Review




Structured Review

Bioneer Corporation fak targeting sirna
Fak Targeting Sirna, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fak targeting sirna/product/Bioneer Corporation
Average 86 stars, based on 1 article reviews
fak targeting sirna - by Bioz Stars, 2025-07
86/100 stars

Images



Similar Products

86
Bioneer Corporation fak targeting sirna
Fak Targeting Sirna, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fak targeting sirna/product/Bioneer Corporation
Average 86 stars, based on 1 article reviews
fak targeting sirna - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Ribobio co sirnas targeting fak
Sirnas Targeting Fak, supplied by Ribobio co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirnas targeting fak/product/Ribobio co
Average 86 stars, based on 1 article reviews
sirnas targeting fak - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Thermo Fisher sirna targeting protein tyrosine kinase 2 ptk2
Sirna Targeting Protein Tyrosine Kinase 2 Ptk2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna targeting protein tyrosine kinase 2 ptk2/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
sirna targeting protein tyrosine kinase 2 ptk2 - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Thermo Fisher sirna targeting ptk2
Sirna Targeting Ptk2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna targeting ptk2/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
sirna targeting ptk2 - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Revvity sirna targeting fak
(A) On-gel FUNCAT experiments to monitor mitochondrial translation with <t>siRNA</t> transfection to knock down <t>FAK.</t> (B, D, and F) On-gel FUNCAT experiments to monitor mitochondrial translation under treatment with the indicated compounds at the following concentrations for 12 h: NSC23766, 200 μM; ZCL278, 100 μM; Rhosin, 50 μM; BAY-293,1 μM; LY294002, 10 μM; SP600125, 20 μM; IPA-3, 5 μM; CK666, 25 μM; obatoclax, 2 μM; TW-37, 10 μM. (C) Western blotting of RAC1 protein in the total cell lysate and in the GTP-bound fraction pulled down with the p21-binding domain (PBD) of PAK1. The quantified relative amount of RAC1 in the GTP-bound, activated form is shown. (E) Western blotting of total PAK1 protein and the phosphorylated form (at S144 and S141). The quantified relative amount of phosphorylated PAK1 is shown. (G) Western blotting of total BAD protein in the total lysate and in the mitochondria immunoprecipitated (IP) fraction with anti-TOM22 antibody. (H) Representative distribution of Cy3-conjugated HPG signals normalized to AF647-labeled TOMM20 signals in the indicated cell lines (left). The dashed line presents the mean of the distribution. The quantification is shown on the right. The distribution of unnormalized Cy3-conjugated HPG signals and AF647-labeled TOMM20 signals are shown in . (I) On-gel FUNCAT experiments to monitor mitochondrial translation in naïve and BAD KO HAP1 cells with a titrated concentration of laminin pretreatment. For A-H, data from replicates (points, n = 3 for A, C, E, G, and H; n = 6 for B, D, and F), the mean values (bars), and the s.d.s (errors) are shown. The p values were calculated by Student’s t test (two-tailed) (C, E, G, and H) and by the Tukey‒Kramer test (two-tailed) (A, B, D, and F). For I, data from three replicates and the mean values (bars) are shown. See also .
Sirna Targeting Fak, supplied by Revvity, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna targeting fak/product/Revvity
Average 86 stars, based on 1 article reviews
sirna targeting fak - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Qiagen sirna oligonucleotides against fak targeted sequence 5 tgcaatggaacgagtattaaa
(A) On-gel FUNCAT experiments to monitor mitochondrial translation with <t>siRNA</t> transfection to knock down <t>FAK.</t> (B, D, and F) On-gel FUNCAT experiments to monitor mitochondrial translation under treatment with the indicated compounds at the following concentrations for 12 h: NSC23766, 200 μM; ZCL278, 100 μM; Rhosin, 50 μM; BAY-293,1 μM; LY294002, 10 μM; SP600125, 20 μM; IPA-3, 5 μM; CK666, 25 μM; obatoclax, 2 μM; TW-37, 10 μM. (C) Western blotting of RAC1 protein in the total cell lysate and in the GTP-bound fraction pulled down with the p21-binding domain (PBD) of PAK1. The quantified relative amount of RAC1 in the GTP-bound, activated form is shown. (E) Western blotting of total PAK1 protein and the phosphorylated form (at S144 and S141). The quantified relative amount of phosphorylated PAK1 is shown. (G) Western blotting of total BAD protein in the total lysate and in the mitochondria immunoprecipitated (IP) fraction with anti-TOM22 antibody. (H) Representative distribution of Cy3-conjugated HPG signals normalized to AF647-labeled TOMM20 signals in the indicated cell lines (left). The dashed line presents the mean of the distribution. The quantification is shown on the right. The distribution of unnormalized Cy3-conjugated HPG signals and AF647-labeled TOMM20 signals are shown in . (I) On-gel FUNCAT experiments to monitor mitochondrial translation in naïve and BAD KO HAP1 cells with a titrated concentration of laminin pretreatment. For A-H, data from replicates (points, n = 3 for A, C, E, G, and H; n = 6 for B, D, and F), the mean values (bars), and the s.d.s (errors) are shown. The p values were calculated by Student’s t test (two-tailed) (C, E, G, and H) and by the Tukey‒Kramer test (two-tailed) (A, B, D, and F). For I, data from three replicates and the mean values (bars) are shown. See also .
Sirna Oligonucleotides Against Fak Targeted Sequence 5 Tgcaatggaacgagtattaaa, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna oligonucleotides against fak targeted sequence 5 tgcaatggaacgagtattaaa/product/Qiagen
Average 86 stars, based on 1 article reviews
sirna oligonucleotides against fak targeted sequence 5 tgcaatggaacgagtattaaa - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Millipore sirnas targeting fak
(A) On-gel FUNCAT experiments to monitor mitochondrial translation with <t>siRNA</t> transfection to knock down <t>FAK.</t> (B, D, and F) On-gel FUNCAT experiments to monitor mitochondrial translation under treatment with the indicated compounds at the following concentrations for 12 h: NSC23766, 200 μM; ZCL278, 100 μM; Rhosin, 50 μM; BAY-293,1 μM; LY294002, 10 μM; SP600125, 20 μM; IPA-3, 5 μM; CK666, 25 μM; obatoclax, 2 μM; TW-37, 10 μM. (C) Western blotting of RAC1 protein in the total cell lysate and in the GTP-bound fraction pulled down with the p21-binding domain (PBD) of PAK1. The quantified relative amount of RAC1 in the GTP-bound, activated form is shown. (E) Western blotting of total PAK1 protein and the phosphorylated form (at S144 and S141). The quantified relative amount of phosphorylated PAK1 is shown. (G) Western blotting of total BAD protein in the total lysate and in the mitochondria immunoprecipitated (IP) fraction with anti-TOM22 antibody. (H) Representative distribution of Cy3-conjugated HPG signals normalized to AF647-labeled TOMM20 signals in the indicated cell lines (left). The dashed line presents the mean of the distribution. The quantification is shown on the right. The distribution of unnormalized Cy3-conjugated HPG signals and AF647-labeled TOMM20 signals are shown in . (I) On-gel FUNCAT experiments to monitor mitochondrial translation in naïve and BAD KO HAP1 cells with a titrated concentration of laminin pretreatment. For A-H, data from replicates (points, n = 3 for A, C, E, G, and H; n = 6 for B, D, and F), the mean values (bars), and the s.d.s (errors) are shown. The p values were calculated by Student’s t test (two-tailed) (C, E, G, and H) and by the Tukey‒Kramer test (two-tailed) (A, B, D, and F). For I, data from three replicates and the mean values (bars) are shown. See also .
Sirnas Targeting Fak, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirnas targeting fak/product/Millipore
Average 86 stars, based on 1 article reviews
sirnas targeting fak - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Addgene inc shrna targeting mouse ptk2 cctggcatctttgatattata
(A) On-gel FUNCAT experiments to monitor mitochondrial translation with <t>siRNA</t> transfection to knock down <t>FAK.</t> (B, D, and F) On-gel FUNCAT experiments to monitor mitochondrial translation under treatment with the indicated compounds at the following concentrations for 12 h: NSC23766, 200 μM; ZCL278, 100 μM; Rhosin, 50 μM; BAY-293,1 μM; LY294002, 10 μM; SP600125, 20 μM; IPA-3, 5 μM; CK666, 25 μM; obatoclax, 2 μM; TW-37, 10 μM. (C) Western blotting of RAC1 protein in the total cell lysate and in the GTP-bound fraction pulled down with the p21-binding domain (PBD) of PAK1. The quantified relative amount of RAC1 in the GTP-bound, activated form is shown. (E) Western blotting of total PAK1 protein and the phosphorylated form (at S144 and S141). The quantified relative amount of phosphorylated PAK1 is shown. (G) Western blotting of total BAD protein in the total lysate and in the mitochondria immunoprecipitated (IP) fraction with anti-TOM22 antibody. (H) Representative distribution of Cy3-conjugated HPG signals normalized to AF647-labeled TOMM20 signals in the indicated cell lines (left). The dashed line presents the mean of the distribution. The quantification is shown on the right. The distribution of unnormalized Cy3-conjugated HPG signals and AF647-labeled TOMM20 signals are shown in . (I) On-gel FUNCAT experiments to monitor mitochondrial translation in naïve and BAD KO HAP1 cells with a titrated concentration of laminin pretreatment. For A-H, data from replicates (points, n = 3 for A, C, E, G, and H; n = 6 for B, D, and F), the mean values (bars), and the s.d.s (errors) are shown. The p values were calculated by Student’s t test (two-tailed) (C, E, G, and H) and by the Tukey‒Kramer test (two-tailed) (A, B, D, and F). For I, data from three replicates and the mean values (bars) are shown. See also .
Shrna Targeting Mouse Ptk2 Cctggcatctttgatattata, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna targeting mouse ptk2 cctggcatctttgatattata/product/Addgene inc
Average 86 stars, based on 1 article reviews
shrna targeting mouse ptk2 cctggcatctttgatattata - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

Image Search Results


(A) On-gel FUNCAT experiments to monitor mitochondrial translation with siRNA transfection to knock down FAK. (B, D, and F) On-gel FUNCAT experiments to monitor mitochondrial translation under treatment with the indicated compounds at the following concentrations for 12 h: NSC23766, 200 μM; ZCL278, 100 μM; Rhosin, 50 μM; BAY-293,1 μM; LY294002, 10 μM; SP600125, 20 μM; IPA-3, 5 μM; CK666, 25 μM; obatoclax, 2 μM; TW-37, 10 μM. (C) Western blotting of RAC1 protein in the total cell lysate and in the GTP-bound fraction pulled down with the p21-binding domain (PBD) of PAK1. The quantified relative amount of RAC1 in the GTP-bound, activated form is shown. (E) Western blotting of total PAK1 protein and the phosphorylated form (at S144 and S141). The quantified relative amount of phosphorylated PAK1 is shown. (G) Western blotting of total BAD protein in the total lysate and in the mitochondria immunoprecipitated (IP) fraction with anti-TOM22 antibody. (H) Representative distribution of Cy3-conjugated HPG signals normalized to AF647-labeled TOMM20 signals in the indicated cell lines (left). The dashed line presents the mean of the distribution. The quantification is shown on the right. The distribution of unnormalized Cy3-conjugated HPG signals and AF647-labeled TOMM20 signals are shown in . (I) On-gel FUNCAT experiments to monitor mitochondrial translation in naïve and BAD KO HAP1 cells with a titrated concentration of laminin pretreatment. For A-H, data from replicates (points, n = 3 for A, C, E, G, and H; n = 6 for B, D, and F), the mean values (bars), and the s.d.s (errors) are shown. The p values were calculated by Student’s t test (two-tailed) (C, E, G, and H) and by the Tukey‒Kramer test (two-tailed) (A, B, D, and F). For I, data from three replicates and the mean values (bars) are shown. See also .

Journal: bioRxiv

Article Title: Gravitational and mechanical forces drive mitochondrial translation through the cell adhesion–FAK axis

doi: 10.1101/2023.01.18.524628

Figure Lengend Snippet: (A) On-gel FUNCAT experiments to monitor mitochondrial translation with siRNA transfection to knock down FAK. (B, D, and F) On-gel FUNCAT experiments to monitor mitochondrial translation under treatment with the indicated compounds at the following concentrations for 12 h: NSC23766, 200 μM; ZCL278, 100 μM; Rhosin, 50 μM; BAY-293,1 μM; LY294002, 10 μM; SP600125, 20 μM; IPA-3, 5 μM; CK666, 25 μM; obatoclax, 2 μM; TW-37, 10 μM. (C) Western blotting of RAC1 protein in the total cell lysate and in the GTP-bound fraction pulled down with the p21-binding domain (PBD) of PAK1. The quantified relative amount of RAC1 in the GTP-bound, activated form is shown. (E) Western blotting of total PAK1 protein and the phosphorylated form (at S144 and S141). The quantified relative amount of phosphorylated PAK1 is shown. (G) Western blotting of total BAD protein in the total lysate and in the mitochondria immunoprecipitated (IP) fraction with anti-TOM22 antibody. (H) Representative distribution of Cy3-conjugated HPG signals normalized to AF647-labeled TOMM20 signals in the indicated cell lines (left). The dashed line presents the mean of the distribution. The quantification is shown on the right. The distribution of unnormalized Cy3-conjugated HPG signals and AF647-labeled TOMM20 signals are shown in . (I) On-gel FUNCAT experiments to monitor mitochondrial translation in naïve and BAD KO HAP1 cells with a titrated concentration of laminin pretreatment. For A-H, data from replicates (points, n = 3 for A, C, E, G, and H; n = 6 for B, D, and F), the mean values (bars), and the s.d.s (errors) are shown. The p values were calculated by Student’s t test (two-tailed) (C, E, G, and H) and by the Tukey‒Kramer test (two-tailed) (A, B, D, and F). For I, data from three replicates and the mean values (bars) are shown. See also .

Article Snippet: For knockdown experiments, cells were transfected with 5 μM siRNA targeting FAK (Horizon Discovery, L-003164-00-0005) or control siRNA (Horizon Discovery, D-001206-13-20) using TransIT-X2 Reagent (Mirus Bio, MIR6003) in 10-cm dishes and incubated for 24 h. Then, cells were reseeded on 12-well dishes with or without laminin coating as described above, cultured for an additional 24 h, and used for on-gel mito-FUNCAT experiments.

Techniques: Transfection, Knockdown, Western Blot, Binding Assay, Immunoprecipitation, Labeling, Concentration Assay, Two Tailed Test