Structured Review

Roche expand long range pcr kit
ψND5 element positions in C. briggsae mitochondrial genomes . Dashed boxes indicate the two ψND5 elements and open boxes indicate mtDNA genes. Protein-coding genes are indicated by their common abbreviations and tRNA genes are indicated by their respective associated single-letter amino acid codes. ψND5-1 is 214–223 bp, depending on isolate, and ψND5-2 is 325–344 bp. The dashed horizontal line on top indicates <t>DNA</t> sequences that are lost in heteroplasmic ND5 deletion variants and the arrows indicate the primer positions that are employed for conventional <t>PCR</t> assays.
Expand Long Range Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/expand long range pcr kit/product/Roche
Average 90 stars, based on 36 article reviews
Price from $9.99 to $1999.99
expand long range pcr kit - by Bioz Stars, 2020-07
90/100 stars

Images

1) Product Images from "Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution"

Article Title: Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution

Journal: BMC Evolutionary Biology

doi: 10.1186/1471-2148-8-62

ψND5 element positions in C. briggsae mitochondrial genomes . Dashed boxes indicate the two ψND5 elements and open boxes indicate mtDNA genes. Protein-coding genes are indicated by their common abbreviations and tRNA genes are indicated by their respective associated single-letter amino acid codes. ψND5-1 is 214–223 bp, depending on isolate, and ψND5-2 is 325–344 bp. The dashed horizontal line on top indicates DNA sequences that are lost in heteroplasmic ND5 deletion variants and the arrows indicate the primer positions that are employed for conventional PCR assays.
Figure Legend Snippet: ψND5 element positions in C. briggsae mitochondrial genomes . Dashed boxes indicate the two ψND5 elements and open boxes indicate mtDNA genes. Protein-coding genes are indicated by their common abbreviations and tRNA genes are indicated by their respective associated single-letter amino acid codes. ψND5-1 is 214–223 bp, depending on isolate, and ψND5-2 is 325–344 bp. The dashed horizontal line on top indicates DNA sequences that are lost in heteroplasmic ND5 deletion variants and the arrows indicate the primer positions that are employed for conventional PCR assays.

Techniques Used: Polymerase Chain Reaction

Related Articles

Polymerase Chain Reaction:

Article Title: Maternally inherited genetic variants of CADPS2 are present in Autism Spectrum Disorders and Intellectual Disability patients
Article Snippet: .. A long-range PCR was performed using the Expand-Long Range PCR kit according to the manufacturer's instruction (Roche Diagnostics) using 200 ng of genomic DNA from peripheral blood with the following PCR cycles (40): 92°C 2′, 92°C 10′′ 60°C 15′′ 68°C 14′, 68°C 7′. .. PCR products were purified onto a Millipore PCR clean-up plate, cloned with the Original TA cloning kit (Life Technologies) in the pcDNA2.1 vector, and transformed into DH5α E. coli strains for white/blue screening.

Article Title: Domain Organization and Evolution of the Highly Divergent 5′ Coding Region of Genomes of Arteriviruses, Including the Novel Possum Nidovirus
Article Snippet: .. Since the lengths of the expected PCR fragments were unknown, primary PCRs were also performed using an Expand long-range PCR kit (Roche) according to the manufacturer's instructions, with an initial elongation step of 4 min at 68°C. .. In order to determine whether the longest PCR product represented the 5′ end of the full-length genomic RNA, the RLM RACE protocol was repeated using another capture probe (Biotyn_S12.F) targeting a region within the newly determined 5′ end of the sequence, in combination with virus-specific primers WPD.S10.R, WPD.S13.R, WPD.S14.R, and WPD.S15.R (RACE 2) (Table S1).

Article Title: A Compound Heterozygous One Amino-Acid Insertion/Nonsense Mutation in the Plectin Gene Causes Epidermolysis Bullosa Simplex with Plectin Deficiency
Article Snippet: .. Polymerase chain reactions (PCRs) were performed at 95°C denaturing temperature, 60°C and 62°C annealing temperature, respectively, and 68°C extension temperature using Expand Long-Range PCR kit (Roche Molecular Biomedicals, Indianapolis, IN). .. Amplified DNA was analyzed by conformation-sensitive gel electrophoresis following a standard protocol.

Article Title: The mitochondrial genomes of the acoelomorph worms Paratomella rubra, Isodiametra pulchra and Archaphanostoma ylvae
Article Snippet: .. PCRs were carried out using the Expand Long-Range PCR Kit (Roche Applied Sciences: Product No. 11681834001), following manufacturer recommendations for 50 μl reaction set-up. .. General cycling protocol was: 92 °C for 2 min; 15 cycles of: 92 °C for 10 sec, 57 °C for 15 sec, 68 °C at initial elongation time (approximated as 1 min per 1000 base pairs to be amplified); 2 cycles each of: 92 °C for 10 sec, 57 °C for 15 sec, 68 °C at 40 sec longer than initial elongation time, repeated at increasing 40 sec intervals for a further 14 cycles; a final elongation stage at 68 °C for 7 min and a 4 °C ‘hold’ stage.

Article Title: Ferric Dicitrate Transport System (Fec) of Shigella flexneri 2a YSH6000 Is Encoded on a Novel Pathogenicity Island Carrying Multiple Antibiotic Resistance Genes
Article Snippet: .. Long-range PCR was carried out with the Expand long-range PCR kit (Roche). .. Nucleotide sequencing of the PAI in S. flexneri strain YSH6000 was carried out by sequencing genomic clones, inverse PCR products, sspPCR products, and a long-range PCR product.

Article Title: Using Mitogenomic and Nuclear Ribosomal Sequence Data to Investigate the Phylogeny of the Xiphinema americanum Species Complex
Article Snippet: .. The Expand Long Range PCR kit (Roche, Basel, Switzerland) with primers in the large and small rRNA genes and trnR , designed from the published X. americanum mitochondrial genome sequence was used. .. The primers for long PCR (Xa_lsuA_F: CAACATCGAGGTCAACTATTC ; Xa_ssu_R: ATCTGTTATGGACCGAAGAAG ; Xa_Arg_F: TTAGTGGGTTACTACGCTTGG ; Xa_lsuA_R: AGAATAGTTGACCTCGATGTT ) produced two amplicons (approximately 7,800 kb and 7,100 kb) which together covered the entire mitochondrial genome.

Article Title: Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution
Article Snippet: .. PCR, DNA sequencing and phylogenetics mtDNA sequencing and PCR were performed as previously described [ , ], with the exception that mitochondrial genome sequences were initially amplified as four overlapping PCR products 3–5 kb in size each using the Expand Long Range PCR kit (Roche). e2TAK (Takara) proofreading DNA polymerase was used for all conventional PCRs. .. For single-worm DNA extractions, individual worms were picked at the L1 larval stage and digested in 18 μL of lysis buffer [ , ].

Article Title: Transgene Silencing and Transgene-Derived siRNA Production in Tobacco Plants Homozygous for an Introduced AtMYB90 Construct
Article Snippet: .. AtMYB90 mRNA was converted to cDNA as described previously , and end fragments PCR amplified using an Expand Long Range PCR kit from Roche Applied Science. .. PCR fragment s from cDNA were directly sequenced using an ABI 3130xI Genetic Analyser and Big Dye® Terminator kit v3.1 as per the manufacturer's instructions.

Sequencing:

Article Title: Using Mitogenomic and Nuclear Ribosomal Sequence Data to Investigate the Phylogeny of the Xiphinema americanum Species Complex
Article Snippet: .. The Expand Long Range PCR kit (Roche, Basel, Switzerland) with primers in the large and small rRNA genes and trnR , designed from the published X. americanum mitochondrial genome sequence was used. .. The primers for long PCR (Xa_lsuA_F: CAACATCGAGGTCAACTATTC ; Xa_ssu_R: ATCTGTTATGGACCGAAGAAG ; Xa_Arg_F: TTAGTGGGTTACTACGCTTGG ; Xa_lsuA_R: AGAATAGTTGACCTCGATGTT ) produced two amplicons (approximately 7,800 kb and 7,100 kb) which together covered the entire mitochondrial genome.

Article Title: Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution
Article Snippet: .. PCR, DNA sequencing and phylogenetics mtDNA sequencing and PCR were performed as previously described [ , ], with the exception that mitochondrial genome sequences were initially amplified as four overlapping PCR products 3–5 kb in size each using the Expand Long Range PCR kit (Roche). e2TAK (Takara) proofreading DNA polymerase was used for all conventional PCRs. .. For single-worm DNA extractions, individual worms were picked at the L1 larval stage and digested in 18 μL of lysis buffer [ , ].

Amplification:

Article Title: Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution
Article Snippet: .. PCR, DNA sequencing and phylogenetics mtDNA sequencing and PCR were performed as previously described [ , ], with the exception that mitochondrial genome sequences were initially amplified as four overlapping PCR products 3–5 kb in size each using the Expand Long Range PCR kit (Roche). e2TAK (Takara) proofreading DNA polymerase was used for all conventional PCRs. .. For single-worm DNA extractions, individual worms were picked at the L1 larval stage and digested in 18 μL of lysis buffer [ , ].

Article Title: Transgene Silencing and Transgene-Derived siRNA Production in Tobacco Plants Homozygous for an Introduced AtMYB90 Construct
Article Snippet: .. AtMYB90 mRNA was converted to cDNA as described previously , and end fragments PCR amplified using an Expand Long Range PCR kit from Roche Applied Science. .. PCR fragment s from cDNA were directly sequenced using an ABI 3130xI Genetic Analyser and Big Dye® Terminator kit v3.1 as per the manufacturer's instructions.

DNA Sequencing:

Article Title: Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution
Article Snippet: .. PCR, DNA sequencing and phylogenetics mtDNA sequencing and PCR were performed as previously described [ , ], with the exception that mitochondrial genome sequences were initially amplified as four overlapping PCR products 3–5 kb in size each using the Expand Long Range PCR kit (Roche). e2TAK (Takara) proofreading DNA polymerase was used for all conventional PCRs. .. For single-worm DNA extractions, individual worms were picked at the L1 larval stage and digested in 18 μL of lysis buffer [ , ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Roche long range pcr expand long pcr kit roche
    LCT13 and <t>TFPI-2as</t> expression is linked. ( A ) Schematic diagram of the genomic region in Figure 1 A indicating regions (1–7) analysed by strand-specific <t>RT–PCR</t> (middle). Shown above and below the schematic are the ethidium bromide–stained gels used to visualize the strand-specific RT–PCR. Regions 2–7 are specifically expressed in cancer cell lines (H, HCC-1954 and M, MCF-7), but not normal breast (N), showing that cancer-specific antisense transcription is detectable up to 300 kb away from the TFPI-2 gene and up to the LINE-1 retrotransposon associated with LCT13. ( B ) siRNA knockdown of the LCT13 transcript. 2D densitometry of semiquantitative strand-specific RT–PCR analysis normalized to APRT control reveals an approximate 50% knockdown in LCT13 levels in cells transfected with a pool of three siRNA duplexes directed against LCT13 compared to those transfected with scrambled control siRNAs (left panel). This is paralleled by a 40–50% decrease in the TFPI-2as transcript (right panel).
    Long Range Pcr Expand Long Pcr Kit Roche, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr expand long pcr kit roche/product/Roche
    Average 85 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    long range pcr expand long pcr kit roche - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    88
    Roche expand long template pcr system kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Template Pcr System Kit, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long template pcr system kit/product/Roche
    Average 88 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    expand long template pcr system kit - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    92
    Roche long range pcr
    Effects of BRCA1 RNAi on <t>XIST</t> expression in cells with different XCI status. HMEC (XCI type 0), MCF7 (XCI type 1) and T47D (XCI type 2) were transfected with a mix of two BRCA1 -specific siRNAs, mapping to exons 12 and 24, or a control siRNA. After 72 hrs, cells were processed for BRCA1 immunofluorescence and RNA purification. In all panels BRCA1 is immunostained in green and nuclei are marked with DAPI. The histogram represents quantitative <t>RT-PCR</t> analysis performed on cDNAs of the indicated cell lines, before and after BRCA1 silencing, using primers specific for spliced and unspliced XIST RNA. XIST RNA levels are expressed as a ratio to GAPDH mRNA levels, after subtraction of the background signal from cDNA synthesis reactions lacking reverse transcriptase. To facilitate comparison between cell lines with different XCI status, the XIST / GAPDH transcript ratio was normalised relative to HMEC. Error bars represent standard deviation and the asterisks indicate statistically significant differences (p
    Long Range Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 167 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr/product/Roche
    Average 92 stars, based on 167 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    LCT13 and TFPI-2as expression is linked. ( A ) Schematic diagram of the genomic region in Figure 1 A indicating regions (1–7) analysed by strand-specific RT–PCR (middle). Shown above and below the schematic are the ethidium bromide–stained gels used to visualize the strand-specific RT–PCR. Regions 2–7 are specifically expressed in cancer cell lines (H, HCC-1954 and M, MCF-7), but not normal breast (N), showing that cancer-specific antisense transcription is detectable up to 300 kb away from the TFPI-2 gene and up to the LINE-1 retrotransposon associated with LCT13. ( B ) siRNA knockdown of the LCT13 transcript. 2D densitometry of semiquantitative strand-specific RT–PCR analysis normalized to APRT control reveals an approximate 50% knockdown in LCT13 levels in cells transfected with a pool of three siRNA duplexes directed against LCT13 compared to those transfected with scrambled control siRNAs (left panel). This is paralleled by a 40–50% decrease in the TFPI-2as transcript (right panel).

    Journal: Nucleic Acids Research

    Article Title: Expression of a large LINE-1-driven antisense RNA is linked to epigenetic silencing of the metastasis suppressor gene TFPI-2 in cancer

    doi: 10.1093/nar/gkt438

    Figure Lengend Snippet: LCT13 and TFPI-2as expression is linked. ( A ) Schematic diagram of the genomic region in Figure 1 A indicating regions (1–7) analysed by strand-specific RT–PCR (middle). Shown above and below the schematic are the ethidium bromide–stained gels used to visualize the strand-specific RT–PCR. Regions 2–7 are specifically expressed in cancer cell lines (H, HCC-1954 and M, MCF-7), but not normal breast (N), showing that cancer-specific antisense transcription is detectable up to 300 kb away from the TFPI-2 gene and up to the LINE-1 retrotransposon associated with LCT13. ( B ) siRNA knockdown of the LCT13 transcript. 2D densitometry of semiquantitative strand-specific RT–PCR analysis normalized to APRT control reveals an approximate 50% knockdown in LCT13 levels in cells transfected with a pool of three siRNA duplexes directed against LCT13 compared to those transfected with scrambled control siRNAs (left panel). This is paralleled by a 40–50% decrease in the TFPI-2as transcript (right panel).

    Article Snippet: Generation of constructs and ES cell clones For pTFPI-2as and pTFPI-2pa constructs, a 4.93-kb human genomic DNA fragment including the full-length TFPI-2 gene obtained by long-range PCR (Expand Long PCR kit, Roche) on human genomic DNA with primers HC63f and HC63g and was cloned into the BamHI and KpnI sites of pcDNA3 (Invitrogen) and pcDNA3p(A)for, respectively. pcDNA3p(A)for was derived from pcDNA3 by cloning a 262 bp BGHp(A) fragment, obtained by PCR on pcDNA3 with primers Hind-p(A)-for and Hind-p(A)-rev, into the HindIII site of pcDNA3.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Staining, Transfection

    A human TFPI-2 transgene is sensitive to antisense RNA repression in mouse ES cells. (A) Schematic diagram of constructs introduced into mouse ES cells: pTFPI-2as is designed to transcribe antisense to TFPI-2 from a CMV promoter, while pTFPI-2pa has a poly-A signal insertion downstream of the CMV promoter to block antisense transcription. Arrows indicate direction of transcription. Regions analysed by ChIP are annotated as ‘prom’ and ‘ex-in2’. ( B ) Strand-specific RT–PCR analysis of TFPI-2 antisenese (TFPI-2as) expression in transgenic mouse ES cell lines demonstrates increased levels in pTFPI-2as lines (L2 and L12) relative to pTFPI-2pa cells (L7 and L9), mouse Aprt acts as a positive control for RNA quality and quantity. This correlates with a reduction in TFPI-2 expression as shown by real-time PCR normalized to mouse Gapdh . ( C ) ChIP analysis followed by real-time PCR. Left panel: Antibodies to H3K9me3 reveal localized enrichment of H3K9me3 in the promoter region in the antisense expressing cell line, pTFPI-2as (L2), compared to cells transfected with pTFPI-2pa (L9), which express low levels of TFPI-2as. Right panel: Antibodies to H4K20me3 also show enrichment at the TFPI-2 promoter in pTFPI-2as compared to pTFPI-2pa.

    Journal: Nucleic Acids Research

    Article Title: Expression of a large LINE-1-driven antisense RNA is linked to epigenetic silencing of the metastasis suppressor gene TFPI-2 in cancer

    doi: 10.1093/nar/gkt438

    Figure Lengend Snippet: A human TFPI-2 transgene is sensitive to antisense RNA repression in mouse ES cells. (A) Schematic diagram of constructs introduced into mouse ES cells: pTFPI-2as is designed to transcribe antisense to TFPI-2 from a CMV promoter, while pTFPI-2pa has a poly-A signal insertion downstream of the CMV promoter to block antisense transcription. Arrows indicate direction of transcription. Regions analysed by ChIP are annotated as ‘prom’ and ‘ex-in2’. ( B ) Strand-specific RT–PCR analysis of TFPI-2 antisenese (TFPI-2as) expression in transgenic mouse ES cell lines demonstrates increased levels in pTFPI-2as lines (L2 and L12) relative to pTFPI-2pa cells (L7 and L9), mouse Aprt acts as a positive control for RNA quality and quantity. This correlates with a reduction in TFPI-2 expression as shown by real-time PCR normalized to mouse Gapdh . ( C ) ChIP analysis followed by real-time PCR. Left panel: Antibodies to H3K9me3 reveal localized enrichment of H3K9me3 in the promoter region in the antisense expressing cell line, pTFPI-2as (L2), compared to cells transfected with pTFPI-2pa (L9), which express low levels of TFPI-2as. Right panel: Antibodies to H4K20me3 also show enrichment at the TFPI-2 promoter in pTFPI-2as compared to pTFPI-2pa.

    Article Snippet: Generation of constructs and ES cell clones For pTFPI-2as and pTFPI-2pa constructs, a 4.93-kb human genomic DNA fragment including the full-length TFPI-2 gene obtained by long-range PCR (Expand Long PCR kit, Roche) on human genomic DNA with primers HC63f and HC63g and was cloned into the BamHI and KpnI sites of pcDNA3 (Invitrogen) and pcDNA3p(A)for, respectively. pcDNA3p(A)for was derived from pcDNA3 by cloning a 262 bp BGHp(A) fragment, obtained by PCR on pcDNA3 with primers Hind-p(A)-for and Hind-p(A)-rev, into the HindIII site of pcDNA3.

    Techniques: Construct, Blocking Assay, Chromatin Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Expressing, Transgenic Assay, Positive Control, Real-time Polymerase Chain Reaction, Transfection

    Correlated expression of LCT13 and TFPI-2as transcripts in breast cancer cells. ( A ) Schematic diagram of a 300-kb region of chromosome 7q21.3 including LCT13 and the TFPI-2 gene. Scale is kilobase and indicates the position from the centromere with the value of 0 arbitrarily assigned to the TSS of CALCR . Genes (5′ segment of CALCR , TFPI-2 and GNGT1 ) are indicated as gray arrows. Two LINE-1 elements are present in the region (L1PA2 and L1PA6). Transcriptional orientations are indicated by arrows. LCT13 is a previously identified transcript shown to initiate at an L1ASP by 5′ RACE ( 22 ). TFPI-2as is the fragment analysed by strand-specific RT–PCR to test for the presence of TFPI-2 antisense RNAs. Displayed are the three spliced ESTs isolated from kidney (BG432114) and liver (DW466562 and DW435092) libraries that initiate at the LINE1 antisense promoter like LCT13 and extend past the TFPI-2 gene with a putative alternative transcript GNGT1-005 also annotated. ( B ) Expression of TFPI-2as (upper) and TFPI-2 (lower) in normal breast (N) and in breast cancer cell lines (H, HCC-1954; M, MCF7) analysed by strand specific and real-time RT–PCR, respectively. TFPI-2 expression is reduced in both breast cancer cell lines compared to normal controls (n = 3). TFPI-2 expression levels were normalized to HPRT . ( C ) Expression of TFPI-2as (upper) and TFPI-2 (lower) in a panel of five matched normal and tumour breast tissue analysed as described in B.

    Journal: Nucleic Acids Research

    Article Title: Expression of a large LINE-1-driven antisense RNA is linked to epigenetic silencing of the metastasis suppressor gene TFPI-2 in cancer

    doi: 10.1093/nar/gkt438

    Figure Lengend Snippet: Correlated expression of LCT13 and TFPI-2as transcripts in breast cancer cells. ( A ) Schematic diagram of a 300-kb region of chromosome 7q21.3 including LCT13 and the TFPI-2 gene. Scale is kilobase and indicates the position from the centromere with the value of 0 arbitrarily assigned to the TSS of CALCR . Genes (5′ segment of CALCR , TFPI-2 and GNGT1 ) are indicated as gray arrows. Two LINE-1 elements are present in the region (L1PA2 and L1PA6). Transcriptional orientations are indicated by arrows. LCT13 is a previously identified transcript shown to initiate at an L1ASP by 5′ RACE ( 22 ). TFPI-2as is the fragment analysed by strand-specific RT–PCR to test for the presence of TFPI-2 antisense RNAs. Displayed are the three spliced ESTs isolated from kidney (BG432114) and liver (DW466562 and DW435092) libraries that initiate at the LINE1 antisense promoter like LCT13 and extend past the TFPI-2 gene with a putative alternative transcript GNGT1-005 also annotated. ( B ) Expression of TFPI-2as (upper) and TFPI-2 (lower) in normal breast (N) and in breast cancer cell lines (H, HCC-1954; M, MCF7) analysed by strand specific and real-time RT–PCR, respectively. TFPI-2 expression is reduced in both breast cancer cell lines compared to normal controls (n = 3). TFPI-2 expression levels were normalized to HPRT . ( C ) Expression of TFPI-2as (upper) and TFPI-2 (lower) in a panel of five matched normal and tumour breast tissue analysed as described in B.

    Article Snippet: Generation of constructs and ES cell clones For pTFPI-2as and pTFPI-2pa constructs, a 4.93-kb human genomic DNA fragment including the full-length TFPI-2 gene obtained by long-range PCR (Expand Long PCR kit, Roche) on human genomic DNA with primers HC63f and HC63g and was cloned into the BamHI and KpnI sites of pcDNA3 (Invitrogen) and pcDNA3p(A)for, respectively. pcDNA3p(A)for was derived from pcDNA3 by cloning a 262 bp BGHp(A) fragment, obtained by PCR on pcDNA3 with primers Hind-p(A)-for and Hind-p(A)-rev, into the HindIII site of pcDNA3.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Quantitative RT-PCR

    ψND5 element positions in C. briggsae mitochondrial genomes . Dashed boxes indicate the two ψND5 elements and open boxes indicate mtDNA genes. Protein-coding genes are indicated by their common abbreviations and tRNA genes are indicated by their respective associated single-letter amino acid codes. ψND5-1 is 214–223 bp, depending on isolate, and ψND5-2 is 325–344 bp. The dashed horizontal line on top indicates DNA sequences that are lost in heteroplasmic ND5 deletion variants and the arrows indicate the primer positions that are employed for conventional PCR assays.

    Journal: BMC Evolutionary Biology

    Article Title: Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial genome evolution

    doi: 10.1186/1471-2148-8-62

    Figure Lengend Snippet: ψND5 element positions in C. briggsae mitochondrial genomes . Dashed boxes indicate the two ψND5 elements and open boxes indicate mtDNA genes. Protein-coding genes are indicated by their common abbreviations and tRNA genes are indicated by their respective associated single-letter amino acid codes. ψND5-1 is 214–223 bp, depending on isolate, and ψND5-2 is 325–344 bp. The dashed horizontal line on top indicates DNA sequences that are lost in heteroplasmic ND5 deletion variants and the arrows indicate the primer positions that are employed for conventional PCR assays.

    Article Snippet: PCR, DNA sequencing and phylogenetics mtDNA sequencing and PCR were performed as previously described [ , ], with the exception that mitochondrial genome sequences were initially amplified as four overlapping PCR products 3–5 kb in size each using the Expand Long Range PCR kit (Roche). e2TAK (Takara) proofreading DNA polymerase was used for all conventional PCRs.

    Techniques: Polymerase Chain Reaction

    Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Journal: BioMed Research International

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

    doi: 10.1155/2014/256245

    Figure Lengend Snippet: Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Article Snippet: PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche).

    Techniques: Polymerase Chain Reaction, Marker

    Effects of BRCA1 RNAi on XIST expression in cells with different XCI status. HMEC (XCI type 0), MCF7 (XCI type 1) and T47D (XCI type 2) were transfected with a mix of two BRCA1 -specific siRNAs, mapping to exons 12 and 24, or a control siRNA. After 72 hrs, cells were processed for BRCA1 immunofluorescence and RNA purification. In all panels BRCA1 is immunostained in green and nuclei are marked with DAPI. The histogram represents quantitative RT-PCR analysis performed on cDNAs of the indicated cell lines, before and after BRCA1 silencing, using primers specific for spliced and unspliced XIST RNA. XIST RNA levels are expressed as a ratio to GAPDH mRNA levels, after subtraction of the background signal from cDNA synthesis reactions lacking reverse transcriptase. To facilitate comparison between cell lines with different XCI status, the XIST / GAPDH transcript ratio was normalised relative to HMEC. Error bars represent standard deviation and the asterisks indicate statistically significant differences (p

    Journal: PLoS ONE

    Article Title: Misbehaviour of XIST RNA in Breast Cancer Cells

    doi: 10.1371/journal.pone.0005559

    Figure Lengend Snippet: Effects of BRCA1 RNAi on XIST expression in cells with different XCI status. HMEC (XCI type 0), MCF7 (XCI type 1) and T47D (XCI type 2) were transfected with a mix of two BRCA1 -specific siRNAs, mapping to exons 12 and 24, or a control siRNA. After 72 hrs, cells were processed for BRCA1 immunofluorescence and RNA purification. In all panels BRCA1 is immunostained in green and nuclei are marked with DAPI. The histogram represents quantitative RT-PCR analysis performed on cDNAs of the indicated cell lines, before and after BRCA1 silencing, using primers specific for spliced and unspliced XIST RNA. XIST RNA levels are expressed as a ratio to GAPDH mRNA levels, after subtraction of the background signal from cDNA synthesis reactions lacking reverse transcriptase. To facilitate comparison between cell lines with different XCI status, the XIST / GAPDH transcript ratio was normalised relative to HMEC. Error bars represent standard deviation and the asterisks indicate statistically significant differences (p

    Article Snippet: XIST probe was obtained by Long Range PCR (Long Range PCR-Kit Expand 20 Kb PLUS PCR System – Roche) amplifying exons 1 and 6 of XIST gene and pulling them together.

    Techniques: Expressing, Transfection, Immunofluorescence, Purification, Quantitative RT-PCR, Standard Deviation

    XIST expression and status of X chromosomes and BRCA1 in HMEC and breast cancer cell lines, and evaluation of XIST levels in different groups of breast carcinomas. A) Classification of HMEC and breast cancer cell lines according to XCI type, based on the indicated X chromosome related features. BRCA1 status is also reported. B) Box-plots of the log2-transformed amounts of XIST RNA measured by quantitative real-time RT-PCR in the indicated groups of primary human breast cancers. Each box-plot represents the first quartile (lower edge of the box), median value (bar inside the box), third quartile (upper edge of the box), and minimum and maximum values (horizontal lines). Points at a distance from the quartiles > 1.5 times the inter-quartile range are plotted individually. Statistically significant p values between groups are reported (Kruskal-Wallis Rank Sum test).

    Journal: PLoS ONE

    Article Title: Misbehaviour of XIST RNA in Breast Cancer Cells

    doi: 10.1371/journal.pone.0005559

    Figure Lengend Snippet: XIST expression and status of X chromosomes and BRCA1 in HMEC and breast cancer cell lines, and evaluation of XIST levels in different groups of breast carcinomas. A) Classification of HMEC and breast cancer cell lines according to XCI type, based on the indicated X chromosome related features. BRCA1 status is also reported. B) Box-plots of the log2-transformed amounts of XIST RNA measured by quantitative real-time RT-PCR in the indicated groups of primary human breast cancers. Each box-plot represents the first quartile (lower edge of the box), median value (bar inside the box), third quartile (upper edge of the box), and minimum and maximum values (horizontal lines). Points at a distance from the quartiles > 1.5 times the inter-quartile range are plotted individually. Statistically significant p values between groups are reported (Kruskal-Wallis Rank Sum test).

    Article Snippet: XIST probe was obtained by Long Range PCR (Long Range PCR-Kit Expand 20 Kb PLUS PCR System – Roche) amplifying exons 1 and 6 of XIST gene and pulling them together.

    Techniques: Expressing, Transformation Assay, Quantitative RT-PCR