expand long range pcr kit  (Boehringer Mannheim)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Boehringer Mannheim expand long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range pcr kit - by Bioz Stars, 2021-03
    86/100 stars

    Images

    1) Product Images from "Biological functions of the ISWI chromatin remodeling complex NURF"

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

    Journal: Genes & Development

    doi: 10.1101/gad.1032202

    nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Figure Legend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Techniques Used: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation

    Related Articles

    Amplification:

    Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
    Article Snippet: Subclone pYH5 was injected at a concentration of 30 ng/μl, and pWJC5 was injected at a concentration of 25 ng/μl. .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

    Mutagenesis:

    Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
    Article Snippet: Subclone pYH5 was injected at a concentration of 30 ng/μl, and pWJC5 was injected at a concentration of 25 ng/μl. .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
    Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

    Polymerase Chain Reaction:

    Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
    Article Snippet: Subclone pYH5 was injected at a concentration of 30 ng/μl, and pWJC5 was injected at a concentration of 25 ng/μl. .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

    Article Title: Molecular and Biological Analysis of Eight Genetic Islands That Distinguish Neisseria meningitidis from the Closely Related Pathogen Neisseria gonorrhoeae
    Article Snippet: The PCR reactions were incubated 1 min at 94°C, followed by 30 cycles of 1 min at 94°C, 1.5 min at 5°C below the Tm of the oligonucleotide primers, and 2 min at 72°C, followed by incubation for 5 min at 72°C. .. For PCR products between 3 and 8 kb, semi-long-range PCR was performed by using the Expand Long Template PCR System (Boehringer Mannheim) under the same conditions except that the mixture contained Buffer 1 and the polymerase mix (0.75 μl) supplied with the kit. .. Template DNA longer than 8 kb was amplified by using the same kit and conditions except that higher concentrations of dATP, dCTP, dGTP, and dTTP (350 μM concentrations of each) and oligonucleotide primers (300 nM) and 2 μl of the polymerase mix were used.

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
    Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

    Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
    Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

    Isolation:

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
    Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

    Construct:

    Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
    Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

    Generated:

    Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
    Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • expand long range pcr kit  (Boehringer Mannheim)
    86
    Boehringer Mannheim expand long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range pcr kit - by Bioz Stars, 2021-03
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Journal: Genes & Development

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

    doi: 10.1101/gad.1032202

    Figure Lengend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Article Snippet: EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template.

    Techniques: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation