Structured Review

Roche expand long template pcr kit
Characterization and suitability of the <t>HEMn</t> cell system: The OCA2 gene is differentially expressed in HEMn-LP and HEMn-DP cells. ( A ) overview of the OCA2 - HERC2 locus ( top panel). ( Middle panel) The region covered on BAC RP11-1365A12. Vertebrate conservation (green); the position of rs12913832 (red). ( Lower panel) A schematic overview of the region investigated in this study. Restriction enzyme digestion sites are indicated. ( B ) Sequence analysis of the region around HERC2 rs12913832 in HEMn-LP ( left ) and HEMn-DP ( right ). The genotypes of rs12913832 were determined by direct sequencing of <t>PCR</t> fragments containing rs12913832. ( C ) RT-qPCR analysis of OCA2 primary transcripts in MCF7 and HEMn cells demonstrates differential OCA2 expression between HEMn-LP and HEMn-DP cells. Each gene expression analysis is carried out in triplicate and normalized to an endogenous reference gene ( ACTB ). ( D ) ChIP-qPCR of RNA Pol II binding at the OCA2 promoter in MCF7, HEMn-LP, and HEMn-DP cells. Enrichment is calculated relative to necdin ( NDN ), and values are normalized to input measurements. All ChIP analyses are performed in triplicate. Data are represented as mean ± SEM; (*) p
Expand Long Template Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/expand long template pcr kit/product/Roche
Average 91 stars, based on 80 article reviews
Price from $9.99 to $1999.99
expand long template pcr kit - by Bioz Stars, 2020-07
91/100 stars

Images

1) Product Images from "HERC2 rs12913832 modulates human pigmentation by attenuating chromatin-loop formation between a long-range enhancer and the OCA2 promoter"

Article Title: HERC2 rs12913832 modulates human pigmentation by attenuating chromatin-loop formation between a long-range enhancer and the OCA2 promoter

Journal: Genome Research

doi: 10.1101/gr.128652.111

Characterization and suitability of the HEMn cell system: The OCA2 gene is differentially expressed in HEMn-LP and HEMn-DP cells. ( A ) overview of the OCA2 - HERC2 locus ( top panel). ( Middle panel) The region covered on BAC RP11-1365A12. Vertebrate conservation (green); the position of rs12913832 (red). ( Lower panel) A schematic overview of the region investigated in this study. Restriction enzyme digestion sites are indicated. ( B ) Sequence analysis of the region around HERC2 rs12913832 in HEMn-LP ( left ) and HEMn-DP ( right ). The genotypes of rs12913832 were determined by direct sequencing of PCR fragments containing rs12913832. ( C ) RT-qPCR analysis of OCA2 primary transcripts in MCF7 and HEMn cells demonstrates differential OCA2 expression between HEMn-LP and HEMn-DP cells. Each gene expression analysis is carried out in triplicate and normalized to an endogenous reference gene ( ACTB ). ( D ) ChIP-qPCR of RNA Pol II binding at the OCA2 promoter in MCF7, HEMn-LP, and HEMn-DP cells. Enrichment is calculated relative to necdin ( NDN ), and values are normalized to input measurements. All ChIP analyses are performed in triplicate. Data are represented as mean ± SEM; (*) p
Figure Legend Snippet: Characterization and suitability of the HEMn cell system: The OCA2 gene is differentially expressed in HEMn-LP and HEMn-DP cells. ( A ) overview of the OCA2 - HERC2 locus ( top panel). ( Middle panel) The region covered on BAC RP11-1365A12. Vertebrate conservation (green); the position of rs12913832 (red). ( Lower panel) A schematic overview of the region investigated in this study. Restriction enzyme digestion sites are indicated. ( B ) Sequence analysis of the region around HERC2 rs12913832 in HEMn-LP ( left ) and HEMn-DP ( right ). The genotypes of rs12913832 were determined by direct sequencing of PCR fragments containing rs12913832. ( C ) RT-qPCR analysis of OCA2 primary transcripts in MCF7 and HEMn cells demonstrates differential OCA2 expression between HEMn-LP and HEMn-DP cells. Each gene expression analysis is carried out in triplicate and normalized to an endogenous reference gene ( ACTB ). ( D ) ChIP-qPCR of RNA Pol II binding at the OCA2 promoter in MCF7, HEMn-LP, and HEMn-DP cells. Enrichment is calculated relative to necdin ( NDN ), and values are normalized to input measurements. All ChIP analyses are performed in triplicate. Data are represented as mean ± SEM; (*) p

Techniques Used: BAC Assay, Sequencing, Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay

FAIRE analysis of pigmentation-associated SNPs other than HERC2 rs12913832 present within the 3′ HERC2 /5′ OCA2 region does not reveal additional regulatory elements. ( Left ) of the investigated 3′ HERC2/ 5′ OCA2 region. Pigmentation-associated SNPs (red); linked SNPs ( r 2 > 0.8) (black). The approximate location of the analyzed PCR amplicons is indicated. ( Right side) The genotype of each SNP for HEMn-LP and HEMn-DP. The enrichments displayed are relative to NDN . Data are represented as mean ± SEM.
Figure Legend Snippet: FAIRE analysis of pigmentation-associated SNPs other than HERC2 rs12913832 present within the 3′ HERC2 /5′ OCA2 region does not reveal additional regulatory elements. ( Left ) of the investigated 3′ HERC2/ 5′ OCA2 region. Pigmentation-associated SNPs (red); linked SNPs ( r 2 > 0.8) (black). The approximate location of the analyzed PCR amplicons is indicated. ( Right side) The genotype of each SNP for HEMn-LP and HEMn-DP. The enrichments displayed are relative to NDN . Data are represented as mean ± SEM.

Techniques Used: Polymerase Chain Reaction

2) Product Images from "GC Content-Based Pan-Pox Universal PCR Assays for Poxvirus Detection ▿"

Article Title: GC Content-Based Pan-Pox Universal PCR Assays for Poxvirus Detection ▿

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.01697-09

Low- and high-GC PCR and TaqI RFLP assays. (A) Low-GC PCR amplicons and TaqI RFLP patterns. The top panel shows low-GC PCR amplicons from 20 poxvirus DNA samples. The bottom panel shows corresponding TaqI restriction endonuclease RFLP patterns. (B) High-GC
Figure Legend Snippet: Low- and high-GC PCR and TaqI RFLP assays. (A) Low-GC PCR amplicons and TaqI RFLP patterns. The top panel shows low-GC PCR amplicons from 20 poxvirus DNA samples. The bottom panel shows corresponding TaqI restriction endonuclease RFLP patterns. (B) High-GC

Techniques Used: Polymerase Chain Reaction

3) Product Images from "Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5"

Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5

Journal: Journal of Virology

doi: 10.1128/JVI.76.14.7094-7102.2002

HRV-5 is an ERV of rabbits. Genomic DNA from several mammalian and avian species was tested for the presence of HRV-5 sequences. (A) Southern blots probed with the MA domain of HRV-5 gag. Kbp, kilobase pairs. (B) PCR products obtained from the same species with primers derived from HRV-5 PR/RT, IN, and LTR and with degenerate primers for a gammaretrovirus pol sequence (γ). Following PCR, the HRV-5 products were transferred to a nylon membrane and were probed with an internal fragment specific for each product. Lanes: w, water; 1, fat-tailed dunnart; 2, quail; 3, Syrian hamster; 4, Chinese hamster; 5, rat; 6, mouse; 7, bat; 8, marmoset; 9, macaque; 10 African green monkey; 11, gibbon; 12, chimpanzee; 13, human (donor blood); 14, human (HeLa); 15, horse; 16, mink; 17, cat; 18, dog; 19, cow; 20, pig; 21, rabbit (SIRC); 22, rabbit (EREp), 23, rabbit spleen; 24, European hare; 25, black-tailed jackrabbit; and 26, Afghan pika. HRV-5 sequences were detected in rabbit DNA from three sources. (C) Southern blot of several species of Lagomorpha probed with the MA domain of HRV-5 gag .
Figure Legend Snippet: HRV-5 is an ERV of rabbits. Genomic DNA from several mammalian and avian species was tested for the presence of HRV-5 sequences. (A) Southern blots probed with the MA domain of HRV-5 gag. Kbp, kilobase pairs. (B) PCR products obtained from the same species with primers derived from HRV-5 PR/RT, IN, and LTR and with degenerate primers for a gammaretrovirus pol sequence (γ). Following PCR, the HRV-5 products were transferred to a nylon membrane and were probed with an internal fragment specific for each product. Lanes: w, water; 1, fat-tailed dunnart; 2, quail; 3, Syrian hamster; 4, Chinese hamster; 5, rat; 6, mouse; 7, bat; 8, marmoset; 9, macaque; 10 African green monkey; 11, gibbon; 12, chimpanzee; 13, human (donor blood); 14, human (HeLa); 15, horse; 16, mink; 17, cat; 18, dog; 19, cow; 20, pig; 21, rabbit (SIRC); 22, rabbit (EREp), 23, rabbit spleen; 24, European hare; 25, black-tailed jackrabbit; and 26, Afghan pika. HRV-5 sequences were detected in rabbit DNA from three sources. (C) Southern blot of several species of Lagomorpha probed with the MA domain of HRV-5 gag .

Techniques Used: Polymerase Chain Reaction, Derivative Assay, Sequencing, Southern Blot

HRV-5 RNA expression in rabbit tissues. The expression of HRV-5 RNA was analyzed in several rabbit tissues by RT-PCR with primer sets from gag (NC) and pol (IN). Lanes: 1, spleen; 2, kidney; 3, liver; 4, ovary; 5, stomach; 6, colon; 7, pancreas; 8, heart; 9, skeletal muscle; 10, lung; 11 skin; 12, brain; 13, placenta; 14, mammary gland; 15, lymph node; 16, SIRC (rabbit corneal epithelial cell line), 17, human L363 cell RNA; w, PCR water control; +, positive control (rabbit DNA); 18, water control from the DNase treatment step; and 19, water control from the primer-annealing step. Experiments were performed with or without RT in the cDNA synthesis reaction to control for contamination with cellular DNA. PCR primers for rabbit GAPDH were used as controls for RNA quality.
Figure Legend Snippet: HRV-5 RNA expression in rabbit tissues. The expression of HRV-5 RNA was analyzed in several rabbit tissues by RT-PCR with primer sets from gag (NC) and pol (IN). Lanes: 1, spleen; 2, kidney; 3, liver; 4, ovary; 5, stomach; 6, colon; 7, pancreas; 8, heart; 9, skeletal muscle; 10, lung; 11 skin; 12, brain; 13, placenta; 14, mammary gland; 15, lymph node; 16, SIRC (rabbit corneal epithelial cell line), 17, human L363 cell RNA; w, PCR water control; +, positive control (rabbit DNA); 18, water control from the DNase treatment step; and 19, water control from the primer-annealing step. Experiments were performed with or without RT in the cDNA synthesis reaction to control for contamination with cellular DNA. PCR primers for rabbit GAPDH were used as controls for RNA quality.

Techniques Used: RNA Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Positive Control

4) Product Images from "Developmental origins and impact of BCR-ABL1 fusion and IKZF1 deletions in monozygotic twins with Ph+ acute lymphoblastic leukemia"

Article Title: Developmental origins and impact of BCR-ABL1 fusion and IKZF1 deletions in monozygotic twins with Ph+ acute lymphoblastic leukemia

Journal: Blood

doi: 10.1182/blood-2011-07-366542

PCR amplification of the genomic BCR-ABL1 rearrangements from twins. (A) Genomic BCR-ABL1 rearrangements from twins 1A and 1B at diagnosis; lanes: 1, marker; 2, diagnosis twin 1A; 3, diagnosis twin 1B; 4 and 5, negative controls; 6, no DNA control. (B)
Figure Legend Snippet: PCR amplification of the genomic BCR-ABL1 rearrangements from twins. (A) Genomic BCR-ABL1 rearrangements from twins 1A and 1B at diagnosis; lanes: 1, marker; 2, diagnosis twin 1A; 3, diagnosis twin 1B; 4 and 5, negative controls; 6, no DNA control. (B)

Techniques Used: Polymerase Chain Reaction, Amplification, Marker

5) Product Images from "Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter"

Article Title: Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter

Journal: Journal of Clinical Investigation

doi:

PCR of human genomic DNA (lanes 1, 2) and BAC clones 452D14 (lanes 3–6) and 305N23 (lanes 7–10). Lanes 1, 3, 4, 7, and 8 are PCR products obtained with hUAT -specific primers. Lanes 2, 5, 6, 9, and 10 are PCR products obtained with hUAT2 -specific primers. Lane 0 is a 1-kbp DNA ladder.
Figure Legend Snippet: PCR of human genomic DNA (lanes 1, 2) and BAC clones 452D14 (lanes 3–6) and 305N23 (lanes 7–10). Lanes 1, 3, 4, 7, and 8 are PCR products obtained with hUAT -specific primers. Lanes 2, 5, 6, 9, and 10 are PCR products obtained with hUAT2 -specific primers. Lane 0 is a 1-kbp DNA ladder.

Techniques Used: Polymerase Chain Reaction, BAC Assay, Clone Assay

Related Articles

Polymerase Chain Reaction:

Article Title: From the Cover: Immunologically silent cancer clone transmission from mother to offspring
Article Snippet: .. For detection and amplification of DNA breakpoints, ranging from 300 bp to 12 kbp the Expand Long Template PCR kit (Roche) with System 2 was used, with an annealing temperature of 64 °C. .. To cover the BCR and ABL1 regions, within which breakpoints can occur, 21 BCR forward primers and 20 ABL1 reverse primers were used in multiplex, combining each BCR forward primer with 4 mixes of 5 ABL1 reverse primers.

Article Title: The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor ▿
Article Snippet: .. When DNA fragments were produced by PCR for subsequent cloning and expression, the Expand-Long-Template PCR kit (Roche, Molecular Biochemicals) containing a polymerase with proofreading capacity was used. .. The sequencing of 40 N-terminal amino acids of purified AsaP1 revealed 85% similarity to a corresponding sequence in the EprA1 protease of Aeromonas hydrophila (Table ).

Article Title: Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter
Article Snippet: .. To assure that the differences in expression did not result from disparate efficiencies of the hUAT versus hUAT2 primer pairs, PCR was performed with these primers using genomic DNA as a template with the Expand Long Template PCR kit in buffer number 1 (Roche Molecular Biochemicals). .. Since expression of hUAT was much greater than hUAT2 in the MTC panels, tissue levels of hUAT expression were determined by Northern analysis and dot-blot array.

Article Title: Developmental origins and impact of BCR-ABL1 fusion and IKZF1 deletions in monozygotic twins with Ph+ acute lymphoblastic leukemia
Article Snippet: .. For detection and amplification of DNA breakpoints, ranging from 300 bp to 12 kbp, the Expand Long Template PCR kit (Roche) with System 2 was used, with an annealing temperature of 64°C. .. To cover the BCR and ABL1 regions, within which breakpoints can occur, 21 BCR forward primers and 20 ABL1 reverse primers were used in multiplex, combining each BCR forward primer with 4 mixes of 5 ABL1 reverse primers, as described elsewhere.

Article Title: Increased mitochondrial biogenesis in muscle improves aging phenotypes in the mtDNA mutator mouse
Article Snippet: .. CRMs were amplified with Expand Long Template PCR kit (Roche) using primers 15720F (CACCAATGCCCCTCTTCTCG) and 16022B (TTGGGTTTTGCGGACTAATGAT). ..

Article Title: GC Content-Based Pan-Pox Universal PCR Assays for Poxvirus Detection ▿
Article Snippet: .. PCR mixtures contained ∼10 to 100 ng of viral DNA and a 20 μM primer pair in 50 μl of a solution of 50 mM Tris-HCl buffer (pH 9.2); 16 mM (NH4 )2 SO4 ; 2.25 mM MgCl2 ; 2% (vol/vol) dimethyl sulfoxide; 0.1% (vol/vol) detergent Tween 20; 350 μM (each) dATP, dCTP, dGTP, and dTTP; and 2 units of the DNA polymerases Taq and Pwo provided in the Expand Long Template PCR Kit (Roche Molecular Biologicals, Indianapolis, IN). .. Using a mixture of proofreading DNA polymerases reduces the potential sequence error from PCR amplification.

Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5
Article Snippet: .. HRV-5 proviral clones were amplified from 200 ng of SIRC DNA using the Expand Long Template PCR kit (Roche). .. The 3A locus was amplified with primers G7F2 (TGGTGCCGTGACTCGGATAGGA) and L1R1 (TTAAGGACAGAGATCCCACATAAG), the 5A locus using primers K12F1 (CAGCCCTGGCCGGAACTGTTGCAG-3) and U3R3 (TTGATACGCGCCTGTGTAAAGTTC), and the 5B locus using primers FLANK-R1 (GCTGGAGTCACATATATAAGTGACC) and U3R3.

Article Title: HERC2 rs12913832 modulates human pigmentation by attenuating chromatin-loop formation between a long-range enhancer and the OCA2 promoter
Article Snippet: .. A 1450-bp fragment surrounding rs12913832 was PCR-amplified from genomic DNA obtained from HEMn-LP (C-allele) or HEMn-DP (T-allele) using the Expand Long Template PCR Kit (Roche). .. The PCR fragment was digested with HindIII and PstI, generating a 750-bp fragment that was subcloned in pBluescript.

Produced:

Article Title: The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor ▿
Article Snippet: .. When DNA fragments were produced by PCR for subsequent cloning and expression, the Expand-Long-Template PCR kit (Roche, Molecular Biochemicals) containing a polymerase with proofreading capacity was used. .. The sequencing of 40 N-terminal amino acids of purified AsaP1 revealed 85% similarity to a corresponding sequence in the EprA1 protease of Aeromonas hydrophila (Table ).

Amplification:

Article Title: From the Cover: Immunologically silent cancer clone transmission from mother to offspring
Article Snippet: .. For detection and amplification of DNA breakpoints, ranging from 300 bp to 12 kbp the Expand Long Template PCR kit (Roche) with System 2 was used, with an annealing temperature of 64 °C. .. To cover the BCR and ABL1 regions, within which breakpoints can occur, 21 BCR forward primers and 20 ABL1 reverse primers were used in multiplex, combining each BCR forward primer with 4 mixes of 5 ABL1 reverse primers.

Article Title: Developmental origins and impact of BCR-ABL1 fusion and IKZF1 deletions in monozygotic twins with Ph+ acute lymphoblastic leukemia
Article Snippet: .. For detection and amplification of DNA breakpoints, ranging from 300 bp to 12 kbp, the Expand Long Template PCR kit (Roche) with System 2 was used, with an annealing temperature of 64°C. .. To cover the BCR and ABL1 regions, within which breakpoints can occur, 21 BCR forward primers and 20 ABL1 reverse primers were used in multiplex, combining each BCR forward primer with 4 mixes of 5 ABL1 reverse primers, as described elsewhere.

Article Title: Increased mitochondrial biogenesis in muscle improves aging phenotypes in the mtDNA mutator mouse
Article Snippet: .. CRMs were amplified with Expand Long Template PCR kit (Roche) using primers 15720F (CACCAATGCCCCTCTTCTCG) and 16022B (TTGGGTTTTGCGGACTAATGAT). ..

Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5
Article Snippet: .. HRV-5 proviral clones were amplified from 200 ng of SIRC DNA using the Expand Long Template PCR kit (Roche). .. The 3A locus was amplified with primers G7F2 (TGGTGCCGTGACTCGGATAGGA) and L1R1 (TTAAGGACAGAGATCCCACATAAG), the 5A locus using primers K12F1 (CAGCCCTGGCCGGAACTGTTGCAG-3) and U3R3 (TTGATACGCGCCTGTGTAAAGTTC), and the 5B locus using primers FLANK-R1 (GCTGGAGTCACATATATAAGTGACC) and U3R3.

Expressing:

Article Title: The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor ▿
Article Snippet: .. When DNA fragments were produced by PCR for subsequent cloning and expression, the Expand-Long-Template PCR kit (Roche, Molecular Biochemicals) containing a polymerase with proofreading capacity was used. .. The sequencing of 40 N-terminal amino acids of purified AsaP1 revealed 85% similarity to a corresponding sequence in the EprA1 protease of Aeromonas hydrophila (Table ).

Article Title: Functional reconstitution, membrane targeting, genomic structure, and chromosomal localization of a human urate transporter
Article Snippet: .. To assure that the differences in expression did not result from disparate efficiencies of the hUAT versus hUAT2 primer pairs, PCR was performed with these primers using genomic DNA as a template with the Expand Long Template PCR kit in buffer number 1 (Roche Molecular Biochemicals). .. Since expression of hUAT was much greater than hUAT2 in the MTC panels, tissue levels of hUAT expression were determined by Northern analysis and dot-blot array.

Clone Assay:

Article Title: The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor ▿
Article Snippet: .. When DNA fragments were produced by PCR for subsequent cloning and expression, the Expand-Long-Template PCR kit (Roche, Molecular Biochemicals) containing a polymerase with proofreading capacity was used. .. The sequencing of 40 N-terminal amino acids of purified AsaP1 revealed 85% similarity to a corresponding sequence in the EprA1 protease of Aeromonas hydrophila (Table ).

Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5
Article Snippet: .. HRV-5 proviral clones were amplified from 200 ng of SIRC DNA using the Expand Long Template PCR kit (Roche). .. The 3A locus was amplified with primers G7F2 (TGGTGCCGTGACTCGGATAGGA) and L1R1 (TTAAGGACAGAGATCCCACATAAG), the 5A locus using primers K12F1 (CAGCCCTGGCCGGAACTGTTGCAG-3) and U3R3 (TTGATACGCGCCTGTGTAAAGTTC), and the 5B locus using primers FLANK-R1 (GCTGGAGTCACATATATAAGTGACC) and U3R3.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Roche expand long template pcr kit
    Characterization and suitability of the <t>HEMn</t> cell system: The OCA2 gene is differentially expressed in HEMn-LP and HEMn-DP cells. ( A ) overview of the OCA2 - HERC2 locus ( top panel). ( Middle panel) The region covered on BAC RP11-1365A12. Vertebrate conservation (green); the position of rs12913832 (red). ( Lower panel) A schematic overview of the region investigated in this study. Restriction enzyme digestion sites are indicated. ( B ) Sequence analysis of the region around HERC2 rs12913832 in HEMn-LP ( left ) and HEMn-DP ( right ). The genotypes of rs12913832 were determined by direct sequencing of <t>PCR</t> fragments containing rs12913832. ( C ) RT-qPCR analysis of OCA2 primary transcripts in MCF7 and HEMn cells demonstrates differential OCA2 expression between HEMn-LP and HEMn-DP cells. Each gene expression analysis is carried out in triplicate and normalized to an endogenous reference gene ( ACTB ). ( D ) ChIP-qPCR of RNA Pol II binding at the OCA2 promoter in MCF7, HEMn-LP, and HEMn-DP cells. Enrichment is calculated relative to necdin ( NDN ), and values are normalized to input measurements. All ChIP analyses are performed in triplicate. Data are represented as mean ± SEM; (*) p
    Expand Long Template Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 105 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long template pcr kit/product/Roche
    Average 91 stars, based on 105 article reviews
    Price from $9.99 to $1999.99
    expand long template pcr kit - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    Image Search Results


    Characterization and suitability of the HEMn cell system: The OCA2 gene is differentially expressed in HEMn-LP and HEMn-DP cells. ( A ) overview of the OCA2 - HERC2 locus ( top panel). ( Middle panel) The region covered on BAC RP11-1365A12. Vertebrate conservation (green); the position of rs12913832 (red). ( Lower panel) A schematic overview of the region investigated in this study. Restriction enzyme digestion sites are indicated. ( B ) Sequence analysis of the region around HERC2 rs12913832 in HEMn-LP ( left ) and HEMn-DP ( right ). The genotypes of rs12913832 were determined by direct sequencing of PCR fragments containing rs12913832. ( C ) RT-qPCR analysis of OCA2 primary transcripts in MCF7 and HEMn cells demonstrates differential OCA2 expression between HEMn-LP and HEMn-DP cells. Each gene expression analysis is carried out in triplicate and normalized to an endogenous reference gene ( ACTB ). ( D ) ChIP-qPCR of RNA Pol II binding at the OCA2 promoter in MCF7, HEMn-LP, and HEMn-DP cells. Enrichment is calculated relative to necdin ( NDN ), and values are normalized to input measurements. All ChIP analyses are performed in triplicate. Data are represented as mean ± SEM; (*) p

    Journal: Genome Research

    Article Title: HERC2 rs12913832 modulates human pigmentation by attenuating chromatin-loop formation between a long-range enhancer and the OCA2 promoter

    doi: 10.1101/gr.128652.111

    Figure Lengend Snippet: Characterization and suitability of the HEMn cell system: The OCA2 gene is differentially expressed in HEMn-LP and HEMn-DP cells. ( A ) overview of the OCA2 - HERC2 locus ( top panel). ( Middle panel) The region covered on BAC RP11-1365A12. Vertebrate conservation (green); the position of rs12913832 (red). ( Lower panel) A schematic overview of the region investigated in this study. Restriction enzyme digestion sites are indicated. ( B ) Sequence analysis of the region around HERC2 rs12913832 in HEMn-LP ( left ) and HEMn-DP ( right ). The genotypes of rs12913832 were determined by direct sequencing of PCR fragments containing rs12913832. ( C ) RT-qPCR analysis of OCA2 primary transcripts in MCF7 and HEMn cells demonstrates differential OCA2 expression between HEMn-LP and HEMn-DP cells. Each gene expression analysis is carried out in triplicate and normalized to an endogenous reference gene ( ACTB ). ( D ) ChIP-qPCR of RNA Pol II binding at the OCA2 promoter in MCF7, HEMn-LP, and HEMn-DP cells. Enrichment is calculated relative to necdin ( NDN ), and values are normalized to input measurements. All ChIP analyses are performed in triplicate. Data are represented as mean ± SEM; (*) p

    Article Snippet: A 1450-bp fragment surrounding rs12913832 was PCR-amplified from genomic DNA obtained from HEMn-LP (C-allele) or HEMn-DP (T-allele) using the Expand Long Template PCR Kit (Roche).

    Techniques: BAC Assay, Sequencing, Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay

    FAIRE analysis of pigmentation-associated SNPs other than HERC2 rs12913832 present within the 3′ HERC2 /5′ OCA2 region does not reveal additional regulatory elements. ( Left ) of the investigated 3′ HERC2/ 5′ OCA2 region. Pigmentation-associated SNPs (red); linked SNPs ( r 2 > 0.8) (black). The approximate location of the analyzed PCR amplicons is indicated. ( Right side) The genotype of each SNP for HEMn-LP and HEMn-DP. The enrichments displayed are relative to NDN . Data are represented as mean ± SEM.

    Journal: Genome Research

    Article Title: HERC2 rs12913832 modulates human pigmentation by attenuating chromatin-loop formation between a long-range enhancer and the OCA2 promoter

    doi: 10.1101/gr.128652.111

    Figure Lengend Snippet: FAIRE analysis of pigmentation-associated SNPs other than HERC2 rs12913832 present within the 3′ HERC2 /5′ OCA2 region does not reveal additional regulatory elements. ( Left ) of the investigated 3′ HERC2/ 5′ OCA2 region. Pigmentation-associated SNPs (red); linked SNPs ( r 2 > 0.8) (black). The approximate location of the analyzed PCR amplicons is indicated. ( Right side) The genotype of each SNP for HEMn-LP and HEMn-DP. The enrichments displayed are relative to NDN . Data are represented as mean ± SEM.

    Article Snippet: A 1450-bp fragment surrounding rs12913832 was PCR-amplified from genomic DNA obtained from HEMn-LP (C-allele) or HEMn-DP (T-allele) using the Expand Long Template PCR Kit (Roche).

    Techniques: Polymerase Chain Reaction

    Low- and high-GC PCR and TaqI RFLP assays. (A) Low-GC PCR amplicons and TaqI RFLP patterns. The top panel shows low-GC PCR amplicons from 20 poxvirus DNA samples. The bottom panel shows corresponding TaqI restriction endonuclease RFLP patterns. (B) High-GC

    Journal: Journal of Clinical Microbiology

    Article Title: GC Content-Based Pan-Pox Universal PCR Assays for Poxvirus Detection ▿

    doi: 10.1128/JCM.01697-09

    Figure Lengend Snippet: Low- and high-GC PCR and TaqI RFLP assays. (A) Low-GC PCR amplicons and TaqI RFLP patterns. The top panel shows low-GC PCR amplicons from 20 poxvirus DNA samples. The bottom panel shows corresponding TaqI restriction endonuclease RFLP patterns. (B) High-GC

    Article Snippet: PCR mixtures contained ∼10 to 100 ng of viral DNA and a 20 μM primer pair in 50 μl of a solution of 50 mM Tris-HCl buffer (pH 9.2); 16 mM (NH4 )2 SO4 ; 2.25 mM MgCl2 ; 2% (vol/vol) dimethyl sulfoxide; 0.1% (vol/vol) detergent Tween 20; 350 μM (each) dATP, dCTP, dGTP, and dTTP; and 2 units of the DNA polymerases Taq and Pwo provided in the Expand Long Template PCR Kit (Roche Molecular Biologicals, Indianapolis, IN).

    Techniques: Polymerase Chain Reaction

    HRV-5 is an ERV of rabbits. Genomic DNA from several mammalian and avian species was tested for the presence of HRV-5 sequences. (A) Southern blots probed with the MA domain of HRV-5 gag. Kbp, kilobase pairs. (B) PCR products obtained from the same species with primers derived from HRV-5 PR/RT, IN, and LTR and with degenerate primers for a gammaretrovirus pol sequence (γ). Following PCR, the HRV-5 products were transferred to a nylon membrane and were probed with an internal fragment specific for each product. Lanes: w, water; 1, fat-tailed dunnart; 2, quail; 3, Syrian hamster; 4, Chinese hamster; 5, rat; 6, mouse; 7, bat; 8, marmoset; 9, macaque; 10 African green monkey; 11, gibbon; 12, chimpanzee; 13, human (donor blood); 14, human (HeLa); 15, horse; 16, mink; 17, cat; 18, dog; 19, cow; 20, pig; 21, rabbit (SIRC); 22, rabbit (EREp), 23, rabbit spleen; 24, European hare; 25, black-tailed jackrabbit; and 26, Afghan pika. HRV-5 sequences were detected in rabbit DNA from three sources. (C) Southern blot of several species of Lagomorpha probed with the MA domain of HRV-5 gag .

    Journal: Journal of Virology

    Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5

    doi: 10.1128/JVI.76.14.7094-7102.2002

    Figure Lengend Snippet: HRV-5 is an ERV of rabbits. Genomic DNA from several mammalian and avian species was tested for the presence of HRV-5 sequences. (A) Southern blots probed with the MA domain of HRV-5 gag. Kbp, kilobase pairs. (B) PCR products obtained from the same species with primers derived from HRV-5 PR/RT, IN, and LTR and with degenerate primers for a gammaretrovirus pol sequence (γ). Following PCR, the HRV-5 products were transferred to a nylon membrane and were probed with an internal fragment specific for each product. Lanes: w, water; 1, fat-tailed dunnart; 2, quail; 3, Syrian hamster; 4, Chinese hamster; 5, rat; 6, mouse; 7, bat; 8, marmoset; 9, macaque; 10 African green monkey; 11, gibbon; 12, chimpanzee; 13, human (donor blood); 14, human (HeLa); 15, horse; 16, mink; 17, cat; 18, dog; 19, cow; 20, pig; 21, rabbit (SIRC); 22, rabbit (EREp), 23, rabbit spleen; 24, European hare; 25, black-tailed jackrabbit; and 26, Afghan pika. HRV-5 sequences were detected in rabbit DNA from three sources. (C) Southern blot of several species of Lagomorpha probed with the MA domain of HRV-5 gag .

    Article Snippet: HRV-5 proviral clones were amplified from 200 ng of SIRC DNA using the Expand Long Template PCR kit (Roche).

    Techniques: Polymerase Chain Reaction, Derivative Assay, Sequencing, Southern Blot

    HRV-5 RNA expression in rabbit tissues. The expression of HRV-5 RNA was analyzed in several rabbit tissues by RT-PCR with primer sets from gag (NC) and pol (IN). Lanes: 1, spleen; 2, kidney; 3, liver; 4, ovary; 5, stomach; 6, colon; 7, pancreas; 8, heart; 9, skeletal muscle; 10, lung; 11 skin; 12, brain; 13, placenta; 14, mammary gland; 15, lymph node; 16, SIRC (rabbit corneal epithelial cell line), 17, human L363 cell RNA; w, PCR water control; +, positive control (rabbit DNA); 18, water control from the DNase treatment step; and 19, water control from the primer-annealing step. Experiments were performed with or without RT in the cDNA synthesis reaction to control for contamination with cellular DNA. PCR primers for rabbit GAPDH were used as controls for RNA quality.

    Journal: Journal of Virology

    Article Title: Novel Endogenous Retrovirus in Rabbits Previously Reported as Human Retrovirus 5

    doi: 10.1128/JVI.76.14.7094-7102.2002

    Figure Lengend Snippet: HRV-5 RNA expression in rabbit tissues. The expression of HRV-5 RNA was analyzed in several rabbit tissues by RT-PCR with primer sets from gag (NC) and pol (IN). Lanes: 1, spleen; 2, kidney; 3, liver; 4, ovary; 5, stomach; 6, colon; 7, pancreas; 8, heart; 9, skeletal muscle; 10, lung; 11 skin; 12, brain; 13, placenta; 14, mammary gland; 15, lymph node; 16, SIRC (rabbit corneal epithelial cell line), 17, human L363 cell RNA; w, PCR water control; +, positive control (rabbit DNA); 18, water control from the DNase treatment step; and 19, water control from the primer-annealing step. Experiments were performed with or without RT in the cDNA synthesis reaction to control for contamination with cellular DNA. PCR primers for rabbit GAPDH were used as controls for RNA quality.

    Article Snippet: HRV-5 proviral clones were amplified from 200 ng of SIRC DNA using the Expand Long Template PCR kit (Roche).

    Techniques: RNA Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Positive Control

    Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Journal: BioMed Research International

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

    doi: 10.1155/2014/256245

    Figure Lengend Snippet: Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Article Snippet: PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche).

    Techniques: Polymerase Chain Reaction, Marker