fam labeled primer probes  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Thermo Fisher fam labeled primer probes
    Fam Labeled Primer Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled primer probes/product/Thermo Fisher
    Average 97 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    fam labeled primer probes - by Bioz Stars, 2020-12
    97/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Therapeutic vaccination with a trivalent T-cell receptor (TCR) peptide vaccine restores deficient FoxP3 expression and TCR recognition in subjects with multiple sclerosis
    Article Snippet: .. TaqMan Universal PCR Master Mix, and both the FoxP3 primer/probe (part #Hs00203958_m1) and the HPRT1 primer/probe sets (part #4333768F) were purchased directly from Applied Biosystems. ..

    Article Title: Phase 1 trial of IL-15 trans presentation blockade using humanized Mik-Beta-1 mAb in patients with T-cell large granular lymphocytic leukemia
    Article Snippet: .. The TaqMan Universal PCR Master Mix, human IL-2 (Hs99999150_mH), human IL-15 (Hs99999039_ml), and human HPRT1 (catalog number 4333768T) primer probes were from Applied Biosystems. .. The detection of human IL-2, IL-15, and HPRT1 was performed using an ABI Prism 7700 Sequence Detection System (Applied Biosystems) according to the manufacturer's instructions.

    Expressing:

    Article Title: Chimeric Antigen Receptor Modified T cells That Target Chemokine Receptor CCR4 as a Therapeutic Modality for T-cell Malignancies
    Article Snippet: .. The TaqMan Gene Expression Master Mix, the human CCR4 primer/probe (Assay ID: Hs00747615_s1) and the HPRT1 primer/probe (Cat. # 4333768F) were purchased from Life Technologies (Foster City, CA). .. Relative quantitation of human CCR4 and HPRT1 were performed using an ABI7500 Real Time Sequence Detection System (Life Technologies) according to the manufacturer's instructions.

    Amplification:

    Article Title: Indole and synthetic derivative activate chaperone expression to reduce polyQ aggregation in SCA17 neuronal cell and slice culture models
    Article Snippet: .. Gene-specific TaqMan fluorogenic probes Hs00920494_ml for TBP and 4326321E for HPRT1 (endogenous control) (Applied Biosystems) and 20 ng cDNA were added to the amplification reaction. ..

    other:

    Article Title: The phenotype of polycythemia due to Croatian homozygous VHL (571C > G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C > T:R200W)
    Article Snippet: Data were normalized to HPRT (4333768F) and GAPDH (4333764F) reference genes.

    Quantitative RT-PCR:

    Article Title: Downregulation of ORP3 Correlates with Reduced Survival of Colon Cancer Patients with Advanced Nodal Metastasis and of Female Patients with Grade 3 Colon Cancer
    Article Snippet: .. Determination of ORP3 mRNA Levels by RT-qPCR in Matched Normal and Tumor Tissue of 44 Colon Cancer Patients Following primer pairs were used to quantify ORP3 and HPRT1, respectively: ORP3-F: 5′-GTCATCCGCCCTAGCACAAAA and ORP3-R: 5′-AGAGACTCGGCATGGATTCTG; HPRT1-F: 5′- TGAGGATTTGGAAAGGGTGT and HPRT1-R: 5′- GAGCACACAGAGGGCTACAA. .. Quantitative PCR (qPCR) was performed using the iQ SYBRgreen super mix (Bio-Rad; 170–8880) by Applied Biosystem 7300 real-time PCR system.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Thermo Fisher gene exp camp hs00189038 m1
    Comparison of iSS-predicted effects of 25OHD or 1,25(OH) 2 D on monocyte expression of <t>CAMP</t> with observed in vitro responses of monocytes to treatment with these metabolites. Adherent human monocytes were incubated for 6 hrs in media containing 5% serum with doses of (A) 25OHD (1–300 nM) and (B) 1,25(OH) 2 D (0.1–6 nM). The experimental data is indicated by blue dots and error bars (± SD). Black lines indicate data predicted by the iSS mathematical model assuming basal levels of VDR and CYP27B1 (i.e. no activation). For the purpose of this modeling, DBP was represented by the GC1F/1F allelic combination.
    Gene Exp Camp Hs00189038 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp camp hs00189038 m1/product/Thermo Fisher
    Average 96 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    gene exp camp hs00189038 m1 - by Bioz Stars, 2020-12
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher gene exp irf7 mm00516788 m1
    Gene and protein expression of plasma membrane and intracellular localized TLRs and of the IFN regulatory factors <t>IRF3</t> and <t>IRF7</t> in murine and human cardiac tissue under basal conditions. Cardiac tissue of healthy C57BL/6J wildtype mice was used for TaqMan based gene expression analysis of various TLRs and their IFN regulatory factors Irf3 and Irf7 under basal conditions. Gene expressions of Tlr4 , Tlr9 , Irf3 and Irf7 were highly expressed when compared to the remaining TLRs under basal conditions in murine cardiac tissue. The highest gene expression under basal condition was detected for Irf7 . In addition, we detected similar human protein expression patterns when compared with murine gene expression in cardiac tissue under basal conditions. Data are presented in box plots as absolute mRNA expression normalized to the house keeping gene Cdkn1b and human protein abundance are presented as rhombus sign on the right-hand of each mRNA expression.
    Gene Exp Irf7 Mm00516788 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp irf7 mm00516788 m1/product/Thermo Fisher
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    gene exp irf7 mm00516788 m1 - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher gene exp esr1 hs00174860 m1
    Cells were transiently transfected for 24 h with 3x ERE-luc and phRL-TK Renilla internal control plasmid together with either pDsRed-express-C1 (empty vector control), <t>pDsRed-wt-ESR1</t> or pDsRed-Δ7-ESR1. Following transfection, cells were incubated for 24 h in the absence or presence of the indicated concentrations of 17β-estradiol ( A ) or 50 pM of 17β-estradiol ( B ). Values are mean +SEM averaged from n = 6 replicate cultures and presented as luciferase activity relative to the empty vector construct of the vehicle-treated control condition (*** P
    Gene Exp Esr1 Hs00174860 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp esr1 hs00174860 m1/product/Thermo Fisher
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    gene exp esr1 hs00174860 m1 - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of iSS-predicted effects of 25OHD or 1,25(OH) 2 D on monocyte expression of CAMP with observed in vitro responses of monocytes to treatment with these metabolites. Adherent human monocytes were incubated for 6 hrs in media containing 5% serum with doses of (A) 25OHD (1–300 nM) and (B) 1,25(OH) 2 D (0.1–6 nM). The experimental data is indicated by blue dots and error bars (± SD). Black lines indicate data predicted by the iSS mathematical model assuming basal levels of VDR and CYP27B1 (i.e. no activation). For the purpose of this modeling, DBP was represented by the GC1F/1F allelic combination.

    Journal: PLoS ONE

    Article Title: Vitamin D Binding Protein and Monocyte Response to 25-Hydroxyvitamin D and 1,25-Dihydroxyvitamin D: Analysis by Mathematical Modeling

    doi: 10.1371/journal.pone.0030773

    Figure Lengend Snippet: Comparison of iSS-predicted effects of 25OHD or 1,25(OH) 2 D on monocyte expression of CAMP with observed in vitro responses of monocytes to treatment with these metabolites. Adherent human monocytes were incubated for 6 hrs in media containing 5% serum with doses of (A) 25OHD (1–300 nM) and (B) 1,25(OH) 2 D (0.1–6 nM). The experimental data is indicated by blue dots and error bars (± SD). Black lines indicate data predicted by the iSS mathematical model assuming basal levels of VDR and CYP27B1 (i.e. no activation). For the purpose of this modeling, DBP was represented by the GC1F/1F allelic combination.

    Article Snippet: Specifically, we utilized FAM-labeled TaqMan Gene Expression Assay probe/primer Hs00189038_m1 (CAMP) in conjunction with VIC/MGB Probe/Primer Eukaryotic 18S rRNA Endogenous Control (part number 4319413E) as the internal calibrator.

    Techniques: Expressing, In Vitro, Incubation, Activation Assay

    Schematic framework of parameters used to produce extracellular steady state (eSS) and intracellular (iSS) mathematical models for vitamin D metabolism and function. Free 25OHD and 1,25(OH) 2 D interacting with extra-cellular vitamin D binding protein (DBP) or albumin indicated in black text and arrows (eSS model). Intra-cellular interactions involving the vitamin D-activating enzyme (CYP27B1), the vitamin D receptor (VDR) and transcriptional induction of the antibacterial protein CAMP via interaction between VDR and the CAMP gene promoter (CAMP-DNA) indicated by grey text and arrows (iSS model).

    Journal: PLoS ONE

    Article Title: Vitamin D Binding Protein and Monocyte Response to 25-Hydroxyvitamin D and 1,25-Dihydroxyvitamin D: Analysis by Mathematical Modeling

    doi: 10.1371/journal.pone.0030773

    Figure Lengend Snippet: Schematic framework of parameters used to produce extracellular steady state (eSS) and intracellular (iSS) mathematical models for vitamin D metabolism and function. Free 25OHD and 1,25(OH) 2 D interacting with extra-cellular vitamin D binding protein (DBP) or albumin indicated in black text and arrows (eSS model). Intra-cellular interactions involving the vitamin D-activating enzyme (CYP27B1), the vitamin D receptor (VDR) and transcriptional induction of the antibacterial protein CAMP via interaction between VDR and the CAMP gene promoter (CAMP-DNA) indicated by grey text and arrows (iSS model).

    Article Snippet: Specifically, we utilized FAM-labeled TaqMan Gene Expression Assay probe/primer Hs00189038_m1 (CAMP) in conjunction with VIC/MGB Probe/Primer Eukaryotic 18S rRNA Endogenous Control (part number 4319413E) as the internal calibrator.

    Techniques: Binding Assay

    Gene and protein expression of plasma membrane and intracellular localized TLRs and of the IFN regulatory factors IRF3 and IRF7 in murine and human cardiac tissue under basal conditions. Cardiac tissue of healthy C57BL/6J wildtype mice was used for TaqMan based gene expression analysis of various TLRs and their IFN regulatory factors Irf3 and Irf7 under basal conditions. Gene expressions of Tlr4 , Tlr9 , Irf3 and Irf7 were highly expressed when compared to the remaining TLRs under basal conditions in murine cardiac tissue. The highest gene expression under basal condition was detected for Irf7 . In addition, we detected similar human protein expression patterns when compared with murine gene expression in cardiac tissue under basal conditions. Data are presented in box plots as absolute mRNA expression normalized to the house keeping gene Cdkn1b and human protein abundance are presented as rhombus sign on the right-hand of each mRNA expression.

    Journal: PLoS ONE

    Article Title: Role of Toll-like receptors and interferon regulatory factors in different experimental heart failure models of diverse etiology: IRF7 as novel cardiovascular stress-inducible factor

    doi: 10.1371/journal.pone.0193844

    Figure Lengend Snippet: Gene and protein expression of plasma membrane and intracellular localized TLRs and of the IFN regulatory factors IRF3 and IRF7 in murine and human cardiac tissue under basal conditions. Cardiac tissue of healthy C57BL/6J wildtype mice was used for TaqMan based gene expression analysis of various TLRs and their IFN regulatory factors Irf3 and Irf7 under basal conditions. Gene expressions of Tlr4 , Tlr9 , Irf3 and Irf7 were highly expressed when compared to the remaining TLRs under basal conditions in murine cardiac tissue. The highest gene expression under basal condition was detected for Irf7 . In addition, we detected similar human protein expression patterns when compared with murine gene expression in cardiac tissue under basal conditions. Data are presented in box plots as absolute mRNA expression normalized to the house keeping gene Cdkn1b and human protein abundance are presented as rhombus sign on the right-hand of each mRNA expression.

    Article Snippet: To assess the mRNA expression of the target genes real time PCR was performed using 5 μl of the gene expression master mix (life technologies) and the 0.5 μl of the gene expression assay for Tlr1 (Mm00446095_m1), Tlr2 (Mm00442346_m1), Tlr3 (Mm01207404_m1), Tlr4 (Mm00445273_m1), Tlr5 (Mm00546288_m1), Tlr6 (Mm02529782_s1), Tlr7 (Mm00446917_m1), Tlr8 (Mm04209873_m1), Tlr9 (mM00446193_m1), Irf3 (Mm00516784_m1), and Irf7 (Mm00516788_m1) (each includes forward and reverse primers as well the fluorescently FAM-labeled probe).

    Techniques: Expressing, Mouse Assay

    Gene expression levels of the IFN regulatory factors Irf3 and Irf7 in different HF models of diverse etiology. Cardiac tissue of healthy and diseased C57BL/6J mice was used for TaqMan based gene expression analysis of the IFN regulatory factors Irf3 and Irf7 . Expression levels of cardiac tissue from control mice are shown as white boxes, from diseased animals as red, blue, green or yellow boxes corresponding to the analyzed heart failure model. In viral-induced myocarditis (shown in red), gene expression of Irf7 showed by far the highest increase 7 days after infection compared to healthy controls. However, Irf3 displayed no changes in gene expression during viral myocarditis. Moreover, in the model of myocardial infarction (shown in blue), gene expression of Irf3 and Irf7 was highly increased 5 days post infarction in the scar tissue when compared to the non-infarcted LV or sham, whereas Irf7 showed a clearly higher gene expression when compared to the expression of Irf3 . In STZ-induced diabetic cardiomyopathy (shown in green), an opposite effect on gene expression of Irf3 and Irf7 was observed. Whereas, Irf3 showed a decreased gene expression, Irf7 displayed an increased gene expression under diabetic conditions. However, in the heart failure model caused by chronic AngII-infusion for 21 days (shown in yellow), no differences in gene expression of Irf3 and Irf7 were detected. Data are presented in box plots as relative mRNA expression in fold change to the corresponding untreated control using the formula 2 −ΔΔCt . * = significantly different compared to corresponding control; # = significantly different compared to VM (acute—7 days) or RZ (remote zone).

    Journal: PLoS ONE

    Article Title: Role of Toll-like receptors and interferon regulatory factors in different experimental heart failure models of diverse etiology: IRF7 as novel cardiovascular stress-inducible factor

    doi: 10.1371/journal.pone.0193844

    Figure Lengend Snippet: Gene expression levels of the IFN regulatory factors Irf3 and Irf7 in different HF models of diverse etiology. Cardiac tissue of healthy and diseased C57BL/6J mice was used for TaqMan based gene expression analysis of the IFN regulatory factors Irf3 and Irf7 . Expression levels of cardiac tissue from control mice are shown as white boxes, from diseased animals as red, blue, green or yellow boxes corresponding to the analyzed heart failure model. In viral-induced myocarditis (shown in red), gene expression of Irf7 showed by far the highest increase 7 days after infection compared to healthy controls. However, Irf3 displayed no changes in gene expression during viral myocarditis. Moreover, in the model of myocardial infarction (shown in blue), gene expression of Irf3 and Irf7 was highly increased 5 days post infarction in the scar tissue when compared to the non-infarcted LV or sham, whereas Irf7 showed a clearly higher gene expression when compared to the expression of Irf3 . In STZ-induced diabetic cardiomyopathy (shown in green), an opposite effect on gene expression of Irf3 and Irf7 was observed. Whereas, Irf3 showed a decreased gene expression, Irf7 displayed an increased gene expression under diabetic conditions. However, in the heart failure model caused by chronic AngII-infusion for 21 days (shown in yellow), no differences in gene expression of Irf3 and Irf7 were detected. Data are presented in box plots as relative mRNA expression in fold change to the corresponding untreated control using the formula 2 −ΔΔCt . * = significantly different compared to corresponding control; # = significantly different compared to VM (acute—7 days) or RZ (remote zone).

    Article Snippet: To assess the mRNA expression of the target genes real time PCR was performed using 5 μl of the gene expression master mix (life technologies) and the 0.5 μl of the gene expression assay for Tlr1 (Mm00446095_m1), Tlr2 (Mm00442346_m1), Tlr3 (Mm01207404_m1), Tlr4 (Mm00445273_m1), Tlr5 (Mm00546288_m1), Tlr6 (Mm02529782_s1), Tlr7 (Mm00446917_m1), Tlr8 (Mm04209873_m1), Tlr9 (mM00446193_m1), Irf3 (Mm00516784_m1), and Irf7 (Mm00516788_m1) (each includes forward and reverse primers as well the fluorescently FAM-labeled probe).

    Techniques: Expressing, Mouse Assay, Infection

    Gene and protein expression of plasma membrane and intracellular localized TLRs and of the IFN regulatory factors IRF3 and IRF7 in murine and human cardiac tissue under basal conditions. Cardiac tissue of healthy C57BL/6J wildtype mice was used for TaqMan based gene expression analysis of various TLRs and their IFN regulatory factors Irf3 and Irf7 under basal conditions. Gene expressions of Tlr4 , Tlr9 , Irf3 and Irf7 were highly expressed when compared to the remaining TLRs under basal conditions in murine cardiac tissue. The highest gene expression under basal condition was detected for Irf7 . In addition, we detected similar human protein expression patterns when compared with murine gene expression in cardiac tissue under basal conditions. Data are presented in box plots as absolute mRNA expression normalized to the house keeping gene Cdkn1b and human protein abundance are presented as rhombus sign on the right-hand of each mRNA expression.

    Journal: PLoS ONE

    Article Title: Role of Toll-like receptors and interferon regulatory factors in different experimental heart failure models of diverse etiology: IRF7 as novel cardiovascular stress-inducible factor

    doi: 10.1371/journal.pone.0193844

    Figure Lengend Snippet: Gene and protein expression of plasma membrane and intracellular localized TLRs and of the IFN regulatory factors IRF3 and IRF7 in murine and human cardiac tissue under basal conditions. Cardiac tissue of healthy C57BL/6J wildtype mice was used for TaqMan based gene expression analysis of various TLRs and their IFN regulatory factors Irf3 and Irf7 under basal conditions. Gene expressions of Tlr4 , Tlr9 , Irf3 and Irf7 were highly expressed when compared to the remaining TLRs under basal conditions in murine cardiac tissue. The highest gene expression under basal condition was detected for Irf7 . In addition, we detected similar human protein expression patterns when compared with murine gene expression in cardiac tissue under basal conditions. Data are presented in box plots as absolute mRNA expression normalized to the house keeping gene Cdkn1b and human protein abundance are presented as rhombus sign on the right-hand of each mRNA expression.

    Article Snippet: To assess the mRNA expression of the target genes real time PCR was performed using 5 μl of the gene expression master mix (life technologies) and the 0.5 μl of the gene expression assay for Tlr1 (Mm00446095_m1), Tlr2 (Mm00442346_m1), Tlr3 (Mm01207404_m1), Tlr4 (Mm00445273_m1), Tlr5 (Mm00546288_m1), Tlr6 (Mm02529782_s1), Tlr7 (Mm00446917_m1), Tlr8 (Mm04209873_m1), Tlr9 (mM00446193_m1), Irf3 (Mm00516784_m1), and Irf7 (Mm00516788_m1) (each includes forward and reverse primers as well the fluorescently FAM-labeled probe).

    Techniques: Expressing, Mouse Assay

    Gene expression levels of the IFN regulatory factors Irf3 and Irf7 in different HF models of diverse etiology. Cardiac tissue of healthy and diseased C57BL/6J mice was used for TaqMan based gene expression analysis of the IFN regulatory factors Irf3 and Irf7 . Expression levels of cardiac tissue from control mice are shown as white boxes, from diseased animals as red, blue, green or yellow boxes corresponding to the analyzed heart failure model. In viral-induced myocarditis (shown in red), gene expression of Irf7 showed by far the highest increase 7 days after infection compared to healthy controls. However, Irf3 displayed no changes in gene expression during viral myocarditis. Moreover, in the model of myocardial infarction (shown in blue), gene expression of Irf3 and Irf7 was highly increased 5 days post infarction in the scar tissue when compared to the non-infarcted LV or sham, whereas Irf7 showed a clearly higher gene expression when compared to the expression of Irf3 . In STZ-induced diabetic cardiomyopathy (shown in green), an opposite effect on gene expression of Irf3 and Irf7 was observed. Whereas, Irf3 showed a decreased gene expression, Irf7 displayed an increased gene expression under diabetic conditions. However, in the heart failure model caused by chronic AngII-infusion for 21 days (shown in yellow), no differences in gene expression of Irf3 and Irf7 were detected. Data are presented in box plots as relative mRNA expression in fold change to the corresponding untreated control using the formula 2 −ΔΔCt . * = significantly different compared to corresponding control; # = significantly different compared to VM (acute—7 days) or RZ (remote zone).

    Journal: PLoS ONE

    Article Title: Role of Toll-like receptors and interferon regulatory factors in different experimental heart failure models of diverse etiology: IRF7 as novel cardiovascular stress-inducible factor

    doi: 10.1371/journal.pone.0193844

    Figure Lengend Snippet: Gene expression levels of the IFN regulatory factors Irf3 and Irf7 in different HF models of diverse etiology. Cardiac tissue of healthy and diseased C57BL/6J mice was used for TaqMan based gene expression analysis of the IFN regulatory factors Irf3 and Irf7 . Expression levels of cardiac tissue from control mice are shown as white boxes, from diseased animals as red, blue, green or yellow boxes corresponding to the analyzed heart failure model. In viral-induced myocarditis (shown in red), gene expression of Irf7 showed by far the highest increase 7 days after infection compared to healthy controls. However, Irf3 displayed no changes in gene expression during viral myocarditis. Moreover, in the model of myocardial infarction (shown in blue), gene expression of Irf3 and Irf7 was highly increased 5 days post infarction in the scar tissue when compared to the non-infarcted LV or sham, whereas Irf7 showed a clearly higher gene expression when compared to the expression of Irf3 . In STZ-induced diabetic cardiomyopathy (shown in green), an opposite effect on gene expression of Irf3 and Irf7 was observed. Whereas, Irf3 showed a decreased gene expression, Irf7 displayed an increased gene expression under diabetic conditions. However, in the heart failure model caused by chronic AngII-infusion for 21 days (shown in yellow), no differences in gene expression of Irf3 and Irf7 were detected. Data are presented in box plots as relative mRNA expression in fold change to the corresponding untreated control using the formula 2 −ΔΔCt . * = significantly different compared to corresponding control; # = significantly different compared to VM (acute—7 days) or RZ (remote zone).

    Article Snippet: To assess the mRNA expression of the target genes real time PCR was performed using 5 μl of the gene expression master mix (life technologies) and the 0.5 μl of the gene expression assay for Tlr1 (Mm00446095_m1), Tlr2 (Mm00442346_m1), Tlr3 (Mm01207404_m1), Tlr4 (Mm00445273_m1), Tlr5 (Mm00546288_m1), Tlr6 (Mm02529782_s1), Tlr7 (Mm00446917_m1), Tlr8 (Mm04209873_m1), Tlr9 (mM00446193_m1), Irf3 (Mm00516784_m1), and Irf7 (Mm00516788_m1) (each includes forward and reverse primers as well the fluorescently FAM-labeled probe).

    Techniques: Expressing, Mouse Assay, Infection

    Cells were transiently transfected for 24 h with 3x ERE-luc and phRL-TK Renilla internal control plasmid together with either pDsRed-express-C1 (empty vector control), pDsRed-wt-ESR1 or pDsRed-Δ7-ESR1. Following transfection, cells were incubated for 24 h in the absence or presence of the indicated concentrations of 17β-estradiol ( A ) or 50 pM of 17β-estradiol ( B ). Values are mean +SEM averaged from n = 6 replicate cultures and presented as luciferase activity relative to the empty vector construct of the vehicle-treated control condition (*** P

    Journal: Human Molecular Genetics

    Article Title: Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia

    doi: 10.1093/hmg/ddn130

    Figure Lengend Snippet: Cells were transiently transfected for 24 h with 3x ERE-luc and phRL-TK Renilla internal control plasmid together with either pDsRed-express-C1 (empty vector control), pDsRed-wt-ESR1 or pDsRed-Δ7-ESR1. Following transfection, cells were incubated for 24 h in the absence or presence of the indicated concentrations of 17β-estradiol ( A ) or 50 pM of 17β-estradiol ( B ). Values are mean +SEM averaged from n = 6 replicate cultures and presented as luciferase activity relative to the empty vector construct of the vehicle-treated control condition (*** P

    Article Snippet: Each qPCR reaction contained 3 µl cDNA template (corresponding to 90 ng cDNA), 5 µl Master Mix (Eurogentec, California), 0.5 µl 20X assay-on demand mix containing forward and reverse primers and FAM™ dye-labeled TaqMan® MGB probe (Hs00174860_m1) and 1.5 µl H2 O.

    Techniques: Transfection, Plasmid Preparation, Incubation, Luciferase, Activity Assay, Construct

    ( A ) The PCR products produced after nested PCR for ESR1 from cDNA derived from the DLPFC of patients with schizophrenia. Note that the samples are migrating on a slight downward diagonal. Lane 1 contains the 100 bp DNA ladder (L). The bright band in the first three sample lanes (lanes 2–4) and the last 2 lanes (15 and 16) corresponds to the expected 1380 bp amplicon (horizontal arrow). This ∼1.4 band would be predicted if all 8 coding exons were present in the ESR1 transcript (wild-type). Many bands with smaller than the predicted sizes are found in the range of 1 to 1.3 kb and can occur in different individuals (for example, compare lanes 4 to lane 5) or within the same individual (lanes 7, 8, 11, 13 and 14). The exact identities of these bands could not be definitively identified at this stage (see Materials and Methods). Note that in lanes 5, 6, 7 and 10 no wild-type bands are detected. In the 12th lane, a larger than predicted amplicon was observed (vertical arrow, 1493 bp). In panel B, the 1493 bp ESR1 transcript was confirmed to be about 100 bp longer by a separate PCR directly targeting ESR1 exons 4 and 5 in normal individuals (N) and in the patient with schizophrenia with this genomic insertion (S).

    Journal: Human Molecular Genetics

    Article Title: Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia

    doi: 10.1093/hmg/ddn130

    Figure Lengend Snippet: ( A ) The PCR products produced after nested PCR for ESR1 from cDNA derived from the DLPFC of patients with schizophrenia. Note that the samples are migrating on a slight downward diagonal. Lane 1 contains the 100 bp DNA ladder (L). The bright band in the first three sample lanes (lanes 2–4) and the last 2 lanes (15 and 16) corresponds to the expected 1380 bp amplicon (horizontal arrow). This ∼1.4 band would be predicted if all 8 coding exons were present in the ESR1 transcript (wild-type). Many bands with smaller than the predicted sizes are found in the range of 1 to 1.3 kb and can occur in different individuals (for example, compare lanes 4 to lane 5) or within the same individual (lanes 7, 8, 11, 13 and 14). The exact identities of these bands could not be definitively identified at this stage (see Materials and Methods). Note that in lanes 5, 6, 7 and 10 no wild-type bands are detected. In the 12th lane, a larger than predicted amplicon was observed (vertical arrow, 1493 bp). In panel B, the 1493 bp ESR1 transcript was confirmed to be about 100 bp longer by a separate PCR directly targeting ESR1 exons 4 and 5 in normal individuals (N) and in the patient with schizophrenia with this genomic insertion (S).

    Article Snippet: Each qPCR reaction contained 3 µl cDNA template (corresponding to 90 ng cDNA), 5 µl Master Mix (Eurogentec, California), 0.5 µl 20X assay-on demand mix containing forward and reverse primers and FAM™ dye-labeled TaqMan® MGB probe (Hs00174860_m1) and 1.5 µl H2 O.

    Techniques: Polymerase Chain Reaction, Produced, Nested PCR, Derivative Assay, Amplification

    A schematic figure shows the general location of ESR1 common SNPs (arrows) used in association analyses. Gray horizontal bars indicate the regions of the ESR1 gene that were re-sequenced. The eight coding exons and the insertion are indicated by thin black vertical lines. ESR1 introns are shown as open horizontal bars (note thy can be grey or white). Numbers at the bottom correspond to exons and letters represent the different alternative start sites of transcription (indicated on gene with flags). Lines connecting exons C and B to exon 1 represent some of the alternative splicing. Other alternative 5′-UTR exons upstream of exon D are not shown.

    Journal: Human Molecular Genetics

    Article Title: Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia

    doi: 10.1093/hmg/ddn130

    Figure Lengend Snippet: A schematic figure shows the general location of ESR1 common SNPs (arrows) used in association analyses. Gray horizontal bars indicate the regions of the ESR1 gene that were re-sequenced. The eight coding exons and the insertion are indicated by thin black vertical lines. ESR1 introns are shown as open horizontal bars (note thy can be grey or white). Numbers at the bottom correspond to exons and letters represent the different alternative start sites of transcription (indicated on gene with flags). Lines connecting exons C and B to exon 1 represent some of the alternative splicing. Other alternative 5′-UTR exons upstream of exon D are not shown.

    Article Snippet: Each qPCR reaction contained 3 µl cDNA template (corresponding to 90 ng cDNA), 5 µl Master Mix (Eurogentec, California), 0.5 µl 20X assay-on demand mix containing forward and reverse primers and FAM™ dye-labeled TaqMan® MGB probe (Hs00174860_m1) and 1.5 µl H2 O.

    Techniques:

    Schematic representations of the variation in transcription factor binding sites (TFBS) for the two promoter haplotypes of ESR1 are diagrammed. The top represents the common haplotype for C4, C5, C10 and C11 (1, 2, 1, 1, 1) that is not associated with the risk for schizophrenia. The bottom schematic shows the haplotype associated with risk (2, 1, 2, 2, 2). Ovals represent transcription factor binding to either the sense (upper) or antisense (lower) ESR1 DNA strand. Note the loss of a predicted biding of a transcription factor sites at C4, C5 and C11 and a gain of transcription factor binding site at C10 and Indel-C1 in the risk haplotype. Black oval, SOX5; grey ovals, MYT1; checkered oval, NGF1C; dotted oval, AP4; hatched oval, RP580 or ZNF238; white oval, myb.

    Journal: Human Molecular Genetics

    Article Title: Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia

    doi: 10.1093/hmg/ddn130

    Figure Lengend Snippet: Schematic representations of the variation in transcription factor binding sites (TFBS) for the two promoter haplotypes of ESR1 are diagrammed. The top represents the common haplotype for C4, C5, C10 and C11 (1, 2, 1, 1, 1) that is not associated with the risk for schizophrenia. The bottom schematic shows the haplotype associated with risk (2, 1, 2, 2, 2). Ovals represent transcription factor binding to either the sense (upper) or antisense (lower) ESR1 DNA strand. Note the loss of a predicted biding of a transcription factor sites at C4, C5 and C11 and a gain of transcription factor binding site at C10 and Indel-C1 in the risk haplotype. Black oval, SOX5; grey ovals, MYT1; checkered oval, NGF1C; dotted oval, AP4; hatched oval, RP580 or ZNF238; white oval, myb.

    Article Snippet: Each qPCR reaction contained 3 µl cDNA template (corresponding to 90 ng cDNA), 5 µl Master Mix (Eurogentec, California), 0.5 µl 20X assay-on demand mix containing forward and reverse primers and FAM™ dye-labeled TaqMan® MGB probe (Hs00174860_m1) and 1.5 µl H2 O.

    Techniques: Binding Assay

    Scatter plot showing the average quantity of ESR1 mRNA levels normalized to the geometric mean of four housekeeper (HSKPs) mRNAs on the Y -axis as determined by real time qPCR. The values of ESR for patients with schizophrenia are plotted according to the PvuII (C11) genotype with C being the risk allele. Those patients homozygous for the risk allele (CC), have significantly lower expression compared to the other genotype groups (T/C and T/T). * P > 0.05.

    Journal: Human Molecular Genetics

    Article Title: Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia

    doi: 10.1093/hmg/ddn130

    Figure Lengend Snippet: Scatter plot showing the average quantity of ESR1 mRNA levels normalized to the geometric mean of four housekeeper (HSKPs) mRNAs on the Y -axis as determined by real time qPCR. The values of ESR for patients with schizophrenia are plotted according to the PvuII (C11) genotype with C being the risk allele. Those patients homozygous for the risk allele (CC), have significantly lower expression compared to the other genotype groups (T/C and T/T). * P > 0.05.

    Article Snippet: Each qPCR reaction contained 3 µl cDNA template (corresponding to 90 ng cDNA), 5 µl Master Mix (Eurogentec, California), 0.5 µl 20X assay-on demand mix containing forward and reverse primers and FAM™ dye-labeled TaqMan® MGB probe (Hs00174860_m1) and 1.5 µl H2 O.

    Techniques: Real-time Polymerase Chain Reaction, Electron Paramagnetic Resonance, Expressing

    Schematic view of the ESR1 transcripts detected from cDNA from the DLPFC of adult humans. Nineteen different exon-deleted ESR1 mRNAs are depicted with the boxes representing the 8 known coding exons according to Genbank entry NM_000125. *the partial exon deletion, N the variant only detected in normal controls, P the variant only detected in psychiatric patients. WT = wild-type ESR1.

    Journal: Human Molecular Genetics

    Article Title: Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia

    doi: 10.1093/hmg/ddn130

    Figure Lengend Snippet: Schematic view of the ESR1 transcripts detected from cDNA from the DLPFC of adult humans. Nineteen different exon-deleted ESR1 mRNAs are depicted with the boxes representing the 8 known coding exons according to Genbank entry NM_000125. *the partial exon deletion, N the variant only detected in normal controls, P the variant only detected in psychiatric patients. WT = wild-type ESR1.

    Article Snippet: Each qPCR reaction contained 3 µl cDNA template (corresponding to 90 ng cDNA), 5 µl Master Mix (Eurogentec, California), 0.5 µl 20X assay-on demand mix containing forward and reverse primers and FAM™ dye-labeled TaqMan® MGB probe (Hs00174860_m1) and 1.5 µl H2 O.

    Techniques: Variant Assay