGGGTACAA-3′) .

    Synthesized:

    Article Title: DNA cytosine hydroxymethylation levels are distinct among non-overlapping classes of peripheral blood leukocytes
    Article Snippet: A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel. .. A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel.

    Article Title: MiR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1
    Article Snippet: First-strand of complementary DNA was synthesized from 1 μg of total RNA using the First Strand cDNA Synthesis Kit (Fermentas, Burlington, VT, USA). .. Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control.

    Quantitative RT-PCR:

    Article Title: Reduced Susceptibility of DNA Methyltransferase 1 Hypomorphic (Dnmt1N/+) Mice to Hepatic Steatosis upon Feeding Liquid Alcohol Diet
    Article Snippet: Paragraph title: Real-time RT-PCR (qRT-PCR) Analysis ... For gene expression assay, DNase I treated total RNA was reverse transcribed using high capacity cDNA reverse transcription kit (Invitrogen) and real-time PCR was performed using SYBR Green chemistry (Invitrogen).

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: Paragraph title: Quantitative RT-PCR ... Quantitative real-time PCR was performed on 10 ng of the resulting cDNA using SYBR Green detection (Applied Biosystems).

    Article Title: DNA cytosine hydroxymethylation levels are distinct among non-overlapping classes of peripheral blood leukocytes
    Article Snippet: Paragraph title: 4.4. qRT-PCR analysis of transcript levels ... A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel.

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG. .. The copy number of specific and β-actin genes was established in each sample by extrapolation of the standard curve.

    Article Title: Andrographolide Enhances TRAIL-Induced Apoptosis via p53-Mediated Death Receptors Up-Regulation and Suppression of the NF-кB Pathway in Bladder Cancer Cells
    Article Snippet: Paragraph title: qRT-PCR ... PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA.

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction (qRT-PCR) ... PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA.

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Total RNA was extracted from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and 1 μ g was reverse transcribed into cDNA, using M-MLV Reverse Transcriptase (Invitrogen) in a 20-μ L reaction, according to the manufacturer's protocols. .. CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used as an internal control.

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms
    Article Snippet: Paragraph title: qRT-PCR ... 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer.

    Article Title: MiR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1
    Article Snippet: Paragraph title: SYBR Green qRT-PCR ... Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control.

    Article Title: Knockdown of the Antiapoptotic Bcl-2 Family Member A1/Bfl-1 Protects Mice from Anaphylaxis
    Article Snippet: Quantitative RT-PCR (qRT-PCR) on mRNA was performed with an Omniscript RT Kit (QIAGEN) using 1 μg total RNA pretreated with 1 U/μl RQ1 DNase (Promega). .. PCR conditions were 95°C for 7 min and 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG reagent (Invitrogen). .. Primers used were A1 fwd 5′-AGAGCAGATTGCCCTGGATGTA-3′; A1 rev 5′-GATAACCATTCTCGTGGGAG-3′; GAPDH fwd 5′-CATCACCATCTTCCAGGAGCG-3′; and GAPDH rev 5′-GTCTTCTGGGTGGCAGTGATGG-3′.

    Article Title: EVIDENCE FOR CONSTITUTIVE BONE MORPHOGENETIC PROTEIN-2 SECRETION BY M1 MACROPHAGES
    Article Snippet: Primary antibodies used were: phospho-Smad1/5 (Ser463/465; clone 41D10 rabbit monoclonal, cat. #9516, Cell Signaling (MA), Runx-2 (Abcam, cat. #102711) and GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA). .. Real-time PCR (qRT-PCR): essentially as we described in ( ). cDNA prepared from M1 or M2 macrophages was evaluated by semi-quantitative real-time PCR (qRT-PCR) with TrueAmp SYBR green qPCR supermix (Applied Biosystems, CA). .. The relative amount of mRNA was estimated by comparing with corresponding standards and normalized relative to glyceraldehyde 3-phosphate dehydrogenase (Gapdh).

    Real-time Polymerase Chain Reaction:

    Article Title: Reduced Susceptibility of DNA Methyltransferase 1 Hypomorphic (Dnmt1N/+) Mice to Hepatic Steatosis upon Feeding Liquid Alcohol Diet
    Article Snippet: The expression was normalized to RNU6B. .. For gene expression assay, DNase I treated total RNA was reverse transcribed using high capacity cDNA reverse transcription kit (Invitrogen) and real-time PCR was performed using SYBR Green chemistry (Invitrogen). .. The expression was normalized to Gapdh or 18S rRNA.

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: 1 μg of total RNA was reverse-transcribed by oligodT-priming using SuperScriptIII reverse transcriptase (Invitrogen). .. Quantitative real-time PCR was performed on 10 ng of the resulting cDNA using SYBR Green detection (Applied Biosystems). .. All qPCR primer pairs are exon-spanning and are available upon request.

    Article Title: Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification
    Article Snippet: Paragraph title: Real-time PCR. ... SYBR green PCR mix (Applied Biosystems, Cheshire, United Kingdom) consisted of 2.5 μl SYBR green buffer, 3 μl 25 mM MgCl2 , 2.5 μl 12.5 mM deoxynucleoside triphosphate, 0.25 μl Amp Erase, 0.13 μl AmpliTaq Gold (5 U/ml), 2 μl of each primer at a concentration of 10 mM (Microsynth, Balgach, Switzerland), 1 or 2 μl of DNA extract (for protocols I and II, 1 μl; for protocol III, 2 μl), and LAL reagent water (Cambrex, Verviers, Belgium) to a final volume of 25 μl.

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: The primer sequences are shown in . .. The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. .. A dissociation curve (melting) was performed by a gradual increase in temperature (0.3 °C).

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction (qRT-PCR) ... PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA.

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Total RNA was extracted from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and 1 μ g was reverse transcribed into cDNA, using M-MLV Reverse Transcriptase (Invitrogen) in a 20-μ L reaction, according to the manufacturer's protocols. .. CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used as an internal control.

    Article Title: SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression
    Article Snippet: Paragraph title: qPCR detection of chromatin immunoprecipitated DNA ... PCR reactions were performed using 1 µl of each immunoprecipitate (IP) or input samples (see below), primer mix (1 µM each primer), and SYBR Green Power Up Master Mix™ (Thermo Fisher, Waltham, MA) in a final volume of 10 µl.

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1
    Article Snippet: In all, 1 μg of total RNA purified using TRI-Reagent (Sigma) was reverse transcribed using 100 ng of random primers following the Superscript II (Invitrogen) protocol. .. Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems). .. Mean values of duplicate measurements were calculated according to the –ΔΔCt quantification method using 36B4 gene expression as a reference for normalization.

    Article Title: Therapeutic Antiviral Effect of the Nucleic Acid Polymer REP 2055 against Persistent Duck Hepatitis B Virus Infection
    Article Snippet: Primers for total DHBV DNA were situated within the polymerase open reading frame; P1-5’CAGATCTCCCTCGCCTAGGA (nt 390–410), P2- 3’ATTGCCTCATGCTGCATCAC (nt 666–646) while primers for cccDNA spanned the cohesive overlap region; P3-5’CCTGATTGGACGGCTCTTAC (nt 2462–2481), P4- 3’AAAGGTACAGTCAAGGCTGA (nt 2618–2599). .. The qPCR was performed using SYBR green qPCR master mix (Applied Biosystems) and an AB StepOnePlus Real Time PCR machine. .. The qPCR conditions and the standard curve were set up with an initial denaturation step at 50°C for 2 min, activation of polymerase at 95°C for 10 min followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C.

    Article Title: The Heteroaryldihydropyrimidine Bay 38-7690 Induces Hepatitis B Virus Core Protein Aggregates Associated with Promyelocytic Leukemia Nuclear Bodies in Infected Cells
    Article Snippet: Forward and reverse primers for total HBV DNA quantification were 5′ CCTGGTTATCGCTGGATGTGT 3′ and 5′ GGACAAACGGGCAACATACCTT 3′, respectively ( ). .. DNA in a 10-µl reaction volume was subjected to amplification by denaturation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s using ABsolute qPCR SYBR green mix (Thermo Scientific) in a PikoReal real-time PCR system. .. A standard curve was generated with dilutions of pHBV ( ).

    Article Title: Association of telomere length and mitochondrial DNA copy number with risperidone treatment response in first-episode antipsychotic-naïve schizophrenia
    Article Snippet: The telomere length was measured by quantitative polymerase chain reaction (qPCR) originally described by Cawthon . .. Briefly, the qPCR was assayed by using Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). .. The primers for the telomere PCR were 270 nM Tel1 (5′-GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT-3′) and 900 nM Tel2 (5′-TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA-3′) and for single-copy gene (36B4) PCR were 300 nM 36B4u (5′-CAGCAAGTGGGAAGGTGTAATCC-3′) and 500 nM 36B4d (5′-CCCATTCTATCATCAACGGGTACAA-3′) .

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms
    Article Snippet: The qRT-PCR was performed on an iCycler (Bio-Rad, Hercules, CA). .. 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer. .. First denaturation and activation of the Taq-polymerase occurred at 95°C for 15 min, followed by 45 cycles of denaturation at 95°C for 15 s, annealing at 56°C for 30 s and elongation at 72°C for 30 s. qRT-PCR outputs of three biological replicates per species and gene were analyzed using the MyiQ software (Bio-Rad, Hercules, CA).

    Article Title: MiR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1
    Article Snippet: First-strand of complementary DNA was synthesized from 1 μg of total RNA using the First Strand cDNA Synthesis Kit (Fermentas, Burlington, VT, USA). .. Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control. .. The primer sequences of genes are listed in .

    Article Title: Knockdown of the Antiapoptotic Bcl-2 Family Member A1/Bfl-1 Protects Mice from Anaphylaxis
    Article Snippet: Quantitative RT-PCR (qRT-PCR) on mRNA was performed with an Omniscript RT Kit (QIAGEN) using 1 μg total RNA pretreated with 1 U/μl RQ1 DNase (Promega). .. PCR conditions were 95°C for 7 min and 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG reagent (Invitrogen). .. Primers used were A1 fwd 5′-AGAGCAGATTGCCCTGGATGTA-3′; A1 rev 5′-GATAACCATTCTCGTGGGAG-3′; GAPDH fwd 5′-CATCACCATCTTCCAGGAGCG-3′; and GAPDH rev 5′-GTCTTCTGGGTGGCAGTGATGG-3′.

    Article Title: EVIDENCE FOR CONSTITUTIVE BONE MORPHOGENETIC PROTEIN-2 SECRETION BY M1 MACROPHAGES
    Article Snippet: Primary antibodies used were: phospho-Smad1/5 (Ser463/465; clone 41D10 rabbit monoclonal, cat. #9516, Cell Signaling (MA), Runx-2 (Abcam, cat. #102711) and GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA). .. Real-time PCR (qRT-PCR): essentially as we described in ( ). cDNA prepared from M1 or M2 macrophages was evaluated by semi-quantitative real-time PCR (qRT-PCR) with TrueAmp SYBR green qPCR supermix (Applied Biosystems, CA). .. The relative amount of mRNA was estimated by comparing with corresponding standards and normalized relative to glyceraldehyde 3-phosphate dehydrogenase (Gapdh).

    Random Hexamer Labeling:

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: After incubation at 37°C for 30 minutes, DNase I was inactivated by heating at 65°C for 10 minutes in presence of 25 mM EDTA (1 μl/μg of RNA). cDNA synthesis was performed on 1 μg total RNA using MMLV reverse transcriptase (Invitrogen) and random hexamer primers (Promega). .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    Expressing:

    Article Title: Reduced Susceptibility of DNA Methyltransferase 1 Hypomorphic (Dnmt1N/+) Mice to Hepatic Steatosis upon Feeding Liquid Alcohol Diet
    Article Snippet: The expression was normalized to RNU6B. .. For gene expression assay, DNase I treated total RNA was reverse transcribed using high capacity cDNA reverse transcription kit (Invitrogen) and real-time PCR was performed using SYBR Green chemistry (Invitrogen). .. The expression was normalized to Gapdh or 18S rRNA.

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: For measurements of gene expression in brain tissues, total RNA was isolated using Trizol reagent (Invitrogen) and treated with TURBO DNase (Ambion). .. Quantitative real-time PCR was performed on 10 ng of the resulting cDNA using SYBR Green detection (Applied Biosystems).

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    Article Title: Andrographolide Enhances TRAIL-Induced Apoptosis via p53-Mediated Death Receptors Up-Regulation and Suppression of the NF-кB Pathway in Bladder Cancer Cells
    Article Snippet: PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA. .. PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA.

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA. .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA.

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Total RNA was extracted from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and 1 μ g was reverse transcribed into cDNA, using M-MLV Reverse Transcriptase (Invitrogen) in a 20-μ L reaction, according to the manufacturer's protocols. .. CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used as an internal control.

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms
    Article Snippet: 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer. .. 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer.

    Article Title: MiR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1
    Article Snippet: Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control. .. Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control.

    Article Title: Knockdown of the Antiapoptotic Bcl-2 Family Member A1/Bfl-1 Protects Mice from Anaphylaxis
    Article Snippet: Paragraph title: qRT-PCR analysis of mRNA expression levels ... PCR conditions were 95°C for 7 min and 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG reagent (Invitrogen).

    Hybridization:

    Article Title: Therapeutic Antiviral Effect of the Nucleic Acid Polymer REP 2055 against Persistent Duck Hepatitis B Virus Infection
    Article Snippet: Paragraph title: Detection of DHBV DNA in liver tissue by qPCR and Southern blot hybridisation ... The qPCR was performed using SYBR green qPCR master mix (Applied Biosystems) and an AB StepOnePlus Real Time PCR machine.

    Southern Blot:

    Article Title: Therapeutic Antiviral Effect of the Nucleic Acid Polymer REP 2055 against Persistent Duck Hepatitis B Virus Infection
    Article Snippet: Paragraph title: Detection of DHBV DNA in liver tissue by qPCR and Southern blot hybridisation ... The qPCR was performed using SYBR green qPCR master mix (Applied Biosystems) and an AB StepOnePlus Real Time PCR machine.

    Immunoprecipitation:

    Article Title: SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression
    Article Snippet: Paragraph title: qPCR detection of chromatin immunoprecipitated DNA ... PCR reactions were performed using 1 µl of each immunoprecipitate (IP) or input samples (see below), primer mix (1 µM each primer), and SYBR Green Power Up Master Mix™ (Thermo Fisher, Waltham, MA) in a final volume of 10 µl.

    Incubation:

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: After incubation at 37°C for 30 minutes, DNase I was inactivated by heating at 65°C for 10 minutes in presence of 25 mM EDTA (1 μl/μg of RNA). cDNA synthesis was performed on 1 μg total RNA using MMLV reverse transcriptase (Invitrogen) and random hexamer primers (Promega). .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    TaqMan microRNA Assay:

    Article Title: Reduced Susceptibility of DNA Methyltransferase 1 Hypomorphic (Dnmt1N/+) Mice to Hepatic Steatosis upon Feeding Liquid Alcohol Diet
    Article Snippet: Real-time RT-PCR (qRT-PCR) Analysis The TaqMan miRNA Assay (Invitrogen) was used to quantify mature miRNAs according to manufacturer’s instructions. .. For gene expression assay, DNase I treated total RNA was reverse transcribed using high capacity cDNA reverse transcription kit (Invitrogen) and real-time PCR was performed using SYBR Green chemistry (Invitrogen).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Total RNA was purified using the EasyPure® RNA kit from Annagen Biotech (Baltimore, MD) or the High Pure RNA Isolation Kit from Roche Life Science (Indianapolis, IN) The cDNA prepared with TransScript® First Strand cDNA Synthesis Supermix (Annagen Biotech) or First Strand cDNA Synthesis Kit for RT-PCR (Roche Life Science). .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA.

    Generated:

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1
    Article Snippet: Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems). .. Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems).

    Sequencing:

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Total RNA was extracted from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and 1 μ g was reverse transcribed into cDNA, using M-MLV Reverse Transcriptase (Invitrogen) in a 20-μ L reaction, according to the manufacturer's protocols. .. CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used as an internal control.

    Fluorescence:

    Article Title: KS-Detect – Validation of Solar Thermal PCR for the Diagnosis of Kaposi’s Sarcoma Using Pseudo-Biopsy Samples
    Article Snippet: Paragraph title: Smartphone based fluorescence detection ... 5 μL of SYBR green DNA dye (Life Technologies 10,000X concentrate diluted to 10X in TBE buffer) was combined with 1 μL of amplified sample.

    Isolation:

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: For measurements of gene expression in brain tissues, total RNA was isolated using Trizol reagent (Invitrogen) and treated with TURBO DNase (Ambion). .. Quantitative real-time PCR was performed on 10 ng of the resulting cDNA using SYBR Green detection (Applied Biosystems).

    Article Title: Andrographolide Enhances TRAIL-Induced Apoptosis via p53-Mediated Death Receptors Up-Regulation and Suppression of the NF-кB Pathway in Bladder Cancer Cells
    Article Snippet: Briefly, RNA isolated from cells was converted to cDNA using a reverse transcription kit (Transgen Biotech, Beijing, China). .. PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA.

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Total RNA was purified using the EasyPure® RNA kit from Annagen Biotech (Baltimore, MD) or the High Pure RNA Isolation Kit from Roche Life Science (Indianapolis, IN) The cDNA prepared with TransScript® First Strand cDNA Synthesis Supermix (Annagen Biotech) or First Strand cDNA Synthesis Kit for RT-PCR (Roche Life Science). .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA.

    Article Title: Integrative DNA methylation and gene expression analysis in high-grade soft tissue sarcomas
    Article Snippet: Paragraph title: RNA isolation and quantification ... Then 1 μg of total RNA was reverse transcribed with the RevertAid™ H minus Reverse Transcriptase (Fermentas, St Leon-Rot, Germany) and analyzed using the RT cycler ABI PRISM 7300 (Applied Biosystems, Darmstadt, Germany) with Absolute SYBR Green ROX Mix (Abgene, Epsom, United Kingdom).

    Article Title: Association of telomere length and mitochondrial DNA copy number with risperidone treatment response in first-episode antipsychotic-naïve schizophrenia
    Article Snippet: Genomic DNA was isolated from 200 μl of each blood sample using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and according to the manufacturer’s protocol. .. Briefly, the qPCR was assayed by using Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA).

    Negative Control:

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. .. The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Purification:

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Total RNA was purified using the EasyPure® RNA kit from Annagen Biotech (Baltimore, MD) or the High Pure RNA Isolation Kit from Roche Life Science (Indianapolis, IN) The cDNA prepared with TransScript® First Strand cDNA Synthesis Supermix (Annagen Biotech) or First Strand cDNA Synthesis Kit for RT-PCR (Roche Life Science). .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA.

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1
    Article Snippet: In all, 1 μg of total RNA purified using TRI-Reagent (Sigma) was reverse transcribed using 100 ng of random primers following the Superscript II (Invitrogen) protocol. .. Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: KS-Detect – Validation of Solar Thermal PCR for the Diagnosis of Kaposi’s Sarcoma Using Pseudo-Biopsy Samples
    Article Snippet: 5 μL of SYBR green DNA dye (Life Technologies 10,000X concentrate diluted to 10X in TBE buffer) was combined with 1 μL of amplified sample. .. 5 μL of SYBR green DNA dye (Life Technologies 10,000X concentrate diluted to 10X in TBE buffer) was combined with 1 μL of amplified sample.

    Article Title: DNA cytosine hydroxymethylation levels are distinct among non-overlapping classes of peripheral blood leukocytes
    Article Snippet: A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel. .. A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel.

    Article Title: Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification
    Article Snippet: The primer pairs specific for conserved DNA sequences encoding the 16S rRNA gene used are listed in Table . .. SYBR green PCR mix (Applied Biosystems, Cheshire, United Kingdom) consisted of 2.5 μl SYBR green buffer, 3 μl 25 mM MgCl2 , 2.5 μl 12.5 mM deoxynucleoside triphosphate, 0.25 μl Amp Erase, 0.13 μl AmpliTaq Gold (5 U/ml), 2 μl of each primer at a concentration of 10 mM (Microsynth, Balgach, Switzerland), 1 or 2 μl of DNA extract (for protocols I and II, 1 μl; for protocol III, 2 μl), and LAL reagent water (Cambrex, Verviers, Belgium) to a final volume of 25 μl. .. PCR was performed using an ABI PRISM 7700 sequence detector (Applied Biosystems).

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: Paragraph title: 2.5. Real-Time PCR—qPCR Assay ... The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Article Title: Andrographolide Enhances TRAIL-Induced Apoptosis via p53-Mediated Death Receptors Up-Regulation and Suppression of the NF-кB Pathway in Bladder Cancer Cells
    Article Snippet: Briefly, RNA isolated from cells was converted to cDNA using a reverse transcription kit (Transgen Biotech, Beijing, China). .. PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA. .. Primer sequences for glyceraldehyde 3-phosphate dehydrogenase (GAPDH ), Bcl-2 , XIAP , RelA , and p53 are listed in Table .

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Total RNA was purified using the EasyPure® RNA kit from Annagen Biotech (Baltimore, MD) or the High Pure RNA Isolation Kit from Roche Life Science (Indianapolis, IN) The cDNA prepared with TransScript® First Strand cDNA Synthesis Supermix (Annagen Biotech) or First Strand cDNA Synthesis Kit for RT-PCR (Roche Life Science). .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA. .. Primer sequences are listed in .

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Paragraph title: 2.4. RNA Extraction and Quantitative Reverse Transcription PCR (qRT-PCR) ... CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen).

    Article Title: SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression
    Article Snippet: A summary of primers used in ChIP assays is provided in Supplementary Table . .. PCR reactions were performed using 1 µl of each immunoprecipitate (IP) or input samples (see below), primer mix (1 µM each primer), and SYBR Green Power Up Master Mix™ (Thermo Fisher, Waltham, MA) in a final volume of 10 µl. .. Input samples consisted of 10% of the chromatin volume used for immunoprecipitation.

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1
    Article Snippet: Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems). .. Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems).

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms
    Article Snippet: 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer. .. Statistical analysis of expression ratios and standard error was conducted using a pair wise fixed reallocation randomization test implemented in Excel with the Relative Expression Software Tool (REST)-384 [ , ].

    Article Title: Knockdown of the Antiapoptotic Bcl-2 Family Member A1/Bfl-1 Protects Mice from Anaphylaxis
    Article Snippet: Quantitative RT-PCR (qRT-PCR) on mRNA was performed with an Omniscript RT Kit (QIAGEN) using 1 μg total RNA pretreated with 1 U/μl RQ1 DNase (Promega). .. PCR conditions were 95°C for 7 min and 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG reagent (Invitrogen). .. Primers used were A1 fwd 5′-AGAGCAGATTGCCCTGGATGTA-3′; A1 rev 5′-GATAACCATTCTCGTGGGAG-3′; GAPDH fwd 5′-CATCACCATCTTCCAGGAGCG-3′; and GAPDH rev 5′-GTCTTCTGGGTGGCAGTGATGG-3′.

    IA:

    Article Title: DNA cytosine hydroxymethylation levels are distinct among non-overlapping classes of peripheral blood leukocytes
    Article Snippet: A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel. .. A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel.

    Chromatin Immunoprecipitation:

    Article Title: SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression
    Article Snippet: A summary of primers used in ChIP assays is provided in Supplementary Table . .. PCR reactions were performed using 1 µl of each immunoprecipitate (IP) or input samples (see below), primer mix (1 µM each primer), and SYBR Green Power Up Master Mix™ (Thermo Fisher, Waltham, MA) in a final volume of 10 µl.

    Software:

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms
    Article Snippet: 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer. .. 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer.

    SYBR Green Assay:

    Article Title: KS-Detect – Validation of Solar Thermal PCR for the Diagnosis of Kaposi’s Sarcoma Using Pseudo-Biopsy Samples
    Article Snippet: Specificity was taken as the ratio of the number of negative results to the number of amplifications performed, considering only the 0% KSHV+ concentration sample. .. 5 μL of SYBR green DNA dye (Life Technologies 10,000X concentrate diluted to 10X in TBE buffer) was combined with 1 μL of amplified sample. .. A 465 nm blue LED was used as an excitation source, and the sample was viewed through a dichroic filter (505–575 nm).

    Article Title: Reduced Susceptibility of DNA Methyltransferase 1 Hypomorphic (Dnmt1N/+) Mice to Hepatic Steatosis upon Feeding Liquid Alcohol Diet
    Article Snippet: The expression was normalized to RNU6B. .. For gene expression assay, DNase I treated total RNA was reverse transcribed using high capacity cDNA reverse transcription kit (Invitrogen) and real-time PCR was performed using SYBR Green chemistry (Invitrogen). .. The expression was normalized to Gapdh or 18S rRNA.

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: 1 μg of total RNA was reverse-transcribed by oligodT-priming using SuperScriptIII reverse transcriptase (Invitrogen). .. Quantitative real-time PCR was performed on 10 ng of the resulting cDNA using SYBR Green detection (Applied Biosystems). .. All qPCR primer pairs are exon-spanning and are available upon request.

    Article Title: DNA cytosine hydroxymethylation levels are distinct among non-overlapping classes of peripheral blood leukocytes
    Article Snippet: Two to six primer sets were tested for each of the target genes and those having a single sharp dissociation peak, ensuring the specific gene target was being amplified, and the lowest CT values were selected for subsequent use. .. A 25 μl reaction using SYBR green master mix (Life Technologies, Grand Island, NY, USA Cat# 43677659) and 4 ng of cDNA was used for analysis of the gene panel. .. To determine statistical relevance of differences in transcript levels, a one-way ANOVA was used to examine the effects of cell type on expression with Tukey’s HSD test as a post hoc using Statistica software 7.1 (StatSoft; Tulsa, OK, USA).

    Article Title: Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification
    Article Snippet: The primer pairs specific for conserved DNA sequences encoding the 16S rRNA gene used are listed in Table . .. SYBR green PCR mix (Applied Biosystems, Cheshire, United Kingdom) consisted of 2.5 μl SYBR green buffer, 3 μl 25 mM MgCl2 , 2.5 μl 12.5 mM deoxynucleoside triphosphate, 0.25 μl Amp Erase, 0.13 μl AmpliTaq Gold (5 U/ml), 2 μl of each primer at a concentration of 10 mM (Microsynth, Balgach, Switzerland), 1 or 2 μl of DNA extract (for protocols I and II, 1 μl; for protocol III, 2 μl), and LAL reagent water (Cambrex, Verviers, Belgium) to a final volume of 25 μl. .. PCR was performed using an ABI PRISM 7700 sequence detector (Applied Biosystems).

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG. .. The copy number of specific and β-actin genes was established in each sample by extrapolation of the standard curve.

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: The primer sequences are shown in . .. The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. .. A dissociation curve (melting) was performed by a gradual increase in temperature (0.3 °C).

    Article Title: Andrographolide Enhances TRAIL-Induced Apoptosis via p53-Mediated Death Receptors Up-Regulation and Suppression of the NF-кB Pathway in Bladder Cancer Cells
    Article Snippet: Briefly, RNA isolated from cells was converted to cDNA using a reverse transcription kit (Transgen Biotech, Beijing, China). .. PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA. .. Primer sequences for glyceraldehyde 3-phosphate dehydrogenase (GAPDH ), Bcl-2 , XIAP , RelA , and p53 are listed in Table .

    Article Title: Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells
    Article Snippet: Total RNA was purified using the EasyPure® RNA kit from Annagen Biotech (Baltimore, MD) or the High Pure RNA Isolation Kit from Roche Life Science (Indianapolis, IN) The cDNA prepared with TransScript® First Strand cDNA Synthesis Supermix (Annagen Biotech) or First Strand cDNA Synthesis Kit for RT-PCR (Roche Life Science). .. PCR amplification was performed with an Eppendorf Realplex Instrument (Eppendorf AG, Hamburg, Germany) with SYBR Green supermix (Fermentas, Glen Burnie, MD), 0.8 μM of each primer, and 1 μl cDNA. .. Primer sequences are listed in .

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Total RNA was extracted from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and 1 μ g was reverse transcribed into cDNA, using M-MLV Reverse Transcriptase (Invitrogen) in a 20-μ L reaction, according to the manufacturer's protocols. .. CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen). .. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used as an internal control.

    Article Title: Integrative DNA methylation and gene expression analysis in high-grade soft tissue sarcomas
    Article Snippet: RNA was isolated from snap-frozen tissue using the Allprep DNA/RNA Mini Kit (Qiagen) according to the manufacturer’s instructions. .. Then 1 μg of total RNA was reverse transcribed with the RevertAid™ H minus Reverse Transcriptase (Fermentas, St Leon-Rot, Germany) and analyzed using the RT cycler ABI PRISM 7300 (Applied Biosystems, Darmstadt, Germany) with Absolute SYBR Green ROX Mix (Abgene, Epsom, United Kingdom). .. All samples were run in triplicate and 10 ng cDNA (relative to the inserted total RNA) was used per reaction.

    Article Title: SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression
    Article Snippet: A summary of primers used in ChIP assays is provided in Supplementary Table . .. PCR reactions were performed using 1 µl of each immunoprecipitate (IP) or input samples (see below), primer mix (1 µM each primer), and SYBR Green Power Up Master Mix™ (Thermo Fisher, Waltham, MA) in a final volume of 10 µl. .. Input samples consisted of 10% of the chromatin volume used for immunoprecipitation.

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1
    Article Snippet: In all, 1 μg of total RNA purified using TRI-Reagent (Sigma) was reverse transcribed using 100 ng of random primers following the Superscript II (Invitrogen) protocol. .. Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems). .. Mean values of duplicate measurements were calculated according to the –ΔΔCt quantification method using 36B4 gene expression as a reference for normalization.

    Article Title: Therapeutic Antiviral Effect of the Nucleic Acid Polymer REP 2055 against Persistent Duck Hepatitis B Virus Infection
    Article Snippet: Primers for total DHBV DNA were situated within the polymerase open reading frame; P1-5’CAGATCTCCCTCGCCTAGGA (nt 390–410), P2- 3’ATTGCCTCATGCTGCATCAC (nt 666–646) while primers for cccDNA spanned the cohesive overlap region; P3-5’CCTGATTGGACGGCTCTTAC (nt 2462–2481), P4- 3’AAAGGTACAGTCAAGGCTGA (nt 2618–2599). .. The qPCR was performed using SYBR green qPCR master mix (Applied Biosystems) and an AB StepOnePlus Real Time PCR machine. .. The qPCR conditions and the standard curve were set up with an initial denaturation step at 50°C for 2 min, activation of polymerase at 95°C for 10 min followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C.

    Article Title: The Heteroaryldihydropyrimidine Bay 38-7690 Induces Hepatitis B Virus Core Protein Aggregates Associated with Promyelocytic Leukemia Nuclear Bodies in Infected Cells
    Article Snippet: Forward and reverse primers for total HBV DNA quantification were 5′ CCTGGTTATCGCTGGATGTGT 3′ and 5′ GGACAAACGGGCAACATACCTT 3′, respectively ( ). .. DNA in a 10-µl reaction volume was subjected to amplification by denaturation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s using ABsolute qPCR SYBR green mix (Thermo Scientific) in a PikoReal real-time PCR system. .. A standard curve was generated with dilutions of pHBV ( ).

    Article Title: Association of telomere length and mitochondrial DNA copy number with risperidone treatment response in first-episode antipsychotic-naïve schizophrenia
    Article Snippet: The telomere length was measured by quantitative polymerase chain reaction (qPCR) originally described by Cawthon . .. Briefly, the qPCR was assayed by using Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). .. The primers for the telomere PCR were 270 nM Tel1 (5′-GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT-3′) and 900 nM Tel2 (5′-TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA-3′) and for single-copy gene (36B4) PCR were 300 nM 36B4u (5′-CAGCAAGTGGGAAGGTGTAATCC-3′) and 500 nM 36B4d (5′-CCCATTCTATCATCAACGGGTACAA-3′) .

    Article Title: Pathway analysis of the transcriptome and metabolome of salt sensitive and tolerant poplar species reveals evolutionary adaption of stress tolerance mechanisms
    Article Snippet: The qRT-PCR was performed on an iCycler (Bio-Rad, Hercules, CA). .. 250 ng cDNA were used in a 25 μl reaction with 1 × ABsolute qPCR SYBR Green Fluorescein Mix (ABgene, Surrey, UK; including Thermo-Start DNA Polymerase) and 10 μM primer. .. First denaturation and activation of the Taq-polymerase occurred at 95°C for 15 min, followed by 45 cycles of denaturation at 95°C for 15 s, annealing at 56°C for 30 s and elongation at 72°C for 30 s. qRT-PCR outputs of three biological replicates per species and gene were analyzed using the MyiQ software (Bio-Rad, Hercules, CA).

    Article Title: MiR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1
    Article Snippet: First-strand of complementary DNA was synthesized from 1 μg of total RNA using the First Strand cDNA Synthesis Kit (Fermentas, Burlington, VT, USA). .. Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control. .. The primer sequences of genes are listed in .

    Article Title: Knockdown of the Antiapoptotic Bcl-2 Family Member A1/Bfl-1 Protects Mice from Anaphylaxis
    Article Snippet: Quantitative RT-PCR (qRT-PCR) on mRNA was performed with an Omniscript RT Kit (QIAGEN) using 1 μg total RNA pretreated with 1 U/μl RQ1 DNase (Promega). .. PCR conditions were 95°C for 7 min and 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG reagent (Invitrogen). .. Primers used were A1 fwd 5′-AGAGCAGATTGCCCTGGATGTA-3′; A1 rev 5′-GATAACCATTCTCGTGGGAG-3′; GAPDH fwd 5′-CATCACCATCTTCCAGGAGCG-3′; and GAPDH rev 5′-GTCTTCTGGGTGGCAGTGATGG-3′.

    Article Title: EVIDENCE FOR CONSTITUTIVE BONE MORPHOGENETIC PROTEIN-2 SECRETION BY M1 MACROPHAGES
    Article Snippet: Primary antibodies used were: phospho-Smad1/5 (Ser463/465; clone 41D10 rabbit monoclonal, cat. #9516, Cell Signaling (MA), Runx-2 (Abcam, cat. #102711) and GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA). .. Real-time PCR (qRT-PCR): essentially as we described in ( ). cDNA prepared from M1 or M2 macrophages was evaluated by semi-quantitative real-time PCR (qRT-PCR) with TrueAmp SYBR green qPCR supermix (Applied Biosystems, CA). .. The relative amount of mRNA was estimated by comparing with corresponding standards and normalized relative to glyceraldehyde 3-phosphate dehydrogenase (Gapdh).

    RNA Extraction:

    Article Title: Adenovirus-Mediated CCR7 and BTLA Overexpression Enhances Immune Tolerance and Migration in Immature Dendritic Cells
    Article Snippet: Paragraph title: 2.4. RNA Extraction and Quantitative Reverse Transcription PCR (qRT-PCR) ... CCR7, BTLA, IL-10, and HVEM gene expression were then analyzed by qRT-PCR in a ABI PRISM 7500 Sequence Detection System, using SYBR Green qPCR SuperMix (Invitrogen).

    Article Title: MiR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1
    Article Snippet: Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control. .. Real-time PCR was performed by using the Platinum SYBR Green qPCR SuperMix UDG reagent (Invitrogen) according to the manufacturer's instruction. β-actin RNA was used as an internal control.

    Quantitation Assay:

    Article Title: EVIDENCE FOR CONSTITUTIVE BONE MORPHOGENETIC PROTEIN-2 SECRETION BY M1 MACROPHAGES
    Article Snippet: Real-time PCR (qRT-PCR): essentially as we described in ( ). cDNA prepared from M1 or M2 macrophages was evaluated by semi-quantitative real-time PCR (qRT-PCR) with TrueAmp SYBR green qPCR supermix (Applied Biosystems, CA). .. Real-time PCR (qRT-PCR): essentially as we described in ( ). cDNA prepared from M1 or M2 macrophages was evaluated by semi-quantitative real-time PCR (qRT-PCR) with TrueAmp SYBR green qPCR supermix (Applied Biosystems, CA).

    Spectrophotometry:

    Article Title: Toll-Like Receptor 1/2 and 5 Ligands Enhance the Expression of Cyclin D1 and D3 and Induce Proliferation in Mantle Cell Lymphoma
    Article Snippet: Gene expression measurement was performed with the ABI prism 7700 Sequence Detection System (Applyed Biosystems). cDNA standards were obtained by RT-PCR amplification of the specific mRNAs and quantitated by NanoDrop® ND-1000 UV-Vis Spectrophotometer. .. SYBR-green quantitative RT-PCR reactions were performed on 20 ng of retrotranscribed total RNA in a final volume of 25 μl 1 X SYBR Green Master Mix (Applied Biosystems) at 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and at 60°C for 1 min, followed by dissociation performed at 95°C for 15 s, 60°C for 20 s and 95°C for 15 s. SYBR-green primers sets were as follows: β-actin, forward CGA GCG CGG CTA CAG CTT and reverse CCT TAA TGT CAC GCA CGA TT; cyclin D1, forward GTGCTGCGAAGTGGAAACC and reverse ATCCAGGTGGCGACGATCT; cyclin D3, forward GACCATCGAAAAACTGTGCATCTA and reverse CCCACTTGAGCTTCCCTAGGA; IL-6, forward TACATCCTCGACGGCATCTC and reverse ACCAGGCAAGTCTCCTCATTG.

    Article Title: Therapeutic Antiviral Effect of the Nucleic Acid Polymer REP 2055 against Persistent Duck Hepatitis B Virus Infection
    Article Snippet: The qPCR was performed using SYBR green qPCR master mix (Applied Biosystems) and an AB StepOnePlus Real Time PCR machine. .. The qPCR was performed using SYBR green qPCR master mix (Applied Biosystems) and an AB StepOnePlus Real Time PCR machine.

    Article Title: Association of telomere length and mitochondrial DNA copy number with risperidone treatment response in first-episode antipsychotic-naïve schizophrenia
    Article Snippet: DNA samples were quantified using the Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. Briefly, the qPCR was assayed by using Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA).

    Concentration Assay:

    Article Title: Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification
    Article Snippet: The primer pairs specific for conserved DNA sequences encoding the 16S rRNA gene used are listed in Table . .. SYBR green PCR mix (Applied Biosystems, Cheshire, United Kingdom) consisted of 2.5 μl SYBR green buffer, 3 μl 25 mM MgCl2 , 2.5 μl 12.5 mM deoxynucleoside triphosphate, 0.25 μl Amp Erase, 0.13 μl AmpliTaq Gold (5 U/ml), 2 μl of each primer at a concentration of 10 mM (Microsynth, Balgach, Switzerland), 1 or 2 μl of DNA extract (for protocols I and II, 1 μl; for protocol III, 2 μl), and LAL reagent water (Cambrex, Verviers, Belgium) to a final volume of 25 μl. .. PCR was performed using an ABI PRISM 7700 sequence detector (Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher fast sybr green master mix
    Detection and quantitation of ChPV using the sensitive <t>fast-qPCR</t> based on <t>SYBR</t> ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.
    Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1725 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 1725 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    85
    Thermo Fisher individual hindlimb muscle
    Utrophin isoforms exhibit species‐ and isoform‐specific transcript levels. (A) The postnatal mouse response to dystrophin‐deficiency is tissue and isoform specific. Quantitative RT‐PCR (qRT‐PCR) analysis of tissue samples sourced from control (wt) C57BL/10 and mdx C57BL/10 mouse tissue at the 2‐week precrisis period (upper panel) and during the degeneration‐regeneration period in mdx during which total Utrn levels are elevated (6‐weeks; lower panel). Values for wt are at the left and for mdx at the right as denoted below each pair of columns. Utrn ‐C/D mRNAs were greatly lowered in comparison to other isoforms (Table ). P values represent differences between wild‐type and mdx tissues at the same time point ( P < 0.0001••• P < 0.001••, P < 0.05•, 99% cl). qRT‐PCR analysis of Utrn ‐A,‐A′ and ‐F levels in specific <t>hindlimb</t> muscles ( tibilialis anterior , quadricep and soleus) compared to diaphragm (Fig. A) is provided in Fig. . (B) Selective upregulation of utrophin isoforms during C2C12 myogenesis. qRT‐PCR analysis of endogenous Utrn mRNA levels in myoblasts (myob) and differentiating (diff) myotubes sampled at days 3, 6 and 9, with corresponding mRNA profiles illustrated below. For (A and B), values are represented as a colour scale under (B), standardised to 28s cDNA for each time‐point. Numerical values obtained for all sample sets and additional statistical data are provided in Table . (C–D) Species‐specific utrophin mRNA myogenic profiles are mirrored in skeletal muscle mesoangioblasts (MABs). qRT‐PCR of utrophin mRNA isoform levels in wild‐type, mdx /DMD myogenic cell lines (left panel; white columns, myoblast, black columns, myotubes as outlined in the legend) and in dystrophin‐deficient skeletal muscle mesoangioblasts (MAB, grey columns, right panel). Values too low to be visualised by scale are provided numerically (upper value; myoblast, lower value; myotube). Numerical values for (A–B) sample sets are provided in Table .
    Individual Hindlimb Muscle, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/individual hindlimb muscle/product/Thermo Fisher
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    individual hindlimb muscle - by Bioz Stars, 2020-01
    85/100 stars
      Buy from Supplier

    Image Search Results


    Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Article Snippet: The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Quantitation Assay, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Article Snippet: The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    IL-22BP protein and mRNA levels in monocyte-derived DCs. (A) (Upper left) Diagram showing exons with the primer-binding positions for IL22RA2 variant discrimination strategy. (Lower left) Expression of IL22RA2v1, v2 , and v3 in moDC after 6 days of culture in differentiation medium (DM) ± AM580, a retinoic acid receptor agonist, by RT-PCR. IL22RA2v2 expression vector was used as positive control for IL22RA2v2 expression. (Upper right) Expression of IL22RA2 variants in moDC following 6 days of culture in DM ± AM580 by RT-qPCR using the isoform-specific primers indicated in the left diagram (mean ± SEM; n = 3) relative to the housekeeping gene GAPDH . (B) Effect of different maturation stimuli (CpG and LPS + IFN-γ or Poly I:C) on IL22RA2, IL12B , and IL6 expression in moDC after 6 days of culture in DM by RT-qPCR using Taqman probes relative to the housekeeping gene ACTB . Extent of maturation is represented as percentage of CD83 + fluorescence by flow cytometry. Data showing representative experiment of 3 performed. (C) IL-22BP secretion by moDC cultured in DM detected by ELISA corresponds to IL22RA2 mRNA expression levels analyzed by RT-qPCR using Taqman probes and both increase over the cultivation period (mean ± SEM, n = 2). (D) Cell lysates (CL) of moDCs and conditioned media (CM) were harvested after 6 days in DM ± AM580 and immunoblotted for detection of IL-22BP (IL-22BP antibody 1) using tubulin as a loading control, IL22RA2 mRNA expression relative to the mean of the housekeeping genes GAPDH and ACTB was measured by RT-qPCR using pre-designed SYBR Green primers from the same cells. Representative experiment out of three performed. All primers used are listed in Supplementary Table 2 .

    Journal: Frontiers in Immunology

    Article Title: Long Interleukin-22 Binding Protein Isoform-1 Is an Intracellular Activator of the Unfolded Protein Response

    doi: 10.3389/fimmu.2018.02934

    Figure Lengend Snippet: IL-22BP protein and mRNA levels in monocyte-derived DCs. (A) (Upper left) Diagram showing exons with the primer-binding positions for IL22RA2 variant discrimination strategy. (Lower left) Expression of IL22RA2v1, v2 , and v3 in moDC after 6 days of culture in differentiation medium (DM) ± AM580, a retinoic acid receptor agonist, by RT-PCR. IL22RA2v2 expression vector was used as positive control for IL22RA2v2 expression. (Upper right) Expression of IL22RA2 variants in moDC following 6 days of culture in DM ± AM580 by RT-qPCR using the isoform-specific primers indicated in the left diagram (mean ± SEM; n = 3) relative to the housekeeping gene GAPDH . (B) Effect of different maturation stimuli (CpG and LPS + IFN-γ or Poly I:C) on IL22RA2, IL12B , and IL6 expression in moDC after 6 days of culture in DM by RT-qPCR using Taqman probes relative to the housekeeping gene ACTB . Extent of maturation is represented as percentage of CD83 + fluorescence by flow cytometry. Data showing representative experiment of 3 performed. (C) IL-22BP secretion by moDC cultured in DM detected by ELISA corresponds to IL22RA2 mRNA expression levels analyzed by RT-qPCR using Taqman probes and both increase over the cultivation period (mean ± SEM, n = 2). (D) Cell lysates (CL) of moDCs and conditioned media (CM) were harvested after 6 days in DM ± AM580 and immunoblotted for detection of IL-22BP (IL-22BP antibody 1) using tubulin as a loading control, IL22RA2 mRNA expression relative to the mean of the housekeeping genes GAPDH and ACTB was measured by RT-qPCR using pre-designed SYBR Green primers from the same cells. Representative experiment out of three performed. All primers used are listed in Supplementary Table 2 .

    Article Snippet: One microliter of cDNA was amplified by qPCR using primers and SYBR Green (Thermo Scientific, 4385616) or Taqman probes on a 7500 Fast Real Time PCR System (Applied Biosystems).

    Techniques: Derivative Assay, Binding Assay, Variant Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Quantitative RT-PCR, Fluorescence, Flow Cytometry, Cytometry, Cell Culture, Enzyme-linked Immunosorbent Assay, SYBR Green Assay

    Sensitive real time fast-real time PCR (qPCR) based on SYBR® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Article Snippet: The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    Utrophin isoforms exhibit species‐ and isoform‐specific transcript levels. (A) The postnatal mouse response to dystrophin‐deficiency is tissue and isoform specific. Quantitative RT‐PCR (qRT‐PCR) analysis of tissue samples sourced from control (wt) C57BL/10 and mdx C57BL/10 mouse tissue at the 2‐week precrisis period (upper panel) and during the degeneration‐regeneration period in mdx during which total Utrn levels are elevated (6‐weeks; lower panel). Values for wt are at the left and for mdx at the right as denoted below each pair of columns. Utrn ‐C/D mRNAs were greatly lowered in comparison to other isoforms (Table ). P values represent differences between wild‐type and mdx tissues at the same time point ( P < 0.0001••• P < 0.001••, P < 0.05•, 99% cl). qRT‐PCR analysis of Utrn ‐A,‐A′ and ‐F levels in specific hindlimb muscles ( tibilialis anterior , quadricep and soleus) compared to diaphragm (Fig. A) is provided in Fig. . (B) Selective upregulation of utrophin isoforms during C2C12 myogenesis. qRT‐PCR analysis of endogenous Utrn mRNA levels in myoblasts (myob) and differentiating (diff) myotubes sampled at days 3, 6 and 9, with corresponding mRNA profiles illustrated below. For (A and B), values are represented as a colour scale under (B), standardised to 28s cDNA for each time‐point. Numerical values obtained for all sample sets and additional statistical data are provided in Table . (C–D) Species‐specific utrophin mRNA myogenic profiles are mirrored in skeletal muscle mesoangioblasts (MABs). qRT‐PCR of utrophin mRNA isoform levels in wild‐type, mdx /DMD myogenic cell lines (left panel; white columns, myoblast, black columns, myotubes as outlined in the legend) and in dystrophin‐deficient skeletal muscle mesoangioblasts (MAB, grey columns, right panel). Values too low to be visualised by scale are provided numerically (upper value; myoblast, lower value; myotube). Numerical values for (A–B) sample sets are provided in Table .

    Journal: Febs Letters

    Article Title: Alternative utrophin mRNAs contribute to phenotypic differences between dystrophin‐deficient mice and Duchenne muscular dystrophy

    doi: 10.1002/1873-3468.13099

    Figure Lengend Snippet: Utrophin isoforms exhibit species‐ and isoform‐specific transcript levels. (A) The postnatal mouse response to dystrophin‐deficiency is tissue and isoform specific. Quantitative RT‐PCR (qRT‐PCR) analysis of tissue samples sourced from control (wt) C57BL/10 and mdx C57BL/10 mouse tissue at the 2‐week precrisis period (upper panel) and during the degeneration‐regeneration period in mdx during which total Utrn levels are elevated (6‐weeks; lower panel). Values for wt are at the left and for mdx at the right as denoted below each pair of columns. Utrn ‐C/D mRNAs were greatly lowered in comparison to other isoforms (Table ). P values represent differences between wild‐type and mdx tissues at the same time point ( P < 0.0001••• P < 0.001••, P < 0.05•, 99% cl). qRT‐PCR analysis of Utrn ‐A,‐A′ and ‐F levels in specific hindlimb muscles ( tibilialis anterior , quadricep and soleus) compared to diaphragm (Fig. A) is provided in Fig. . (B) Selective upregulation of utrophin isoforms during C2C12 myogenesis. qRT‐PCR analysis of endogenous Utrn mRNA levels in myoblasts (myob) and differentiating (diff) myotubes sampled at days 3, 6 and 9, with corresponding mRNA profiles illustrated below. For (A and B), values are represented as a colour scale under (B), standardised to 28s cDNA for each time‐point. Numerical values obtained for all sample sets and additional statistical data are provided in Table . (C–D) Species‐specific utrophin mRNA myogenic profiles are mirrored in skeletal muscle mesoangioblasts (MABs). qRT‐PCR of utrophin mRNA isoform levels in wild‐type, mdx /DMD myogenic cell lines (left panel; white columns, myoblast, black columns, myotubes as outlined in the legend) and in dystrophin‐deficient skeletal muscle mesoangioblasts (MAB, grey columns, right panel). Values too low to be visualised by scale are provided numerically (upper value; myoblast, lower value; myotube). Numerical values for (A–B) sample sets are provided in Table .

    Article Snippet: All reactions used Sensimix; Bioline, Ltd., Canton, MA, USA and Rotor‐Gene 3000 (Corbett Life Science, Crawley, UK) with the exception of studies involving individual hindlimb muscle (Fig. ; StepOne Real‐Time system and Fast SYBR Green Master Mix; Thermo Fisher, Cramlington, UK).

    Techniques: Quantitative RT-PCR