expand long template pcr system (Roche)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Roche expand long template pcr system

Deletion of SAMHD1 does not affect <t>mtDNA</t> stability. a) MtDNA copy number in the TA muscle of 5 or 6 wt (filled dots) and SAMHD1 −/− (open dots) 13-week-old (adult), 1-year-old (old adult), and 2-year-old (aged) animals was determined by qPCR and normalized to the value for adult wt mice. The mean for each group is indicated by a horizontal line. The p-values were calculated using Welch’s t-test; ns, non-significant. b) DNA isolated from embryos and from the TA muscle of pups, adults, 1-year-old (old) adults, or aged animals was linearized with SacI endonuclease and separated on a neutral gel. MtDNA was visualized as above. Full-length mtDNA is indicated (FL); the asterisk denotes a higher-migrating species resistant to cleavage. c) Long-range <t>PCR</t> to detect deletions in mtDNA from the TA muscle of wt mice of various ages. Full-length product is indicated (FL). Only minor species containing deletions are observed in the mtDNA from old adults and aged animals, as indicated by the vertical line on the right-hand side of the gel. d) Untreated or alkali-treated DNA from skeletal muscle of aged wt and SAMHD1 −/− (ko) mice was analyzed on a denaturing gel, and mtDNA was visualized using a COX1 probe. Each sample lane corresponds to an individual mouse, and dotted lines represent the median. e) The median length of the untreated mtDNA in samples from Fig. 5d is indicated by a horizontal line. The two groups were compared using Welch’s t-test (ns, non-significant; n = 4). f) The length difference between untreated and alkali-treated mtDNAs shown in Fig. 5d was used to compute the number of rNMPs per single strand of mtDNA. The horizontal lines indicate the median. The p-value of the statistically significant difference between the two groups was calculated by Welch’s t-test; n = 4. g) Long-range PCR was performed on mtDNA isolated from the TA muscle of adult and aged wt or SAMHD1 −/− (ko) mice. FL, full-length product; the vertical line indicates the size range of mtDNA molecules with deletions. h) Kaplan–Meier survival curve for wt and SAMHD1 −/− (ko) mice. Comparison of the curves by the log-rank (Mantel–Cox) test confirmed no statistically significant difference between the genotypes. The sizes of the bands in the DNA ladder are indicated in kb. See also Fig. S5.

Expand Long Template Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 1004 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/expand long template pcr system/product/Roche
Average 94 stars, based on 1004 article reviews
Price from $9.99 to $1999.99

expand long template pcr system - by Bioz Stars, 2020-08

94/100 stars

Related Products / Commonly Used Together

pcr
pcr amplification
long-range pcr
pcrs
pcr reactions
genomic dna
dntp
cdna
abi 2720 thermal cycler
bsa
pcr-amplified
dmso
dna sequence
rna
mtdna deletions

Images

1) Product Images from "The physiological level of rNMPs present in mtDNA does not compromise its stability"

Article Title: The physiological level of rNMPs present in mtDNA does not compromise its stability

Journal: bioRxiv

doi: 10.1101/746719

Deletion of SAMHD1 does not affect mtDNA stability. a) MtDNA copy number in the TA muscle of 5 or 6 wt (filled dots) and SAMHD1 −/− (open dots) 13-week-old (adult), 1-year-old (old adult), and 2-year-old (aged) animals was determined by qPCR and normalized to the value for adult wt mice. The mean for each group is indicated by a horizontal line. The p-values were calculated using Welch’s t-test; ns, non-significant. b) DNA isolated from embryos and from the TA muscle of pups, adults, 1-year-old (old) adults, or aged animals was linearized with SacI endonuclease and separated on a neutral gel. MtDNA was visualized as above. Full-length mtDNA is indicated (FL); the asterisk denotes a higher-migrating species resistant to cleavage. c) Long-range PCR to detect deletions in mtDNA from the TA muscle of wt mice of various ages. Full-length product is indicated (FL). Only minor species containing deletions are observed in the mtDNA from old adults and aged animals, as indicated by the vertical line on the right-hand side of the gel. d) Untreated or alkali-treated DNA from skeletal muscle of aged wt and SAMHD1 −/− (ko) mice was analyzed on a denaturing gel, and mtDNA was visualized using a COX1 probe. Each sample lane corresponds to an individual mouse, and dotted lines represent the median. e) The median length of the untreated mtDNA in samples from Fig. 5d is indicated by a horizontal line. The two groups were compared using Welch’s t-test (ns, non-significant; n = 4). f) The length difference between untreated and alkali-treated mtDNAs shown in Fig. 5d was used to compute the number of rNMPs per single strand of mtDNA. The horizontal lines indicate the median. The p-value of the statistically significant difference between the two groups was calculated by Welch’s t-test; n = 4. g) Long-range PCR was performed on mtDNA isolated from the TA muscle of adult and aged wt or SAMHD1 −/− (ko) mice. FL, full-length product; the vertical line indicates the size range of mtDNA molecules with deletions. h) Kaplan–Meier survival curve for wt and SAMHD1 −/− (ko) mice. Comparison of the curves by the log-rank (Mantel–Cox) test confirmed no statistically significant difference between the genotypes. The sizes of the bands in the DNA ladder are indicated in kb. See also Fig. S5.

Figure Legend Snippet: Deletion of SAMHD1 does not affect mtDNA stability. a) MtDNA copy number in the TA muscle of 5 or 6 wt (filled dots) and SAMHD1 −/− (open dots) 13-week-old (adult), 1-year-old (old adult), and 2-year-old (aged) animals was determined by qPCR and normalized to the value for adult wt mice. The mean for each group is indicated by a horizontal line. The p-values were calculated using Welch’s t-test; ns, non-significant. b) DNA isolated from embryos and from the TA muscle of pups, adults, 1-year-old (old) adults, or aged animals was linearized with SacI endonuclease and separated on a neutral gel. MtDNA was visualized as above. Full-length mtDNA is indicated (FL); the asterisk denotes a higher-migrating species resistant to cleavage. c) Long-range PCR to detect deletions in mtDNA from the TA muscle of wt mice of various ages. Full-length product is indicated (FL). Only minor species containing deletions are observed in the mtDNA from old adults and aged animals, as indicated by the vertical line on the right-hand side of the gel. d) Untreated or alkali-treated DNA from skeletal muscle of aged wt and SAMHD1 −/− (ko) mice was analyzed on a denaturing gel, and mtDNA was visualized using a COX1 probe. Each sample lane corresponds to an individual mouse, and dotted lines represent the median. e) The median length of the untreated mtDNA in samples from Fig. 5d is indicated by a horizontal line. The two groups were compared using Welch’s t-test (ns, non-significant; n = 4). f) The length difference between untreated and alkali-treated mtDNAs shown in Fig. 5d was used to compute the number of rNMPs per single strand of mtDNA. The horizontal lines indicate the median. The p-value of the statistically significant difference between the two groups was calculated by Welch’s t-test; n = 4. g) Long-range PCR was performed on mtDNA isolated from the TA muscle of adult and aged wt or SAMHD1 −/− (ko) mice. FL, full-length product; the vertical line indicates the size range of mtDNA molecules with deletions. h) Kaplan–Meier survival curve for wt and SAMHD1 −/− (ko) mice. Comparison of the curves by the log-rank (Mantel–Cox) test confirmed no statistically significant difference between the genotypes. The sizes of the bands in the DNA ladder are indicated in kb. See also Fig. S5.

Techniques Used: Real-time Polymerase Chain Reaction, Mouse Assay, Isolation, Polymerase Chain Reaction

2) Product Images from "Extensive somatic L1 retrotransposition in colorectal tumors"

Article Title: Extensive somatic L1 retrotransposition in colorectal tumors

Journal: Genome Research

doi: 10.1101/gr.145235.112

Genomic distribution of L1 insertions. Outer rings show the density of detected insertion sites for reference (gray) and nonreference (black) L1s. The approximate locations of the 72 PCR-validated somatic insertions are indicated by dots inside the circle.

Figure Legend Snippet: Genomic distribution of L1 insertions. Outer rings show the density of detected insertion sites for reference (gray) and nonreference (black) L1s. The approximate locations of the 72 PCR-validated somatic insertions are indicated by dots inside the circle.

Techniques Used: Polymerase Chain Reaction

Analysis of factors influencing L1 activity. ( A ) L1 CpG promoter methylation status performed by quantitative bisulfite PCR analysis. (N) Normal tissue; (T) tumor tissue; (*) MSI. Replicates of four were done for each data point. (Error bars) Standard

Figure Legend Snippet: Analysis of factors influencing L1 activity. ( A ) L1 CpG promoter methylation status performed by quantitative bisulfite PCR analysis. (N) Normal tissue; (T) tumor tissue; (*) MSI. Replicates of four were done for each data point. (Error bars) Standard

Techniques Used: Activity Assay, Methylation, Polymerase Chain Reaction

PCR validation scheme of L1-seq results. ( A ) The three-step PCR validation scheme and location of primers used. Triangles symbolize TSD. ( B ) PCR validation of the 3′ junction (ins. 7). This insertion is in tumor 1 of the eight DNA samples that

Figure Legend Snippet: PCR validation scheme of L1-seq results. ( A ) The three-step PCR validation scheme and location of primers used. Triangles symbolize TSD. ( B ) PCR validation of the 3′ junction (ins. 7). This insertion is in tumor 1 of the eight DNA samples that

Techniques Used: Polymerase Chain Reaction

3) Product Images from "Bidirectional transcription stimulates expansion and contraction of expanded (CTG)o(CAG) repeats"

Article Title: Bidirectional transcription stimulates expansion and contraction of expanded (CTG)o(CAG) repeats

Journal: Human Molecular Genetics

doi: 10.1093/hmg/ddq501

( A ) Small-pool PCR followed by Southern blot for analysis of CTG repeat length. DNA from fibroblast clones was diluted to produce, on average, one amplifiable expanded repeat allele per PCR tube. The repeat tract was amplified by 24 cycles of PCR. The

Figure Legend Snippet: ( A ) Small-pool PCR followed by Southern blot for analysis of CTG repeat length. DNA from fibroblast clones was diluted to produce, on average, one amplifiable expanded repeat allele per PCR tube. The repeat tract was amplified by 24 cycles of PCR. The

Techniques Used: Polymerase Chain Reaction, Southern Blot, CTG Assay, Clone Assay, Amplification

4) Product Images from "The human hGSTA5 gene encodes an enzymatically active protein"

Article Title: The human hGSTA5 gene encodes an enzymatically active protein

Journal:

doi: 10.1016/j.bbagen.2009.07.025

Specificity of primers used for the identification of hGSTA5 transcript by RT-PCR. The PCR primers (shown in the bottom line of each panel) were designed so that they do not recognize targets other than Alpha-class GSTs (as shown by a BLAST search against

Figure Legend Snippet: Specificity of primers used for the identification of hGSTA5 transcript by RT-PCR. The PCR primers (shown in the bottom line of each panel) were designed so that they do not recognize targets other than Alpha-class GSTs (as shown by a BLAST search against

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

5) Product Images from "New Molecular Mechanism for Ullrich Congenital Muscular Dystrophy: A Heterozygous In-Frame Deletion in the COL6A1 Gene Causes a Severe Phenotype"

Article Title: New Molecular Mechanism for Ullrich Congenital Muscular Dystrophy: A Heterozygous In-Frame Deletion in the COL6A1 Gene Causes a Severe Phenotype

Journal: American Journal of Human Genetics

doi:

Mutational analysis of the COL6A1 gene. A, Schematic diagram of the COL6A1 genomic region including exons 7–15 ( blackened boxes ). Exon 8 encodes the beginning of the triple-helical domain, and exons 9–15 each encode discrete numbers of Gly-Xaa-Yaa repeats in the triple-helical domain. A minisatellite ( unblackened box labeled “VNTR” ) is present at the 5′ end of intron 8. In patient UC-1, one of the COL6A1 alleles contains a 1.1-kb gene deletion ( dotted box ) extending from intron 8 to intron 10. Patient UC-4 carries a heterozygous G→A transition at the +1 position of intron 14. B, PCR amplification of genomic DNA from patient UC-1 and his family ( lanes 2–6 ) and from four unaffected control individuals ( lanes 7–10 ) with primers in introns 6 and 12 ( arrows in A ). Lanes 1 and 11 contain DNA size markers. C, DNA sequence of the 1.8-kb PCR product from UC-1, showing the breakpoint of the internal gene deletion ( middle line ) and its alignment with the normal COL6A1 genomic sequence of intron 8 ( top line ) and of intron 9–exon 10–intron 10 ( bottom line ). Exon sequences are in capital letters. Between the arrows are 15-bp inserted sequences in the deletion junction, which contains an 11-bp direct duplication of the sequence in intron 10 ( boxed ). The dotted box depicts the last repeat of the minisatellite sequence in intron 8. In = intron; Ex = exon.

Figure Legend Snippet: Mutational analysis of the COL6A1 gene. A, Schematic diagram of the COL6A1 genomic region including exons 7–15 ( blackened boxes ). Exon 8 encodes the beginning of the triple-helical domain, and exons 9–15 each encode discrete numbers of Gly-Xaa-Yaa repeats in the triple-helical domain. A minisatellite ( unblackened box labeled “VNTR” ) is present at the 5′ end of intron 8. In patient UC-1, one of the COL6A1 alleles contains a 1.1-kb gene deletion ( dotted box ) extending from intron 8 to intron 10. Patient UC-4 carries a heterozygous G→A transition at the +1 position of intron 14. B, PCR amplification of genomic DNA from patient UC-1 and his family ( lanes 2–6 ) and from four unaffected control individuals ( lanes 7–10 ) with primers in introns 6 and 12 ( arrows in A ). Lanes 1 and 11 contain DNA size markers. C, DNA sequence of the 1.8-kb PCR product from UC-1, showing the breakpoint of the internal gene deletion ( middle line ) and its alignment with the normal COL6A1 genomic sequence of intron 8 ( top line ) and of intron 9–exon 10–intron 10 ( bottom line ). Exon sequences are in capital letters. Between the arrows are 15-bp inserted sequences in the deletion junction, which contains an 11-bp direct duplication of the sequence in intron 10 ( boxed ). The dotted box depicts the last repeat of the minisatellite sequence in intron 8. In = intron; Ex = exon.

Techniques Used: Labeling, Polymerase Chain Reaction, Amplification, Sequencing

6) Product Images from "Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1"

Article Title: Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1

Journal: Blood

doi: 10.1182/blood-2010-05-286328

Evidence of RAG involvement in Notch1 rearrangements in murine T-ALL . (A) Rearrangements in Notch1 deduced from sequencing of PCR products generated from 11 cell lines with type 1 deletions (top) and 3 cell lines with type 2 deletions (bottom). GL is the sequence of the germline DNA flanking the breakpoints. Nucleotide positions are expressed relative to the ATG start codon in exon 1 of Notch1 . Flanking sequences resembling RAG recognition sequences are boxed. Residues matching the consensus RAG signal sequence (a CACATGT heptamer followed by a 12- or 23-bp spacer and the nonameric sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. The point of joining in SCID-adh contains a single cytosine residue (underlined) of unknown origin. (B) Distribution of RAG2 binding and H3K4 trimethylation across the murine Notch1 locus. ChIP-Seq was performed with antibodies specific for RAG2 and H3K4-me3 on DNA immunoprecipitated from normal thymocytes (αRAG2 WT), thymocytes expressing a RAG1 D708A mutant (αRAG2 Mut) that binds chromatin but is catalytically inactive, and homozygous RAG2 knockout thymoctyes (αRAG2 −/− Histograms showing sequence reads that aligned to the murine genome are superimposed on a diagram of the Notch1 locus. The y-axis of each histogram corresponds to the number of aligned reads per 10 6 total reads.

Figure Legend Snippet: Evidence of RAG involvement in Notch1 rearrangements in murine T-ALL . (A) Rearrangements in Notch1 deduced from sequencing of PCR products generated from 11 cell lines with type 1 deletions (top) and 3 cell lines with type 2 deletions (bottom). GL is the sequence of the germline DNA flanking the breakpoints. Nucleotide positions are expressed relative to the ATG start codon in exon 1 of Notch1 . Flanking sequences resembling RAG recognition sequences are boxed. Residues matching the consensus RAG signal sequence (a CACATGT heptamer followed by a 12- or 23-bp spacer and the nonameric sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. The point of joining in SCID-adh contains a single cytosine residue (underlined) of unknown origin. (B) Distribution of RAG2 binding and H3K4 trimethylation across the murine Notch1 locus. ChIP-Seq was performed with antibodies specific for RAG2 and H3K4-me3 on DNA immunoprecipitated from normal thymocytes (αRAG2 WT), thymocytes expressing a RAG1 D708A mutant (αRAG2 Mut) that binds chromatin but is catalytically inactive, and homozygous RAG2 knockout thymoctyes (αRAG2 −/− Histograms showing sequence reads that aligned to the murine genome are superimposed on a diagram of the Notch1 locus. The y-axis of each histogram corresponds to the number of aligned reads per 10 6 total reads.

Techniques Used: Sequencing, Polymerase Chain Reaction, Generated, Binding Assay, Chromatin Immunoprecipitation, Immunoprecipitation, Expressing, Mutagenesis, Knock-Out

Detection of 5′ deletions and aberrant Notch1 transcripts in primary murine “thymomas.” (A) Sequences of PCR products obtained by amplification of genomic DNA isolated from 2 thymic lymphomas with primers flanking the most common breakpoints associated with type 1 aberrant transcripts. Sites of DNA breakage and joining, as deduced from sequencing of PCR products, are shown. Residues matching the consensus RAG recognition sequence (CACAGTG followed by a 12- or 23-bp spacer and the sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. GL indicates germline DNA flanking the breakpoints. Boxes represent sequences resembling RAG signal sequences. (B) Ratiometric Notch1 quantitative RT-PCR analysis. The relative amounts of transcripts containing 5′ (exons 23 and 24) and 3′ (exons 30 and 31) Notch1 sequences were determined for the tumors in panel A and normal murine thymus, a cell line with a homozygous type 2 deletion (135.2), and a cell line with a heterozygous type 1 deletion (144). Each determination was made in triplicate. The results shown are representative of 2 independent experiments.

Figure Legend Snippet: Detection of 5′ deletions and aberrant Notch1 transcripts in primary murine “thymomas.” (A) Sequences of PCR products obtained by amplification of genomic DNA isolated from 2 thymic lymphomas with primers flanking the most common breakpoints associated with type 1 aberrant transcripts. Sites of DNA breakage and joining, as deduced from sequencing of PCR products, are shown. Residues matching the consensus RAG recognition sequence (CACAGTG followed by a 12- or 23-bp spacer and the sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. GL indicates germline DNA flanking the breakpoints. Boxes represent sequences resembling RAG signal sequences. (B) Ratiometric Notch1 quantitative RT-PCR analysis. The relative amounts of transcripts containing 5′ (exons 23 and 24) and 3′ (exons 30 and 31) Notch1 sequences were determined for the tumors in panel A and normal murine thymus, a cell line with a homozygous type 2 deletion (135.2), and a cell line with a heterozygous type 1 deletion (144). Each determination was made in triplicate. The results shown are representative of 2 independent experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Isolation, Sequencing, Quantitative RT-PCR

7) Product Images from "Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR"

Article Title: Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR

Journal: Virology Journal

doi: 10.1186/1743-422X-7-194

Type-specific L1 DNA determined by multiplex qPCR correlates with typing determined by degenerative PCR using DNA from nonsmoker/nondrinker clinical samples . DNA was extracted from paraffin-embedded tissue and used in the HPV type-specific L1 qPCR assay. C indicates the presence of cancer, P indicates that cancer was previously diagnosed and B indicates the tissue was histologically benign at the time biopsies were performed. The type-specific HPV L1 for each sample was previously determined by nested PCR using MY09/11 and GP5+/6+ primers pairs followed by direct sequencing of the PCR products. Homology of the PCR product with HPV16 is indicated by 16 while homology of the PCR product with HPV18 is indicated by 18. The inability to obtain a product by nested PCR is indicated by a dash. HPV type as determined by qPCR.

Figure Legend Snippet: Type-specific L1 DNA determined by multiplex qPCR correlates with typing determined by degenerative PCR using DNA from nonsmoker/nondrinker clinical samples . DNA was extracted from paraffin-embedded tissue and used in the HPV type-specific L1 qPCR assay. C indicates the presence of cancer, P indicates that cancer was previously diagnosed and B indicates the tissue was histologically benign at the time biopsies were performed. The type-specific HPV L1 for each sample was previously determined by nested PCR using MY09/11 and GP5+/6+ primers pairs followed by direct sequencing of the PCR products. Homology of the PCR product with HPV16 is indicated by 16 while homology of the PCR product with HPV18 is indicated by 18. The inability to obtain a product by nested PCR is indicated by a dash. HPV type as determined by qPCR.

Techniques Used: Multiplex Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Nested PCR, Sequencing

8) Product Images from "A Clonal Lineage of VanA-Type Enterococcus faecalis Predominates in Vancomycin-Resistant Enterococci Isolated in New Zealand"

Article Title: A Clonal Lineage of VanA-Type Enterococcus faecalis Predominates in Vancomycin-Resistant Enterococci Isolated in New Zealand

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.47.1.204-210.2003

Comparison of poultry and human VRE in New Zealand. (A) PFGE of Sma I macrorestriction patterns in vancomycin-resistant E. faecalis . Lane 1, lambda DNA ladder standard; lanes 2 and 3, poultry isolates; lanes 4 to 8, human clinical isolates. (B) Long-template PCR Cla I RFLP patterns of Tn 1546 elements. Lane 1, E. faecium BM4147; lanes 2 and 3, poultry VRE isolates; lanes 4 to 7, human clinical isolates; lane 8, lambda DNA cut with Bst EII. Cla I fragments are 3,228, 2,968, 2,009, and 1,471 bp. Marker sizes are indicated in kilobases.

Figure Legend Snippet: Comparison of poultry and human VRE in New Zealand. (A) PFGE of Sma I macrorestriction patterns in vancomycin-resistant E. faecalis . Lane 1, lambda DNA ladder standard; lanes 2 and 3, poultry isolates; lanes 4 to 8, human clinical isolates. (B) Long-template PCR Cla I RFLP patterns of Tn 1546 elements. Lane 1, E. faecium BM4147; lanes 2 and 3, poultry VRE isolates; lanes 4 to 7, human clinical isolates; lane 8, lambda DNA cut with Bst EII. Cla I fragments are 3,228, 2,968, 2,009, and 1,471 bp. Marker sizes are indicated in kilobases.

Techniques Used: Lambda DNA Preparation, Polymerase Chain Reaction, Marker

9) Product Images from "Transcriptional regulation of parathyroid hormone-related protein promoter P2 by NF-?B in adult T-cell leukemia/lymphoma"

Article Title: Transcriptional regulation of parathyroid hormone-related protein promoter P2 by NF-?B in adult T-cell leukemia/lymphoma

Journal: Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K

doi: 10.1038/sj.leu.2404798

NF-κB p50 and c-Rel bound to the PTHrP P2 promoter in vivo : ChIP was performed in MT-2 cells with antibodies to p50, c-Rel, Bcl-3 and IgG. ( a ) Real-time PCR quantification of transcription factor binding was expressed as enrichment ratio of antibody over IgG control, and each error bar represents standard deviation calculated from triplicates. ( b ) PCR amplification of a 91-bp product from the PTHrP P2 promoter genomic DNA is shown on a 2% agarose gel.

Figure Legend Snippet: NF-κB p50 and c-Rel bound to the PTHrP P2 promoter in vivo : ChIP was performed in MT-2 cells with antibodies to p50, c-Rel, Bcl-3 and IgG. ( a ) Real-time PCR quantification of transcription factor binding was expressed as enrichment ratio of antibody over IgG control, and each error bar represents standard deviation calculated from triplicates. ( b ) PCR amplification of a 91-bp product from the PTHrP P2 promoter genomic DNA is shown on a 2% agarose gel.

Techniques Used: In Vivo, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Standard Deviation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

10) Product Images from "An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers"

Article Title: An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx811

Generation and functional analysis of inducible conditional Setdb1 mutant ES cell lines. ( A ) Allelic structures and workflow of vector electroporations. IKMC heterozygous ‘knockout-first’ ( tm1a/ + ) ES cells are treated with Flp recombinase to generate a conditional allele ( tm1c ) and targeted with pI_hygGFP to generate conditional/null ( tm1c/tm2 ) cells. Cre-ERT2 is then introduced by targeting vector knockin into the Rosa26 locus. Upon treatment with 4′OHT, Cre recombinase activity removes the floxed ‘criticial exon’ of the tm1c allele to generate bi-allelic null cells ( tm1d/tm2 ). Primers for PCR genotyping are noted as small arrows. ( B ) Western blots showing absence of full-length Setdb1 protein (black arrow) in the Setdb1 tm1d/tm2 mutant ES cell lines after treatment with 4′OHT. A 39 kDa truncation product is generated from the tm2 allele (gray arrow). α-tubulin was used as a loading control (open arrow). ( C ) Setdb1 tm1d/tm2 mutant ES cells plated at low density (1 × 10∧3 cells per 10cm dish; following a 48 h 4′OHT treatment period) are unable to form colonies of undifferentiated ES cells, whereas control Setdb1 +/tm1d heterozygous ES cells (4′OHT treated and plated concurrently) exhibit normal undifferentiated ES cell colony morphology; a representative example is shown. Cells were stained with methylene blue 8 days after plating. ( D ) Growth of 4′OHT treated Setdb1 tm1d/tm2 null ES cells is severely compromised, while 4′OHT treated control Setdb1 +/tm1d heterozygous ES cells retain robust growth characteristics similar to non-treated Setdb1 tm1c/ + and tm1c/tm2 cells. Cells were plated following a 48 h 4′OHT treatment and counted at the time intervals indicated. Data points are the mean of three biological replicates (independent cell lines), error bars indicate s.d. ( E ) 4′OHT-treated Setdb1 tm1c/tm2 ES cells start to differentiate by 6 days after treatment and gradually lose alkaline phosphatase (AP) activity, while treated control Setdb1 +/tm1d ES cells retain AP activity and normal ES cell morphology.

Figure Legend Snippet: Generation and functional analysis of inducible conditional Setdb1 mutant ES cell lines. ( A ) Allelic structures and workflow of vector electroporations. IKMC heterozygous ‘knockout-first’ ( tm1a/ + ) ES cells are treated with Flp recombinase to generate a conditional allele ( tm1c ) and targeted with pI_hygGFP to generate conditional/null ( tm1c/tm2 ) cells. Cre-ERT2 is then introduced by targeting vector knockin into the Rosa26 locus. Upon treatment with 4′OHT, Cre recombinase activity removes the floxed ‘criticial exon’ of the tm1c allele to generate bi-allelic null cells ( tm1d/tm2 ). Primers for PCR genotyping are noted as small arrows. ( B ) Western blots showing absence of full-length Setdb1 protein (black arrow) in the Setdb1 tm1d/tm2 mutant ES cell lines after treatment with 4′OHT. A 39 kDa truncation product is generated from the tm2 allele (gray arrow). α-tubulin was used as a loading control (open arrow). ( C ) Setdb1 tm1d/tm2 mutant ES cells plated at low density (1 × 10∧3 cells per 10cm dish; following a 48 h 4′OHT treatment period) are unable to form colonies of undifferentiated ES cells, whereas control Setdb1 +/tm1d heterozygous ES cells (4′OHT treated and plated concurrently) exhibit normal undifferentiated ES cell colony morphology; a representative example is shown. Cells were stained with methylene blue 8 days after plating. ( D ) Growth of 4′OHT treated Setdb1 tm1d/tm2 null ES cells is severely compromised, while 4′OHT treated control Setdb1 +/tm1d heterozygous ES cells retain robust growth characteristics similar to non-treated Setdb1 tm1c/ + and tm1c/tm2 cells. Cells were plated following a 48 h 4′OHT treatment and counted at the time intervals indicated. Data points are the mean of three biological replicates (independent cell lines), error bars indicate s.d. ( E ) 4′OHT-treated Setdb1 tm1c/tm2 ES cells start to differentiate by 6 days after treatment and gradually lose alkaline phosphatase (AP) activity, while treated control Setdb1 +/tm1d ES cells retain AP activity and normal ES cell morphology.

Techniques Used: Functional Assay, Mutagenesis, Plasmid Preparation, Knock-Out, Knock-In, Activity Assay, Polymerase Chain Reaction, Western Blot, Generated, Staining

Schematic of allele structures in second allele targeted and revertant ES cells and cell line validation. ( A ) Insertion-type targeting vector pI_hygGFP for inactivation of the WT allele in ES cells heterozygous for a standard IKMC knockout-first allele ( tm1a ). ( B ) Structure of the bi-allelic locus after targeting the second allele. The tm2 allele contains the pI_hygGFP targeting cassette and duplicated homology region, where exon 2 is re-generated by gap repair. ( C ) Western blots of Cbx1 and Jarid2 parental IKMC heterozygous ES cells (B01 and E08 lines), and examples of cell lines following pI_hygGFP electroporation including doubly targeted ES cells ( 1a/2 ) showing the absence of protein expression, and failed targeting events ( 1a/+ ). ( D ) Reversion from null mutant ( 1a/2 ) to conditional mutant ( 1c/2 ) by Flp recombinase. ( E ) Western blots of mutant ( 1a/2 ) and reverted ( 1c/2 ) Cbx1 and Jarid2 ES cell lines showing re-expression of protein. Primers for LR-PCR genotyping are indicated by small arrows and α-tubulin was used for Western blot loading controls. ( F ) Rescue of Polycomb PRC1 recruitment to PRC2 target genes in Jarid2 revertant cell lines ( 1c/2 ), shown by reinstatement of Mel18 binding at known Jarid2-dependent gene promoter regions, assessed by chromatin immunoprecipitation (ChIP)-qRT-PCR. Hprt is a control locus known to be negative for PRC1 binding. Results show mean ± s.d. of three biological replicates (independent cell lines), where values are expressed as relative fold-enrichment over 10% input chromatin. Asterisks indicate statistically significant differences between Jarid2 revertant ( 1c/2 ) and null ( 1a/2 ) cell lines ( P

Figure Legend Snippet: Schematic of allele structures in second allele targeted and revertant ES cells and cell line validation. ( A ) Insertion-type targeting vector pI_hygGFP for inactivation of the WT allele in ES cells heterozygous for a standard IKMC knockout-first allele ( tm1a ). ( B ) Structure of the bi-allelic locus after targeting the second allele. The tm2 allele contains the pI_hygGFP targeting cassette and duplicated homology region, where exon 2 is re-generated by gap repair. ( C ) Western blots of Cbx1 and Jarid2 parental IKMC heterozygous ES cells (B01 and E08 lines), and examples of cell lines following pI_hygGFP electroporation including doubly targeted ES cells ( 1a/2 ) showing the absence of protein expression, and failed targeting events ( 1a/+ ). ( D ) Reversion from null mutant ( 1a/2 ) to conditional mutant ( 1c/2 ) by Flp recombinase. ( E ) Western blots of mutant ( 1a/2 ) and reverted ( 1c/2 ) Cbx1 and Jarid2 ES cell lines showing re-expression of protein. Primers for LR-PCR genotyping are indicated by small arrows and α-tubulin was used for Western blot loading controls. ( F ) Rescue of Polycomb PRC1 recruitment to PRC2 target genes in Jarid2 revertant cell lines ( 1c/2 ), shown by reinstatement of Mel18 binding at known Jarid2-dependent gene promoter regions, assessed by chromatin immunoprecipitation (ChIP)-qRT-PCR. Hprt is a control locus known to be negative for PRC1 binding. Results show mean ± s.d. of three biological replicates (independent cell lines), where values are expressed as relative fold-enrichment over 10% input chromatin. Asterisks indicate statistically significant differences between Jarid2 revertant ( 1c/2 ) and null ( 1a/2 ) cell lines ( P

Techniques Used: Plasmid Preparation, Knock-Out, Generated, Western Blot, Electroporation, Expressing, Mutagenesis, Polymerase Chain Reaction, Binding Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR

11) Product Images from "Therapeutic effect of green tea extract on alcohol induced hepatic mitochondrial DNA damage in albino wistar rats"

Article Title: Therapeutic effect of green tea extract on alcohol induced hepatic mitochondrial DNA damage in albino wistar rats

Journal: Journal of Advanced Research

doi: 10.1016/j.jare.2017.02.002

Long-extension PCR analysis of mtDNA deletions in hepatic tissue of experimental rats: M: DNA size marker; C: Controls; ALC: Alcohol; and GTE: Green tea extract.

Figure Legend Snippet: Long-extension PCR analysis of mtDNA deletions in hepatic tissue of experimental rats: M: DNA size marker; C: Controls; ALC: Alcohol; and GTE: Green tea extract.

Techniques Used: Polymerase Chain Reaction, Marker

12) Product Images from "Structural polymorphism in the promoter of pfmrp2 confers Plasmodium falciparum tolerance to quinoline drugs"

Article Title: Structural polymorphism in the promoter of pfmrp2 confers Plasmodium falciparum tolerance to quinoline drugs

Journal: Molecular Microbiology

doi: 10.1111/mmi.12505

Deletion of the pfmrp2 gene 5′ upstream sequence identified by PCR and sequencing.A. A map of the 5′ upstream region of the 3D7 pfmrp2 gene showing the panel of used primer pairs (purple) and their positions relative to the gene start codon. Listed are the sizes of the PCR products obtained for clones 11C/wt and 6A/mut for the various primer pairs. Bottom panel: Agarose gel images of PCR products obtained for the corresponding primer pairs. The images show full-length PCR products obtained for clone 11C/wt for all primer pairs and the truncated products for the primer pairs 1.9 and 1.12 from 6A/mut.B. Sequence alignment of clone 11C/wt and clone 6A/mut compared to 3D7 sequence (PlasmoDB version 8.1). The sequence alignment depicts the 200 bp coding sequence of the pfmrp2 gene at the 5′ end and its upstream, non-coding region. The grey dotted lines indicate the break points of the 6A/mut deletion. The numbers indicate the base position relative to the start codon. Two DNA constructs of 6A/mut of 0.3 and 0.5 kb in size were sequenced to identify the deletion break point as −4345th bp from the start codon.

Figure Legend Snippet: Deletion of the pfmrp2 gene 5′ upstream sequence identified by PCR and sequencing.A. A map of the 5′ upstream region of the 3D7 pfmrp2 gene showing the panel of used primer pairs (purple) and their positions relative to the gene start codon. Listed are the sizes of the PCR products obtained for clones 11C/wt and 6A/mut for the various primer pairs. Bottom panel: Agarose gel images of PCR products obtained for the corresponding primer pairs. The images show full-length PCR products obtained for clone 11C/wt for all primer pairs and the truncated products for the primer pairs 1.9 and 1.12 from 6A/mut.B. Sequence alignment of clone 11C/wt and clone 6A/mut compared to 3D7 sequence (PlasmoDB version 8.1). The sequence alignment depicts the 200 bp coding sequence of the pfmrp2 gene at the 5′ end and its upstream, non-coding region. The grey dotted lines indicate the break points of the 6A/mut deletion. The numbers indicate the base position relative to the start codon. Two DNA constructs of 6A/mut of 0.3 and 0.5 kb in size were sequenced to identify the deletion break point as −4345th bp from the start codon.

Techniques Used: Sequencing, Polymerase Chain Reaction, Clone Assay, Agarose Gel Electrophoresis, Construct

13) Product Images from "A20 Orchestrates Inflammatory Response in the Oral Mucosa through Restraining NF-κB Activity"

Article Title: A20 Orchestrates Inflammatory Response in the Oral Mucosa through Restraining NF-κB Activity

Journal: The Journal of Immunology Author Choice

doi: 10.4049/jimmunol.1801286

A20 expression is increased in human macrophages upon P. gingivalis infection. THP-1 cells were infected with P. gingivalis (100 MOI) for the indicated time, and cells were harvested and applied to qRT-PCR ( A ) and Western blot ( B ), and the protein levels were plotted ( C ). The blots are derived from the same protein samples. Results are representative of a minimum of three independent experiments with averages and SD shown. All through the manuscript, blots within one panel are derived from the same protein samples.** p ≤ 0.01, **** p ≤ 0.0001.

Figure Legend Snippet: A20 expression is increased in human macrophages upon P. gingivalis infection. THP-1 cells were infected with P. gingivalis (100 MOI) for the indicated time, and cells were harvested and applied to qRT-PCR ( A ) and Western blot ( B ), and the protein levels were plotted ( C ). The blots are derived from the same protein samples. Results are representative of a minimum of three independent experiments with averages and SD shown. All through the manuscript, blots within one panel are derived from the same protein samples.** p ≤ 0.01, **** p ≤ 0.0001.

Techniques Used: Expressing, Infection, Quantitative RT-PCR, Western Blot, Derivative Assay

Partial A20 loss instigates increased gingival inflammation and alveolar bone loss compared with A20-competent mice. Silk 5-0 threads were placed at the left side of the maxilla interdentally between the first and second maxillary molars, and the right sides were left unligated as controls on A20 +/+ and A20 +/− mice. The bone loss was determined by micro-CT ( A ), and the cemento-enamel-junction–alveolar bone crest was analyzed and plotted ( B ) ( n = 17 for A20 +/+ , n = 16 for A20 +/− ). Averages and SD are shown. Gingival tissues derived from ligated or control periodontium were applied to H E staining ( C ) and observed under microscope, and the percentage of inflammatory cells in the periodontium were calculated and plotted ( D ). Data are representative of three independent experiments, with a minimum of four mice analyzed in each group per experiment. The gingival tissues derived from ligated or control periodontium were digested and applied to RNA preparation. The mRNA levels of mIL-6 ( E ), mTNF ( F ), mIL-17 ( G ), and mIL-23 ( H ) were determined with qRT-PCR, and the relative mRNA expression levels were plotted. Data are representative of three independent experiments analyzed, with averages and SD shown. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.

Figure Legend Snippet: Partial A20 loss instigates increased gingival inflammation and alveolar bone loss compared with A20-competent mice. Silk 5-0 threads were placed at the left side of the maxilla interdentally between the first and second maxillary molars, and the right sides were left unligated as controls on A20 +/+ and A20 +/− mice. The bone loss was determined by micro-CT ( A ), and the cemento-enamel-junction–alveolar bone crest was analyzed and plotted ( B ) ( n = 17 for A20 +/+ , n = 16 for A20 +/− ). Averages and SD are shown. Gingival tissues derived from ligated or control periodontium were applied to H E staining ( C ) and observed under microscope, and the percentage of inflammatory cells in the periodontium were calculated and plotted ( D ). Data are representative of three independent experiments, with a minimum of four mice analyzed in each group per experiment. The gingival tissues derived from ligated or control periodontium were digested and applied to RNA preparation. The mRNA levels of mIL-6 ( E ), mTNF ( F ), mIL-17 ( G ), and mIL-23 ( H ) were determined with qRT-PCR, and the relative mRNA expression levels were plotted. Data are representative of three independent experiments analyzed, with averages and SD shown. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.

Techniques Used: Mouse Assay, Micro-CT, Derivative Assay, Staining, Microscopy, Quantitative RT-PCR, Expressing

14) Product Images from "The Intracellular Redox Stress Caused by Hexavalent Chromium is Selective for Proteins that Have Key Roles in Cell Survival and Thiol Redox Control"

Article Title: The Intracellular Redox Stress Caused by Hexavalent Chromium is Selective for Proteins that Have Key Roles in Cell Survival and Thiol Redox Control

Journal: Toxicology

doi: 10.1016/j.tox.2011.01.001

Cr(VI) treatment does not cause detectable DNA damage in the mitochondria or nucleus of BEAS-2B cells. Representative PCR of total DNA using primers that amplify 16.2 kb of mitochondrial DNA (A), or a 13.5-kb region of nuclear DNA encoding the β-globin

Figure Legend Snippet: Cr(VI) treatment does not cause detectable DNA damage in the mitochondria or nucleus of BEAS-2B cells. Representative PCR of total DNA using primers that amplify 16.2 kb of mitochondrial DNA (A), or a 13.5-kb region of nuclear DNA encoding the β-globin

Techniques Used: Polymerase Chain Reaction

15) Product Images from "Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿"

Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.01236-09

Susceptibility of wild-type, CsA-resistant, and CsA/NIM-resistant cells to CsA and NIM811. Wild-type (DMSOr), CsAr, and CsA/NIMr clones were treated for 48 h with CsA (A) or NIM811 (B). Viral RNA was quantified by qRT-PCR and normalized to total cellular RNA. The susceptibility curves of a representative experiment (A and B) show the level of viral RNA after drug treatment as the percentage of DMSO control cells. The standard deviation of six replicas is included. The experiment has been repeated several times, and the same trend has been observed. The EC 50 for CsA was 0.66, 3.39, and > 10 μM in DMSOr, CsAr, and CsA/NIMr replicon-containing cells, respectively. The EC 50 for NIM811 was 0.21, 0.83, and 3.5 μM in DMSOr, CsAr, and CsA/NIMr replicon-containing cells, respectively.

Figure Legend Snippet: Susceptibility of wild-type, CsA-resistant, and CsA/NIM-resistant cells to CsA and NIM811. Wild-type (DMSOr), CsAr, and CsA/NIMr clones were treated for 48 h with CsA (A) or NIM811 (B). Viral RNA was quantified by qRT-PCR and normalized to total cellular RNA. The susceptibility curves of a representative experiment (A and B) show the level of viral RNA after drug treatment as the percentage of DMSO control cells. The standard deviation of six replicas is included. The experiment has been repeated several times, and the same trend has been observed. The EC 50 for CsA was 0.66, 3.39, and > 10 μM in DMSOr, CsAr, and CsA/NIMr replicon-containing cells, respectively. The EC 50 for NIM811 was 0.21, 0.83, and 3.5 μM in DMSOr, CsAr, and CsA/NIMr replicon-containing cells, respectively.

Techniques Used: Clone Assay, Quantitative RT-PCR, Standard Deviation

16) Product Images from "Characterization of a Cytolytic Strain of Equine Infectious Anemia Virus"

Article Title: Characterization of a Cytolytic Strain of Equine Infectious Anemia Virus

Journal: Journal of Virology

doi: 10.1128/JVI.77.4.2385-2399.2003

Restriction site polymorphism analysis of PCR-amplified DNA from Hirt supernatants demonstrated that vMA-1c is able to superinfect ED cells but not Cf 2 Th cells. Naïve or chronically infected ED cells were infected with MA-1 or vMA-1c for 4 days. Low-molecular-weight (Hirt) DNA was isolated from infected cells, and DNA was amplified with EIAV env primers 6743 and 7426C′. (A) vMA-1c is able to superinfect MA-1-infected ED cells but not MA-1-infected Cf 2 Th cells. env DNA was amplified from MA-1-infected cells and contained two Msc I sites producing 286-, 200-, and 194-bp bands upon Msc I digestion. The sites were not present in vMA-1c, resulting in a 683-bp band. Msc I did not cutthe MA-1-amplified DNA to completion, presumably due to restriction site polymorphisms present in the MA-1 stock, and partially digested bands are evident in the gel. An asterisk indicates the 683-bp band, and the arrows identify the completely digested fragments. (B) vMA-1c is able to superinfect pSP19-2-infected ED cells but not pSP19-2-infected Cf 2 Th cells. The parental MA-1 virus was unable to superinfect either of the chronically pSP19-2-infected cell populations. Low-molecular-weight DNA was PCR amplified with primers 6743 and 7426C′ from chronically pSP19-2-infected ED and Cf 2 Th cells superinfected with vMA-1c or MA-1. Restriction site polymorphism analysis was then performed with Bst EII digestion. pSP19-2 contains a Bst EII site, producing 439- and 244-bp bands upon digestion; the site was not present in vMA-1c or MA-1, resulting in a 683-bp band. An asterisk indicates the 683-bp band, and the arrows identify the completely digested fragments.

Figure Legend Snippet: Restriction site polymorphism analysis of PCR-amplified DNA from Hirt supernatants demonstrated that vMA-1c is able to superinfect ED cells but not Cf 2 Th cells. Naïve or chronically infected ED cells were infected with MA-1 or vMA-1c for 4 days. Low-molecular-weight (Hirt) DNA was isolated from infected cells, and DNA was amplified with EIAV env primers 6743 and 7426C′. (A) vMA-1c is able to superinfect MA-1-infected ED cells but not MA-1-infected Cf 2 Th cells. env DNA was amplified from MA-1-infected cells and contained two Msc I sites producing 286-, 200-, and 194-bp bands upon Msc I digestion. The sites were not present in vMA-1c, resulting in a 683-bp band. Msc I did not cutthe MA-1-amplified DNA to completion, presumably due to restriction site polymorphisms present in the MA-1 stock, and partially digested bands are evident in the gel. An asterisk indicates the 683-bp band, and the arrows identify the completely digested fragments. (B) vMA-1c is able to superinfect pSP19-2-infected ED cells but not pSP19-2-infected Cf 2 Th cells. The parental MA-1 virus was unable to superinfect either of the chronically pSP19-2-infected cell populations. Low-molecular-weight DNA was PCR amplified with primers 6743 and 7426C′ from chronically pSP19-2-infected ED and Cf 2 Th cells superinfected with vMA-1c or MA-1. Restriction site polymorphism analysis was then performed with Bst EII digestion. pSP19-2 contains a Bst EII site, producing 439- and 244-bp bands upon digestion; the site was not present in vMA-1c or MA-1, resulting in a 683-bp band. An asterisk indicates the 683-bp band, and the arrows identify the completely digested fragments.

Techniques Used: Polymerase Chain Reaction, Amplification, Infection, Molecular Weight, Isolation

17) Product Images from "Acquired Bacitracin Resistance in Enterococcus faecalis Is Mediated by an ABC Transporter and a Novel Regulatory Protein, BcrR"

Article Title: Acquired Bacitracin Resistance in Enterococcus faecalis Is Mediated by an ABC Transporter and a Novel Regulatory Protein, BcrR

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.48.10.3743-3748.2004

Organization and restriction map of the bcr region in E. faecalis AR01/DGVS. Open arrows indicate the positions of ORFs. The restriction sites and fragments used to generate further constructs are shown. PCR products and probes are indicated by thick black lines, and transcriptional terminators are indicated by circles on stems. The Tn 917 insertion sites in bacitracin-sensitive mutants DGM2 and DGM4 are represented by triangles.

Figure Legend Snippet: Organization and restriction map of the bcr region in E. faecalis AR01/DGVS. Open arrows indicate the positions of ORFs. The restriction sites and fragments used to generate further constructs are shown. PCR products and probes are indicated by thick black lines, and transcriptional terminators are indicated by circles on stems. The Tn 917 insertion sites in bacitracin-sensitive mutants DGM2 and DGM4 are represented by triangles.

Techniques Used: Construct, Polymerase Chain Reaction

18) Product Images from "Comparative Signature-Tagged Mutagenesis Identifies Pseudomonas Factors Conferring Resistance to the Pulmonary Collectin SP-A"

Article Title: Comparative Signature-Tagged Mutagenesis Identifies Pseudomonas Factors Conferring Resistance to the Pulmonary Collectin SP-A

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.0010031

PCR-Based Signature-Tagged Mutagenesis (A) Schematic drawing of PCR-based STM. Pools of 72 uniquely tagged mutants were intranasally inoculated into SP-A +/+ and SP-A −/− mice; 16 h later, lungs were harvested, homogenized, and plated. Approximately 10,000 colonies were harvested from the plates for genomic DNA extraction. PCR-amplification of tags was performed on the genomic DNA to screen for the presence or absence of DNA tags of each of the 72 mutants. Mutants whose DNA tags were present in the input pool and in the SP-A −/− pool, but absent in the SP-A +/+ pool (see white arrows) were further screened for susceptibility to SP-A. (B) Agarose gel of PCR-based STM, identifying the pch mutant (left panel). Attenuation in the first SP-A +/+ mouse (right panel, m1) was confirmed in two additional SP-A +/+ mice (right panel, m2 and m3). (C) Genetic loci of P. aeruginosa, when mutated, conferred increased sensitivity to in vivo killing by SP-A. DNA regions flanking pUTmini-Tn 5 transposon insertions were cloned and sequenced. Similarity BLAST searches were performed against P. aeruginosa PA01 genomic sequence on NCBI and on http://www.pseudomonas.com . Black arrows indicate the approximate insertion site within the mutated ORFS. (D) TLC analyses indicate that the pch STM mutant is unable to synthesize pyochelin (see arrows). Wild-type PA01 grown in LB and the pch mutant grown in LB supplemented with 1 mM salicylate produced green color pyochelin (see arrows). In contrast, no observable pyochelin was produced by the pch and PA06331 strains. Pure pyochelin was used as control. (E) Restriction fragment length polymorphism analysis between parental wild-type PA01 and STM mutants confirmed that mutations in pch and ptsP were caused by a single insertion.

Figure Legend Snippet: PCR-Based Signature-Tagged Mutagenesis (A) Schematic drawing of PCR-based STM. Pools of 72 uniquely tagged mutants were intranasally inoculated into SP-A +/+ and SP-A −/− mice; 16 h later, lungs were harvested, homogenized, and plated. Approximately 10,000 colonies were harvested from the plates for genomic DNA extraction. PCR-amplification of tags was performed on the genomic DNA to screen for the presence or absence of DNA tags of each of the 72 mutants. Mutants whose DNA tags were present in the input pool and in the SP-A −/− pool, but absent in the SP-A +/+ pool (see white arrows) were further screened for susceptibility to SP-A. (B) Agarose gel of PCR-based STM, identifying the pch mutant (left panel). Attenuation in the first SP-A +/+ mouse (right panel, m1) was confirmed in two additional SP-A +/+ mice (right panel, m2 and m3). (C) Genetic loci of P. aeruginosa, when mutated, conferred increased sensitivity to in vivo killing by SP-A. DNA regions flanking pUTmini-Tn 5 transposon insertions were cloned and sequenced. Similarity BLAST searches were performed against P. aeruginosa PA01 genomic sequence on NCBI and on http://www.pseudomonas.com . Black arrows indicate the approximate insertion site within the mutated ORFS. (D) TLC analyses indicate that the pch STM mutant is unable to synthesize pyochelin (see arrows). Wild-type PA01 grown in LB and the pch mutant grown in LB supplemented with 1 mM salicylate produced green color pyochelin (see arrows). In contrast, no observable pyochelin was produced by the pch and PA06331 strains. Pure pyochelin was used as control. (E) Restriction fragment length polymorphism analysis between parental wild-type PA01 and STM mutants confirmed that mutations in pch and ptsP were caused by a single insertion.

Techniques Used: Polymerase Chain Reaction, Mutagenesis, Mouse Assay, DNA Extraction, Amplification, Agarose Gel Electrophoresis, In Vivo, Clone Assay, Sequencing, Thin Layer Chromatography, Produced

19) Product Images from "A widely conserved bacterial cytoskeletal component influences unique helical shape and motility of the spirochete Leptospira biflexa"

Article Title: A widely conserved bacterial cytoskeletal component influences unique helical shape and motility of the spirochete Leptospira biflexa

Journal: Molecular microbiology

doi: 10.1111/mmi.13917

Bactofilin transcript levels do not change to compensate for the loss of lbbD transcripts Quantitative RT-PCR analysis of the transcript levels of the five bactofilin genes in wild type and mutant strains. Transcript from each gene was normalized to 1 copy of flaB transcript. Each point represents a biological replicate (averaged from 3 technical replicates) from independent RNA preparations ± the standard deviation. Ordinary one-way ANOVA was applied to determine statistical differences (* denotes P value

Figure Legend Snippet: Bactofilin transcript levels do not change to compensate for the loss of lbbD transcripts Quantitative RT-PCR analysis of the transcript levels of the five bactofilin genes in wild type and mutant strains. Transcript from each gene was normalized to 1 copy of flaB transcript. Each point represents a biological replicate (averaged from 3 technical replicates) from independent RNA preparations ± the standard deviation. Ordinary one-way ANOVA was applied to determine statistical differences (* denotes P value

Techniques Used: Quantitative RT-PCR, Mutagenesis, Standard Deviation

20) Product Images from "Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis"

Article Title: Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis

Journal: Infection and Immunity

doi: 10.1128/IAI.00144-12

fpt genes are expressed during intracellular growth. J774.1 cells were infected with LVS for a period of 20 h. Following overnight incubation, RNA was isolated, cDNA was generated, and the presence of fpt transcripts was confirmed by PCR with Fpt gene-specific primers. For each labeled gene, lane 1 represents the gene-specific PCR product amplified from cDNA, lane 2 is a non-RT negative control for genomic DNA contamination, and lane 3 is a positive control where the specified gene was amplified from LVS genomic DNA.

Figure Legend Snippet: fpt genes are expressed during intracellular growth. J774.1 cells were infected with LVS for a period of 20 h. Following overnight incubation, RNA was isolated, cDNA was generated, and the presence of fpt transcripts was confirmed by PCR with Fpt gene-specific primers. For each labeled gene, lane 1 represents the gene-specific PCR product amplified from cDNA, lane 2 is a non-RT negative control for genomic DNA contamination, and lane 3 is a positive control where the specified gene was amplified from LVS genomic DNA.

Techniques Used: Infection, Incubation, Isolation, Generated, Polymerase Chain Reaction, Labeling, Amplification, Negative Control, Positive Control

21) Product Images from "Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans"

Article Title: Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans

Journal: Human Molecular Genetics

doi: 10.1093/hmg/ddu210

The 5′UTR CGG repeat causes a significant increase in mRNA level. Total RNA from adult transgenic animals was extracted, reverse-transcribed into cDNA, and quantified by real-time PCR. GFP mRNA expression was increased ∼5-fold in animals expressing p AWC ::FMR(CGG) 99 ::GFP compared with control (0CGG) animals, which was set to 1. (Error bars: SEM.) The data were collected from four independently isolated populations of animals.

Figure Legend Snippet: The 5′UTR CGG repeat causes a significant increase in mRNA level. Total RNA from adult transgenic animals was extracted, reverse-transcribed into cDNA, and quantified by real-time PCR. GFP mRNA expression was increased ∼5-fold in animals expressing p AWC ::FMR(CGG) 99 ::GFP compared with control (0CGG) animals, which was set to 1. (Error bars: SEM.) The data were collected from four independently isolated populations of animals.

Techniques Used: Transgenic Assay, Real-time Polymerase Chain Reaction, Expressing, Isolation

Expression of 99 CGG repeats in the 5′UTR results in olfactory adaptation defects. ( A ) Animals carrying the control GFP reporter with 0 CGGs in the 5′UTR behave like wild type. Transgenic strains (‘+’; express the FMR1 reporter and p unc-122 ::GFP in coelomocytes) and siblings that lost the transgene (‘−’) were grown on the same plates. Bars and error bars represent the mean CIs and standard errors of the mean (SEM) from at least 3 independent assay days from populations that were either naïve (white or gray bars) or pre-exposed to odor (black or hatched bars). To quantitate the relative gDNA levels, total gDNA from the larval stage 4 (L4) animals was extracted and subjected to real-time PCR. The relative levels of the 0CGG and 99CGG reporters were normalized to the housekeeping gene, act-3 . The data were collected from three independent experiments. ‘±’ indicates the values of SEM. ( B ) 100% of lines that express 99 CGG repeats are defective for olfactory adaptation. The chemotaxis and adaptation values for seven transgenic lines (lines 1–7) carrying the p AWC ::FMR(CGG) 99 ::GFP construct (labeled (+)) were compared with their siblings without transgenes (labeled (−)). Data are from at least five independent assays and are labeled as in Figure 3 A. P -values indicate results of two-tailed t -tests between the CIs of transgenic- (+) and non-transgenic (−) adapted animals in the same transgenic strain. ‘n.s.’ indicates no significant difference, as P -value is > 0.05. The relative gDNA levels are presented at the bottom line. ( C ) PCR genotyping of transgenic animals carrying 99 CGG repeats. gDNA from individual strains was extracted and genotyped with two primers flanking the CGG-repeat area. The PCR product is 505 bp, indicated by an arrow, and the p AWC ::FMR(CGG) 99 ::GFP plasmid, referred as CGG plasmid, was used as a positive control. Amplification of an endogenous control, act-3 , is shown below. ‘*’ indicates non-specific amplification. The absence of a band for line 8 indicates that this line had lost the FMR1 reporter.

Figure Legend Snippet: Expression of 99 CGG repeats in the 5′UTR results in olfactory adaptation defects. ( A ) Animals carrying the control GFP reporter with 0 CGGs in the 5′UTR behave like wild type. Transgenic strains (‘+’; express the FMR1 reporter and p unc-122 ::GFP in coelomocytes) and siblings that lost the transgene (‘−’) were grown on the same plates. Bars and error bars represent the mean CIs and standard errors of the mean (SEM) from at least 3 independent assay days from populations that were either naïve (white or gray bars) or pre-exposed to odor (black or hatched bars). To quantitate the relative gDNA levels, total gDNA from the larval stage 4 (L4) animals was extracted and subjected to real-time PCR. The relative levels of the 0CGG and 99CGG reporters were normalized to the housekeeping gene, act-3 . The data were collected from three independent experiments. ‘±’ indicates the values of SEM. ( B ) 100% of lines that express 99 CGG repeats are defective for olfactory adaptation. The chemotaxis and adaptation values for seven transgenic lines (lines 1–7) carrying the p AWC ::FMR(CGG) 99 ::GFP construct (labeled (+)) were compared with their siblings without transgenes (labeled (−)). Data are from at least five independent assays and are labeled as in Figure 3 A. P -values indicate results of two-tailed t -tests between the CIs of transgenic- (+) and non-transgenic (−) adapted animals in the same transgenic strain. ‘n.s.’ indicates no significant difference, as P -value is > 0.05. The relative gDNA levels are presented at the bottom line. ( C ) PCR genotyping of transgenic animals carrying 99 CGG repeats. gDNA from individual strains was extracted and genotyped with two primers flanking the CGG-repeat area. The PCR product is 505 bp, indicated by an arrow, and the p AWC ::FMR(CGG) 99 ::GFP plasmid, referred as CGG plasmid, was used as a positive control. Amplification of an endogenous control, act-3 , is shown below. ‘*’ indicates non-specific amplification. The absence of a band for line 8 indicates that this line had lost the FMR1 reporter.

Techniques Used: Expressing, Transgenic Assay, Real-time Polymerase Chain Reaction, Activated Clotting Time Assay, Chemotaxis Assay, Construct, Labeling, Two Tailed Test, Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Amplification

Interactions between the premutation CGG repeats and adaptation-promoting pathways. ( A ) Olfactory adaptation. 99CGG animals were crossed with mutants defining three pathways: ALG-2 is an miRNA-specific Argonaute, FBF-1 up-regulates EGL-4 translation, and MUT-7 is required for siRNA processing. alg-2 knockout decreased the effect of expanded CGG repeats, reducing adaptation defects in the double mutants. Conversely, the adaptation defects of 99CGG animals crossed with fbf-1 and mut-7 mutants were partially additive to defects in 99CGG animals alone. CI experiments were performed in at least triplicate, and error bars represent SEM. ( B ) Genotyping of animals with transgenes. 206- and 505-bp PCR fragments were amplified in animals carrying p AWC ::FMR(CGG) 0 ::GFP and p AWC ::FMR(CGG) 99 ::GFP plasmids. A few non-specific bands are indicated by ‘*’. ( C ) Expanded-repeat mRNA levels had no significant change after crossing with alg-2 , fbf-1 , and mut-7 knockout lines. Bars represent the fold change of FMR(CGG) 99 mRNA levels in p AWC ::FMR(CGG) 99 ::GFP, or in either alg-2 , fbf-1 or mut-7 double mutants, respectively, compared to the mRNA levels of a control p AWC ::FMR(CGG) 0 ::GFP. The data were collected from four independent experiments.

Figure Legend Snippet: Interactions between the premutation CGG repeats and adaptation-promoting pathways. ( A ) Olfactory adaptation. 99CGG animals were crossed with mutants defining three pathways: ALG-2 is an miRNA-specific Argonaute, FBF-1 up-regulates EGL-4 translation, and MUT-7 is required for siRNA processing. alg-2 knockout decreased the effect of expanded CGG repeats, reducing adaptation defects in the double mutants. Conversely, the adaptation defects of 99CGG animals crossed with fbf-1 and mut-7 mutants were partially additive to defects in 99CGG animals alone. CI experiments were performed in at least triplicate, and error bars represent SEM. ( B ) Genotyping of animals with transgenes. 206- and 505-bp PCR fragments were amplified in animals carrying p AWC ::FMR(CGG) 0 ::GFP and p AWC ::FMR(CGG) 99 ::GFP plasmids. A few non-specific bands are indicated by ‘*’. ( C ) Expanded-repeat mRNA levels had no significant change after crossing with alg-2 , fbf-1 , and mut-7 knockout lines. Bars represent the fold change of FMR(CGG) 99 mRNA levels in p AWC ::FMR(CGG) 99 ::GFP, or in either alg-2 , fbf-1 or mut-7 double mutants, respectively, compared to the mRNA levels of a control p AWC ::FMR(CGG) 0 ::GFP. The data were collected from four independent experiments.

Techniques Used: Knock-Out, Polymerase Chain Reaction, Amplification

22) Product Images from "Contribution of Long Polar Fimbriae to the Virulence of Rabbit-Specific Enteropathogenic Escherichia coli"

Article Title: Contribution of Long Polar Fimbriae to the Virulence of Rabbit-Specific Enteropathogenic Escherichia coli

Journal: Infection and Immunity

doi: 10.1128/IAI.72.3.1230-1239.2004

RT-PCR analysis of lpf R141 . (A) Schematic organization of the lpf R141 operon and location of primers used for RT-PCR. (B) RT-PCR analysis of E. coli ORN103(pCR-Script: lpf R141 ) cDNA. Lanes 1 to 3, primers LPFAF and LPFAR; lanes 4 to 6, primers LPFCF and LPFCR; lanes 7 to 9, primers LPFDF and LPFDR; lanes 10 to 12, primers LPFEF and LPFER. (C) RT-PCR analysis of E. coli ORN103(pCR-Script: lpf R141 ) cDNA. Lanes 1 to 3, primers LPFAF and LPFBR. (D) RT-PCR analysis of REPEC 83/39 cDNA. Lanes 1 to 3, primers LPFDF and LPFDR. D, DNA control PCR; + and −, presence or absence of the RT reaction, respectively. The sizes of the PCR products are indicated.

Figure Legend Snippet: RT-PCR analysis of lpf R141 . (A) Schematic organization of the lpf R141 operon and location of primers used for RT-PCR. (B) RT-PCR analysis of E. coli ORN103(pCR-Script: lpf R141 ) cDNA. Lanes 1 to 3, primers LPFAF and LPFAR; lanes 4 to 6, primers LPFCF and LPFCR; lanes 7 to 9, primers LPFDF and LPFDR; lanes 10 to 12, primers LPFEF and LPFER. (C) RT-PCR analysis of E. coli ORN103(pCR-Script: lpf R141 ) cDNA. Lanes 1 to 3, primers LPFAF and LPFBR. (D) RT-PCR analysis of REPEC 83/39 cDNA. Lanes 1 to 3, primers LPFDF and LPFDR. D, DNA control PCR; + and −, presence or absence of the RT reaction, respectively. The sizes of the PCR products are indicated.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

23) Product Images from "High-Resolution Recombination Patterns in a Region of Human Chromosome 21 Measured by Sperm Typing"

Article Title: High-Resolution Recombination Patterns in a Region of Human Chromosome 21 Measured by Sperm Typing

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.0020070

$Crossover Distribution in Interval 15 for Three Different Individuals The breakpoint of the crossover was determined by genotyping the SNPs (shown as triangles on top of each graph) using PCR product obtained from individual crossovers. Percentages represent the fraction of crossovers counted between two adjacent informative SNPs and are plotted against the position of the crossover for both type A and the reciprocal type B recombinants. The numbers associated with each bar represent the recombination intensities in cM/Mb (see details in Protocol S2 ). (A) Crossover distribution in interval 15 for an individual based on 36 and 24 recombinants recovered from 66,000 and 44,000 meioses, respectively. Note that this individual has one more informative SNP 50 bp before the end of the interval compared to the other two donors. Only a small fraction of the crossovers occur within these last 50 bps, but the estimated recombination intensity ranges between ~200 to 300 cM/Mb because this region is so small. (B) Crossover distribution in a second donor based on 37 and 12 recombinants recovered from 66,000 and 24,000 meioses, respectively. (C) Crossover distribution for a third donor based on 23 and 43 recombinants recovered from 66,000 and 88,000 meioses, respectively. For a detailed comparison of the crossover distribution with the three LD based estimates, see Protocol S5 .$
Figure Legend Snippet: Crossover Distribution in Interval 15 for Three Different Individuals The breakpoint of the crossover was determined by genotyping the SNPs (shown as triangles on top of each graph) using PCR product obtained from individual crossovers. Percentages represent the fraction of crossovers counted between two adjacent informative SNPs and are plotted against the position of the crossover for both type A and the reciprocal type B recombinants. The numbers associated with each bar represent the recombination intensities in cM/Mb (see details in Protocol S2 ). (A) Crossover distribution in interval 15 for an individual based on 36 and 24 recombinants recovered from 66,000 and 44,000 meioses, respectively. Note that this individual has one more informative SNP 50 bp before the end of the interval compared to the other two donors. Only a small fraction of the crossovers occur within these last 50 bps, but the estimated recombination intensity ranges between ~200 to 300 cM/Mb because this region is so small. (B) Crossover distribution in a second donor based on 37 and 12 recombinants recovered from 66,000 and 24,000 meioses, respectively. (C) Crossover distribution for a third donor based on 23 and 43 recombinants recovered from 66,000 and 88,000 meioses, respectively. For a detailed comparison of the crossover distribution with the three LD based estimates, see Protocol S5 .

Techniques Used: Polymerase Chain Reaction

Illustration of the Experimental Approach (A) Shown here are all four possible meiotic products. One of the two recombinants (R 1 ) is selectively amplified in two rounds of allele-specific PCR by using forward and the reverse primers that both form a perfect match with the chosen crossover type, in this case R 1 (shown here in a red box). One mismatch is formed with the two non-recombinant (NR 1 and NR 2 ) meiotic products and two mismatches with the other crossover type (R 2 ). In a second PCR round, new allele-specific primers anneal to an internal pair of SNPs and the specific recombinant is enriched further. (B) In order to analyze a million meioses, ~300 aliquots containing ~3,000 sperm genomes were analyzed. Given that recombination is a rare event, only a few aliquots contain a single recombinant molecule (aliquot with a single recombinant shown in red). The second PCR was performed in a real-time PCR machine to monitor the preferential amplification of the chosen recombinant over the other meiotic products. (C) The amplification curve obtained for each sperm aliquot was compared to the amplification obtained for positive controls (containing non-recombinants with, on average, one added recombinant which, based on the Poisson distribution, will render only 65% of the aliquots positive) and negative controls (containing only non-recombinants). Two distinct clusters are formed of positive and negative amplification curves. The number of sperm aliquots with positive amplification curves was considered the number of recombinants. Similarly, sperm aliquots with negative amplification curves were considered not to contain a recombinant. Additional details can be found in Materials and Methods .

Figure Legend Snippet: Illustration of the Experimental Approach (A) Shown here are all four possible meiotic products. One of the two recombinants (R 1 ) is selectively amplified in two rounds of allele-specific PCR by using forward and the reverse primers that both form a perfect match with the chosen crossover type, in this case R 1 (shown here in a red box). One mismatch is formed with the two non-recombinant (NR 1 and NR 2 ) meiotic products and two mismatches with the other crossover type (R 2 ). In a second PCR round, new allele-specific primers anneal to an internal pair of SNPs and the specific recombinant is enriched further. (B) In order to analyze a million meioses, ~300 aliquots containing ~3,000 sperm genomes were analyzed. Given that recombination is a rare event, only a few aliquots contain a single recombinant molecule (aliquot with a single recombinant shown in red). The second PCR was performed in a real-time PCR machine to monitor the preferential amplification of the chosen recombinant over the other meiotic products. (C) The amplification curve obtained for each sperm aliquot was compared to the amplification obtained for positive controls (containing non-recombinants with, on average, one added recombinant which, based on the Poisson distribution, will render only 65% of the aliquots positive) and negative controls (containing only non-recombinants). Two distinct clusters are formed of positive and negative amplification curves. The number of sperm aliquots with positive amplification curves was considered the number of recombinants. Similarly, sperm aliquots with negative amplification curves were considered not to contain a recombinant. Additional details can be found in Materials and Methods .

Techniques Used: Amplification, Polymerase Chain Reaction, Recombinant, Real-time Polymerase Chain Reaction

24) Product Images from "Human FasL Gene Is a Target of ?-Catenin/T-Cell Factor Pathway and Complex FasL Haplotypes Alter Promoter Functions"

Article Title: Human FasL Gene Is a Target of ?-Catenin/T-Cell Factor Pathway and Complex FasL Haplotypes Alter Promoter Functions

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026143

Binding of TCF-4 and β-catenin to the distal FasL TCF/LEF-1 binding element (TBE1). A ). Radio-labeled wild-type TBE1 probe (lane 1-5) and mutant TBE1 probe (lane 6) were incubated with 8 µg of SW480 cell nuclear extracts for 30 min. Competition experiments were performed by preincubating with 200 fold molar excess of the unlabeled TBE1 probes (Cold SP, lane 3), or non-specific probe (Cold NP, lane 5). Antibody binding experiments were carried out following the vendor's instruction with anti-TCF-4 antibody (lane 4) and rabbit IgG as control (lane 1). The arrow indicates the position of specific transcription factor complexes. Results shown were representative of four experiments. B ). Radio-labeled TBE1 (lane 1-4) and mutant TBE1 probes (lane 5) were incubated with 8 µg of Jurkat cell nuclear extracts for 30 min. Antibody binding experiments were carried out with anti-β-catenin antibody (lane 3). The arrows indicate the position of specific transcription factor complexes. Results shown are representative of four experiments. C ). TCF-4 bound to the TBE1 of FasL promoter in a Chromatin Immunoprecipitation Assay (ChIP). ChIP assay was performed as described in “ Materials and Methods ”. Rabbit anti-human TCF-4 antibody was used to precipitate Jurkat T cell chromatin complexes containing FasL promoter DNA fragment (lane 5). The appropriate positive (lane 2) and negative controls (lane 3 and 4) were included. Lane 1 contained DNA molecular weight marker (100 bp DNA ladders). D ). β-catenin bound to the FasL promoter TBE1 in a ChIP assay. Mouse monoclonal antibody against human β-catenin was used to precipitate Jurkat T cell chromatin complexes containing FasL promoter DNA fragment (lane 5). The appropriate positive (lane 2) and negative controls (lane 3 and 4) were included. Lane 1 contained DNA molecular weight marker (100 bp DNA ladders). The positive PCR products were shown as 163 bp DNA bands (pointed by arrow) in ChIP assays. The identity of DNA band was further confirmed with DNA sequencing.

Figure Legend Snippet: Binding of TCF-4 and β-catenin to the distal FasL TCF/LEF-1 binding element (TBE1). A ). Radio-labeled wild-type TBE1 probe (lane 1-5) and mutant TBE1 probe (lane 6) were incubated with 8 µg of SW480 cell nuclear extracts for 30 min. Competition experiments were performed by preincubating with 200 fold molar excess of the unlabeled TBE1 probes (Cold SP, lane 3), or non-specific probe (Cold NP, lane 5). Antibody binding experiments were carried out following the vendor's instruction with anti-TCF-4 antibody (lane 4) and rabbit IgG as control (lane 1). The arrow indicates the position of specific transcription factor complexes. Results shown were representative of four experiments. B ). Radio-labeled TBE1 (lane 1-4) and mutant TBE1 probes (lane 5) were incubated with 8 µg of Jurkat cell nuclear extracts for 30 min. Antibody binding experiments were carried out with anti-β-catenin antibody (lane 3). The arrows indicate the position of specific transcription factor complexes. Results shown are representative of four experiments. C ). TCF-4 bound to the TBE1 of FasL promoter in a Chromatin Immunoprecipitation Assay (ChIP). ChIP assay was performed as described in “ Materials and Methods ”. Rabbit anti-human TCF-4 antibody was used to precipitate Jurkat T cell chromatin complexes containing FasL promoter DNA fragment (lane 5). The appropriate positive (lane 2) and negative controls (lane 3 and 4) were included. Lane 1 contained DNA molecular weight marker (100 bp DNA ladders). D ). β-catenin bound to the FasL promoter TBE1 in a ChIP assay. Mouse monoclonal antibody against human β-catenin was used to precipitate Jurkat T cell chromatin complexes containing FasL promoter DNA fragment (lane 5). The appropriate positive (lane 2) and negative controls (lane 3 and 4) were included. Lane 1 contained DNA molecular weight marker (100 bp DNA ladders). The positive PCR products were shown as 163 bp DNA bands (pointed by arrow) in ChIP assays. The identity of DNA band was further confirmed with DNA sequencing.

Techniques Used: Binding Assay, Labeling, Mutagenesis, Incubation, Chromatin Immunoprecipitation, Molecular Weight, Marker, Polymerase Chain Reaction, DNA Sequencing

Binding of TCF-4 and β-catenin to the proximal FasL TCF/LEF-1 binding element (TBE2). A ). Radio-labeled wild-type TBE2 probe (-205C allele, lane 1-6) and mutant TBE2 probe (-205G allele) (lane 6) were incubated with 8 µg of SW480 cell nuclear extracts for 30 min. Competition experiments were performed with the unlabeled TBE2 probes (Cold SP, lane 3) or unlabeled non-specific probes (Cold NP, lane 5 and 6). Antibody binding experiments were carried out by using anti-TCF-4 antibody (lane 4) and control rabbit IgG (lane 1). The arrow indicates the position of specific transcription factor complexes. Results shown were representative of four experiments. B ). Radio-labeled TBE2 probe (lane 1-4) and mutant TBE2 probes (lane 5) were incubated with Jurkat cell nuclear extracts. Competition experiments were performed with the unlabeled TBE2 probe (Cold SP, lane 2), or non-specific probe (Cold NP, lane 4). Antibody binding experiments were carried with anti-β-catenin antibody (lane 3). Arrows indicate the position of specific transcription factor complexes. Results shown are representative of four experiments. C ). TCF-4 bound to FasL TBE2 in a ChIP assay. Anti-human TCF-4 antibody was used to immunoprecipitate Jurkat chromatin complexes containing FasL DNA fragment (lane 5). The positive (lane 2) and negative controls (lane 3 and 4) were included. DNA molecular weight marker (100 bp ladders) was in Lane 1. D ). β-catenin bound to the FasL promoter TBE2 in a ChIP assay. Mouse monoclonal antibody against human β-catenin was used to precipitate Jurkat T cell chromatin complexes containing FasL promoter DNA fragment (lane 5). The appropriate positive (lane 2) and negative controls (lane 3 and 4) were included. Lane 1 contained DNA molecular weight marker (100 bp DNA ladders). The positive PCR products were shown as 213 bp DNA bands (pointed by arrow) in ChIP assays and the identity of DNA band was further confirmed with DNA sequencing.

Figure Legend Snippet: Binding of TCF-4 and β-catenin to the proximal FasL TCF/LEF-1 binding element (TBE2). A ). Radio-labeled wild-type TBE2 probe (-205C allele, lane 1-6) and mutant TBE2 probe (-205G allele) (lane 6) were incubated with 8 µg of SW480 cell nuclear extracts for 30 min. Competition experiments were performed with the unlabeled TBE2 probes (Cold SP, lane 3) or unlabeled non-specific probes (Cold NP, lane 5 and 6). Antibody binding experiments were carried out by using anti-TCF-4 antibody (lane 4) and control rabbit IgG (lane 1). The arrow indicates the position of specific transcription factor complexes. Results shown were representative of four experiments. B ). Radio-labeled TBE2 probe (lane 1-4) and mutant TBE2 probes (lane 5) were incubated with Jurkat cell nuclear extracts. Competition experiments were performed with the unlabeled TBE2 probe (Cold SP, lane 2), or non-specific probe (Cold NP, lane 4). Antibody binding experiments were carried with anti-β-catenin antibody (lane 3). Arrows indicate the position of specific transcription factor complexes. Results shown are representative of four experiments. C ). TCF-4 bound to FasL TBE2 in a ChIP assay. Anti-human TCF-4 antibody was used to immunoprecipitate Jurkat chromatin complexes containing FasL DNA fragment (lane 5). The positive (lane 2) and negative controls (lane 3 and 4) were included. DNA molecular weight marker (100 bp ladders) was in Lane 1. D ). β-catenin bound to the FasL promoter TBE2 in a ChIP assay. Mouse monoclonal antibody against human β-catenin was used to precipitate Jurkat T cell chromatin complexes containing FasL promoter DNA fragment (lane 5). The appropriate positive (lane 2) and negative controls (lane 3 and 4) were included. Lane 1 contained DNA molecular weight marker (100 bp DNA ladders). The positive PCR products were shown as 213 bp DNA bands (pointed by arrow) in ChIP assays and the identity of DNA band was further confirmed with DNA sequencing.

Techniques Used: Binding Assay, Labeling, Mutagenesis, Incubation, Chromatin Immunoprecipitation, Molecular Weight, Marker, Polymerase Chain Reaction, DNA Sequencing

25) Product Images from "α-Difluoromethylornithine reduces gastric carcinogenesis by causing mutations in Helicobacter pylori cagY"

Article Title: α-Difluoromethylornithine reduces gastric carcinogenesis by causing mutations in Helicobacter pylori cagY

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1814497116

Oxidative DNA damage and cagY RFLP in H. pylori Δ mutS2 . ( A ) mutS2 mRNA expression by real-time PCR, expressed as fold increase compared with the untreated control at each time point. §§ P

Figure Legend Snippet: Oxidative DNA damage and cagY RFLP in H. pylori Δ mutS2 . ( A ) mutS2 mRNA expression by real-time PCR, expressed as fold increase compared with the untreated control at each time point. §§ P

Techniques Used: Expressing, Real-time Polymerase Chain Reaction

26) Product Images from "Differential impact of prostaglandin H synthase 1 knockdown on platelets and parturition"

Article Title: Differential impact of prostaglandin H synthase 1 knockdown on platelets and parturition

Journal:

doi: 10.1172/JCI200523683

Generation of PGHS1 Neo mice. ( A ) Targeting strategy. Numbers indicate known coding exons. Dashed lines indicate regions for homologous recombination; dotted lines represent fragments generated by PCR genotyping. TK, thymidine kinase. Restriction sites:

Figure Legend Snippet: Generation of PGHS1 Neo mice. ( A ) Targeting strategy. Numbers indicate known coding exons. Dashed lines indicate regions for homologous recombination; dotted lines represent fragments generated by PCR genotyping. TK, thymidine kinase. Restriction sites:

Techniques Used: Mouse Assay, Homologous Recombination, Generated, Polymerase Chain Reaction

27) Product Images from "Analysis of neonatal brain lacking ATRX or MeCP2 reveals changes in nucleosome density, CTCF binding and chromatin looping"

Article Title: Analysis of neonatal brain lacking ATRX or MeCP2 reveals changes in nucleosome density, CTCF binding and chromatin looping

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku564

ATRX and MeCP2 regulate nucleosome positioning and long-range chromatin interactions mediated by the Gtl2 DMR. ( a ) 4C-sequencing analysis using the Gtl2 DMR as bait was performed in wild-type neonatal forebrains. Venn diagrams show the number of common sequences between 4C-seq biological replicates. Interactions of the Gtl2 DMR in trans are represented on the left and interactions in cis are represented on the right. ( b ) Analysis of genomic distribution of Gtl2 DMR-interacting fragments on each chromosome reveals that the majority of reproducible interactions occur within chromosome 12 while trans interactions are distributed across the genome, with a noted enrichment on the sex chromosomes. ( c ) Schematic representation of the Gtl2/Dlk1 genomic region, the position of EcoRI sites (black vertical lines) and the primers used for 3C analysis (black arrows). Gray boxes represent the position of genes and black boxes demarcate regulatory elements. Numbers indicate the relative nucleotide position from the start of Gtl2 . The Gtl2 DMR bait sequence is highlighted in yellow. ( d ) For 3C analysis, DNA was digested with EcoRI, ligated and quantified by real-time PCR with a forward primer (red arrow) and Taqman probe to the Gtl2 DMR (asterisk), and reverse primers (black arrows). Analysis was performed in control and ATRX-null or control and MeCP2-null neonatal forebrains ( n = 3 littermate matched pairs each). A significant reduction in interaction frequency is observed at specific sites including the Dlk1 gene and many intergenic regions. Graphed data represents the mean fold change, and error bars depict SEM. A two-tailed t -test was used to assess significance. * P

Figure Legend Snippet: ATRX and MeCP2 regulate nucleosome positioning and long-range chromatin interactions mediated by the Gtl2 DMR. ( a ) 4C-sequencing analysis using the Gtl2 DMR as bait was performed in wild-type neonatal forebrains. Venn diagrams show the number of common sequences between 4C-seq biological replicates. Interactions of the Gtl2 DMR in trans are represented on the left and interactions in cis are represented on the right. ( b ) Analysis of genomic distribution of Gtl2 DMR-interacting fragments on each chromosome reveals that the majority of reproducible interactions occur within chromosome 12 while trans interactions are distributed across the genome, with a noted enrichment on the sex chromosomes. ( c ) Schematic representation of the Gtl2/Dlk1 genomic region, the position of EcoRI sites (black vertical lines) and the primers used for 3C analysis (black arrows). Gray boxes represent the position of genes and black boxes demarcate regulatory elements. Numbers indicate the relative nucleotide position from the start of Gtl2 . The Gtl2 DMR bait sequence is highlighted in yellow. ( d ) For 3C analysis, DNA was digested with EcoRI, ligated and quantified by real-time PCR with a forward primer (red arrow) and Taqman probe to the Gtl2 DMR (asterisk), and reverse primers (black arrows). Analysis was performed in control and ATRX-null or control and MeCP2-null neonatal forebrains ( n = 3 littermate matched pairs each). A significant reduction in interaction frequency is observed at specific sites including the Dlk1 gene and many intergenic regions. Graphed data represents the mean fold change, and error bars depict SEM. A two-tailed t -test was used to assess significance. * P

Techniques Used: Sequencing, Real-time Polymerase Chain Reaction, Two Tailed Test

28) Product Images from "Detection of mitochondrial single nucleotide polymorphisms using a primer elongation reaction on oligonucleotide microarrays"

Article Title: Detection of mitochondrial single nucleotide polymorphisms using a primer elongation reaction on oligonucleotide microarrays

Journal: Nucleic Acids Research

doi:

Detection of 46 mitochondrial SNPs contained in five large targets generated by exonuclease-treatment of the respective PTO-modified PCR products (A, B, C1, C2 and D), which span the mitochondrial genome. Particular SNPs are found in overlapping targets as depicted by identical numeration. Paired match and mismatch oligonucleotide primers are arranged in alternate rows with the exception of a few pairs, as indicated by oblique arrows.

Figure Legend Snippet: Detection of 46 mitochondrial SNPs contained in five large targets generated by exonuclease-treatment of the respective PTO-modified PCR products (A, B, C1, C2 and D), which span the mitochondrial genome. Particular SNPs are found in overlapping targets as depicted by identical numeration. Paired match and mismatch oligonucleotide primers are arranged in alternate rows with the exception of a few pairs, as indicated by oblique arrows.

Techniques Used: Generated, Modification, Polymerase Chain Reaction

29) Product Images from "Isolation and Characterization of a Replication-Competent Molecular Clone of an HIV-1 Circulating Recombinant Form (CRF33_01B)"

Article Title: Isolation and Characterization of a Replication-Competent Molecular Clone of an HIV-1 Circulating Recombinant Form (CRF33_01B)

Journal: PLoS ONE

doi: 10.1371/journal.pone.0006666

Outline for constructing a replication-competent DNA clone of HIV-1 CRF33_01B (p05MYKL045.1). Near full-length proviral DNA of CRF33_01B was amplified by long-range PCR using pbsA- Nar I and 9KU5B primers and TA-cloned into a pCR-XL-TOPO vector. DNA clone containing CRF33_01B genome and p93JP-NH1, an infectious clone of CRF01_AE origin [13] , were linearized by Nar I and Eco RI. The Nar I- Eco RI fragment from the respective CRF33_01B proviral DNA was directionally ligated with the pBR-SK2 vector that contains the p93JP-NH1 5′ long terminal repeat (LTR) to reconstitute a chimeric full-length construct. Each clone was purified and transformed into HeLa cells to determine proviral replication. Constructs producing non-replicating viruses were then rescued by reconstituting a 3.7 kb proviral fragment (with Nco I and Eco RI sites) that includes the functional env gene to recover an infectious CRF33_01B clone, designated as p05MYKL045.1. Restriction enzyme sites in the DNA and the p93JP-NH1-derived 5′ LTR region in p05MYKL045.1 (shaded) are indicated. Refer text for complete descriptions.

Figure Legend Snippet: Outline for constructing a replication-competent DNA clone of HIV-1 CRF33_01B (p05MYKL045.1). Near full-length proviral DNA of CRF33_01B was amplified by long-range PCR using pbsA- Nar I and 9KU5B primers and TA-cloned into a pCR-XL-TOPO vector. DNA clone containing CRF33_01B genome and p93JP-NH1, an infectious clone of CRF01_AE origin [13] , were linearized by Nar I and Eco RI. The Nar I- Eco RI fragment from the respective CRF33_01B proviral DNA was directionally ligated with the pBR-SK2 vector that contains the p93JP-NH1 5′ long terminal repeat (LTR) to reconstitute a chimeric full-length construct. Each clone was purified and transformed into HeLa cells to determine proviral replication. Constructs producing non-replicating viruses were then rescued by reconstituting a 3.7 kb proviral fragment (with Nco I and Eco RI sites) that includes the functional env gene to recover an infectious CRF33_01B clone, designated as p05MYKL045.1. Restriction enzyme sites in the DNA and the p93JP-NH1-derived 5′ LTR region in p05MYKL045.1 (shaded) are indicated. Refer text for complete descriptions.

Techniques Used: Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Construct, Purification, Transformation Assay, Functional Assay, Derivative Assay

30) Product Images from "Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5"

Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5

Journal: Journal of Virology

doi: 10.1128/JVI.76.14.7094-7102.2002

HRV-5 is an ERV of rabbits. Genomic DNA from several mammalian and avian species was tested for the presence of HRV-5 sequences. (A) Southern blots probed with the MA domain of HRV-5 gag. Kbp, kilobase pairs. (B) PCR products obtained from the same species with primers derived from HRV-5 PR/RT, IN, and LTR and with degenerate primers for a gammaretrovirus pol sequence (γ). Following PCR, the HRV-5 products were transferred to a nylon membrane and were probed with an internal fragment specific for each product. Lanes: w, water; 1, fat-tailed dunnart; 2, quail; 3, Syrian hamster; 4, Chinese hamster; 5, rat; 6, mouse; 7, bat; 8, marmoset; 9, macaque; 10 African green monkey; 11, gibbon; 12, chimpanzee; 13, human (donor blood); 14, human (HeLa); 15, horse; 16, mink; 17, cat; 18, dog; 19, cow; 20, pig; 21, rabbit (SIRC); 22, rabbit (EREp), 23, rabbit spleen; 24, European hare; 25, black-tailed jackrabbit; and 26, Afghan pika. HRV-5 sequences were detected in rabbit DNA from three sources. (C) Southern blot of several species of Lagomorpha probed with the MA domain of HRV-5 gag .

Figure Legend Snippet: HRV-5 is an ERV of rabbits. Genomic DNA from several mammalian and avian species was tested for the presence of HRV-5 sequences. (A) Southern blots probed with the MA domain of HRV-5 gag. Kbp, kilobase pairs. (B) PCR products obtained from the same species with primers derived from HRV-5 PR/RT, IN, and LTR and with degenerate primers for a gammaretrovirus pol sequence (γ). Following PCR, the HRV-5 products were transferred to a nylon membrane and were probed with an internal fragment specific for each product. Lanes: w, water; 1, fat-tailed dunnart; 2, quail; 3, Syrian hamster; 4, Chinese hamster; 5, rat; 6, mouse; 7, bat; 8, marmoset; 9, macaque; 10 African green monkey; 11, gibbon; 12, chimpanzee; 13, human (donor blood); 14, human (HeLa); 15, horse; 16, mink; 17, cat; 18, dog; 19, cow; 20, pig; 21, rabbit (SIRC); 22, rabbit (EREp), 23, rabbit spleen; 24, European hare; 25, black-tailed jackrabbit; and 26, Afghan pika. HRV-5 sequences were detected in rabbit DNA from three sources. (C) Southern blot of several species of Lagomorpha probed with the MA domain of HRV-5 gag .

Techniques Used: Polymerase Chain Reaction, Derivative Assay, Sequencing, Southern Blot

HRV-5 RNA expression in rabbit tissues. The expression of HRV-5 RNA was analyzed in several rabbit tissues by RT-PCR with primer sets from gag (NC) and pol (IN). Lanes: 1, spleen; 2, kidney; 3, liver; 4, ovary; 5, stomach; 6, colon; 7, pancreas; 8, heart; 9, skeletal muscle; 10, lung; 11 skin; 12, brain; 13, placenta; 14, mammary gland; 15, lymph node; 16, SIRC (rabbit corneal epithelial cell line), 17, human L363 cell RNA; w, PCR water control; +, positive control (rabbit DNA); 18, water control from the DNase treatment step; and 19, water control from the primer-annealing step. Experiments were performed with or without RT in the cDNA synthesis reaction to control for contamination with cellular DNA. PCR primers for rabbit GAPDH were used as controls for RNA quality.

Figure Legend Snippet: HRV-5 RNA expression in rabbit tissues. The expression of HRV-5 RNA was analyzed in several rabbit tissues by RT-PCR with primer sets from gag (NC) and pol (IN). Lanes: 1, spleen; 2, kidney; 3, liver; 4, ovary; 5, stomach; 6, colon; 7, pancreas; 8, heart; 9, skeletal muscle; 10, lung; 11 skin; 12, brain; 13, placenta; 14, mammary gland; 15, lymph node; 16, SIRC (rabbit corneal epithelial cell line), 17, human L363 cell RNA; w, PCR water control; +, positive control (rabbit DNA); 18, water control from the DNase treatment step; and 19, water control from the primer-annealing step. Experiments were performed with or without RT in the cDNA synthesis reaction to control for contamination with cellular DNA. PCR primers for rabbit GAPDH were used as controls for RNA quality.

Techniques Used: RNA Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Positive Control

31) Product Images from "Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia"

Article Title: Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.181199898

( A ) Limit of detection of the MLL-ENL genomic PCR reaction. Second-round PCR amplification of a 245-bp MLL-ENL breakpoint from t-AML diagnostic blood DNA (100 ng–0.01 pg) serially diluted in normal blood DNA. W, water. 100 bp = DNA ladder. ( B ) DNA integrity control for samples serially collected during ALL therapy. PCR amplification of a 300-bp segment of MLL gene. Lanes 1–5, bone marrow DNA; lanes 6–13, blood DNA. W, water. 100 bp = DNA ladder. ( C ) Second-round PCR of a 245-bp MLL-ENL breakpoint from bone marrow DNA at 608 days of ALL therapy. All of the replicates (100 ng each) were positive and were run with positive and negative controls (see details in the text). ( D ) Second-round PCR of a 245-bp MLL-ENL breakpoint from blood DNA collected after 497 days of ALL therapy. Four of 10 replicates (100 ng each) were positive and were run with positive and negative controls.

Figure Legend Snippet: ( A ) Limit of detection of the MLL-ENL genomic PCR reaction. Second-round PCR amplification of a 245-bp MLL-ENL breakpoint from t-AML diagnostic blood DNA (100 ng–0.01 pg) serially diluted in normal blood DNA. W, water. 100 bp = DNA ladder. ( B ) DNA integrity control for samples serially collected during ALL therapy. PCR amplification of a 300-bp segment of MLL gene. Lanes 1–5, bone marrow DNA; lanes 6–13, blood DNA. W, water. 100 bp = DNA ladder. ( C ) Second-round PCR of a 245-bp MLL-ENL breakpoint from bone marrow DNA at 608 days of ALL therapy. All of the replicates (100 ng each) were positive and were run with positive and negative controls (see details in the text). ( D ) Second-round PCR of a 245-bp MLL-ENL breakpoint from blood DNA collected after 497 days of ALL therapy. Four of 10 replicates (100 ng each) were positive and were run with positive and negative controls.

Techniques Used: Polymerase Chain Reaction, Amplification, Diagnostic Assay

32) Product Images from "Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia"

Article Title: Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.181199898

Techniques Used: Polymerase Chain Reaction, Amplification, Diagnostic Assay

33) Product Images from "Genetic characterization of three qnrS1-harbouring multidrug-resistance plasmids and qnrS1-containing transposons circulating in Ho Chi Minh City, Vietnam"

Article Title: Genetic characterization of three qnrS1-harbouring multidrug-resistance plasmids and qnrS1-containing transposons circulating in Ho Chi Minh City, Vietnam

Journal: Journal of Medical Microbiology

doi: 10.1099/jmm.0.000100

A schematic representation of sequenced qnrS1 -containing transposons. Graphical representation of the synteny between the qnrS -containing transposons between the three plasmids sequenced here (pK18An, pE66An and pK1HV) and other sequenced fragments containing the qnrS -encoding region. The plasmids and the host organism in which they were first identified are given. The region with the greatest DNA homology is identified and includes the highlighted ORFs for qnrS (red), a putative IS 2 element (grey), a gene encoding a putative resolvase protein ( ydaA ) and three other ORFs encoding hypothetical proteins of unknown function. Additional genes are colour coded: blue, bla LAP-2 ; grey, IS elements; white, ORFs without a name encoding hypothetical uncharacterized proteins. The locations of the binding sites for PCR amplification of the transposon are highlighted.

Figure Legend Snippet: A schematic representation of sequenced qnrS1 -containing transposons. Graphical representation of the synteny between the qnrS -containing transposons between the three plasmids sequenced here (pK18An, pE66An and pK1HV) and other sequenced fragments containing the qnrS -encoding region. The plasmids and the host organism in which they were first identified are given. The region with the greatest DNA homology is identified and includes the highlighted ORFs for qnrS (red), a putative IS 2 element (grey), a gene encoding a putative resolvase protein ( ydaA ) and three other ORFs encoding hypothetical proteins of unknown function. Additional genes are colour coded: blue, bla LAP-2 ; grey, IS elements; white, ORFs without a name encoding hypothetical uncharacterized proteins. The locations of the binding sites for PCR amplification of the transposon are highlighted.

Techniques Used: Binding Assay, Polymerase Chain Reaction, Amplification

Eco RI digestion of qnrS -encoding plasmids hybridized with the qnrS1 and bla LAP-2 probes. Upper panel: agarose gel electrophoresis of qnrS -encoding plasmids after digestion with Eco RI. The resulting patterns are duplicate digestions from five plasmids after conjugation. Lanes: 2 and 8, isolate LTMV18; 3 and 9, isolate LTMV33; 4 and 10, isolate LTMV6; 5 and 11, isolate LTMV30; 6 and 12, isolate LTMV1. The ladder (lane 1) is 1 kb Plus (Invitrogen) with sizes shown in kb. Lanes 7 and 13 contain the PCR amplicons of qnrS and bla LAP-2 as positive controls. Bottom panel (left): hybridization against the qnrS1 probe after Southern blotting. All five plasmids contained fragments corresponding to probe qnrS1 . Bottom panel (right): hybridization against the bla LAP-2 probe after Southern blotting.

Figure Legend Snippet: Eco RI digestion of qnrS -encoding plasmids hybridized with the qnrS1 and bla LAP-2 probes. Upper panel: agarose gel electrophoresis of qnrS -encoding plasmids after digestion with Eco RI. The resulting patterns are duplicate digestions from five plasmids after conjugation. Lanes: 2 and 8, isolate LTMV18; 3 and 9, isolate LTMV33; 4 and 10, isolate LTMV6; 5 and 11, isolate LTMV30; 6 and 12, isolate LTMV1. The ladder (lane 1) is 1 kb Plus (Invitrogen) with sizes shown in kb. Lanes 7 and 13 contain the PCR amplicons of qnrS and bla LAP-2 as positive controls. Bottom panel (left): hybridization against the qnrS1 probe after Southern blotting. All five plasmids contained fragments corresponding to probe qnrS1 . Bottom panel (right): hybridization against the bla LAP-2 probe after Southern blotting.

Techniques Used: Agarose Gel Electrophoresis, Conjugation Assay, Polymerase Chain Reaction, Hybridization, Southern Blot

34) Product Images from "Reprogramming triggers endogenous L1 and Alu retrotransposition in human induced pluripotent stem cells"

Article Title: Reprogramming triggers endogenous L1 and Alu retrotransposition in human induced pluripotent stem cells

Journal: Nature Communications

doi: 10.1038/ncomms10286

Reprogramming-induced expression of the L1 retrotransposition machinery is abrogated during embryoid body formation. ( a ) Schematic of organization and expression of a functional human L1 element. Binding sites of TaqMan primer/probe combinations (small convergent arrows) on L1 cDNA used for qRT–PCR analyses and of the 1,299-bp [α- 32 P]dCTP-labelled PCR product in the 5′UTR region (black bar) used for northern analysis are shown. Methylation status of the CpG island (position number 232–491 of the L1.3 reference sequence) was analysed. Open circles, CpG residues. ( b ) Relative full-length L1 (FL-L1) mRNA transcript levels were assessed by qRT–PCR from early passage (until p24) HFF-1-derived (hFF-iPS4, hiPS-SB4 and hiPS-SB5) and hCBEC-derived (hCBiPS1 and hCBiPS1) hiPSC lines (left panel), and after differentiation of hFF-iPS4 (p50) and hiPS-SB4 (p98) lines into embryoid bodies (EBs) (middle panel) (* P

Figure Legend Snippet: Reprogramming-induced expression of the L1 retrotransposition machinery is abrogated during embryoid body formation. ( a ) Schematic of organization and expression of a functional human L1 element. Binding sites of TaqMan primer/probe combinations (small convergent arrows) on L1 cDNA used for qRT–PCR analyses and of the 1,299-bp [α- 32 P]dCTP-labelled PCR product in the 5′UTR region (black bar) used for northern analysis are shown. Methylation status of the CpG island (position number 232–491 of the L1.3 reference sequence) was analysed. Open circles, CpG residues. ( b ) Relative full-length L1 (FL-L1) mRNA transcript levels were assessed by qRT–PCR from early passage (until p24) HFF-1-derived (hFF-iPS4, hiPS-SB4 and hiPS-SB5) and hCBEC-derived (hCBiPS1 and hCBiPS1) hiPSC lines (left panel), and after differentiation of hFF-iPS4 (p50) and hiPS-SB4 (p98) lines into embryoid bodies (EBs) (middle panel) (* P

Techniques Used: Expressing, Functional Assay, Binding Assay, Quantitative RT-PCR, Polymerase Chain Reaction, Northern Blot, Methylation, Sequencing, Derivative Assay

De novo full-length L1 insertions retain retrotransposition competency in vitro. Intact, full-length L1 insertions L1-dn6-2.2 and L1-dn6-5.4 were obtained from two independent genomic PCR reactions amplifying the L1-dn6 de novo insertion, tagged with an mblastI retrotransposition indicator cassette, and inserted into an episomal expression plasmid where they were transcriptionally controlled by the CMV promoter. Resulting L1 reporter plasmids pJJ101/L1-dn6-2.2 and pJJ101/L1-dn6-5.4 were submitted to the L1 retrotransposition reporter assay (see Methods). HeLa cells were transfected with the L1-dn6 reporter plasmids or with positive and negative control L1 reporter plasmids pJJ101/L1.3 and pJJ101/L1.3-D702A, respectively. Blastidicin-S resistant cells arise only if engineered L1 retrotransposition has occurred. pJJ101/L1.3 was used for normalization (100% activity). pJJ101/L1.3-D702A contains a single point mutation in the L1 reverse transcriptase domain. The bar diagram depicts arithmetic mean±s.d. of three independent retrotransposition reporter assays of the engineered L1-dn6 elements relative to L1.3. Black hexagon, SV40 polyadenylation signal; grey arrows, TSDs flanking a 5′-truncated de novo L1 insertion. Blast(s), Blastidicin-S sensitive; Blast(r), Blastidicin-S resistant; SD, splice donor; SA, splice acceptor.

Figure Legend Snippet: De novo full-length L1 insertions retain retrotransposition competency in vitro. Intact, full-length L1 insertions L1-dn6-2.2 and L1-dn6-5.4 were obtained from two independent genomic PCR reactions amplifying the L1-dn6 de novo insertion, tagged with an mblastI retrotransposition indicator cassette, and inserted into an episomal expression plasmid where they were transcriptionally controlled by the CMV promoter. Resulting L1 reporter plasmids pJJ101/L1-dn6-2.2 and pJJ101/L1-dn6-5.4 were submitted to the L1 retrotransposition reporter assay (see Methods). HeLa cells were transfected with the L1-dn6 reporter plasmids or with positive and negative control L1 reporter plasmids pJJ101/L1.3 and pJJ101/L1.3-D702A, respectively. Blastidicin-S resistant cells arise only if engineered L1 retrotransposition has occurred. pJJ101/L1.3 was used for normalization (100% activity). pJJ101/L1.3-D702A contains a single point mutation in the L1 reverse transcriptase domain. The bar diagram depicts arithmetic mean±s.d. of three independent retrotransposition reporter assays of the engineered L1-dn6 elements relative to L1.3. Black hexagon, SV40 polyadenylation signal; grey arrows, TSDs flanking a 5′-truncated de novo L1 insertion. Blast(s), Blastidicin-S sensitive; Blast(r), Blastidicin-S resistant; SD, splice donor; SA, splice acceptor.

Techniques Used: In Vitro, Polymerase Chain Reaction, Expressing, Plasmid Preparation, Reporter Assay, Transfection, Negative Control, Activity Assay, Mutagenesis

L1-dn13 affects CADPS2 expression. ( a ) Schematic of the human CADPS2 allele of the hiPS-SB4 line harbouring insertion L1-dn13. A CADPS2 transcript including exons 7, 8, 27 and 28 is presented. Binding sites of the TaqMan primer/probe combination spanning the exon27/exon28 junction on CADPS2 cDNA used for qRT–PCR analysis are shown (red arrows and line). ( b ) Relative CADPS2 mRNA levels in early (p16) and late passage (p50) hiPS-SB4 cells were assessed by qRT–PCR. HES-3 and hFF-iPS4 cells served as positive controls. qRT–PCR results were normalized to 18S rRNA using CADPS2 expression in parental HFF-1 cells as control. Bars, arithmetic means±s.e.m. of tec hnical triplicates. ( c ) Structure of the L1-dn13 integration site in the CADPS2 gene in hiPS-SB4 subclones. hiPS-SB4_D differs from hiPS-SB4_B by the presence of the L1-dn13 de novo insertion in CADPS2 intron 7. Binding sites of L1-dn13-specific validation PCR primers OP1, ISP1 and ISP2 and expected lengths of the resulting PCR products are indicated. Black diamonds, TSDs. ( d ) Genotyping PCR validating the L1-dn13 presence in subclone hiPS-SB4_D and its absence from hiPS-SB4_B in gDNAs isolated from HFF-1, hiPS_SB4_B, and hiPS_SB4_D cells and from the original mixed population of the hiPS-SB4 culture (hiPS-SB4(Mix)). Primer combinations used are indicated in blue; H 2 O.ISP1/ISP2 and H 2 O.ISP1/OP1, negative control PCRs using H 2 O instead of gDNA; 100-bp ladder, size marker. ( e ) qPCR analyses confirming absence of L1-dn13 from hiPS-SB4_B and HFF-1 cells, and its presence in hiPS-SB4_D cells and the hiPS-SB4 culture. gDNAs from HFF-1 cells and from hiPS-SB4(Mix) cells served as negative and positive controls, respectively. For normalization, a primer/probe combination specific for the human RPP25 gene was used. ΔΔCt values measured the relative quantity of L1-dn13. Bars, arithmetic means±s.e.m. of technical triplicates. ( f ) Relative CADPS2 mRNA levels in hiPS-SB4_B, hiPS-SB4_D and hiPS-SB4(Mix) cells were determined by qRT–PCR using cytoplasmic RNA and primer/probe combinations spanning exon 27/exon 28 junction of CADPS2 . Bars, arithmetic means±s.e.m. of technical triplicates.

Figure Legend Snippet: L1-dn13 affects CADPS2 expression. ( a ) Schematic of the human CADPS2 allele of the hiPS-SB4 line harbouring insertion L1-dn13. A CADPS2 transcript including exons 7, 8, 27 and 28 is presented. Binding sites of the TaqMan primer/probe combination spanning the exon27/exon28 junction on CADPS2 cDNA used for qRT–PCR analysis are shown (red arrows and line). ( b ) Relative CADPS2 mRNA levels in early (p16) and late passage (p50) hiPS-SB4 cells were assessed by qRT–PCR. HES-3 and hFF-iPS4 cells served as positive controls. qRT–PCR results were normalized to 18S rRNA using CADPS2 expression in parental HFF-1 cells as control. Bars, arithmetic means±s.e.m. of tec hnical triplicates. ( c ) Structure of the L1-dn13 integration site in the CADPS2 gene in hiPS-SB4 subclones. hiPS-SB4_D differs from hiPS-SB4_B by the presence of the L1-dn13 de novo insertion in CADPS2 intron 7. Binding sites of L1-dn13-specific validation PCR primers OP1, ISP1 and ISP2 and expected lengths of the resulting PCR products are indicated. Black diamonds, TSDs. ( d ) Genotyping PCR validating the L1-dn13 presence in subclone hiPS-SB4_D and its absence from hiPS-SB4_B in gDNAs isolated from HFF-1, hiPS_SB4_B, and hiPS_SB4_D cells and from the original mixed population of the hiPS-SB4 culture (hiPS-SB4(Mix)). Primer combinations used are indicated in blue; H 2 O.ISP1/ISP2 and H 2 O.ISP1/OP1, negative control PCRs using H 2 O instead of gDNA; 100-bp ladder, size marker. ( e ) qPCR analyses confirming absence of L1-dn13 from hiPS-SB4_B and HFF-1 cells, and its presence in hiPS-SB4_D cells and the hiPS-SB4 culture. gDNAs from HFF-1 cells and from hiPS-SB4(Mix) cells served as negative and positive controls, respectively. For normalization, a primer/probe combination specific for the human RPP25 gene was used. ΔΔCt values measured the relative quantity of L1-dn13. Bars, arithmetic means±s.e.m. of technical triplicates. ( f ) Relative CADPS2 mRNA levels in hiPS-SB4_B, hiPS-SB4_D and hiPS-SB4(Mix) cells were determined by qRT–PCR using cytoplasmic RNA and primer/probe combinations spanning exon 27/exon 28 junction of CADPS2 . Bars, arithmetic means±s.e.m. of technical triplicates.

Techniques Used: Expressing, Binding Assay, Quantitative RT-PCR, Polymerase Chain Reaction, Isolation, Negative Control, Marker, Real-time Polymerase Chain Reaction

35) Product Images from "Cytochrome c oxidase subunit 4 isoform 2-knockout mice show reduced enzyme activity, airway hyporeactivity, and lung pathology"

Article Title: Cytochrome c oxidase subunit 4 isoform 2-knockout mice show reduced enzyme activity, airway hyporeactivity, and lung pathology

Journal: The FASEB Journal

doi: 10.1096/fj.11-203273

Gene knockout of COX4i2. A ) Schematic representation of the gene-knockout strategy. PCR-based amplification of the 5′ and 3′ COX4i2 regions (o-PCR, outer PCR; arrows) was followed by an inner PCR (i-PCR) with primers containing the indicated

Figure Legend Snippet: Gene knockout of COX4i2. A ) Schematic representation of the gene-knockout strategy. PCR-based amplification of the 5′ and 3′ COX4i2 regions (o-PCR, outer PCR; arrows) was followed by an inner PCR (i-PCR) with primers containing the indicated

Techniques Used: Gene Knockout, Polymerase Chain Reaction, Amplification

36) Product Images from "Intra- and Interspecies Signaling between Streptococcus salivarius and Streptococcus pyogenes Mediated by SalA and SalA1 Lantibiotic Peptides"

Article Title: Intra- and Interspecies Signaling between Streptococcus salivarius and Streptococcus pyogenes Mediated by SalA and SalA1 Lantibiotic Peptides

Journal: Journal of Bacteriology

doi: 10.1128/JB.183.13.3931-3938.2001

RT-PCR analysis of sal locus transcripts from S. salivarius 20P3. cDNA was generated from mRNA by using the oligonucleotide SalRterm. (A) Lanes 2 to 5 PCRs performed with primers SalAF and SalXR; lanes 7 to 10, PCRs performed with primers SalY2S and SalRterm; lanes 2 and 7, cDNA template generated by RT; lanes 3 and 8, RNA controls (no RT); lanes 4 and 9, chromosomal DNA template; lanes 5 and 10, no-template controls. (B) PCRs performed with primers SalAF and SalRR. Lane 2, cDNA template generated by RT; lane 3, RNA control; lane 4, chromosomal DNA; lane 5, no template. The molecular mass markers (panel A, lanes 1 and 6; panel B, lane 1) were λ DNA Hin dIII fragments (23.1, 9.41, 6.56, 4.36, 2.32, and 2.02 kb).

Figure Legend Snippet: RT-PCR analysis of sal locus transcripts from S. salivarius 20P3. cDNA was generated from mRNA by using the oligonucleotide SalRterm. (A) Lanes 2 to 5 PCRs performed with primers SalAF and SalXR; lanes 7 to 10, PCRs performed with primers SalY2S and SalRterm; lanes 2 and 7, cDNA template generated by RT; lanes 3 and 8, RNA controls (no RT); lanes 4 and 9, chromosomal DNA template; lanes 5 and 10, no-template controls. (B) PCRs performed with primers SalAF and SalRR. Lane 2, cDNA template generated by RT; lane 3, RNA control; lane 4, chromosomal DNA; lane 5, no template. The molecular mass markers (panel A, lanes 1 and 6; panel B, lane 1) were λ DNA Hin dIII fragments (23.1, 9.41, 6.56, 4.36, 2.32, and 2.02 kb).

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Generated

37) Product Images from "PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis"

Article Title: PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis

Journal: The American Journal of Pathology

doi:

Multiplex PCR demonstrating homozygous deletions of PTEN and DMBT1. A: Amplification of PTEN ex 5-2 in case 1760 is significantly less than paired constitutional DNA and representative loss of heterozygosity cases. B: Amplification of intragenic sequence (g14ext, 156 bp) of DMBT1 in cases 1828 and 1968 is significantly less than paired constitutional DNA, 30% constitutional DNA/70% U343 DNA, and loss of heterozygosity cases. Thirty percent normal DNA/70% U343 DNA represents homozygous deletion contaminated with 30% of normal cells. N, paired constitutional DNA; T, tumor DNA; HD, homozygous deletion.

Figure Legend Snippet: Multiplex PCR demonstrating homozygous deletions of PTEN and DMBT1. A: Amplification of PTEN ex 5-2 in case 1760 is significantly less than paired constitutional DNA and representative loss of heterozygosity cases. B: Amplification of intragenic sequence (g14ext, 156 bp) of DMBT1 in cases 1828 and 1968 is significantly less than paired constitutional DNA, 30% constitutional DNA/70% U343 DNA, and loss of heterozygosity cases. Thirty percent normal DNA/70% U343 DNA represents homozygous deletion contaminated with 30% of normal cells. N, paired constitutional DNA; T, tumor DNA; HD, homozygous deletion.

Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Amplification, Sequencing

38) Product Images from "Next-Generation Sequencing Identifies the Danforth's Short Tail Mouse Mutation as a Retrotransposon Insertion Affecting Ptf1a ExpressionEctopic Expression of Ptf1a Induces Spinal Defects, Urogenital Defects and Anorectal Malformations in Danforth's Short Tail MiceA Retrotransposon Insertion in the 5′ Regulatory Domain of Ptf1a Results in Ectopic Gene Expression and Multiple Congenital Defects in Danforth's Short Tail MouseRetrotransposon Activates Ectopic Ptf1a Expression: A Short Tail"

Article Title: Next-Generation Sequencing Identifies the Danforth's Short Tail Mouse Mutation as a Retrotransposon Insertion Affecting Ptf1a ExpressionEctopic Expression of Ptf1a Induces Spinal Defects, Urogenital Defects and Anorectal Malformations in Danforth's Short Tail MiceA Retrotransposon Insertion in the 5′ Regulatory Domain of Ptf1a Results in Ectopic Gene Expression and Multiple Congenital Defects in Danforth's Short Tail MouseRetrotransposon Activates Ectopic Ptf1a Expression: A Short Tail

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1003205

Confirmation and mapping of the Sd mutation. A) Southern analysis and PCR showing the presence of a large DNA insertion at the Sd locus. B) Multiplex PCR from inbred mouse lines showing the mutation is only present in Sd mice, and is not a polymorphism. In this three primer PCR reaction the Sd amplimer is 406 bp, while the WT amplimer is 510 bp. C) Mapping of the Sd mutation which we identified as an ETn (early transposon) in relation to nearby gene/ESTs, figure not to scale.

Figure Legend Snippet: Confirmation and mapping of the Sd mutation. A) Southern analysis and PCR showing the presence of a large DNA insertion at the Sd locus. B) Multiplex PCR from inbred mouse lines showing the mutation is only present in Sd mice, and is not a polymorphism. In this three primer PCR reaction the Sd amplimer is 406 bp, while the WT amplimer is 510 bp. C) Mapping of the Sd mutation which we identified as an ETn (early transposon) in relation to nearby gene/ESTs, figure not to scale.

Techniques Used: Mutagenesis, Polymerase Chain Reaction, Multiplex Assay, Mouse Assay

39) Product Images from "Lightoid and Claret: A rab GTPase and its putative guanine nucleotide exchange factor in biogenesis of Drosophila eye pigment granules"

Article Title: Lightoid and Claret: A rab GTPase and its putative guanine nucleotide exchange factor in biogenesis of Drosophila eye pigment granules

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0401926101

Molecular identification of the gene defective in the claret mutant ( ca 1 ). ( A ) Semiquantitative RT-PCR analysis of the putative claret mRNA and an internal control (CG7814). The positions of DNA size markers are indicated ( Left ). ( B ) Schematic representation

Figure Legend Snippet: Molecular identification of the gene defective in the claret mutant ( ca 1 ). ( A ) Semiquantitative RT-PCR analysis of the putative claret mRNA and an internal control (CG7814). The positions of DNA size markers are indicated ( Left ). ( B ) Schematic representation

Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction

40) Product Images from "An intein with genetically selectable markers provides a new approach to internally label proteins with GFP"

Article Title: An intein with genetically selectable markers provides a new approach to internally label proteins with GFP

Journal: BMC Biotechnology

doi: 10.1186/1472-6750-11-71

Integration of the marked Pch PRP8 inteins at CMD1 locus . A . Tetrad analysis of diploids that are heterozygous for the insertion of the marked inteins at the CMD1 locus ( CMD1/CMD1::GFP-Pch PRP8 marker-intein ). Individual haploid spores were grown on non-selective YPD medium. Segregation of the mutant alleles was 2:2 and the slow growing colonies contain CMD1 with the G418 R -and HygB R -intein insertions as determined by plating the haploids on selective medium (not shown). B . Western blot analysis of protein extracts from haploids containing the Pch PRP8 marked-inteins at the CMD1 locus. Lane 1, 100 ng purified calmodulin; Lane 2 LAY18-2C expressing Cmd1-GFP (constructed using the classic PCR method [ 41 ]); Lane 3, extract from a haploid CMD1::GFP-Pch PRP8-HIS5-intein isolate; Lanes 4, 5 extracts from two separate haploid CMD1::GFP-Pch PRP8-G418 R -intein isolates. C . Fluorescence microscopy of the haploid CMD1::GFP-Pch PRP8-HIS5-intein isolate. Numbers 1-4 refer to images showing unbudded, small budded, medium budded or large budded cells, respectively.

Figure Legend Snippet: Integration of the marked Pch PRP8 inteins at CMD1 locus . A . Tetrad analysis of diploids that are heterozygous for the insertion of the marked inteins at the CMD1 locus ( CMD1/CMD1::GFP-Pch PRP8 marker-intein ). Individual haploid spores were grown on non-selective YPD medium. Segregation of the mutant alleles was 2:2 and the slow growing colonies contain CMD1 with the G418 R -and HygB R -intein insertions as determined by plating the haploids on selective medium (not shown). B . Western blot analysis of protein extracts from haploids containing the Pch PRP8 marked-inteins at the CMD1 locus. Lane 1, 100 ng purified calmodulin; Lane 2 LAY18-2C expressing Cmd1-GFP (constructed using the classic PCR method [ 41 ]); Lane 3, extract from a haploid CMD1::GFP-Pch PRP8-HIS5-intein isolate; Lanes 4, 5 extracts from two separate haploid CMD1::GFP-Pch PRP8-G418 R -intein isolates. C . Fluorescence microscopy of the haploid CMD1::GFP-Pch PRP8-HIS5-intein isolate. Numbers 1-4 refer to images showing unbudded, small budded, medium budded or large budded cells, respectively.

Techniques Used: Marker, Mutagenesis, Western Blot, Purification, Expressing, Construct, Polymerase Chain Reaction, Fluorescence, Microscopy

Schematic showing the experimental design to integrate the marked Pch PRP8 inteins at the CMD1 locus . The top panel shows the composition and organization of the PCR amplified DNA used to transform yeast. The blue hatched area corresponds to the central sequence of the CMD1 gene that was the target for homologous recombination. L1-L5 are linker regions. In the bottom panel are the two proteins produced after splicing: 1) calmodulin with GFP inserted between S79 and N80, and 2) Pch PRP8 intein with genetic markers inserted at the vacant endonuclease site. The junction between L2 and L5 is the splice site. L2 and L5 contain 5 and 4 amino acids from the original Pch Prp8 extein sequences. For a description of the linker sequences see Methods. EF refers to the calcium-binding EF-hand domains. The sizes of the regions are drawn for clarity and are not to scale.

Figure Legend Snippet: Schematic showing the experimental design to integrate the marked Pch PRP8 inteins at the CMD1 locus . The top panel shows the composition and organization of the PCR amplified DNA used to transform yeast. The blue hatched area corresponds to the central sequence of the CMD1 gene that was the target for homologous recombination. L1-L5 are linker regions. In the bottom panel are the two proteins produced after splicing: 1) calmodulin with GFP inserted between S79 and N80, and 2) Pch PRP8 intein with genetic markers inserted at the vacant endonuclease site. The junction between L2 and L5 is the splice site. L2 and L5 contain 5 and 4 amino acids from the original Pch Prp8 extein sequences. For a description of the linker sequences see Methods. EF refers to the calcium-binding EF-hand domains. The sizes of the regions are drawn for clarity and are not to scale.

Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Homologous Recombination, Produced, Binding Assay

Polymerase Chain Reaction:

Article Title: The physiological level of rNMPs present in mtDNA does not compromise its stability
Article Snippet: .. MtDNA deletion analysis by long-range PCR The Expand Long Template PCR system (Roche) with forward and reverse primers at nt 2,478–2,512 and nt 1,933–1,906, respectively, was used to amplify a ~15,800 bp fragment of mouse mtDNA from 25 ng of total DNA. .. Products were separated by electrophoresis on a 0.7% agarose gel run in 1× TAE buffer at 55 V in the cold room and imaged on a ChemiDoc Touch instrument (Bio-Rad).

Article Title: New Molecular Mechanism for Ullrich Congenital Muscular Dystrophy: A Heterozygous In-Frame Deletion in the COL6A1 Gene Causes a Severe Phenotype
Article Snippet: .. Genomic DNA isolated from patient UC-1 and his family was PCR amplified with a forward primer in intron 6 (5′-GACTCGTCTCCATGCTTTCC-3′) and a reverse primer in intron 11 (5′-CATGGGGACTGACAGTGATG-3′), through use of the Expand Long Template PCR system (Roche). ..

Article Title: Extensive somatic L1 retrotransposition in colorectal tumors
Article Snippet: .. Long-range PCR to recover longer L1 insertions was performed with the Expand Long Template PCR System (Roche) according to the manufacturer's instructions in buffer 1, with 1 μL of 20 μM FS and ES primers each, and 25 ng of tumor DNA. .. 5′ junctions were PCR amplified using the same conditions as for the 3′ junction, except that a primer hybridizing to the L1 5′UTR was used (L1nt112out: GATGAACCCGGTACCTCAGA) together with the respective ES primer, and primer extension time was only 45 sec. FS and ES primer sequences are included in the Supplemental Material (Supplemental Table S1).

Article Title: Bidirectional transcription stimulates expansion and contraction of expanded (CTG)o(CAG) repeats
Article Snippet: .. Briefly, the transgene sequence containing the CTG repeat was amplified by Expand Long Template PCR System (Roche) using primers 5′-ACCCTAGAACTGTCTTCGACTCC-3′ and 5′-TTCCCGAGTAAGCAGGCAGAG-3′ through 24 rounds of PCR. .. The small-pool PCR products were resolved on 0.7% agarose gels buffered with 40 m m Tris–acetate, 1 m m EDTA.

Article Title: Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR
Article Snippet: .. Full-length HPV16 genome was PCR-amplified from Caski cell DNA using a Roche Expand Long Template PCR System and the primers HPV16BamHIF (5'-CCC GGATCC CCATGTACCAATGTTGCA-3') and HPV16BamHIR (5'-CCC GGATCC TTTGCCCCAGTGTTCC-3'). .. The 7.9 kb PCR fragment was TA-cloned into pCR2.1-topo vector to generate pHPV16.

Article Title: The human hGSTA5 gene encodes an enzymatically active protein
Article Snippet: .. A 9,021-bp fragment of the hGSTA5 gene was amplified from human genomic DNA using the Expand Long Template PCR System (Roche Diagnostics, Indianapolis, IN). ..

Article Title: A Clonal Lineage of VanA-Type Enterococcus faecalis Predominates in Vancomycin-Resistant Enterococci Isolated in New Zealand
Article Snippet: .. Tn 1546 -like elements were amplified using an Expand Long Template PCR system (Roche) and the conditions recommended by the manufacturer. ..

Article Title: Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1
Article Snippet: .. Genomic DNA was amplified using the Expand Long Template PCR System (Roche Diagnostics), the sense primer ATGGTGGAATGCCTACTTTGTA, and the antisense primer CGTTTGGGTAGAAGAGATGCTTTAC. .. PCR cycling conditions were: 94°C for 1 minute; 35 cycles of 94°C for 15 seconds, 58°C for 30 seconds, and 68°C for 45 seconds; and a final extension at 68°C for 5 minutes.

Structured Review

Related Products / Commonly Used Together

Images

1) Product Images from "The physiological level of rNMPs present in mtDNA does not compromise its stability"

2) Product Images from "Extensive somatic L1 retrotransposition in colorectal tumors"

3) Product Images from "Bidirectional transcription stimulates expansion and contraction of expanded (CTG)o(CAG) repeats"

4) Product Images from "The human hGSTA5 gene encodes an enzymatically active protein"

5) Product Images from "New Molecular Mechanism for Ullrich Congenital Muscular Dystrophy: A Heterozygous In-Frame Deletion in the COL6A1 Gene Causes a Severe Phenotype"

6) Product Images from "Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1"

7) Product Images from "Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR"

8) Product Images from "A Clonal Lineage of VanA-Type Enterococcus faecalis Predominates in Vancomycin-Resistant Enterococci Isolated in New Zealand"

9) Product Images from "Transcriptional regulation of parathyroid hormone-related protein promoter P2 by NF-?B in adult T-cell leukemia/lymphoma"

10) Product Images from "An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers"

11) Product Images from "Therapeutic effect of green tea extract on alcohol induced hepatic mitochondrial DNA damage in albino wistar rats"

12) Product Images from "Structural polymorphism in the promoter of pfmrp2 confers Plasmodium falciparum tolerance to quinoline drugs"

13) Product Images from "A20 Orchestrates Inflammatory Response in the Oral Mucosa through Restraining NF-κB Activity"

14) Product Images from "The Intracellular Redox Stress Caused by Hexavalent Chromium is Selective for Proteins that Have Key Roles in Cell Survival and Thiol Redox Control"

15) Product Images from "Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿"

16) Product Images from "Characterization of a Cytolytic Strain of Equine Infectious Anemia Virus"

17) Product Images from "Acquired Bacitracin Resistance in Enterococcus faecalis Is Mediated by an ABC Transporter and a Novel Regulatory Protein, BcrR"

18) Product Images from "Comparative Signature-Tagged Mutagenesis Identifies Pseudomonas Factors Conferring Resistance to the Pulmonary Collectin SP-A"

19) Product Images from "A widely conserved bacterial cytoskeletal component influences unique helical shape and motility of the spirochete Leptospira biflexa"

20) Product Images from "Members of the Francisella tularensis Phagosomal Transporter Subfamily of Major Facilitator Superfamily Transporters Are Critical for Pathogenesis"

21) Product Images from "Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans"

22) Product Images from "Contribution of Long Polar Fimbriae to the Virulence of Rabbit-Specific Enteropathogenic Escherichia coli"

23) Product Images from "High-Resolution Recombination Patterns in a Region of Human Chromosome 21 Measured by Sperm Typing"

24) Product Images from "Human FasL Gene Is a Target of ?-Catenin/T-Cell Factor Pathway and Complex FasL Haplotypes Alter Promoter Functions"

25) Product Images from "α-Difluoromethylornithine reduces gastric carcinogenesis by causing mutations in Helicobacter pylori cagY"

26) Product Images from "Differential impact of prostaglandin H synthase 1 knockdown on platelets and parturition"

27) Product Images from "Analysis of neonatal brain lacking ATRX or MeCP2 reveals changes in nucleosome density, CTCF binding and chromatin looping"

28) Product Images from "Detection of mitochondrial single nucleotide polymorphisms using a primer elongation reaction on oligonucleotide microarrays"

29) Product Images from "Isolation and Characterization of a Replication-Competent Molecular Clone of an HIV-1 Circulating Recombinant Form (CRF33_01B)"

30) Product Images from "Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5"

31) Product Images from "Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia"

32) Product Images from "Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia"

33) Product Images from "Genetic characterization of three qnrS1-harbouring multidrug-resistance plasmids and qnrS1-containing transposons circulating in Ho Chi Minh City, Vietnam"

34) Product Images from "Reprogramming triggers endogenous L1 and Alu retrotransposition in human induced pluripotent stem cells"

35) Product Images from "Cytochrome c oxidase subunit 4 isoform 2-knockout mice show reduced enzyme activity, airway hyporeactivity, and lung pathology"

36) Product Images from "Intra- and Interspecies Signaling between Streptococcus salivarius and Streptococcus pyogenes Mediated by SalA and SalA1 Lantibiotic Peptides"

37) Product Images from "PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis"

39) Product Images from "Lightoid and Claret: A rab GTPase and its putative guanine nucleotide exchange factor in biogenesis of Drosophila eye pigment granules"

40) Product Images from "An intein with genetically selectable markers provides a new approach to internally label proteins with GFP"

Related Articles

Polymerase Chain Reaction:

Isolation:

Amplification:

Sequencing:

CTG Assay:

Similar Products

Image Search Results