fast sybr green master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    Fast SYBR Green Master Mix
    Description:
    Alternative Product Try PowerUp SYBR Green Master Mix our newest high performance SYBR dye based master mix for superior performance at a very competitive price With PowerUp SYBR Green Master Mix we ve taken the best of Fast SYBR Green Master Mix and added additional capabilities for your gene expression analysis Fast SYBR Green Master Mix Real Time PCR Master Mix Designed for Speed Obtain a fast reliable and cost effective solution for your real time PCR applications without compromising sensitivity specificity dynamic range or PCR efficiency • Fast Real time PCR results in as fast as 35 minutes • Sensitive Detect very low copies of target • Specific Minimize primer dimer and non specific amplification • Reproducible Consistent amplification across a wide dynamic range Fast SYBR Green Master Mix contains all of the components excluding the template and primers in a convenient 2X master mix It includes the following components in an optimized buffer • AmpliTaq Fast DNA Polymerase UP a highly purified DNA polymerase designed to allow instant hot start minimizing non specific product formation and enabling reactions to be set up at room temperature • SYBR Green I dye to enable detection of double stranded DNA • Deoxynucleotides dNTPs to help maintain optimal PCR results • Uracil DNA Glycosylase UDG designed to reduce carryover contamination • Passive internal reference based on proprietary ROX dye to enable increased precision
    Catalog Number:
    4385610
    Price:
    None
    Category:
    Kits and Assays
    Applications:
    Enzymes & Master Mixes for Real-Time PCR|Fast Real-Time PCR|PCR & Real-Time PCR|Real Time PCR (qPCR)|Real Time PCR-Based Gene Expression Profiling|Gene Expression Analysis & Genotyping
    Buy from Supplier


    Structured Review

    Thermo Fisher fast sybr green master mix
    Detection and quantitation of ChPV using the sensitive <t>fast-qPCR</t> based on <t>SYBR</t> ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.
    Alternative Product Try PowerUp SYBR Green Master Mix our newest high performance SYBR dye based master mix for superior performance at a very competitive price With PowerUp SYBR Green Master Mix we ve taken the best of Fast SYBR Green Master Mix and added additional capabilities for your gene expression analysis Fast SYBR Green Master Mix Real Time PCR Master Mix Designed for Speed Obtain a fast reliable and cost effective solution for your real time PCR applications without compromising sensitivity specificity dynamic range or PCR efficiency • Fast Real time PCR results in as fast as 35 minutes • Sensitive Detect very low copies of target • Specific Minimize primer dimer and non specific amplification • Reproducible Consistent amplification across a wide dynamic range Fast SYBR Green Master Mix contains all of the components excluding the template and primers in a convenient 2X master mix It includes the following components in an optimized buffer • AmpliTaq Fast DNA Polymerase UP a highly purified DNA polymerase designed to allow instant hot start minimizing non specific product formation and enabling reactions to be set up at room temperature • SYBR Green I dye to enable detection of double stranded DNA • Deoxynucleotides dNTPs to help maintain optimal PCR results • Uracil DNA Glycosylase UDG designed to reduce carryover contamination • Passive internal reference based on proprietary ROX dye to enable increased precision
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2021-07
    97/100 stars

    Images

    1) Product Images from "Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)"

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    Journal: Veterinary Sciences

    doi: 10.3390/vetsci5030069

    Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.
    Figure Legend Snippet: Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Techniques Used: Quantitation Assay, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.
    Figure Legend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    2) Product Images from "A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages"

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0174223

    Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).
    Figure Legend Snippet: Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).

    Techniques Used: SYBR Green Assay, Real-time Polymerase Chain Reaction, Generated, Amplification

    3) Product Images from "Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation"

    Article Title: Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation

    Journal: Oxidative Medicine and Cellular Longevity

    doi: 10.1155/2018/3704129

    qPCR studies for kidney biopsies taken prior to transplant. For a separate series of kidney transplants, biopsies were collected for qPCR. (a) PCR primers used for qPCR. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1 or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. (b–e) qPCR results for (b) ALDH2, (c) ALDH7A1, (d) ALDH4A1, and (e) ALDH1A1. ALDH2, ALDH7A1, and ALDH4A1 by qPCR were significantly elevated in kidneys that did not develop delayed graft function versus those kidneys that developed delayed graft function ( n = 10/group, ∗ P
    Figure Legend Snippet: qPCR studies for kidney biopsies taken prior to transplant. For a separate series of kidney transplants, biopsies were collected for qPCR. (a) PCR primers used for qPCR. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1 or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. (b–e) qPCR results for (b) ALDH2, (c) ALDH7A1, (d) ALDH4A1, and (e) ALDH1A1. ALDH2, ALDH7A1, and ALDH4A1 by qPCR were significantly elevated in kidneys that did not develop delayed graft function versus those kidneys that developed delayed graft function ( n = 10/group, ∗ P

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, SYBR Green Assay

    4) Product Images from "Single-Cell Analysis of Murine Long-Term Hematopoietic Stem Cells Reveals Distinct Patterns of Gene Expression during Fetal Migration"

    Article Title: Single-Cell Analysis of Murine Long-Term Hematopoietic Stem Cells Reveals Distinct Patterns of Gene Expression during Fetal Migration

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0030542

    Validation of single-cell multiplex RT-qPCR. A) Schematic representation of the single cell multiplex RT-qPCR methodology. After lysing single cells by heating, cDNA is obtained by retrotranscription with as many specific primers as genes studied. The cDNA template is subjected to a 10-cycle pre-amplification reaction using a primer pair for each gene studied in order to maintain the linear ratio of the original sample. The pre-amplified product is split into aliquots for qPCR analysis with SYBR®-Green using the same primer pairs as in the pre-amplification step. B) Efficiency of qPCR reactions after pre-amplification using 10-fold dilutions of standards did not show significant differences between the genes studied. C) Similar qPCR Ct values between samples using either single or multiplex RT primers indicate no primer competition during the retrotranscription reaction. D) Similar qPCR Ct values between samples using either single or multiplex primer pairs indicate no primer competition during the 10-cycle pre-amplification reaction. E) Quantification of varied copy number for a particular gene amplified in the presence of a constant number of plasmids for the other genes studied. For each reaction, 10 2 (purple line), 10 4 (blue line), or 10 6 (red line) plasmids were mixed with a constant number (10 4 ) of plasmids for the other eight genes studied. Gene specific multiplex qPCR amplification was then performed. Each reaction was performed in triplicate. F) Regression lines obtained from standard curves for each gene with the single cell RT-qPCR conditions. R 2 -values were greater than 0.990 with detection limit of 100 copies for most genes.
    Figure Legend Snippet: Validation of single-cell multiplex RT-qPCR. A) Schematic representation of the single cell multiplex RT-qPCR methodology. After lysing single cells by heating, cDNA is obtained by retrotranscription with as many specific primers as genes studied. The cDNA template is subjected to a 10-cycle pre-amplification reaction using a primer pair for each gene studied in order to maintain the linear ratio of the original sample. The pre-amplified product is split into aliquots for qPCR analysis with SYBR®-Green using the same primer pairs as in the pre-amplification step. B) Efficiency of qPCR reactions after pre-amplification using 10-fold dilutions of standards did not show significant differences between the genes studied. C) Similar qPCR Ct values between samples using either single or multiplex RT primers indicate no primer competition during the retrotranscription reaction. D) Similar qPCR Ct values between samples using either single or multiplex primer pairs indicate no primer competition during the 10-cycle pre-amplification reaction. E) Quantification of varied copy number for a particular gene amplified in the presence of a constant number of plasmids for the other genes studied. For each reaction, 10 2 (purple line), 10 4 (blue line), or 10 6 (red line) plasmids were mixed with a constant number (10 4 ) of plasmids for the other eight genes studied. Gene specific multiplex qPCR amplification was then performed. Each reaction was performed in triplicate. F) Regression lines obtained from standard curves for each gene with the single cell RT-qPCR conditions. R 2 -values were greater than 0.990 with detection limit of 100 copies for most genes.

    Techniques Used: Multiplex Assay, Quantitative RT-PCR, Amplification, Real-time Polymerase Chain Reaction, SYBR Green Assay

    5) Product Images from "An astrocyte cell line that differentially propagates murine prions"

    Article Title: An astrocyte cell line that differentially propagates murine prions

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA120.012596

    Expression of PrP C in C8D astrocytes as compared with other neuronal and non-neuronal cell lines. A , mRNA expression of Prnp gene in four different cell lines. Relative fold change for PrP mRNA expression was measured by RT-PCR. 1 × 10 6 cells were plated in triplicate, and after 4 days of culture, total RNA was extracted and reverse-transcribed. cDNA was used for quantitative real-time PCR using SYBR. Relative mRNA expression was normalized with actin and calculated using the ΔΔ Ct method. *, p value ≤ 0.05 and ***, p value ≤ 0.0001 when compared with astrocytes using ANOVA (Dunnett's multiple comparisons) in GraphPad Prism. Error bars represent averages ± S.E. B , PrP C surface levels in four different cell lines. Surface PrP C was analyzed by FACS after staining with mAb 4H11 and Alexa 405–conjugated secondary antibody. Relative mean fluorescence values of N2a, MEF, and CAD5 were compared with the average fluorescence value of astrocytes, which was set to 100%. Statistical analysis was performed by one-way ANOVA and Dunnett's multiple comparison tests using GraphPad Prism. *, p value ≤ 0.05; **, p value ≤ 0.01. Error bars represent averages ± S.E.
    Figure Legend Snippet: Expression of PrP C in C8D astrocytes as compared with other neuronal and non-neuronal cell lines. A , mRNA expression of Prnp gene in four different cell lines. Relative fold change for PrP mRNA expression was measured by RT-PCR. 1 × 10 6 cells were plated in triplicate, and after 4 days of culture, total RNA was extracted and reverse-transcribed. cDNA was used for quantitative real-time PCR using SYBR. Relative mRNA expression was normalized with actin and calculated using the ΔΔ Ct method. *, p value ≤ 0.05 and ***, p value ≤ 0.0001 when compared with astrocytes using ANOVA (Dunnett's multiple comparisons) in GraphPad Prism. Error bars represent averages ± S.E. B , PrP C surface levels in four different cell lines. Surface PrP C was analyzed by FACS after staining with mAb 4H11 and Alexa 405–conjugated secondary antibody. Relative mean fluorescence values of N2a, MEF, and CAD5 were compared with the average fluorescence value of astrocytes, which was set to 100%. Statistical analysis was performed by one-way ANOVA and Dunnett's multiple comparison tests using GraphPad Prism. *, p value ≤ 0.05; **, p value ≤ 0.01. Error bars represent averages ± S.E.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, FACS, Staining, Fluorescence

    6) Product Images from "HuR-mediated SCN5A mRNA stability reduces arrhythmic risk in heart failure"

    Article Title: HuR-mediated SCN5A mRNA stability reduces arrhythmic risk in heart failure

    Journal: Heart rhythm

    doi: 10.1016/j.hrthm.2018.02.018

    HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with SYBR ™ Safe DNA Gel Stain in agarose gels. (C) qRT-PCR was performed to confirm the results in (B).
    Figure Legend Snippet: HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with SYBR ™ Safe DNA Gel Stain in agarose gels. (C) qRT-PCR was performed to confirm the results in (B).

    Techniques Used: Isolation, Synthesized, Polymerase Chain Reaction, Staining, Quantitative RT-PCR

    7) Product Images from "RBCS1A and RBCS3B, two major members within the Arabidopsis RBCS multigene family, function to yield sufficient Rubisco content for leaf photosynthetic capacity"

    Article Title: RBCS1A and RBCS3B, two major members within the Arabidopsis RBCS multigene family, function to yield sufficient Rubisco content for leaf photosynthetic capacity

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/err434

    Identification of rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 mutants. (A) Genomic structures of RBCS1A and RBCS3B loci and T-DNA insertion sites. White and black boxes represent exons. The white boxes represent the untranslated regions and the black boxes represent the coding regions in exons. Grey boxes represent T-DNA. Arrows represent the positions of primer pairs used for RT-PCR analysis. (B) RT-PCR analysis for investigating RBCS1A and RBCS3B mRNA accumulation in leaves of rbcs mutants. Total RNA was isolated from leaves of wild-type, rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 plants and subjected to RT-PCR analysis using gene-specific primers. PCR products were separated by electrophoresis, stained with SYBR Green I, and detected by a fluorescence image analyser. 18S rRNA was used as an internal control.
    Figure Legend Snippet: Identification of rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 mutants. (A) Genomic structures of RBCS1A and RBCS3B loci and T-DNA insertion sites. White and black boxes represent exons. The white boxes represent the untranslated regions and the black boxes represent the coding regions in exons. Grey boxes represent T-DNA. Arrows represent the positions of primer pairs used for RT-PCR analysis. (B) RT-PCR analysis for investigating RBCS1A and RBCS3B mRNA accumulation in leaves of rbcs mutants. Total RNA was isolated from leaves of wild-type, rbcs1a-1, rbcs3b-1 , and rbcs1a3b-1 plants and subjected to RT-PCR analysis using gene-specific primers. PCR products were separated by electrophoresis, stained with SYBR Green I, and detected by a fluorescence image analyser. 18S rRNA was used as an internal control.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Electrophoresis, Staining, SYBR Green Assay, Fluorescence

    8) Product Images from "Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)"

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    Journal: Veterinary Sciences

    doi: 10.3390/vetsci5030069

    Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.
    Figure Legend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    9) Product Images from "TLR3/4 Signaling is Mediated via the NFκB-CXCR4/7 Pathway in Human Alcoholic Hepatitis and Non Alcoholic Steatohepatitis Which Formed Mallory-Denk Bodies"

    Article Title: TLR3/4 Signaling is Mediated via the NFκB-CXCR4/7 Pathway in Human Alcoholic Hepatitis and Non Alcoholic Steatohepatitis Which Formed Mallory-Denk Bodies

    Journal: Experimental and molecular pathology

    doi: 10.1016/j.yexmp.2014.07.001

    Induction of TLRs downstream components in the livers of AH (A) and NASH (B) biopsies. Quantification of mRNA was carried out by SYBR real-time PCR assays. * p
    Figure Legend Snippet: Induction of TLRs downstream components in the livers of AH (A) and NASH (B) biopsies. Quantification of mRNA was carried out by SYBR real-time PCR assays. * p

    Techniques Used: Real-time Polymerase Chain Reaction

    10) Product Images from "Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation"

    Article Title: Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation

    Journal: Oxidative Medicine and Cellular Longevity

    doi: 10.1155/2018/3704129

    qPCR studies for kidney biopsies taken prior to transplant. For a separate series of kidney transplants, biopsies were collected for qPCR. (a) PCR primers used for qPCR. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1 or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. (b–e) qPCR results for (b) ALDH2, (c) ALDH7A1, (d) ALDH4A1, and (e) ALDH1A1. ALDH2, ALDH7A1, and ALDH4A1 by qPCR were significantly elevated in kidneys that did not develop delayed graft function versus those kidneys that developed delayed graft function ( n = 10/group, ∗ P
    Figure Legend Snippet: qPCR studies for kidney biopsies taken prior to transplant. For a separate series of kidney transplants, biopsies were collected for qPCR. (a) PCR primers used for qPCR. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1 or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. (b–e) qPCR results for (b) ALDH2, (c) ALDH7A1, (d) ALDH4A1, and (e) ALDH1A1. ALDH2, ALDH7A1, and ALDH4A1 by qPCR were significantly elevated in kidneys that did not develop delayed graft function versus those kidneys that developed delayed graft function ( n = 10/group, ∗ P

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, SYBR Green Assay

    11) Product Images from "TRPV4 channel activation selectively inhibits tumor endothelial cell proliferation"

    Article Title: TRPV4 channel activation selectively inhibits tumor endothelial cell proliferation

    Journal: Scientific Reports

    doi: 10.1038/srep14257

    TEC express increased levels of proliferation-associated genes. Relative gene expression of cell-cycle associated genes in NEC and TEC. EC were treated with GSK (100 nM) for 24 h and subsequently lysed for RNA isolation. cDNA was prepared and qPCR analysis was performed using Fast SYBR green master mix (Applied Biosystems). Gene expression was first normalized to GAPDH and presented as relative expression to NEC. All the data shown is mean ± SEM from at least three independent experiments.
    Figure Legend Snippet: TEC express increased levels of proliferation-associated genes. Relative gene expression of cell-cycle associated genes in NEC and TEC. EC were treated with GSK (100 nM) for 24 h and subsequently lysed for RNA isolation. cDNA was prepared and qPCR analysis was performed using Fast SYBR green master mix (Applied Biosystems). Gene expression was first normalized to GAPDH and presented as relative expression to NEC. All the data shown is mean ± SEM from at least three independent experiments.

    Techniques Used: Expressing, Isolation, Real-time Polymerase Chain Reaction, SYBR Green Assay

    12) Product Images from "RNA-Seq and protein mass spectrometry in microdissected kidney tubules reveal signaling processes initiating lithium-induced nephrogenic diabetes insipidus."

    Article Title: RNA-Seq and protein mass spectrometry in microdissected kidney tubules reveal signaling processes initiating lithium-induced nephrogenic diabetes insipidus.

    Journal: Kidney international

    doi: 10.1016/j.kint.2019.02.015

    RT-qPCR analysis. SYBR green fluorescence curves (left panels) and C T values (right panels) for indicated target transcripts were shown. Control samples are shown in green curves and lithium samples are shown in orange curves. Data were collected from three pairs of control/lithium rats. (A) Atp1a1. (B) Ccl2. (C) Ccl20. (D) Cxcl10. (E) B2m.
    Figure Legend Snippet: RT-qPCR analysis. SYBR green fluorescence curves (left panels) and C T values (right panels) for indicated target transcripts were shown. Control samples are shown in green curves and lithium samples are shown in orange curves. Data were collected from three pairs of control/lithium rats. (A) Atp1a1. (B) Ccl2. (C) Ccl20. (D) Cxcl10. (E) B2m.

    Techniques Used: Quantitative RT-PCR, SYBR Green Assay, Fluorescence

    13) Product Images from "Differential regulation of mitochondrial complex I and oxidative stress based on metastatic potential of colorectal cancer cells"

    Article Title: Differential regulation of mitochondrial complex I and oxidative stress based on metastatic potential of colorectal cancer cells

    Journal: Oncology Letters

    doi: 10.3892/ol.2020.12176

    Gene expression profiling of oncogenic and metastatic marker genes. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green-based reverse transcription-quantitative PCR. Results are presented as the fold change in the mRNA expression relative to HT-29. *P
    Figure Legend Snippet: Gene expression profiling of oncogenic and metastatic marker genes. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green-based reverse transcription-quantitative PCR. Results are presented as the fold change in the mRNA expression relative to HT-29. *P

    Techniques Used: Expressing, Marker, SYBR Green Assay, Real-time Polymerase Chain Reaction

    Analysis of mitochondrial biogenesis and signaling pathways. (A) Mitochondrial biogenesis was measured via mtDNA copy number and mRNA expression of mitochondrial biogenesis markers. (A-a) Changes in mtDNA copy number were determined using the SYBR green qPCR method. mRNA expression levels of (A-b) mitochondrial biogenesis marker PGC1-α and (A-c) TFAM were analyzed using reverse transcription-quantitative PCR. (B) Immunoblotting was performed to analyze the expression levels of p-AKT (Ser 478 and Thr 308), HIF1-α, cMyc, GAPDH, SOD1, Beclin-1 and ATG5. Values represent relative band intensities of protein that were measured by densitometry, normalized with actin loading control and presented as relative to HT-29. p-AKT (Ser 478 and Thr 308) proteins were normalized with total AKT as well as actin, and other proteins were normalized with β-actin as loading control. *P
    Figure Legend Snippet: Analysis of mitochondrial biogenesis and signaling pathways. (A) Mitochondrial biogenesis was measured via mtDNA copy number and mRNA expression of mitochondrial biogenesis markers. (A-a) Changes in mtDNA copy number were determined using the SYBR green qPCR method. mRNA expression levels of (A-b) mitochondrial biogenesis marker PGC1-α and (A-c) TFAM were analyzed using reverse transcription-quantitative PCR. (B) Immunoblotting was performed to analyze the expression levels of p-AKT (Ser 478 and Thr 308), HIF1-α, cMyc, GAPDH, SOD1, Beclin-1 and ATG5. Values represent relative band intensities of protein that were measured by densitometry, normalized with actin loading control and presented as relative to HT-29. p-AKT (Ser 478 and Thr 308) proteins were normalized with total AKT as well as actin, and other proteins were normalized with β-actin as loading control. *P

    Techniques Used: Expressing, SYBR Green Assay, Real-time Polymerase Chain Reaction, Marker

    Effect of C-I inhibition on metastatic signaling. HCT-116 cells were treated with rotenone (100 µM) for indicated time points, and RNA was used for reverse transcription-quantitative PCR. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green dye. Fold changes were calculated relative to non-treated control at 0 h. *P
    Figure Legend Snippet: Effect of C-I inhibition on metastatic signaling. HCT-116 cells were treated with rotenone (100 µM) for indicated time points, and RNA was used for reverse transcription-quantitative PCR. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green dye. Fold changes were calculated relative to non-treated control at 0 h. *P

    Techniques Used: Inhibition, Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay

    14) Product Images from "Ufmylation and FATylation Pathways are Down Regulated in Human Alcoholic and Non Alcoholic Steatohepatitis, and Mice Fed DDC, where Mallory-Denk Bodies (MDBs) Form"

    Article Title: Ufmylation and FATylation Pathways are Down Regulated in Human Alcoholic and Non Alcoholic Steatohepatitis, and Mice Fed DDC, where Mallory-Denk Bodies (MDBs) Form

    Journal: Experimental and molecular pathology

    doi: 10.1016/j.yexmp.2014.05.010

    Induction of FAT10 and subunits of immunoproteasome (LMP2, LMP7 and MECL-1) in the livers of DDC re-fed mice. Quantification of mRNA was carried out by SYBR real-time PCR assays. n.s, not significant, * p
    Figure Legend Snippet: Induction of FAT10 and subunits of immunoproteasome (LMP2, LMP7 and MECL-1) in the livers of DDC re-fed mice. Quantification of mRNA was carried out by SYBR real-time PCR assays. n.s, not significant, * p

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction

    15) Product Images from "Unusual Five Copies and Dual Forms of nrdB in “Candidatus Liberibacter asiaticus”: Biological Implications and PCR Detection Application"

    Article Title: Unusual Five Copies and Dual Forms of nrdB in “Candidatus Liberibacter asiaticus”: Biological Implications and PCR Detection Application

    Journal: Scientific Reports

    doi: 10.1038/srep39020

    Comparisons of PCR detection sensitivities on “ Candidatus Liberibacter asiaticus” using 57 samples from China (34) and USA (23) among primer sets RNRf/RNRr ( nrdB -based), HLBas/HLBr (16S rRNA gene-based), and LJ900f/LJ900r (prophage-based). ( a ) SYBR Green real-time PCR. ( b ) TaqMan Real-time PCR. Numbers within each bar box are mean Ct values with standard deviation. P values were calculated based on independent-sample T-test. All qPCR assays were performed on the ABI real-time PCR system with the same regent kit (Universal PCR Master Mix, Applied biosystems).
    Figure Legend Snippet: Comparisons of PCR detection sensitivities on “ Candidatus Liberibacter asiaticus” using 57 samples from China (34) and USA (23) among primer sets RNRf/RNRr ( nrdB -based), HLBas/HLBr (16S rRNA gene-based), and LJ900f/LJ900r (prophage-based). ( a ) SYBR Green real-time PCR. ( b ) TaqMan Real-time PCR. Numbers within each bar box are mean Ct values with standard deviation. P values were calculated based on independent-sample T-test. All qPCR assays were performed on the ABI real-time PCR system with the same regent kit (Universal PCR Master Mix, Applied biosystems).

    Techniques Used: Polymerase Chain Reaction, SYBR Green Assay, Real-time Polymerase Chain Reaction, Standard Deviation

    16) Product Images from "Differential regulation of mitochondrial complex I and oxidative stress based on metastatic potential of colorectal cancer cells"

    Article Title: Differential regulation of mitochondrial complex I and oxidative stress based on metastatic potential of colorectal cancer cells

    Journal: Oncology Letters

    doi: 10.3892/ol.2020.12176

    Gene expression profiling of oncogenic and metastatic marker genes. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green-based reverse transcription-quantitative PCR. Results are presented as the fold change in the mRNA expression relative to HT-29. *P
    Figure Legend Snippet: Gene expression profiling of oncogenic and metastatic marker genes. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green-based reverse transcription-quantitative PCR. Results are presented as the fold change in the mRNA expression relative to HT-29. *P

    Techniques Used: Expressing, Marker, SYBR Green Assay, Real-time Polymerase Chain Reaction

    Analysis of mitochondrial biogenesis and signaling pathways. (A) Mitochondrial biogenesis was measured via mtDNA copy number and mRNA expression of mitochondrial biogenesis markers. (A-a) Changes in mtDNA copy number were determined using the SYBR green qPCR method. mRNA expression levels of (A-b) mitochondrial biogenesis marker PGC1-α and (A-c) TFAM were analyzed using reverse transcription-quantitative PCR. (B) Immunoblotting was performed to analyze the expression levels of p-AKT (Ser 478 and Thr 308), HIF1-α, cMyc, GAPDH, SOD1, Beclin-1 and ATG5. Values represent relative band intensities of protein that were measured by densitometry, normalized with actin loading control and presented as relative to HT-29. p-AKT (Ser 478 and Thr 308) proteins were normalized with total AKT as well as actin, and other proteins were normalized with β-actin as loading control. *P
    Figure Legend Snippet: Analysis of mitochondrial biogenesis and signaling pathways. (A) Mitochondrial biogenesis was measured via mtDNA copy number and mRNA expression of mitochondrial biogenesis markers. (A-a) Changes in mtDNA copy number were determined using the SYBR green qPCR method. mRNA expression levels of (A-b) mitochondrial biogenesis marker PGC1-α and (A-c) TFAM were analyzed using reverse transcription-quantitative PCR. (B) Immunoblotting was performed to analyze the expression levels of p-AKT (Ser 478 and Thr 308), HIF1-α, cMyc, GAPDH, SOD1, Beclin-1 and ATG5. Values represent relative band intensities of protein that were measured by densitometry, normalized with actin loading control and presented as relative to HT-29. p-AKT (Ser 478 and Thr 308) proteins were normalized with total AKT as well as actin, and other proteins were normalized with β-actin as loading control. *P

    Techniques Used: Expressing, SYBR Green Assay, Real-time Polymerase Chain Reaction, Marker

    Effect of C-I inhibition on metastatic signaling. HCT-116 cells were treated with rotenone (100 µM) for indicated time points, and RNA was used for reverse transcription-quantitative PCR. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green dye. Fold changes were calculated relative to non-treated control at 0 h. *P
    Figure Legend Snippet: Effect of C-I inhibition on metastatic signaling. HCT-116 cells were treated with rotenone (100 µM) for indicated time points, and RNA was used for reverse transcription-quantitative PCR. mRNA expression levels of (A) AKT-1, (B) HIF1-α, (C) cMyc, (D) Survivin, (E) SLC2A1, (F) CA-9 and (G) VEGF genes were analyzed using SYBR green dye. Fold changes were calculated relative to non-treated control at 0 h. *P

    Techniques Used: Inhibition, Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay

    17) Product Images from "Candida albicans Mycofilms Support Staphylococcus aureus Colonization and Enhances Miconazole Resistance in Dual-Species Interactions"

    Article Title: Candida albicans Mycofilms Support Staphylococcus aureus Colonization and Enhances Miconazole Resistance in Dual-Species Interactions

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2017.00258

    Extracellular DNA contributes to inter-kingdom pathogenicity. Mono- and dual-species biofilms were seeded at 1 × 10 6 CFU/mL in black 96-well plates and eDNA release at 1.5, 6, 12, and 24 h measured using a SYBR ® Green 1 based microplate fluorescence assay (MFA) in comparison to a standard curve (A) . Biofilms were washed with 0.2 M EDTA to remove the ECM and resulting eDNA quantified using the MFA described above in comparison to a standard curve (B) . ECM associated DNA was then precipitated from matrix extracts and species contributions were analyzed using qPCR (C) . C. albicans only biofilms were grown for 24 h in black 96-well plates. After washing biofilms were then treated with either 130 or 650 mg/L of DNase for 4 h. SYTO9 ® stained S. aureus cells (1 × 10 6 CFU/mL) were then added to the biofilm and incubated for 90 mins before being fluorescently quantified in comparison to an vehicle control treated biofilm (D). Data represents duplicate samples from three independent experiments ( ∗ p
    Figure Legend Snippet: Extracellular DNA contributes to inter-kingdom pathogenicity. Mono- and dual-species biofilms were seeded at 1 × 10 6 CFU/mL in black 96-well plates and eDNA release at 1.5, 6, 12, and 24 h measured using a SYBR ® Green 1 based microplate fluorescence assay (MFA) in comparison to a standard curve (A) . Biofilms were washed with 0.2 M EDTA to remove the ECM and resulting eDNA quantified using the MFA described above in comparison to a standard curve (B) . ECM associated DNA was then precipitated from matrix extracts and species contributions were analyzed using qPCR (C) . C. albicans only biofilms were grown for 24 h in black 96-well plates. After washing biofilms were then treated with either 130 or 650 mg/L of DNase for 4 h. SYTO9 ® stained S. aureus cells (1 × 10 6 CFU/mL) were then added to the biofilm and incubated for 90 mins before being fluorescently quantified in comparison to an vehicle control treated biofilm (D). Data represents duplicate samples from three independent experiments ( ∗ p

    Techniques Used: SYBR Green Assay, Fluorescence, Real-time Polymerase Chain Reaction, Staining, Incubation

    18) Product Images from "Central Resistin Overexposure Induces Insulin Resistance Through Toll-Like Receptor 4"

    Article Title: Central Resistin Overexposure Induces Insulin Resistance Through Toll-Like Receptor 4

    Journal: Diabetes

    doi: 10.2337/db12-0237

    Effect of chronic resistin treatment on SOCS-3, PTP-1B, and IL-6 expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, SOCS-3 ( A ), PTP-1B ( B ), and IL-6 ( C ) mRNA levels were evaluated by SYBR Green real-time RT-PCR (Applied Biosystems) in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, mRNA levels of SOCS-3 and PTP-1B were measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. For protein analysis, protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti–SOCS-3 ( A ), anti–PTP-1B ( B ), and anti–IL-6 ( C ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of SOCS-3/β-tubulin, PTP-1B/β-tubulin, and IL-6/β-tubulin. Data are means ± SEM ( n = 3–6/group). * P
    Figure Legend Snippet: Effect of chronic resistin treatment on SOCS-3, PTP-1B, and IL-6 expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, SOCS-3 ( A ), PTP-1B ( B ), and IL-6 ( C ) mRNA levels were evaluated by SYBR Green real-time RT-PCR (Applied Biosystems) in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, mRNA levels of SOCS-3 and PTP-1B were measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. For protein analysis, protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti–SOCS-3 ( A ), anti–PTP-1B ( B ), and anti–IL-6 ( C ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of SOCS-3/β-tubulin, PTP-1B/β-tubulin, and IL-6/β-tubulin. Data are means ± SEM ( n = 3–6/group). * P

    Techniques Used: Expressing, SYBR Green Assay, Quantitative RT-PCR, Western Blot

    Effect of central chronic resistin infusion on metabolic and endocrine parameters. A – C : Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks, and body weight gain and food intake were measured daily ( A ). At the end of the infusion period, the mRNA levels of POMC and NPY were measured in the hypothalamus ( B ). UCP-2, adipoR1, and adipoR2 mRNA levels also measured in the hypothalamus and peripheral insulin-sensitive tissues using SYBR Green real-time RT-PCR (Applied Biosystems). Results were normalized to 18S RNA. All data are presented as means ± SEM ( n = 3–6/group). * P
    Figure Legend Snippet: Effect of central chronic resistin infusion on metabolic and endocrine parameters. A – C : Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks, and body weight gain and food intake were measured daily ( A ). At the end of the infusion period, the mRNA levels of POMC and NPY were measured in the hypothalamus ( B ). UCP-2, adipoR1, and adipoR2 mRNA levels also measured in the hypothalamus and peripheral insulin-sensitive tissues using SYBR Green real-time RT-PCR (Applied Biosystems). Results were normalized to 18S RNA. All data are presented as means ± SEM ( n = 3–6/group). * P

    Techniques Used: SYBR Green Assay, Quantitative RT-PCR

    Effect of chronic resistin treatment on IR phosphorylation and expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, vehicle and resistin-treated rats received IP human insulin (1 U/kg body weight) or saline bolus 30 min before euthanasia to test insulin sensitivity. Serum-deprived SH-SY5Y cells were incubated for 16 h with resistin (100 ng/mL) and then stimulated for 10 min with or without insulin (100 nmol/L). Protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti– p -IR ( A ) followed by anti-IR antibodies ( B ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of p -IR/β-tubulin and IR/β-tubulin. C : At the end of the experimental period of ICV resistin, SYBR Green real-time RT-PCR (Applied Biosystems) was conducted to measure IR mRNA levels in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, IR mRNA expression was measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. All data are means ± SEM ( n = 3–6/group). a,b,c denote significant differences at P
    Figure Legend Snippet: Effect of chronic resistin treatment on IR phosphorylation and expression. Male Wistar rats received an ICV of vehicle or resistin (1.2 μg/day) during a period of 2 weeks. At the end of the infusion period, vehicle and resistin-treated rats received IP human insulin (1 U/kg body weight) or saline bolus 30 min before euthanasia to test insulin sensitivity. Serum-deprived SH-SY5Y cells were incubated for 16 h with resistin (100 ng/mL) and then stimulated for 10 min with or without insulin (100 nmol/L). Protein lysates from hypothalamus, liver, muscle, adipose tissue, and SH-SY5Y cells were subjected to Western blot analysis. Membranes were probed sequentially with anti– p -IR ( A ) followed by anti-IR antibodies ( B ). The proteins on the blots were revealed by ECL and bands quantified by densitometry. The results are expressed as ratio of p -IR/β-tubulin and IR/β-tubulin. C : At the end of the experimental period of ICV resistin, SYBR Green real-time RT-PCR (Applied Biosystems) was conducted to measure IR mRNA levels in the hypothalamus and peripheral insulin-sensitive tissues. In SH-SY5Y cells, IR mRNA expression was measured after chronic resistin treatment (100 ng/mL) for 16 h. Results were normalized to 18S RNA. All data are means ± SEM ( n = 3–6/group). a,b,c denote significant differences at P

    Techniques Used: Expressing, Incubation, Western Blot, SYBR Green Assay, Quantitative RT-PCR

    Related Articles

    SYBR Green Assay:

    Article Title: The Lipopolysaccharide and ?-1,3-Glucan Binding Protein Gene Is Upregulated in White Spot Virus-Infected Shrimp (Penaeus stylirostris)
    Article Snippet: The SYBR Green RT-PCR assay was carried out in a GeneAmp 9600 thermocycler coupled with a GeneAmp 5700 Sequence Detection System (PE Applied Biosystems). .. The amplifications were performed in a 96-well plate in a 25-μl reaction volume containing 7.1 μl of 2× SYBR Green Master Mix (PE Applied Biosystems), 0.24 μM (each) LGBP gene-specific forward (289-170F, 5′GGTAACCAGTACGGAGGAACGA3′) and reverse (289-233R, 5′TACTCGACGTGGGTCTTCTCGA3′) primers, and 1 μl of 1:10-diluted cDNA. .. The thermal profile for SYBR Green RT-PCR was 50°C for 2 min and 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min.

    Article Title: Defining the Transcriptional and Cellular Landscape of Type 1 Diabetes in the NOD Mouse
    Article Snippet: .. SYBR green PCR was performed using Fast SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. .. TaqMan PCR was performed using TaqMan Fast Universal PCR Master Mix (Life Technologies).

    Article Title: Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation
    Article Snippet: Kidney biopsy lysates were made by sonification, and RNA was isolated by the use of Ambion© RNAqueous Kit. .. To substantially reduce the possibility of DNA contamination in the preparations, the isolated total RNA was subject to precipitation with lithium chloride and DNase digestion (Ambion DNase-free). cDNA was made using the Takara© Primescript cDNA synthesis kit with oligo dT primers. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1, or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. ..

    Article Title: Distinctive profiles of tumor-infiltrating immune cells and association with intensity of infiltration in colorectal cancer
    Article Snippet: .. Briefly, PCR was performed using 10 ng cDNA, 500 nM forward and reverse primers, and SYBR Green master mix (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in 20 ml reactions. .. This was followed by a 2-step PCR program consisting of 95°C for 15 sec and 60°C for 60 sec for 35 cycles.

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: The primers annealing temperature was tuned with gradient PCR (SureCycler 8800, Agilent Technologies, USA) using 2x PCR Master Mix (Thermo Fisher Scientific, USA). .. Real-time qPCR assays were performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific) on 7500 Fast Real-Time PCR System (Applied Biosystems, USA). .. To test the optimum concentrations of the primers, identical reactions containing different concentrations of the forward and reverse primers, prepared essentially as described [ ], were run using the following thermocycling conditions: initial stage at 50°C for 2 min, hot start at 95°C for 2 min; followed by 40 cycles of (i) 95°C for 15 sec, (ii) 55°C for 30 sec and (iii) 72°C for 30 sec.

    Article Title: Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway
    Article Snippet: The mRNA expression levels of transcription factor, Nrf2, HO-1, NQO-1, GR, and GSTA2, as antioxidant markers were compared with the mRNA expression of β-actin as loading control. .. Real-time RT-PCR was performed using Applied Biosystems Step One (Applied Biosystems, CA, USA) software v2.1). cDNA template (2 µL), SYBR Green Master Mix (Applied Biosystems, CA, USA), sense and Anti-sense primers (1 µL) were added to the wells of the system, and then the total volume of the well was adjusted to 20 µL by adding distilled water. .. The PCR conditions were pre-denaturation at 95℃ for 10 min, denaturation at 95℃ for 15 min, annealing at 60℃ for 1 min, extension at 95℃ for 15 min for 40 cycles.

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: .. Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. ..

    Article Title: A mouse model for monitoring islet cell genesis and developing therapies for diabetes
    Article Snippet: .. Quantification of SeAP /EGFP cDNA was performed with SYBR Green using Fast SYBR Master Mix (Applied Biosystems) and reported relative to levels of the cDNA encoding mouse β-actin. ..

    Polymerase Chain Reaction:

    Article Title: Defining the Transcriptional and Cellular Landscape of Type 1 Diabetes in the NOD Mouse
    Article Snippet: .. SYBR green PCR was performed using Fast SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. .. TaqMan PCR was performed using TaqMan Fast Universal PCR Master Mix (Life Technologies).

    Article Title: Distinctive profiles of tumor-infiltrating immune cells and association with intensity of infiltration in colorectal cancer
    Article Snippet: .. Briefly, PCR was performed using 10 ng cDNA, 500 nM forward and reverse primers, and SYBR Green master mix (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in 20 ml reactions. .. This was followed by a 2-step PCR program consisting of 95°C for 15 sec and 60°C for 60 sec for 35 cycles.

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: .. Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. ..

    Isolation:

    Article Title: Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation
    Article Snippet: Kidney biopsy lysates were made by sonification, and RNA was isolated by the use of Ambion© RNAqueous Kit. .. To substantially reduce the possibility of DNA contamination in the preparations, the isolated total RNA was subject to precipitation with lithium chloride and DNase digestion (Ambion DNase-free). cDNA was made using the Takara© Primescript cDNA synthesis kit with oligo dT primers. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1, or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Association of Impaired Reactive Aldehyde Metabolism with Delayed Graft Function in Human Kidney Transplantation
    Article Snippet: Kidney biopsy lysates were made by sonification, and RNA was isolated by the use of Ambion© RNAqueous Kit. .. To substantially reduce the possibility of DNA contamination in the preparations, the isolated total RNA was subject to precipitation with lithium chloride and DNase digestion (Ambion DNase-free). cDNA was made using the Takara© Primescript cDNA synthesis kit with oligo dT primers. qPCR reactions were performed in a final volume of 20 μ l that contained 15 μ l of Fast SYBR© Green Master Mix (Life Technologies), 1000 nM primer (ALDH2, ALDH7A1, or GAPDH) or 500 nM primer (ALDH4A1), and 10 ng cDNA. ..

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: The primers annealing temperature was tuned with gradient PCR (SureCycler 8800, Agilent Technologies, USA) using 2x PCR Master Mix (Thermo Fisher Scientific, USA). .. Real-time qPCR assays were performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific) on 7500 Fast Real-Time PCR System (Applied Biosystems, USA). .. To test the optimum concentrations of the primers, identical reactions containing different concentrations of the forward and reverse primers, prepared essentially as described [ ], were run using the following thermocycling conditions: initial stage at 50°C for 2 min, hot start at 95°C for 2 min; followed by 40 cycles of (i) 95°C for 15 sec, (ii) 55°C for 30 sec and (iii) 72°C for 30 sec.

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: .. Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. ..

    Quantitative RT-PCR:

    Article Title: Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway
    Article Snippet: The mRNA expression levels of transcription factor, Nrf2, HO-1, NQO-1, GR, and GSTA2, as antioxidant markers were compared with the mRNA expression of β-actin as loading control. .. Real-time RT-PCR was performed using Applied Biosystems Step One (Applied Biosystems, CA, USA) software v2.1). cDNA template (2 µL), SYBR Green Master Mix (Applied Biosystems, CA, USA), sense and Anti-sense primers (1 µL) were added to the wells of the system, and then the total volume of the well was adjusted to 20 µL by adding distilled water. .. The PCR conditions were pre-denaturation at 95℃ for 10 min, denaturation at 95℃ for 15 min, annealing at 60℃ for 1 min, extension at 95℃ for 15 min for 40 cycles.

    Software:

    Article Title: Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway
    Article Snippet: The mRNA expression levels of transcription factor, Nrf2, HO-1, NQO-1, GR, and GSTA2, as antioxidant markers were compared with the mRNA expression of β-actin as loading control. .. Real-time RT-PCR was performed using Applied Biosystems Step One (Applied Biosystems, CA, USA) software v2.1). cDNA template (2 µL), SYBR Green Master Mix (Applied Biosystems, CA, USA), sense and Anti-sense primers (1 µL) were added to the wells of the system, and then the total volume of the well was adjusted to 20 µL by adding distilled water. .. The PCR conditions were pre-denaturation at 95℃ for 10 min, denaturation at 95℃ for 15 min, annealing at 60℃ for 1 min, extension at 95℃ for 15 min for 40 cycles.

    Amplification:

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)
    Article Snippet: .. Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    Thermo Fisher gene exp dyx1c1 ccpg1 hs00370049 m1
    Knockdown of RFX1 , RFX2 , and RFX3 affect the expression of <t>DYX1C1</t> and DCDC2 but not KIAA0319 in hTERT-RPE1 cells. A ) Binding of RFX1 and RFX2 to the X-box motifs present in DYX1C1 and DCDC2 promoters. Biotinylated probes spanning the X-box motifs were incubated with nuclear extracts from serum-starved hTERT-RPE1 cells with or without antibodies (ab) against RFX1, RFX2, and RFX3. Supershifts for both probes were detected for RFX1 and RFX2 antibodies (white arrowheads). One representative experiment of 3 is shown. B ) Fold-change differences in the expression of DCGs upon knockdown of RFX TFs. By using siRNA against RFX1 , RFX2 , and RFX3 , alone or in different combinations, genes were silenced in hTERT-RPE1 cells. Cells were thereafter starved for 24 h to induce ciliogenesis, and expression levels of DYX1C1 , DCDC2 , and KIAA0319 were measured by using qRT-PCR. C ) Fold-change difference in expression levels of RFX1 , RFX2 , and RFX3 upon siRNA silencing. qRT-PCR data are summarized by using the ΔΔC t method as displayed as mean fold-change (2 −ΔΔ Ct or −2 ΔΔ Ct ) ± sem . Significance of the post hoc tests after ANOVA is presented as *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05 after multiple correction of simultaneous comparisons.
    Gene Exp Dyx1c1 Ccpg1 Hs00370049 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp dyx1c1 ccpg1 hs00370049 m1/product/Thermo Fisher
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gene exp dyx1c1 ccpg1 hs00370049 m1 - by Bioz Stars, 2021-07
    87/100 stars
      Buy from Supplier

    97
    Thermo Fisher fast sybr green master mix
    Detection and quantitation of ChPV using the sensitive <t>fast-qPCR</t> based on <t>SYBR</t> ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.
    Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman fast universal pcr master mix
    Expression of GR in clinical lung adenocarcinoma and cell line models. A lung adenocarcinoma tissue microarray was probed by immunohistochemistry for expression of GR and the expression levels were scored in the malignant cells by intensity of staining as well as percent of cells that stained positive (Panel A). Representative images showing the different intensities of staining for GR are shown (Panel B). Whole cell lysates were extracted from H292, A549, H1299, H1299GR Clone 2 and H1299GR Clone 4 cells and GR expression was visualized by western blot using GAPDH as the loading control (Panel C). RNA was also extracted from the same cell lines and the levels of GR mRNA were measured by real time <t>RT-PCR</t> using <t>TaqMan</t> probes and plotted on a linear scale (Panel D). GR mRNA was measured by quantitative RT-PCR using SYBR Green in a cDNA microarray of clinical lung adenocarcinoma tumors; the relative levels of GR mRNA in H1299 and H1299GR Clone 4 cells were simultaneously measured using SYBR Green and the data plotted on a log scale (dashed lines) (Panel E). Panel D: *P, 0.002; **P, 0.001; ***P, 0.003.
    Taqman Fast Universal Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast universal pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taqman fast universal pcr master mix - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Knockdown of RFX1 , RFX2 , and RFX3 affect the expression of DYX1C1 and DCDC2 but not KIAA0319 in hTERT-RPE1 cells. A ) Binding of RFX1 and RFX2 to the X-box motifs present in DYX1C1 and DCDC2 promoters. Biotinylated probes spanning the X-box motifs were incubated with nuclear extracts from serum-starved hTERT-RPE1 cells with or without antibodies (ab) against RFX1, RFX2, and RFX3. Supershifts for both probes were detected for RFX1 and RFX2 antibodies (white arrowheads). One representative experiment of 3 is shown. B ) Fold-change differences in the expression of DCGs upon knockdown of RFX TFs. By using siRNA against RFX1 , RFX2 , and RFX3 , alone or in different combinations, genes were silenced in hTERT-RPE1 cells. Cells were thereafter starved for 24 h to induce ciliogenesis, and expression levels of DYX1C1 , DCDC2 , and KIAA0319 were measured by using qRT-PCR. C ) Fold-change difference in expression levels of RFX1 , RFX2 , and RFX3 upon siRNA silencing. qRT-PCR data are summarized by using the ΔΔC t method as displayed as mean fold-change (2 −ΔΔ Ct or −2 ΔΔ Ct ) ± sem . Significance of the post hoc tests after ANOVA is presented as *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05 after multiple correction of simultaneous comparisons.

    Journal: The FASEB Journal

    Article Title: Ciliary dyslexia candidate genes DYX1C1 andDCDC2 are regulated by Regulatory Factor X (RFX) transcription factors through X-box promoter motifs

    doi: 10.1096/fj.201500124RR

    Figure Lengend Snippet: Knockdown of RFX1 , RFX2 , and RFX3 affect the expression of DYX1C1 and DCDC2 but not KIAA0319 in hTERT-RPE1 cells. A ) Binding of RFX1 and RFX2 to the X-box motifs present in DYX1C1 and DCDC2 promoters. Biotinylated probes spanning the X-box motifs were incubated with nuclear extracts from serum-starved hTERT-RPE1 cells with or without antibodies (ab) against RFX1, RFX2, and RFX3. Supershifts for both probes were detected for RFX1 and RFX2 antibodies (white arrowheads). One representative experiment of 3 is shown. B ) Fold-change differences in the expression of DCGs upon knockdown of RFX TFs. By using siRNA against RFX1 , RFX2 , and RFX3 , alone or in different combinations, genes were silenced in hTERT-RPE1 cells. Cells were thereafter starved for 24 h to induce ciliogenesis, and expression levels of DYX1C1 , DCDC2 , and KIAA0319 were measured by using qRT-PCR. C ) Fold-change difference in expression levels of RFX1 , RFX2 , and RFX3 upon siRNA silencing. qRT-PCR data are summarized by using the ΔΔC t method as displayed as mean fold-change (2 −ΔΔ Ct or −2 ΔΔ Ct ) ± sem . Significance of the post hoc tests after ANOVA is presented as *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05 after multiple correction of simultaneous comparisons.

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was analyzed with cDNA diluted 1:5 using TaqMan expression assays and TaqMan fast Universal PCR Master Mix [4352042; Thermo Fisher Scientific;DYX1C1 : Hs00370049_m1; DCDC2 : Hs00393203_m1;KIAA0319 : Hs00207788_m1; HPRT 1 (hypoxanthine phosphoribosyltransferase 1): Hs02800695_m1; CDK1 (cyclin-dependent kinase 1): Hs00938777_m1; TUBA1A (tubulin α1a): Hs00362387_m1; RFX2 : 01100925_m1] or using SYBR green primers for RFX1 , RFX3 , and HPRT1 (10 µM) and the Fast SYBR Green Master Mix (4385612; Applied Biosystems, Foster City, CA, USA).

    Techniques: Expressing, Binding Assay, Incubation, Quantitative RT-PCR

    The promoters of DYX1C1 , DCDC2 , and KIAA0319 contain functional X-box promoter motifs. A ) Location of putative X-box promoter motifs upstream of DYX1C1 , DCDC2 , and KIAA0319 identified in the bioinformatics screen. X-box sequence logos on the basis of human, mouse, dog, cow, and cat sequence alignments are shown above 3 well-conserved motifs. B ) Luciferase expression assays: pGL3 basic vector containing promoter sequences of DYX1C1 , DCDC2 , and KIAA0319 (containing WT or mutated X-box motifs) were transfected into starved hTERT-RPE1 and SH-SY5Y cells under normal growth conditions. Luciferase expression was measured and data are shown as relative ratio to the WT construct. Data are displayed as means ± sem. * P

    Journal: The FASEB Journal

    Article Title: Ciliary dyslexia candidate genes DYX1C1 andDCDC2 are regulated by Regulatory Factor X (RFX) transcription factors through X-box promoter motifs

    doi: 10.1096/fj.201500124RR

    Figure Lengend Snippet: The promoters of DYX1C1 , DCDC2 , and KIAA0319 contain functional X-box promoter motifs. A ) Location of putative X-box promoter motifs upstream of DYX1C1 , DCDC2 , and KIAA0319 identified in the bioinformatics screen. X-box sequence logos on the basis of human, mouse, dog, cow, and cat sequence alignments are shown above 3 well-conserved motifs. B ) Luciferase expression assays: pGL3 basic vector containing promoter sequences of DYX1C1 , DCDC2 , and KIAA0319 (containing WT or mutated X-box motifs) were transfected into starved hTERT-RPE1 and SH-SY5Y cells under normal growth conditions. Luciferase expression was measured and data are shown as relative ratio to the WT construct. Data are displayed as means ± sem. * P

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was analyzed with cDNA diluted 1:5 using TaqMan expression assays and TaqMan fast Universal PCR Master Mix [4352042; Thermo Fisher Scientific;DYX1C1 : Hs00370049_m1; DCDC2 : Hs00393203_m1;KIAA0319 : Hs00207788_m1; HPRT 1 (hypoxanthine phosphoribosyltransferase 1): Hs02800695_m1; CDK1 (cyclin-dependent kinase 1): Hs00938777_m1; TUBA1A (tubulin α1a): Hs00362387_m1; RFX2 : 01100925_m1] or using SYBR green primers for RFX1 , RFX3 , and HPRT1 (10 µM) and the Fast SYBR Green Master Mix (4385612; Applied Biosystems, Foster City, CA, USA).

    Techniques: Functional Assay, Sequencing, Luciferase, Expressing, Plasmid Preparation, Transfection, Construct

    Induction of ciliogenesis in hTERT-RPE1 cells affects the expression levels of DCGs, RFX TF genes, and ciliogenesis/cell-cycle marker genes. hTERT-RPE1 cells were starved for 6, 12, and 24 h to induce ciliogenesis. Fold-change of difference for each time point compared with 0 h is shown for DYX1C1 ( A ), DCDC2 ( B ), KIAA0319 ( C ), RFX1 ( D ), RFX2 ( E ), RFX3 ( F ), TUBA1A (tubulin α1a) ( G ), IFT57 (intraflagellar transport 57) ( H ), and CDK1 (cyclin-dependent kinase 1) ( I ). qRT-PCR data are summarized by using the ΔΔ C t method as displayed as mean fold-change (2 −ΔΔ Ct or −2 ΔΔ Ct ) ± sem .

    Journal: The FASEB Journal

    Article Title: Ciliary dyslexia candidate genes DYX1C1 andDCDC2 are regulated by Regulatory Factor X (RFX) transcription factors through X-box promoter motifs

    doi: 10.1096/fj.201500124RR

    Figure Lengend Snippet: Induction of ciliogenesis in hTERT-RPE1 cells affects the expression levels of DCGs, RFX TF genes, and ciliogenesis/cell-cycle marker genes. hTERT-RPE1 cells were starved for 6, 12, and 24 h to induce ciliogenesis. Fold-change of difference for each time point compared with 0 h is shown for DYX1C1 ( A ), DCDC2 ( B ), KIAA0319 ( C ), RFX1 ( D ), RFX2 ( E ), RFX3 ( F ), TUBA1A (tubulin α1a) ( G ), IFT57 (intraflagellar transport 57) ( H ), and CDK1 (cyclin-dependent kinase 1) ( I ). qRT-PCR data are summarized by using the ΔΔ C t method as displayed as mean fold-change (2 −ΔΔ Ct or −2 ΔΔ Ct ) ± sem .

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was analyzed with cDNA diluted 1:5 using TaqMan expression assays and TaqMan fast Universal PCR Master Mix [4352042; Thermo Fisher Scientific;DYX1C1 : Hs00370049_m1; DCDC2 : Hs00393203_m1;KIAA0319 : Hs00207788_m1; HPRT 1 (hypoxanthine phosphoribosyltransferase 1): Hs02800695_m1; CDK1 (cyclin-dependent kinase 1): Hs00938777_m1; TUBA1A (tubulin α1a): Hs00362387_m1; RFX2 : 01100925_m1] or using SYBR green primers for RFX1 , RFX3 , and HPRT1 (10 µM) and the Fast SYBR Green Master Mix (4385612; Applied Biosystems, Foster City, CA, USA).

    Techniques: Expressing, Marker, Quantitative RT-PCR

    Subcellular localization of endogenous DYX1C1 ( A ) and DCDC2 ( B ) in hTERT-RPE1 cells. hTERT-RPE1 cells were grown to 80% confluence, serum starved for 24 h to induce ciliogenesis, then fixed and stained for DYX1C1, DCDC2, acetylated α-tubulin (cilia marker), or γ-tubulin (centrosome marker). Nuclei are stained with DRAQ5. Scale bars, 20 µm, 2 µm (insets).

    Journal: The FASEB Journal

    Article Title: Ciliary dyslexia candidate genes DYX1C1 andDCDC2 are regulated by Regulatory Factor X (RFX) transcription factors through X-box promoter motifs

    doi: 10.1096/fj.201500124RR

    Figure Lengend Snippet: Subcellular localization of endogenous DYX1C1 ( A ) and DCDC2 ( B ) in hTERT-RPE1 cells. hTERT-RPE1 cells were grown to 80% confluence, serum starved for 24 h to induce ciliogenesis, then fixed and stained for DYX1C1, DCDC2, acetylated α-tubulin (cilia marker), or γ-tubulin (centrosome marker). Nuclei are stained with DRAQ5. Scale bars, 20 µm, 2 µm (insets).

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was analyzed with cDNA diluted 1:5 using TaqMan expression assays and TaqMan fast Universal PCR Master Mix [4352042; Thermo Fisher Scientific;DYX1C1 : Hs00370049_m1; DCDC2 : Hs00393203_m1;KIAA0319 : Hs00207788_m1; HPRT 1 (hypoxanthine phosphoribosyltransferase 1): Hs02800695_m1; CDK1 (cyclin-dependent kinase 1): Hs00938777_m1; TUBA1A (tubulin α1a): Hs00362387_m1; RFX2 : 01100925_m1] or using SYBR green primers for RFX1 , RFX3 , and HPRT1 (10 µM) and the Fast SYBR Green Master Mix (4385612; Applied Biosystems, Foster City, CA, USA).

    Techniques: Staining, Marker

    Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Detection and quantitation of ChPV using the sensitive fast-qPCR based on SYBR ® Green. ChPV = Chicken Parvovirus; BC = Broiler Chickens; LH = Layer Hens; BH = Breeder Hens; CG = Copies of Genome.

    Article Snippet: Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Quantitation Assay, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Journal: Veterinary Sciences

    Article Title: Development of a Sensitive Real-Time Fast-qPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV)

    doi: 10.3390/vetsci5030069

    Figure Lengend Snippet: Sensitive real time fast-real time PCR (qPCR) based on SYBR ® Green for detection and quantification of non-structural (NS) gene of Chicken Parvovirus (ChPV)—( A ) Standard curve using 10-fold serial dilution of NS gene plasmid of ChPV; ( B ) Amplification Plot; ( C ) Melting Curve.

    Article Snippet: Real-Time PCR—qPCR Assay The qPCR reaction used 19 µL of reaction mixture that contained 2X of Fast SYBR® Green Master Mix (Thermo Fisher Scientific), 0.5 µM of each primer, 5 µL of UltraPure DNase/RNase-Free Distilled Water (Thermo Fisher Scientific) and 1 µL of extracted DNA. qPCR amplification was performed in the fast mode under the following conditions: one cycle of 95 °C for 20 s to completely denature the DNA, 40 cycles of 95 °C for 3 s for template denaturation, and 60 °C for 30 s for annealing and extension.

    Techniques: Real-time Polymerase Chain Reaction, SYBR Green Assay, Serial Dilution, Plasmid Preparation, Amplification

    Analysis of the profile of infiltrating immune cells isolated from tumor and non-tumorous adjacent tissue. Immune cells were isolated from tissue blocks collected from selected patients with CRC during surgery via collagen IV digestion and gradient density centrifugation. Total RNA was extracted from the cells and subsequently reverse transcribed to cDNA. Specific primer sets were designed for transcription factors (A) Foxp3, (B) RORC, (C) BCL-6, (D) GATA-3 and (E) Tbx21 representing Treg, Th17, Tfh, Th2 and Th1 cells, respectively. qPCR was performed using the SYBR-Green method with specific primers to quantify the abundance of each subsets of infiltrating immune cells. GAPDH was amplified simultaneously for normalization. Data were analyzed using the 2 −ΔΔCq method and presented as relative values to GAPDH. T cells were isolated from tumor and non-tumorous adjacent tissue of 6 selected patients with CRC using T cell-specific microbeads. qPCR was performed on RNA isolated from T cells for quantification of (F) CXCL9, (G) CXCR3 and (H) CXCL10. Data are presented as the mean ± standard error of mean. Statistical analysis was performed using Student's t-test. *P

    Journal: Oncology Letters

    Article Title: Distinctive profiles of tumor-infiltrating immune cells and association with intensity of infiltration in colorectal cancer

    doi: 10.3892/ol.2018.7771

    Figure Lengend Snippet: Analysis of the profile of infiltrating immune cells isolated from tumor and non-tumorous adjacent tissue. Immune cells were isolated from tissue blocks collected from selected patients with CRC during surgery via collagen IV digestion and gradient density centrifugation. Total RNA was extracted from the cells and subsequently reverse transcribed to cDNA. Specific primer sets were designed for transcription factors (A) Foxp3, (B) RORC, (C) BCL-6, (D) GATA-3 and (E) Tbx21 representing Treg, Th17, Tfh, Th2 and Th1 cells, respectively. qPCR was performed using the SYBR-Green method with specific primers to quantify the abundance of each subsets of infiltrating immune cells. GAPDH was amplified simultaneously for normalization. Data were analyzed using the 2 −ΔΔCq method and presented as relative values to GAPDH. T cells were isolated from tumor and non-tumorous adjacent tissue of 6 selected patients with CRC using T cell-specific microbeads. qPCR was performed on RNA isolated from T cells for quantification of (F) CXCL9, (G) CXCR3 and (H) CXCL10. Data are presented as the mean ± standard error of mean. Statistical analysis was performed using Student's t-test. *P

    Article Snippet: Briefly, PCR was performed using 10 ng cDNA, 500 nM forward and reverse primers, and SYBR Green master mix (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in 20 ml reactions.

    Techniques: Isolation, Centrifugation, Real-time Polymerase Chain Reaction, SYBR Green Assay, Amplification

    Expression of GR in clinical lung adenocarcinoma and cell line models. A lung adenocarcinoma tissue microarray was probed by immunohistochemistry for expression of GR and the expression levels were scored in the malignant cells by intensity of staining as well as percent of cells that stained positive (Panel A). Representative images showing the different intensities of staining for GR are shown (Panel B). Whole cell lysates were extracted from H292, A549, H1299, H1299GR Clone 2 and H1299GR Clone 4 cells and GR expression was visualized by western blot using GAPDH as the loading control (Panel C). RNA was also extracted from the same cell lines and the levels of GR mRNA were measured by real time RT-PCR using TaqMan probes and plotted on a linear scale (Panel D). GR mRNA was measured by quantitative RT-PCR using SYBR Green in a cDNA microarray of clinical lung adenocarcinoma tumors; the relative levels of GR mRNA in H1299 and H1299GR Clone 4 cells were simultaneously measured using SYBR Green and the data plotted on a log scale (dashed lines) (Panel E). Panel D: *P, 0.002; **P, 0.001; ***P, 0.003.

    Journal: Scientific Reports

    Article Title: Chronic p27Kip1 Induction by Dexamethasone Causes Senescence Phenotype and Permanent Cell Cycle Blockade in Lung Adenocarcinoma Cells Over-expressing Glucocorticoid Receptor

    doi: 10.1038/s41598-018-34475-8

    Figure Lengend Snippet: Expression of GR in clinical lung adenocarcinoma and cell line models. A lung adenocarcinoma tissue microarray was probed by immunohistochemistry for expression of GR and the expression levels were scored in the malignant cells by intensity of staining as well as percent of cells that stained positive (Panel A). Representative images showing the different intensities of staining for GR are shown (Panel B). Whole cell lysates were extracted from H292, A549, H1299, H1299GR Clone 2 and H1299GR Clone 4 cells and GR expression was visualized by western blot using GAPDH as the loading control (Panel C). RNA was also extracted from the same cell lines and the levels of GR mRNA were measured by real time RT-PCR using TaqMan probes and plotted on a linear scale (Panel D). GR mRNA was measured by quantitative RT-PCR using SYBR Green in a cDNA microarray of clinical lung adenocarcinoma tumors; the relative levels of GR mRNA in H1299 and H1299GR Clone 4 cells were simultaneously measured using SYBR Green and the data plotted on a log scale (dashed lines) (Panel E). Panel D: *P, 0.002; **P, 0.001; ***P, 0.003.

    Article Snippet: Reverse transcription was performed using 500 ng of total RNA and High-Capacity cDNA Archive kit (Thermo Fisher Scientific), according to the vendor’s protocol. cDNA was measured by quantitative real-time PCR using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) and TaqMan Fast Universal PCR Master Mix (Thermo Fisher Scientific).

    Techniques: Expressing, Microarray, Immunohistochemistry, Staining, Western Blot, Quantitative RT-PCR, SYBR Green Assay