fam tamra labeled probes  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TaqMan TAMRA Probe
    Description:
    Applied Biosystems TaqMan TAMRA probes are dual labeled probes used for real time PCR applications using TaqMan chemistry TaqMan TAMRA Probes feature a 5 fluorescent reporter dye FAM VIC or TET and 3 fluorescent quencher TAMRA dye TaqMan TAMRA probes which were some of the first TaqMan probes to be developed can be used for a variety of applications
    Catalog Number:
    450003
    Price:
    None
    Category:
    Real Time PCR Primers Probes
    Buy from Supplier


    Structured Review

    Thermo Fisher fam tamra labeled probes
    TaqMan TAMRA Probe
    Applied Biosystems TaqMan TAMRA probes are dual labeled probes used for real time PCR applications using TaqMan chemistry TaqMan TAMRA Probes feature a 5 fluorescent reporter dye FAM VIC or TET and 3 fluorescent quencher TAMRA dye TaqMan TAMRA probes which were some of the first TaqMan probes to be developed can be used for a variety of applications
    https://www.bioz.com/result/fam tamra labeled probes/product/Thermo Fisher
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fam tamra labeled probes - by Bioz Stars, 2020-12
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition
    Article Snippet: .. After DNase I treatment, 1 μg of RNA was reverse transcribed with M-MuLV reverse transcriptase from PeqLab, and fragments were amplified with Taq polymerase by using the following primer pairs: hTLR2, 5′-TGTGAACCTCCAGGCTCTG and 5′-GTCCATATTTCCCACTCTCAGG; hTLR4, 5′-ACAGAAGCTGGTGGCTGTG and 5′-TCTTTAAATGCACCTGGTTGG; hTLR9, 5′-GTGCCCCACTTCTCCATG and 5′ GGCACAGTCATGATGTTGTTG; mTLR9, 5′-CCGCAAGACTCTATTTGTGCTGG and 5′-TGTCCCTAGTCAGGGCTGTACTCAG; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5′ACGGATTTGGTCGTATTGGGC and 5′-TTGACGGTGCCATGGAATTTG. cDNA amounts were normalized based on GAPDH amount determined by TaqMAN-PCR (TaqMan probe, 5′-FAM-CCTGGTCACCAGGGCTGCTTT-TAMRA; Applied Biosystems). .. RT-PCR was performed for 30 cycles on normalized cDNA diluted 1:5 for human TLR2, TLR4, TLR9 and murine TLR9 and diluted 1:125 for GAPDH.

    Labeling:

    Article Title: MicroRNA-99a and 100 mediated upregulation of FOXA1 in bladder cancer
    Article Snippet: .. Realtime quantified PCR with 2 μL cDNA, gene specific primers with FAM-TAMRA labeled probes, water and 2x Taqman Universal PCR MasterMix (Applied Biosystems, Warrington, UK) was performed on the ABI 7900HT system according to manufacturers guidelines. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Spatiotemporal distribution of juvenile chum salmon in Otsuchi Bay, Iwate, Japan, inferred from environmental DNA
    Article Snippet: .. For eDNA quantification of juvenile chum salmon, we employed either FAM-TAMRA TaqMan probe or FAM-ZEN-IBFQ probe with the identical sequence and performed qPCR with an ABI 7900HT real-time PCR system (Applied Biosystems, Foster City, CA, USA) in a 10-μL of a total volume containing 1×TaqMan Universal Master Mix II (Applied Biosystems, Foster City, CA, USA), 900 nM of each of forward and reverse primers, 250 nM of fluorescent probe and 2.5 μL of template eDNA. .. The thermal-cycling profile was 50 cycles of denaturation at 95°C for 15 sec, annealing and extension at 60°C for 1 min, preceded by an activation step at 50°C for 2 min and a denaturation step at 95°C for 10 min.

    Article Title: α6 SUBUNIT-CONTAINING NICOTINIC RECEPTORS MEDIATE LOW-DOSE ETHANOL EFFECTS ON VENTRAL TEGMENTAL AREA NEURONS AND ETHANOL REWARD
    Article Snippet: .. Real-Time quantitative PCR (qRTPCR) using gene specific primers with FAM-TAMRA TaqMan® probes (Applied Biosystems) for the nAChR subunits α4, β2, and α6, as well as TH and 18s rRNA was performed using the iQ Supermix (Bio-Rad) with a CFX-96 Real-Time System (Bio-Rad). ..

    Sequencing:

    Article Title: Spatiotemporal distribution of juvenile chum salmon in Otsuchi Bay, Iwate, Japan, inferred from environmental DNA
    Article Snippet: .. For eDNA quantification of juvenile chum salmon, we employed either FAM-TAMRA TaqMan probe or FAM-ZEN-IBFQ probe with the identical sequence and performed qPCR with an ABI 7900HT real-time PCR system (Applied Biosystems, Foster City, CA, USA) in a 10-μL of a total volume containing 1×TaqMan Universal Master Mix II (Applied Biosystems, Foster City, CA, USA), 900 nM of each of forward and reverse primers, 250 nM of fluorescent probe and 2.5 μL of template eDNA. .. The thermal-cycling profile was 50 cycles of denaturation at 95°C for 15 sec, annealing and extension at 60°C for 1 min, preceded by an activation step at 50°C for 2 min and a denaturation step at 95°C for 10 min.

    other:

    Article Title: G9a methyltransferase governs cell identity in the lung and is required for KRAS G12D tumor development and propagation
    Article Snippet: All Taqman Assays used in the study are described in Table1.

    Article Title: Genome-wide molecular effects of the neuropsychiatric 16p11 CNVs in an iPSC-to-iN neuronal model
    Article Snippet: Three different TaqMan assays were used, one was located within the CNV region (location chr16:29901542, Cat. ID Hs02040751_cn) and two other assays (location chr16:29228600, Cat. ID Hs05451406_cn; location chr16:30389709, Cat. ID Hs05421015_cn) each located on either side of the CNV boundaries.

    Polymerase Chain Reaction:

    Article Title: MicroRNA-99a and 100 mediated upregulation of FOXA1 in bladder cancer
    Article Snippet: .. Realtime quantified PCR with 2 μL cDNA, gene specific primers with FAM-TAMRA labeled probes, water and 2x Taqman Universal PCR MasterMix (Applied Biosystems, Warrington, UK) was performed on the ABI 7900HT system according to manufacturers guidelines. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Thermo Fisher gene exp agrp mm00475829 g1
    Fasting-Induced Depolarization and Firing Rates in <t>AgRP</t> Neurons – Dependence on NMDARs
    Gene Exp Agrp Mm00475829 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp agrp mm00475829 g1/product/Thermo Fisher
    Average 96 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    gene exp agrp mm00475829 g1 - by Bioz Stars, 2020-12
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher dual labeled internal fluorogenic fam tamra probe sets
    Fasting-Induced Depolarization and Firing Rates in <t>AgRP</t> Neurons – Dependence on NMDARs
    Dual Labeled Internal Fluorogenic Fam Tamra Probe Sets, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dual labeled internal fluorogenic fam tamra probe sets/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dual labeled internal fluorogenic fam tamra probe sets - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher dual labeled internal fluorogenic fam tamra probe
    Fasting-Induced Depolarization and Firing Rates in <t>AgRP</t> Neurons – Dependence on NMDARs
    Dual Labeled Internal Fluorogenic Fam Tamra Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dual labeled internal fluorogenic fam tamra probe/product/Thermo Fisher
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    dual labeled internal fluorogenic fam tamra probe - by Bioz Stars, 2020-12
    92/100 stars
      Buy from Supplier

    Image Search Results


    Fasting-Induced Depolarization and Firing Rates in AgRP Neurons – Dependence on NMDARs

    Journal: Neuron

    Article Title: Fasting Activation of AgRP Neurons Requires NMDA Receptors and Involves Spinogenesis and Increased Excitatory Tone

    doi: 10.1016/j.neuron.2011.11.027

    Figure Lengend Snippet: Fasting-Induced Depolarization and Firing Rates in AgRP Neurons – Dependence on NMDARs

    Article Snippet: Agrp , Npy and Pomc were amplified from 0.5ng of reverse-transcribed total RNA using Taqman Universal PCR Mastermix (Applied Biosystems) with Agrp , Npy and Pomc sense and antisense primers, and a dual-labeled probe (5′-FAM, 3′-TAMRA) (Applied Biosystems; assay on demand Mm00475829_g1, Mm00445771_m1, Mm00435874_m1, respectively).

    Techniques:

    Dendritic Spines on AgRP and POMC neurons

    Journal: Neuron

    Article Title: Fasting Activation of AgRP Neurons Requires NMDA Receptors and Involves Spinogenesis and Increased Excitatory Tone

    doi: 10.1016/j.neuron.2011.11.027

    Figure Lengend Snippet: Dendritic Spines on AgRP and POMC neurons

    Article Snippet: Agrp , Npy and Pomc were amplified from 0.5ng of reverse-transcribed total RNA using Taqman Universal PCR Mastermix (Applied Biosystems) with Agrp , Npy and Pomc sense and antisense primers, and a dual-labeled probe (5′-FAM, 3′-TAMRA) (Applied Biosystems; assay on demand Mm00475829_g1, Mm00445771_m1, Mm00435874_m1, respectively).

    Techniques:

    Fasting-Induced Increases in c-Fos protein and Neuropeptide mRNAs in AgRP Neurons – Dependence on NMDARs

    Journal: Neuron

    Article Title: Fasting Activation of AgRP Neurons Requires NMDA Receptors and Involves Spinogenesis and Increased Excitatory Tone

    doi: 10.1016/j.neuron.2011.11.027

    Figure Lengend Snippet: Fasting-Induced Increases in c-Fos protein and Neuropeptide mRNAs in AgRP Neurons – Dependence on NMDARs

    Article Snippet: Agrp , Npy and Pomc were amplified from 0.5ng of reverse-transcribed total RNA using Taqman Universal PCR Mastermix (Applied Biosystems) with Agrp , Npy and Pomc sense and antisense primers, and a dual-labeled probe (5′-FAM, 3′-TAMRA) (Applied Biosystems; assay on demand Mm00475829_g1, Mm00445771_m1, Mm00435874_m1, respectively).

    Techniques:

    Fasting-Induced AMPAR-Mediated EPSCs in AgRP Neurons – Dependence on NMDARs

    Journal: Neuron

    Article Title: Fasting Activation of AgRP Neurons Requires NMDA Receptors and Involves Spinogenesis and Increased Excitatory Tone

    doi: 10.1016/j.neuron.2011.11.027

    Figure Lengend Snippet: Fasting-Induced AMPAR-Mediated EPSCs in AgRP Neurons – Dependence on NMDARs

    Article Snippet: Agrp , Npy and Pomc were amplified from 0.5ng of reverse-transcribed total RNA using Taqman Universal PCR Mastermix (Applied Biosystems) with Agrp , Npy and Pomc sense and antisense primers, and a dual-labeled probe (5′-FAM, 3′-TAMRA) (Applied Biosystems; assay on demand Mm00475829_g1, Mm00445771_m1, Mm00435874_m1, respectively).

    Techniques: