expand high fidelity pcr system  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Roche expand high fidelity pcr system
    Replacement of SENP. ( A ) Schematic representation of LdBPK_262070 replacement using the <t>CRISPR/Cas9</t> technology. SUMO -targeting sgRNAs (grey arrowheads) and replacement cassettes were <t>PCR-amplified</t> and transfected into L. donovani (Cas9/T7RNAP). ( B , C ) RT-qPCR of RNA from L. donovani wild type (WT), SENP −/− clones 1–4, SENP −/− cl.1[pCLN-SENP], and L. donovani (Cas9/T7RNAP). ( B ) SENP-specific RT-qPCR. ( C ) Cas9-specific RT-qPCR. n = 2. ( D ) Whole genome sequencing of L. donovani wild type (WT), L. donovani (Cas9/T7RNAP), SENP −/− cl.1 and SENP −/− cl.2. Sequence reads were aligned to L. donovani chromosome 26. The ruler shows the position of the SENP CDS; the numbers refer to the position within chromosome 26. Read coverage is shown in blue.
    Expand High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 1479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Roche
    Average 92 stars, based on 1479 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2021-01
    92/100 stars

    Related Products / Commonly Used Together

    pcr
    cdna
    pcr amplification
    pcrs
    pcr reactions
    polymerase chain reaction pcr
    pcr-amplified
    taq dna polymerase
    rt-pcr
    nested pcr
    t113l pyruvate kinase
    cdnas
    gic1
    gotaq dna polymerase
    viral dna

    Images

    1) Product Images from "The Leishmania donovani SENP Protease Is Required for SUMO Processing but Not for Viability"

    Article Title: The Leishmania donovani SENP Protease Is Required for SUMO Processing but Not for Viability

    Journal: Genes

    doi: 10.3390/genes11101198

    Replacement of SENP. ( A ) Schematic representation of LdBPK_262070 replacement using the CRISPR/Cas9 technology. SUMO -targeting sgRNAs (grey arrowheads) and replacement cassettes were PCR-amplified and transfected into L. donovani (Cas9/T7RNAP). ( B , C ) RT-qPCR of RNA from L. donovani wild type (WT), SENP −/− clones 1–4, SENP −/− cl.1[pCLN-SENP], and L. donovani (Cas9/T7RNAP). ( B ) SENP-specific RT-qPCR. ( C ) Cas9-specific RT-qPCR. n = 2. ( D ) Whole genome sequencing of L. donovani wild type (WT), L. donovani (Cas9/T7RNAP), SENP −/− cl.1 and SENP −/− cl.2. Sequence reads were aligned to L. donovani chromosome 26. The ruler shows the position of the SENP CDS; the numbers refer to the position within chromosome 26. Read coverage is shown in blue.
    Figure Legend Snippet: Replacement of SENP. ( A ) Schematic representation of LdBPK_262070 replacement using the CRISPR/Cas9 technology. SUMO -targeting sgRNAs (grey arrowheads) and replacement cassettes were PCR-amplified and transfected into L. donovani (Cas9/T7RNAP). ( B , C ) RT-qPCR of RNA from L. donovani wild type (WT), SENP −/− clones 1–4, SENP −/− cl.1[pCLN-SENP], and L. donovani (Cas9/T7RNAP). ( B ) SENP-specific RT-qPCR. ( C ) Cas9-specific RT-qPCR. n = 2. ( D ) Whole genome sequencing of L. donovani wild type (WT), L. donovani (Cas9/T7RNAP), SENP −/− cl.1 and SENP −/− cl.2. Sequence reads were aligned to L. donovani chromosome 26. The ruler shows the position of the SENP CDS; the numbers refer to the position within chromosome 26. Read coverage is shown in blue.

    Techniques Used: CRISPR, Polymerase Chain Reaction, Amplification, Transfection, Quantitative RT-PCR, Clone Assay, Sequencing

    Replacement of SUMO in Leishmania donovani. ( A ) Schematic representation of LdBPK_080480.1 replacement using the CRISPR/Cas9 technology. SUMO -targeting sgRNAs (grey) and the replacement cassettes were PCR-amplified and transfected into a Cas9/T7-RNAP-expressing L. donovani strain. Two sets of genotyping primers were used to test for the presence of the gene of interest (GOI) ( B ) Gene-specific replacement cassettes amplified from pTPURO or pTBLAST vector were analyzed by agarose gel electrophoresis and ethidium bromide staining. The position of the DNA size marker is indicated on the left, the primers used are indicated on the right. ( C ) Amplified sgRNA-coding sequences were separated on a 1% agarose gel and stained with ethidium bromide. ( D ) Genotyping of putative gene replacement mutant clones with primer pairs 7+8 or 5+6. PCR products were analyzed by 1% agarose gel electrophoresis. Positions of DNA size markers are shown to the left; the primer pairs are indicated on the right. ( E ) Genotyping of gene replacement mutants in the SUMO over expression background (SUMO −/−/+ ) indicated primer pairs.
    Figure Legend Snippet: Replacement of SUMO in Leishmania donovani. ( A ) Schematic representation of LdBPK_080480.1 replacement using the CRISPR/Cas9 technology. SUMO -targeting sgRNAs (grey) and the replacement cassettes were PCR-amplified and transfected into a Cas9/T7-RNAP-expressing L. donovani strain. Two sets of genotyping primers were used to test for the presence of the gene of interest (GOI) ( B ) Gene-specific replacement cassettes amplified from pTPURO or pTBLAST vector were analyzed by agarose gel electrophoresis and ethidium bromide staining. The position of the DNA size marker is indicated on the left, the primers used are indicated on the right. ( C ) Amplified sgRNA-coding sequences were separated on a 1% agarose gel and stained with ethidium bromide. ( D ) Genotyping of putative gene replacement mutant clones with primer pairs 7+8 or 5+6. PCR products were analyzed by 1% agarose gel electrophoresis. Positions of DNA size markers are shown to the left; the primer pairs are indicated on the right. ( E ) Genotyping of gene replacement mutants in the SUMO over expression background (SUMO −/−/+ ) indicated primer pairs.

    Techniques Used: CRISPR, Polymerase Chain Reaction, Amplification, Transfection, Expressing, Plasmid Preparation, Agarose Gel Electrophoresis, Staining, Marker, Mutagenesis, Clone Assay, Over Expression

    2) Product Images from "B-Cell-Specific Myd88 L252P Expression Causes a Premalignant Gammopathy Resembling IgM MGUS"

    Article Title: B-Cell-Specific Myd88 L252P Expression Causes a Premalignant Gammopathy Resembling IgM MGUS

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2020.602868

    CDR3 analysis of rearranged VDJ genes shows expansion of clonally related plasma cells in aged Cre ERT2 ;Myd88 L252P mice. Genomic DNA was purified from GFP-reporter-positive TACI + CD138 + plasma cells isolated from bone marrow and spleen of CD19-Cre ERT2 ;Myd88 L252P mice 70 weeks after tamoxifen induction. (A) PCR amplification of rearranged J558 family V genes from bone marrow (upper panel) and spleen (lower panel). Bands corresponding to all four JH segments appeared in the controls, while in Cre ERT2 ;Myd88 L252P mice only J H 4 rearrangements could be detected. (No rearrangements were detected in mouse #2). (B) J H 4 bands (red rectangle shown in A ) were cloned and sequenced. Clonal analysis based on CDR3 sequence revealed that in each mouse the same clones were most frequently detected in the bone marrow (upper panel) and spleen (lower panel). For the most frequently detected clonotype (red sector in pie chart), the % of sequences detected and the V H J558 family member is given. V H genes and VDJ rearrangements of the most frequent clonotypes were shared in bone marrow and spleen of each CD19‑Cre ERT2 ;Myd88 L252P mouse, while they differed in bone marrow and spleen of controls and between the controls. Each pie chart represents one mouse. (See also Supplementary Figures 9 and 10 ).
    Figure Legend Snippet: CDR3 analysis of rearranged VDJ genes shows expansion of clonally related plasma cells in aged Cre ERT2 ;Myd88 L252P mice. Genomic DNA was purified from GFP-reporter-positive TACI + CD138 + plasma cells isolated from bone marrow and spleen of CD19-Cre ERT2 ;Myd88 L252P mice 70 weeks after tamoxifen induction. (A) PCR amplification of rearranged J558 family V genes from bone marrow (upper panel) and spleen (lower panel). Bands corresponding to all four JH segments appeared in the controls, while in Cre ERT2 ;Myd88 L252P mice only J H 4 rearrangements could be detected. (No rearrangements were detected in mouse #2). (B) J H 4 bands (red rectangle shown in A ) were cloned and sequenced. Clonal analysis based on CDR3 sequence revealed that in each mouse the same clones were most frequently detected in the bone marrow (upper panel) and spleen (lower panel). For the most frequently detected clonotype (red sector in pie chart), the % of sequences detected and the V H J558 family member is given. V H genes and VDJ rearrangements of the most frequent clonotypes were shared in bone marrow and spleen of each CD19‑Cre ERT2 ;Myd88 L252P mouse, while they differed in bone marrow and spleen of controls and between the controls. Each pie chart represents one mouse. (See also Supplementary Figures 9 and 10 ).

    Techniques Used: Mouse Assay, Purification, Isolation, Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing

    3) Product Images from "Cu transporter protein CrpF protects against Cu-induced toxicity in Fusarium oxysporum"

    Article Title: Cu transporter protein CrpF protects against Cu-induced toxicity in Fusarium oxysporum

    Journal: Virulence

    doi: 10.1080/21505594.2020.1809324

    Transcriptional analyses of crpF , metal homeostasis mt1 and aceA and stress prx and gapdh related genes by RT-PCR analysis. Transcript levels of act, mt1, crpF, aceA, prx and gapdh from wt and Δ crpF strains on control condition and under exposure to 0.1 mM CdCl 2, 0.175 mM CuSO 4 or 7.5 mM ZnCl 2 are shown.
    Figure Legend Snippet: Transcriptional analyses of crpF , metal homeostasis mt1 and aceA and stress prx and gapdh related genes by RT-PCR analysis. Transcript levels of act, mt1, crpF, aceA, prx and gapdh from wt and Δ crpF strains on control condition and under exposure to 0.1 mM CdCl 2, 0.175 mM CuSO 4 or 7.5 mM ZnCl 2 are shown.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    Targeted deletion of the F. oxysporum crpF gene. (a) Targeted gene replacement strategy using a disruption construct obtained by fusion PCR with Hyg R cassette as selective marker. Relative positions of primers used for PCR and probe (dashes bars) are indicated. (b) Southern blot analysis of gDNA from wt strain and transformants. gDNAs were digested with Sma I and Sac II to detect deletion and complementation of crpF . The Southern blot image provided comes from two nitrocellulose membranes. The images were manipulated with the objective of only show the interesting transformants.
    Figure Legend Snippet: Targeted deletion of the F. oxysporum crpF gene. (a) Targeted gene replacement strategy using a disruption construct obtained by fusion PCR with Hyg R cassette as selective marker. Relative positions of primers used for PCR and probe (dashes bars) are indicated. (b) Southern blot analysis of gDNA from wt strain and transformants. gDNAs were digested with Sma I and Sac II to detect deletion and complementation of crpF . The Southern blot image provided comes from two nitrocellulose membranes. The images were manipulated with the objective of only show the interesting transformants.

    Techniques Used: Construct, Polymerase Chain Reaction, Marker, Southern Blot

    Related Articles

    Amplification:

    Article Title: por Variable-Region Typing by DNA Probe Hybridization Is Broadly Applicable to Epidemiologic Studies of Neisseria gonorrhoeae
    Article Snippet: .. Amplification of the porB gene was performed as described ( ) by using an Expand High-Fidelity PCR System containing Taq DNA polymerase and Tgo DNA polymerase with proofreading activity (Roche Molecular Biochemicals, Indianapolis, Ind.) and primers PIB.Fpr (5′-ATTGCCCTGACTTTGGCAGCCCTTCCT) and PIB.Rpr (5′TTGCAACCAGCCGGCAGAAACCAAGGC), complementary to the signal peptide and loop 8 coding regions, respectively. ..

    Mutagenesis:

    Article Title: Different mutations at position 562 of the hepatitis E virus capsid proteins exhibit differential effects on viral neutralizing activity
    Article Snippet: .. The primers used for mutagenesis are listed in , and PCR was performed using Expand High Fidelity PCR System (Roche) as follows: Denaturation at 94˚C for 45 sec, annealing at 54˚C for 30 sec and extension at 72˚C for 60 sec for a total of 35 cycles. .. The amplicons were separated by 1% agarose gel electrophoresis and visualized by ethidium bromide.

    Isolation:

    Article Title: B-Cell-Specific Myd88 L252P Expression Causes a Premalignant Gammopathy Resembling IgM MGUS
    Article Snippet: .. Sequence Analysis of IgH V Gene Rearrangements IgH V gene rearrangements were PCR-amplified (40 cycles) from genomic DNA (isolated from sorted, GFP-reporter-positive TACI+ CD138+ plasma cells) using the Expand High Fidelity PCR System (Roche Cat# 03310256103) with a forward primer for J558/VH1 family genes [pos. ..

    Construct:

    Article Title: Cu transporter protein CrpF protects against Cu-induced toxicity in Fusarium oxysporum
    Article Snippet: .. Briefly, two overlapping constructs were generated by fusion PCR using Expand High Fidelity PCR System (Roche Diagnostics) to delete crpF gene. .. The 5´and 3ʹ genomic flanking sequences of crpF were obtained by PCR amplifications of wild-type gDNA.

    Article Title: The Leishmania donovani SENP Protease Is Required for SUMO Processing but Not for Viability
    Article Snippet: .. PCR-Amplification of Targeting ConstructsFor CRISPR/Cas9-mediated gene disruption, sgRNA templates and replacement constructs were PCR-amplified using the Expand High Fidelity PCR System (Roche, Mannheim, Germany) and PCR conditions essentially as described previously [ ]. .. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR (qRT-PCR)RNA extraction, cDNA detection and RT-qPCR were performed essentially as described [ , ].

    Polymerase Chain Reaction:

    Article Title: Abortive Phage Resistance Mechanism AbiZ Speeds the Lysis Clock To Cause Premature Lysis of Phage-Infected Lactococcus lactis ▿
    Article Snippet: .. PCR products were generated by using Taq DNA polymerase, the Expand high-fidelity PCR system, or the Expand Long Template PCR system obtained from Roche Applied Science (Indianapolis, IN), as directed by the manufacturer. .. PCR primers were designed using Primer Designer software (Scientific and Educational Software, Durham, NC) and obtained from Integrated DNA Technologies, Inc. (Coralville, IA).

    Article Title: Anti-fibrotic Actions of Equine Interleukin-10 on Transforming Growth Factor-Beta1-Stimulated Dermal Fibroblasts Isolated From Limbs of Horses
    Article Snippet: .. Production of Recombinant Equine IL-10A DNA fragment containing nucleotides 1-534 of eIL-10 (NCBI Reference Sequence: NM_001082490.1) was prepared by polymerase chain reaction (PCR) using the Expand High Fidelity PCR System (Roche, Basel, Switzerland) and a cDNA template. .. The cDNA was generated from equine dermal fibroblasts using the TriRNA Pure Kit (Geneaid, New Taipei City, Taiwan) followed by DNase treatment (Quanta Bio, Beverly, MA) and the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA).

    Article Title: Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo.
    Article Snippet: .. In Parkinson's disease, brain dopamine neurons degenerate most prominently in the substantia nigra. .. In Parkinson's disease, brain dopamine neurons degenerate most prominently in the substantia nigra.

    Article Title: Different mutations at position 562 of the hepatitis E virus capsid proteins exhibit differential effects on viral neutralizing activity
    Article Snippet: .. The primers used for mutagenesis are listed in , and PCR was performed using Expand High Fidelity PCR System (Roche) as follows: Denaturation at 94˚C for 45 sec, annealing at 54˚C for 30 sec and extension at 72˚C for 60 sec for a total of 35 cycles. .. The amplicons were separated by 1% agarose gel electrophoresis and visualized by ethidium bromide.

    Article Title: Cu transporter protein CrpF protects against Cu-induced toxicity in Fusarium oxysporum
    Article Snippet: .. Briefly, two overlapping constructs were generated by fusion PCR using Expand High Fidelity PCR System (Roche Diagnostics) to delete crpF gene. .. The 5´and 3ʹ genomic flanking sequences of crpF were obtained by PCR amplifications of wild-type gDNA.

    Article Title: The Leishmania donovani SENP Protease Is Required for SUMO Processing but Not for Viability
    Article Snippet: .. PCR-Amplification of Targeting ConstructsFor CRISPR/Cas9-mediated gene disruption, sgRNA templates and replacement constructs were PCR-amplified using the Expand High Fidelity PCR System (Roche, Mannheim, Germany) and PCR conditions essentially as described previously [ ]. .. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR (qRT-PCR)RNA extraction, cDNA detection and RT-qPCR were performed essentially as described [ , ].

    Article Title: por Variable-Region Typing by DNA Probe Hybridization Is Broadly Applicable to Epidemiologic Studies of Neisseria gonorrhoeae
    Article Snippet: .. Amplification of the porB gene was performed as described ( ) by using an Expand High-Fidelity PCR System containing Taq DNA polymerase and Tgo DNA polymerase with proofreading activity (Roche Molecular Biochemicals, Indianapolis, Ind.) and primers PIB.Fpr (5′-ATTGCCCTGACTTTGGCAGCCCTTCCT) and PIB.Rpr (5′TTGCAACCAGCCGGCAGAAACCAAGGC), complementary to the signal peptide and loop 8 coding regions, respectively. ..

    Generated:

    Article Title: Abortive Phage Resistance Mechanism AbiZ Speeds the Lysis Clock To Cause Premature Lysis of Phage-Infected Lactococcus lactis ▿
    Article Snippet: .. PCR products were generated by using Taq DNA polymerase, the Expand high-fidelity PCR system, or the Expand Long Template PCR system obtained from Roche Applied Science (Indianapolis, IN), as directed by the manufacturer. .. PCR primers were designed using Primer Designer software (Scientific and Educational Software, Durham, NC) and obtained from Integrated DNA Technologies, Inc. (Coralville, IA).

    Article Title: Cu transporter protein CrpF protects against Cu-induced toxicity in Fusarium oxysporum
    Article Snippet: .. Briefly, two overlapping constructs were generated by fusion PCR using Expand High Fidelity PCR System (Roche Diagnostics) to delete crpF gene. .. The 5´and 3ʹ genomic flanking sequences of crpF were obtained by PCR amplifications of wild-type gDNA.

    Activity Assay:

    Article Title: por Variable-Region Typing by DNA Probe Hybridization Is Broadly Applicable to Epidemiologic Studies of Neisseria gonorrhoeae
    Article Snippet: .. Amplification of the porB gene was performed as described ( ) by using an Expand High-Fidelity PCR System containing Taq DNA polymerase and Tgo DNA polymerase with proofreading activity (Roche Molecular Biochemicals, Indianapolis, Ind.) and primers PIB.Fpr (5′-ATTGCCCTGACTTTGGCAGCCCTTCCT) and PIB.Rpr (5′TTGCAACCAGCCGGCAGAAACCAAGGC), complementary to the signal peptide and loop 8 coding regions, respectively. ..

    CRISPR:

    Article Title: The Leishmania donovani SENP Protease Is Required for SUMO Processing but Not for Viability
    Article Snippet: .. PCR-Amplification of Targeting ConstructsFor CRISPR/Cas9-mediated gene disruption, sgRNA templates and replacement constructs were PCR-amplified using the Expand High Fidelity PCR System (Roche, Mannheim, Germany) and PCR conditions essentially as described previously [ ]. .. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR (qRT-PCR)RNA extraction, cDNA detection and RT-qPCR were performed essentially as described [ , ].

    Sequencing:

    Article Title: Anti-fibrotic Actions of Equine Interleukin-10 on Transforming Growth Factor-Beta1-Stimulated Dermal Fibroblasts Isolated From Limbs of Horses
    Article Snippet: .. Production of Recombinant Equine IL-10A DNA fragment containing nucleotides 1-534 of eIL-10 (NCBI Reference Sequence: NM_001082490.1) was prepared by polymerase chain reaction (PCR) using the Expand High Fidelity PCR System (Roche, Basel, Switzerland) and a cDNA template. .. The cDNA was generated from equine dermal fibroblasts using the TriRNA Pure Kit (Geneaid, New Taipei City, Taiwan) followed by DNase treatment (Quanta Bio, Beverly, MA) and the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA).

    Recombinant:

    Article Title: Anti-fibrotic Actions of Equine Interleukin-10 on Transforming Growth Factor-Beta1-Stimulated Dermal Fibroblasts Isolated From Limbs of Horses
    Article Snippet: .. Production of Recombinant Equine IL-10A DNA fragment containing nucleotides 1-534 of eIL-10 (NCBI Reference Sequence: NM_001082490.1) was prepared by polymerase chain reaction (PCR) using the Expand High Fidelity PCR System (Roche, Basel, Switzerland) and a cDNA template. .. The cDNA was generated from equine dermal fibroblasts using the TriRNA Pure Kit (Geneaid, New Taipei City, Taiwan) followed by DNase treatment (Quanta Bio, Beverly, MA) and the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • expand high fidelity pcr system  (Roche)
    92
    Roche expand high fidelity pcr system
    Transcript levels of cat in B. burgdorferi B31-A3 as measured by <t>QRT-PCR.</t> All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.
    Expand High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 1479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Roche
    Average 92 stars, based on 1479 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2021-01
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Transcript levels of cat in B. burgdorferi B31-A3 as measured by QRT-PCR. All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Transcript levels of cat in B. burgdorferi B31-A3 as measured by QRT-PCR. All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation, Plasmid Preparation

    Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC as cell density increases RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) as spirochete density increased and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS as cell density increased. Fold changes are expressed relative to the initial inoculum. B. QRT-PCR analysis of ospC as cell density increased. Fold changes are expressed relative to the initial inoculum. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with B31-A3 at corresponding cell densities. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared to the B31-A3 at corresponding cell densities. E. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 as cell density increased. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Cell densities are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC as cell density increases RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) as spirochete density increased and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS as cell density increased. Fold changes are expressed relative to the initial inoculum. B. QRT-PCR analysis of ospC as cell density increased. Fold changes are expressed relative to the initial inoculum. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with B31-A3 at corresponding cell densities. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared to the B31-A3 at corresponding cell densities. E. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 as cell density increased. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Cell densities are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Transcript levels of cat in B. burgdorferi A3 ntrA and A3 hk2 as measured by QRT-PCR. cat transcripts levels were measured in B. burgdorferi A3 hk2 and A3 ntrA harbouring plasmids pMB313 (hatched bars) and pMB92S (black bars). Fold changes are relative to strains harbouring pBCAT. All values have been normalized to the internal control, flaB . Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Transcript levels of cat in B. burgdorferi A3 ntrA and A3 hk2 as measured by QRT-PCR. cat transcripts levels were measured in B. burgdorferi A3 hk2 and A3 ntrA harbouring plasmids pMB313 (hatched bars) and pMB92S (black bars). Fold changes are relative to strains harbouring pBCAT. All values have been normalized to the internal control, flaB . Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Construction of a B. burgdorferi hk2 mutant A. Schematic representation for inactivation of hk2 in B31-A3. hk2 and rrp2 are represented by black arrows as labelled. A DNA fragment harbouring hk2 was PCR amplified using hk2-BF and hk2-BR primers and insertionally disrupted at a unique SphI site with a kanamycin cassette (grey arrow) as described in the Experimental procedures section. Primers are denoted by short black arrows. B. Agarose gel patterns of PCR products for B31-A3 (lane 2) and A3 hk2 (lane 3) using the hk2-BF and hk2-BR primer pair. Disruption of hk2 by the kanamycin cassette resulted in an increased size PCR product (compare lanes 2 and 3). PCR products for the hk2-BF and kan5′ primer pair (lane 4), and the hk2-BR and kan3′ primer pair (lane 5), confirmed the orientation of the kanamycin cassette with respect to hk2 and rrp2 as diagrammed in panel A. RT-PCR analysis with the rrp2-RTF and rrp2-RTR primer pair confirmed the presence of rrp2 transcript in both B31-A3 (lane 6) and A3 hk2 (lane 7). Lane 1 contains DNA markers with the sizes indicated to the left. C. Immunoblot analysis of B31-A3, A3 ntrA and A3 hk2 grown to high cell density (2 × 10 8 cells ml −1 + 24 h). Whole-cell lysates of B. burgdorferi strains equivalent to ∼10 8 cells were separated on a 12% Tris-glycine gel, immobilized on a nitrocellulose membrane and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Construction of a B. burgdorferi hk2 mutant A. Schematic representation for inactivation of hk2 in B31-A3. hk2 and rrp2 are represented by black arrows as labelled. A DNA fragment harbouring hk2 was PCR amplified using hk2-BF and hk2-BR primers and insertionally disrupted at a unique SphI site with a kanamycin cassette (grey arrow) as described in the Experimental procedures section. Primers are denoted by short black arrows. B. Agarose gel patterns of PCR products for B31-A3 (lane 2) and A3 hk2 (lane 3) using the hk2-BF and hk2-BR primer pair. Disruption of hk2 by the kanamycin cassette resulted in an increased size PCR product (compare lanes 2 and 3). PCR products for the hk2-BF and kan5′ primer pair (lane 4), and the hk2-BR and kan3′ primer pair (lane 5), confirmed the orientation of the kanamycin cassette with respect to hk2 and rrp2 as diagrammed in panel A. RT-PCR analysis with the rrp2-RTF and rrp2-RTR primer pair confirmed the presence of rrp2 transcript in both B31-A3 (lane 6) and A3 hk2 (lane 7). Lane 1 contains DNA markers with the sizes indicated to the left. C. Immunoblot analysis of B31-A3, A3 ntrA and A3 hk2 grown to high cell density (2 × 10 8 cells ml −1 + 24 h). Whole-cell lysates of B. burgdorferi strains equivalent to ∼10 8 cells were separated on a 12% Tris-glycine gel, immobilized on a nitrocellulose membrane and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Mutagenesis, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction

    Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) grown at 23°C and following a temperature shift to 34°C, and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. B. QRT-PCR analysis of ospC following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. E. Growth curves of B31-A3 (grey triangles), A3 ntrA (black diamonds) and A3 hk2 (open circles) following a temperature shift from 23°C to 34°C. F. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 following an increase in growth temperature from 23°C to 34°C. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Time points are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) grown at 23°C and following a temperature shift to 34°C, and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. B. QRT-PCR analysis of ospC following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. E. Growth curves of B31-A3 (grey triangles), A3 ntrA (black diamonds) and A3 hk2 (open circles) following a temperature shift from 23°C to 34°C. F. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 following an increase in growth temperature from 23°C to 34°C. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Time points are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Quantitative RT-PCR analysis of rpoS and ospC transcripts following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (low-passage, white bars) and B31-A (high-passage, black bars) grown at 23°C, and at various time points following a temperature shift to 34°C. Levels of transcripts were measured with specific primer/probe sets using Taqman, and values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Fold changes are expressed relative to spirochetes grown at 23°C. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. B. QRT-PCR analysis of ospC following a temperature shift. C. Growth curves of B31-A3 (white squares) and B31-A (black triangles) following a temperature shift from 23 to 34°C.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (low-passage, white bars) and B31-A (high-passage, black bars) grown at 23°C, and at various time points following a temperature shift to 34°C. Levels of transcripts were measured with specific primer/probe sets using Taqman, and values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Fold changes are expressed relative to spirochetes grown at 23°C. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. B. QRT-PCR analysis of ospC following a temperature shift. C. Growth curves of B31-A3 (white squares) and B31-A (black triangles) following a temperature shift from 23 to 34°C.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Expression of TLR4 mRNA in PBMCs from subjects classified by rs11536889 genotype. PBMCs were isolated from the G/G, G/C, and C/C subjects, and total RNA was extracted. After reverse transcription, mRNA levels for TLR4 were determined by qRT-PCR using

    Journal: The Journal of Biological Chemistry

    Article Title: A Single Nucleotide Polymorphism in 3?-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation *

    doi: 10.1074/jbc.M111.338426

    Figure Lengend Snippet: Expression of TLR4 mRNA in PBMCs from subjects classified by rs11536889 genotype. PBMCs were isolated from the G/G, G/C, and C/C subjects, and total RNA was extracted. After reverse transcription, mRNA levels for TLR4 were determined by qRT-PCR using

    Article Snippet: Two types of 219-bp genomic fragments (G/G and C/C) of the 3′-UTR of TLR4 at SNP rs11536889 were amplified from two different human genomic DNAs with the Expand High Fidelity PCR system using the primer sets (5′-TGG GAT CCC TCC CCT GTA CCC TTC-3′ (sense) and 5′-CTG GAT CCG TTT CTG AGG AGG CTG GAT G-3′ (antisense)).

    Techniques: Expressing, Isolation, Quantitative RT-PCR

    Chain-terminating ddC residue prevents replicative extension in vitro . Primers containing 6 phosphothioate linkages at each terminus (PT SSO) or 6 phosphothioate linkages at each terminus and a 3′-dideoxycytidine residue (PT+ddC SSO) were used to amplify a 196 bp fragment using pGKfrtmCM(−) as template and mCM(+)DT2 as the reverse primer, in a standard PCR reaction (see Table 6 in Supplementary material for primer sequences). PCRs were performed with the modified SSOs present at three different concentrations (1, 10 or 100 ng per reaction). Results show that the chain-terminating ddC nucleotide on the PT+ddC SSO is sufficient to prevent replicative extension by a DNA polymerase endowed with proofreading activity.

    Journal: Nucleic Acids Research

    Article Title: The involvement of replication in single stranded oligonucleotide-mediated gene repair

    doi: 10.1093/nar/gkl852

    Figure Lengend Snippet: Chain-terminating ddC residue prevents replicative extension in vitro . Primers containing 6 phosphothioate linkages at each terminus (PT SSO) or 6 phosphothioate linkages at each terminus and a 3′-dideoxycytidine residue (PT+ddC SSO) were used to amplify a 196 bp fragment using pGKfrtmCM(−) as template and mCM(+)DT2 as the reverse primer, in a standard PCR reaction (see Table 6 in Supplementary material for primer sequences). PCRs were performed with the modified SSOs present at three different concentrations (1, 10 or 100 ng per reaction). Results show that the chain-terminating ddC nucleotide on the PT+ddC SSO is sufficient to prevent replicative extension by a DNA polymerase endowed with proofreading activity.

    Article Snippet: Plasmid construction DNA inserts for plasmid constructs were amplified by PCR using the Expand High Fidelity PCR system (Roche) and primers linked to restriction enzyme sites suitable for cloning.

    Techniques: In Vitro, Polymerase Chain Reaction, Modification, Activity Assay

    Verification of SSO incorporation into its homologous DNA target ( A ) A schematic illustration of the experimental procedure. Biotinylated recombination products were purified using magnetic streptavidin beads. The presence of (corrected) pmKan was confirmed by the detection of a 496 bp PCR product. ( B ) pmKan and ddH 2 O were used as templates for the negative and positive PCR controls (lanes 2 and 3 respectively). DY380/pmKan cells were incubated at 42°C for 15 min to induce λ-Red protein expression prior to electroporation with biotinylated-SSO (lane 6) or unmodified SSO (lane 4). As a control, DY380/pmKan cells that had been incubated at 32°C for 15 min (i.e. no λ-Red induction) were similarly electroporated with biotinylated-SSO (lane 5). Plasmid DNA were extracted from the electroporated cells after a 15 min recovery period. Three independent experiments were performed; a representative experiment is shown.

    Journal: Nucleic Acids Research

    Article Title: The involvement of replication in single stranded oligonucleotide-mediated gene repair

    doi: 10.1093/nar/gkl852

    Figure Lengend Snippet: Verification of SSO incorporation into its homologous DNA target ( A ) A schematic illustration of the experimental procedure. Biotinylated recombination products were purified using magnetic streptavidin beads. The presence of (corrected) pmKan was confirmed by the detection of a 496 bp PCR product. ( B ) pmKan and ddH 2 O were used as templates for the negative and positive PCR controls (lanes 2 and 3 respectively). DY380/pmKan cells were incubated at 42°C for 15 min to induce λ-Red protein expression prior to electroporation with biotinylated-SSO (lane 6) or unmodified SSO (lane 4). As a control, DY380/pmKan cells that had been incubated at 32°C for 15 min (i.e. no λ-Red induction) were similarly electroporated with biotinylated-SSO (lane 5). Plasmid DNA were extracted from the electroporated cells after a 15 min recovery period. Three independent experiments were performed; a representative experiment is shown.

    Article Snippet: Plasmid construction DNA inserts for plasmid constructs were amplified by PCR using the Expand High Fidelity PCR system (Roche) and primers linked to restriction enzyme sites suitable for cloning.

    Techniques: Purification, Polymerase Chain Reaction, Incubation, Expressing, Electroporation, Plasmid Preparation

    Reproducibility and sensitivity of the pro MSS HTA. ( A ) The MSS HTA reflects the populations in the PCR product accurately and reproducibly at high template numbers. PCR products of two pro genes were mixed at known ratios; the mixtures were then diluted over a 100-fold range and annealed to the MSS HTA probe 6.1. The abundance of one of the products was determined by using the MSS HTA and compared with the known abundance. Error bars represent standard deviations from 5–9 experiments. ( B ) Amplification of pro gene mixtures. Mixtures of pro ) T12S, K43R, M46I, I54V, Q61H, L63P, V82F.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: A multiple-site-specific heteroduplex tracking assay as a tool for the study of viral population dynamics

    doi:

    Figure Lengend Snippet: Reproducibility and sensitivity of the pro MSS HTA. ( A ) The MSS HTA reflects the populations in the PCR product accurately and reproducibly at high template numbers. PCR products of two pro genes were mixed at known ratios; the mixtures were then diluted over a 100-fold range and annealed to the MSS HTA probe 6.1. The abundance of one of the products was determined by using the MSS HTA and compared with the known abundance. Error bars represent standard deviations from 5–9 experiments. ( B ) Amplification of pro gene mixtures. Mixtures of pro ) T12S, K43R, M46I, I54V, Q61H, L63P, V82F.

    Article Snippet: PCR for MSS HTA was done by using the Expand High Fidelity PCR System (Roche Molecular Biochemicals) with the following modifications: reactions contained 0.2–4 μg of total cellular DNA, 1× Titan RT-PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP, 5 mM DTT, 0.5 μM primers PRAMPUP and PRAMPDW, and 1 μl of Expand enzyme mix.

    Techniques: Polymerase Chain Reaction, Amplification

    Cross-sectional study of viral pro populations and correlation of MSS HTA mobility shifts with reduced drug susceptibility. ( A ) The MSS HTA analysis of RT-PCR products from 21 patient plasma samples with different treatment histories. Differences in the bulk sequence of the RT-PCR products from HIV-1 clade B consensus are shown above the gel. Two amino acids indicate a mixed population. Note that positions that were not resistance-associated were omitted. Note also that each population contains at least one of the targeted mutations of the MSS HTA probe (highlighted in gray). In 11/21 cases, multiple populations differing at or near the targeted positions were found by HTA, whereas population-based sequencing identified mixed populations in only 4 subjects. hd, heteroduplex; dsP, double-stranded probe. ( B ) Mobility ( k ) of the most prominent MSS HTA band of each subject correlated with the average reduction of susceptibility to ritonavir, saquinavir, and indinavir ( r a ) of the complete virus population compared with molecular clone NL4–3 (○). The labels indicate the number of targeted mutations seen in the bulk sequence. For comparison, the mobility of bands corresponding to viral populations from seven protease inhibitor-naïve patients (⋄) and the mobility of molecular clones NL4–3 and Hxb-2r (♦) are shown. Not all of these are visible on the plot, because some mobilities are identical.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: A multiple-site-specific heteroduplex tracking assay as a tool for the study of viral population dynamics

    doi:

    Figure Lengend Snippet: Cross-sectional study of viral pro populations and correlation of MSS HTA mobility shifts with reduced drug susceptibility. ( A ) The MSS HTA analysis of RT-PCR products from 21 patient plasma samples with different treatment histories. Differences in the bulk sequence of the RT-PCR products from HIV-1 clade B consensus are shown above the gel. Two amino acids indicate a mixed population. Note that positions that were not resistance-associated were omitted. Note also that each population contains at least one of the targeted mutations of the MSS HTA probe (highlighted in gray). In 11/21 cases, multiple populations differing at or near the targeted positions were found by HTA, whereas population-based sequencing identified mixed populations in only 4 subjects. hd, heteroduplex; dsP, double-stranded probe. ( B ) Mobility ( k ) of the most prominent MSS HTA band of each subject correlated with the average reduction of susceptibility to ritonavir, saquinavir, and indinavir ( r a ) of the complete virus population compared with molecular clone NL4–3 (○). The labels indicate the number of targeted mutations seen in the bulk sequence. For comparison, the mobility of bands corresponding to viral populations from seven protease inhibitor-naïve patients (⋄) and the mobility of molecular clones NL4–3 and Hxb-2r (♦) are shown. Not all of these are visible on the plot, because some mobilities are identical.

    Article Snippet: PCR for MSS HTA was done by using the Expand High Fidelity PCR System (Roche Molecular Biochemicals) with the following modifications: reactions contained 0.2–4 μg of total cellular DNA, 1× Titan RT-PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP, 5 mM DTT, 0.5 μM primers PRAMPUP and PRAMPDW, and 1 μl of Expand enzyme mix.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Sequencing, Protease Inhibitor, Clone Assay

    Development of an RT MSS HTA. ( A ) are shown above. ( B ) Mobility of the radioactively labeled probe when annealed to three PCR products containing resistance mutations in comparison with the mobility of wild type (wt). In addition, plasma RNA of Patient 1029 who started 3TC therapy at day 215 was subjected to an MSS HTA analysis shown on the same gel. hd, heteroduplex; dsP, double-stranded probe.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: A multiple-site-specific heteroduplex tracking assay as a tool for the study of viral population dynamics

    doi:

    Figure Lengend Snippet: Development of an RT MSS HTA. ( A ) are shown above. ( B ) Mobility of the radioactively labeled probe when annealed to three PCR products containing resistance mutations in comparison with the mobility of wild type (wt). In addition, plasma RNA of Patient 1029 who started 3TC therapy at day 215 was subjected to an MSS HTA analysis shown on the same gel. hd, heteroduplex; dsP, double-stranded probe.

    Article Snippet: PCR for MSS HTA was done by using the Expand High Fidelity PCR System (Roche Molecular Biochemicals) with the following modifications: reactions contained 0.2–4 μg of total cellular DNA, 1× Titan RT-PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP, 5 mM DTT, 0.5 μM primers PRAMPUP and PRAMPDW, and 1 μl of Expand enzyme mix.

    Techniques: Labeling, Polymerase Chain Reaction

    Characteristics of the pro MSS HTA probe 6.1. ( A ). Resistance-relevant changes are in close proximity to probe wild-type mismatches. ( B ) Mobility of the radioactively labeled probe annealed to PCR products of pro genes with point mutations. Only the heteroduplexes (hd) and the probe that annealed to its fully complementary strand (double-stranded probe, dsP) are shown. Lanes: 1, wild type; 2, M46I; 3, G48V; 4, I54T; 5, L63P; 6, V82T; 7, V82A; 8, I84V; 9, L90M; 10, G48V/V82T; and 11, G48V/L90M. The mobility ( k ) of each hd relative to the dsP is indicated above all lanes. Note that wild type and L63P, a nontargeted mutation, have identical mobilities, whereas all of the targeted mutations display lower mobilities. The mobilities of the hds are calculated relative to the dsP to control for differences in the gel or in the electric field between lanes and gels.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: A multiple-site-specific heteroduplex tracking assay as a tool for the study of viral population dynamics

    doi:

    Figure Lengend Snippet: Characteristics of the pro MSS HTA probe 6.1. ( A ). Resistance-relevant changes are in close proximity to probe wild-type mismatches. ( B ) Mobility of the radioactively labeled probe annealed to PCR products of pro genes with point mutations. Only the heteroduplexes (hd) and the probe that annealed to its fully complementary strand (double-stranded probe, dsP) are shown. Lanes: 1, wild type; 2, M46I; 3, G48V; 4, I54T; 5, L63P; 6, V82T; 7, V82A; 8, I84V; 9, L90M; 10, G48V/V82T; and 11, G48V/L90M. The mobility ( k ) of each hd relative to the dsP is indicated above all lanes. Note that wild type and L63P, a nontargeted mutation, have identical mobilities, whereas all of the targeted mutations display lower mobilities. The mobilities of the hds are calculated relative to the dsP to control for differences in the gel or in the electric field between lanes and gels.

    Article Snippet: PCR for MSS HTA was done by using the Expand High Fidelity PCR System (Roche Molecular Biochemicals) with the following modifications: reactions contained 0.2–4 μg of total cellular DNA, 1× Titan RT-PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP, 5 mM DTT, 0.5 μM primers PRAMPUP and PRAMPDW, and 1 μl of Expand enzyme mix.

    Techniques: Labeling, Polymerase Chain Reaction, Mutagenesis