expand long range pcr kit  (Boehringer Mannheim)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Boehringer Mannheim expand long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range pcr kit - by Bioz Stars, 2021-09
    86/100 stars

    Images

    1) Product Images from "Biological functions of the ISWI chromatin remodeling complex NURF"

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

    Journal: Genes & Development

    doi: 10.1101/gad.1032202

    nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Figure Legend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Techniques Used: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation

    Related Articles

    Amplification:

    Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
    Article Snippet: .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. ..

    Mutagenesis:

    Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
    Article Snippet: .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. ..

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
    Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. ..

    Polymerase Chain Reaction:

    Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
    Article Snippet: .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. ..

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
    Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. ..

    Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
    Article Snippet: .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

    Article Title: Loss-of-Function Mutations in a Human Gene Related toChlamydomonas reinhardtii Dynein IC78 Result in Primary Ciliary Dyskinesia
    Article Snippet: .. To characterize the intron-exon organization of the DNAI1 gene, long-range PCRs were performed on human genomic DNA, by use of the Expand Long Template PCR System kit (Boehringer Mannheim) and various sets of exonic primers designed in the human DNAI1 cDNA, according to the manufacturer's instructions. ..

    Isolation:

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
    Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. ..

    Construct:

    Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
    Article Snippet: .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

    Generated:

    Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
    Article Snippet: .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • expand long range pcr kit  (Boehringer Mannheim)
    86
    Boehringer Mannheim expand long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range pcr kit - by Bioz Stars, 2021-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Journal: Genes & Development

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

    doi: 10.1101/gad.1032202

    Figure Lengend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Article Snippet: EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template.

    Techniques: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation