Structured Review

Boehringer Mannheim expand long range pcr kit
<t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
Average 88 stars, based on 3 article reviews
Price from $9.99 to $1999.99
expand long range pcr kit - by Bioz Stars, 2020-07
88/100 stars

Images

1) Product Images from "Biological functions of the ISWI chromatin remodeling complex NURF"

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

Journal: Genes & Development

doi: 10.1101/gad.1032202

nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
Figure Legend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

Techniques Used: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation

Related Articles

Mutagenesis:

Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
Article Snippet: .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

Polymerase Chain Reaction:

Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
Article Snippet: .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

Article Title: Complementation of Cold Shock Proteins by Translation Initiation Factor IF1 In Vivo
Article Snippet: .. All PCR analyses were carried out in a Perkin-Elmer GeneAmp PCR System 9700 by using the Expand Long Range PCR Kit from Boehringer Mannheim essentially according to the protocols supplied by the manufacturer. .. Sequencing was performed in an ABI Prism 310 Genetic Analyzer from PE Applied Biosystems by using the ABI Prism dRhodamine Terminator Cycle Sequencing Ready Reaction Kit as suggested by PE Applied Biosystems.

Amplification:

Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
Article Snippet: .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

Isolation:

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Boehringer Mannheim expand long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    expand long range pcr kit - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results


    nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Journal: Genes & Development

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

    doi: 10.1101/gad.1032202

    Figure Lengend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Article Snippet: EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template.

    Techniques: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation