Structured Review

Boehringer Mannheim expand high fidelity pcr polymerase
Expand High Fidelity Pcr Polymerase, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/expand high fidelity pcr polymerase/product/Boehringer Mannheim
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
expand high fidelity pcr polymerase - by Bioz Stars, 2021-07
86/100 stars

Images

Related Articles

Derivative Assay:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

Generated:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

Article Title: Effect of Intragenic Rearrangement and Changes in the 3? Consensus Sequence on NSP1 Expression and Rotavirus Replication
Article Snippet: The concentration of the purified protein was determined by Bradford assay using bovine serum albumin as the protein standard and by comparison with known amounts of bovine serum albumin coelectrophoresed on SDS-polyacrylamide gels and stained with Coomassie brilliant blue R-250. .. The DNA templates for synthesis of the 32 P-labeled RNA probes, v40-GACC and v40-GAACC, were generated by amplification with the Expand High Fidelity PCR System (Boehringer Mannheim). .. The amplification reaction mixtures contained the plasmid SP72-v40 , the plus-sense primer 5′-t aatacgactcactata G-3′, and the minus-sense primer 5′-GGTCACATAAGCGCTTTC-3′ or 5′-GGTTCACATAAGCGCTTTC-3′ (T7 promoter is underlined, and viral sequences are in uppercase).

Article Title: The R3 Region, One of Three Major Repetitive Regions of Human Herpesvirus 6, Is a Strong Enhancer of Immediate-Early Gene U95
Article Snippet: The extension products were concentrated by ethanol precipitation, dissolved in Tris-EDTA (TE), and analyzed on a 6% polyacrylamide–7 M urea sequencing gel using a 4000L DNA sequencer. .. A 756-bp fragment and all deletion mutants of the U95 promoter were generated by PCR with the Expand high-fidelity PCR system (Boehringer Mannheim). .. Genomic DNA prepared from MT-4 cells infected with HHV-6B was used as the template.

Article Title: Kinesin-related KIP3 of Saccharomyces cerevisiae Is Required for a Distinct Step in Nuclear Migration
Article Snippet: For epitope tagging of KIP3 , the myc tag coding sequence ( ) was introduced into the KIP3 coding sequence as follows. .. A 3.8-kb fragment containing the entire KIP3 open reading frame, but lacking the termination codon, was generated by PCR using the Expand High Fidelity PCR system ( Boehringer Mannheim Corp. , Indianapolis, IN). .. This fragment was cloned into a vector containing six tandem copies of the myc tag (pB896 [ ]).

Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

Article Title: Isolation and Characterization of HvNRT2.3and HvNRT2.4, cDNAs Encoding High-Affinity Nitrate Transporters from Roots of Barley 1
Article Snippet: Oligonucleotide BCH4 (5′ CAAAATTTGAAACTTATACGTGTAGG) was used for the isolation of 5′-RACE-PCR product. .. Full-length clones for HvNRT2.3 and HvNRT2.4 were generated by PCR using a high-fidelity PCR system (Expand Long, Boehringer Mannheim/Roche, Basel). ..

Polymerase Chain Reaction:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

Article Title: Effect of Intragenic Rearrangement and Changes in the 3? Consensus Sequence on NSP1 Expression and Rotavirus Replication
Article Snippet: The concentration of the purified protein was determined by Bradford assay using bovine serum albumin as the protein standard and by comparison with known amounts of bovine serum albumin coelectrophoresed on SDS-polyacrylamide gels and stained with Coomassie brilliant blue R-250. .. The DNA templates for synthesis of the 32 P-labeled RNA probes, v40-GACC and v40-GAACC, were generated by amplification with the Expand High Fidelity PCR System (Boehringer Mannheim). .. The amplification reaction mixtures contained the plasmid SP72-v40 , the plus-sense primer 5′-t aatacgactcactata G-3′, and the minus-sense primer 5′-GGTCACATAAGCGCTTTC-3′ or 5′-GGTTCACATAAGCGCTTTC-3′ (T7 promoter is underlined, and viral sequences are in uppercase).

Article Title: The R3 Region, One of Three Major Repetitive Regions of Human Herpesvirus 6, Is a Strong Enhancer of Immediate-Early Gene U95
Article Snippet: The extension products were concentrated by ethanol precipitation, dissolved in Tris-EDTA (TE), and analyzed on a 6% polyacrylamide–7 M urea sequencing gel using a 4000L DNA sequencer. .. A 756-bp fragment and all deletion mutants of the U95 promoter were generated by PCR with the Expand high-fidelity PCR system (Boehringer Mannheim). .. Genomic DNA prepared from MT-4 cells infected with HHV-6B was used as the template.

Article Title: Kinesin-related KIP3 of Saccharomyces cerevisiae Is Required for a Distinct Step in Nuclear Migration
Article Snippet: For epitope tagging of KIP3 , the myc tag coding sequence ( ) was introduced into the KIP3 coding sequence as follows. .. A 3.8-kb fragment containing the entire KIP3 open reading frame, but lacking the termination codon, was generated by PCR using the Expand High Fidelity PCR system ( Boehringer Mannheim Corp. , Indianapolis, IN). .. This fragment was cloned into a vector containing six tandem copies of the myc tag (pB896 [ ]).

Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

Article Title: Isolation and Characterization of HvNRT2.3and HvNRT2.4, cDNAs Encoding High-Affinity Nitrate Transporters from Roots of Barley 1
Article Snippet: Oligonucleotide BCH4 (5′ CAAAATTTGAAACTTATACGTGTAGG) was used for the isolation of 5′-RACE-PCR product. .. Full-length clones for HvNRT2.3 and HvNRT2.4 were generated by PCR using a high-fidelity PCR system (Expand Long, Boehringer Mannheim/Roche, Basel). ..

Article Title: Conversion of 3-Chlorocatechol by Various Catechol 2,3-Dioxygenases and Sequence Analysis of the Chlorocatechol Dioxygenase Region of Pseudomonas putida GJ31
Article Snippet: .. To ensure high fidelity of the PCR product, Pwo DNA polymerase or the Expand High Fidelity PCR system was used according to instructions of the manufacturer (Boehringer, Mannheim, Germany). ..

Amplification:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

Article Title: Effect of Intragenic Rearrangement and Changes in the 3? Consensus Sequence on NSP1 Expression and Rotavirus Replication
Article Snippet: The concentration of the purified protein was determined by Bradford assay using bovine serum albumin as the protein standard and by comparison with known amounts of bovine serum albumin coelectrophoresed on SDS-polyacrylamide gels and stained with Coomassie brilliant blue R-250. .. The DNA templates for synthesis of the 32 P-labeled RNA probes, v40-GACC and v40-GAACC, were generated by amplification with the Expand High Fidelity PCR System (Boehringer Mannheim). .. The amplification reaction mixtures contained the plasmid SP72-v40 , the plus-sense primer 5′-t aatacgactcactata G-3′, and the minus-sense primer 5′-GGTCACATAAGCGCTTTC-3′ or 5′-GGTTCACATAAGCGCTTTC-3′ (T7 promoter is underlined, and viral sequences are in uppercase).

Expressing:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

In Vitro:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

Plasmid Preparation:

Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein
Article Snippet: Products were resolved by electrophoresis through a 1.5% agarose gel and visualized by staining with ethidium bromide. .. Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ). .. During amplification of the β-propeller domain (amino acids 2–420 or 51–420), a G to C substitution was incorporated at nucleotide 430, inactivating a naturally occurring Bam H I site.

Construct:

Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

Clone Assay:

Article Title: Isolation and Characterization of HvNRT2.3and HvNRT2.4, cDNAs Encoding High-Affinity Nitrate Transporters from Roots of Barley 1
Article Snippet: Oligonucleotide BCH4 (5′ CAAAATTTGAAACTTATACGTGTAGG) was used for the isolation of 5′-RACE-PCR product. .. Full-length clones for HvNRT2.3 and HvNRT2.4 were generated by PCR using a high-fidelity PCR system (Expand Long, Boehringer Mannheim/Roche, Basel). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Boehringer Mannheim expand high fidelity pcr system
    Schematic representation of the construction of hybrid catechol 2,3-dioxygenases (H1 to H10). The primers (P1 to P14) that were used in PCRs to generate <t>DNA</t> fragments that contained overlapping regions for the <t>PCR</t> fusions are indicated with arrows. □, polypeptide fragments derived from CbzE; , polypeptide fragments derived from TdnC. The amino acids of CbzE and TdnC between which the fusions were made are indicated.
    Expand High Fidelity Pcr System, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Boehringer Mannheim high fidelity pcr amplification
    Drosophila HCF mRNA is present throughout development. A: Northern blot analysis of total RNA (25 µg) prepared from Drosophila SL2 tissue culture cells. RNA was resolved on a 1% denaturing gel and probed with a P 32 -labeled DNA fragment corresponding to the entire <t>dHCF</t> open reading frame. Sizes of RNA molecular weight standards (Gibco-BRL) are given in thousands of nucleotides. An asterisk denotes a non-specific band. B: <t>RT-PCR</t> analysis using oligonucleotide primers derived from dHCF (upper and middle panels) and ribosomal protein 49 (lower part). In the middle panel, cDNA templates were diluted 10-fold prior to amplification. Sources of mRNA were as follows: 0–4 h embryos (lane 2), 4–8 h embryos (lane 3), 8–12 h embryos (lane 4), 12–24 h embryos (lane 5), 1st instar larvae (lane 6), 2nd instar larvae (lane 7), 3rd instar larvae (lane 8), pupae (lane 9), male head (lane 10), female head (lane 11), male body (lane 12), female body (lane 13), and cloned dHCF cDNA as a positive control (lane 14). Sizes of DNA markers (lane 1) are given in bp. C: The predicted exonintron structure of the dHCF gene. Coding sequences are indicated by filled boxes. Oligonucleotide primers used for RT-PCR analysis are shown above the appropriate exon. Two alternative mRNA splice variants are indicated (labeled 8–11 and 11– 13 splice). The splice variant which deletes exon 12 is based on a single cDNA clone isolated from the embryo library.
    High Fidelity Pcr Amplification, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr amplification/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr amplification - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    Schematic representation of the construction of hybrid catechol 2,3-dioxygenases (H1 to H10). The primers (P1 to P14) that were used in PCRs to generate DNA fragments that contained overlapping regions for the PCR fusions are indicated with arrows. □, polypeptide fragments derived from CbzE; , polypeptide fragments derived from TdnC. The amino acids of CbzE and TdnC between which the fusions were made are indicated.

    Journal: Journal of Bacteriology

    Article Title: Conversion of 3-Chlorocatechol by Various Catechol 2,3-Dioxygenases and Sequence Analysis of the Chlorocatechol Dioxygenase Region of Pseudomonas putida GJ31

    doi:

    Figure Lengend Snippet: Schematic representation of the construction of hybrid catechol 2,3-dioxygenases (H1 to H10). The primers (P1 to P14) that were used in PCRs to generate DNA fragments that contained overlapping regions for the PCR fusions are indicated with arrows. □, polypeptide fragments derived from CbzE; , polypeptide fragments derived from TdnC. The amino acids of CbzE and TdnC between which the fusions were made are indicated.

    Article Snippet: To ensure high fidelity of the PCR product, Pwo DNA polymerase or the Expand High Fidelity PCR system was used according to instructions of the manufacturer (Boehringer, Mannheim, Germany).

    Techniques: Polymerase Chain Reaction, Derivative Assay

    Effect of repetition of the R3 unit on U95 promoter activity. (A) Schematic representation of PCR-generated R3 units containing NF-κB(R3) or NF-κB(TT) (termed R3-A and R3-B, respectively). (B) The left map represents the copy numbers of each R3 unit inserted immediately upstream of U95P-186. MT-4 cells were transfected with each construct and harvested 16 h later, and luciferase activities were measured. The right panel indicates the mean fold activities relative to that of pU95P-186-transfected cells in three independent experiments. The luciferase activities were normalized as described in Materials and Methods, and error bars plot the standard deviation for each set of triplicate samples.

    Journal: Journal of Virology

    Article Title: The R3 Region, One of Three Major Repetitive Regions of Human Herpesvirus 6, Is a Strong Enhancer of Immediate-Early Gene U95

    doi: 10.1128/JVI.75.21.10149-10160.2001

    Figure Lengend Snippet: Effect of repetition of the R3 unit on U95 promoter activity. (A) Schematic representation of PCR-generated R3 units containing NF-κB(R3) or NF-κB(TT) (termed R3-A and R3-B, respectively). (B) The left map represents the copy numbers of each R3 unit inserted immediately upstream of U95P-186. MT-4 cells were transfected with each construct and harvested 16 h later, and luciferase activities were measured. The right panel indicates the mean fold activities relative to that of pU95P-186-transfected cells in three independent experiments. The luciferase activities were normalized as described in Materials and Methods, and error bars plot the standard deviation for each set of triplicate samples.

    Article Snippet: A 756-bp fragment and all deletion mutants of the U95 promoter were generated by PCR with the Expand high-fidelity PCR system (Boehringer Mannheim).

    Techniques: Activity Assay, Polymerase Chain Reaction, Generated, Transfection, Construct, Luciferase, Standard Deviation

    RT-PCR analyses for the transcripts of U95, IE1, Pol, gH, and EF 1α in HST-infected CBMCs treated with CHX and PFA. Total RNAs prepared from mock-infected and HST-infected cells, which had been treated with CHX for 24 h or PFA for 24 h or left untreated, were used. The U95 band was detectable in the presence of CHX and PFA, as well as the IE1 band, while the bands of Pol and gH could not be detected in the presence of CHX. EF1α, the cellular endogenous gene, was transcribed under all conditions.

    Journal: Journal of Virology

    Article Title: The R3 Region, One of Three Major Repetitive Regions of Human Herpesvirus 6, Is a Strong Enhancer of Immediate-Early Gene U95

    doi: 10.1128/JVI.75.21.10149-10160.2001

    Figure Lengend Snippet: RT-PCR analyses for the transcripts of U95, IE1, Pol, gH, and EF 1α in HST-infected CBMCs treated with CHX and PFA. Total RNAs prepared from mock-infected and HST-infected cells, which had been treated with CHX for 24 h or PFA for 24 h or left untreated, were used. The U95 band was detectable in the presence of CHX and PFA, as well as the IE1 band, while the bands of Pol and gH could not be detected in the presence of CHX. EF1α, the cellular endogenous gene, was transcribed under all conditions.

    Article Snippet: A 756-bp fragment and all deletion mutants of the U95 promoter were generated by PCR with the Expand high-fidelity PCR system (Boehringer Mannheim).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Infection

    Drosophila HCF mRNA is present throughout development. A: Northern blot analysis of total RNA (25 µg) prepared from Drosophila SL2 tissue culture cells. RNA was resolved on a 1% denaturing gel and probed with a P 32 -labeled DNA fragment corresponding to the entire dHCF open reading frame. Sizes of RNA molecular weight standards (Gibco-BRL) are given in thousands of nucleotides. An asterisk denotes a non-specific band. B: RT-PCR analysis using oligonucleotide primers derived from dHCF (upper and middle panels) and ribosomal protein 49 (lower part). In the middle panel, cDNA templates were diluted 10-fold prior to amplification. Sources of mRNA were as follows: 0–4 h embryos (lane 2), 4–8 h embryos (lane 3), 8–12 h embryos (lane 4), 12–24 h embryos (lane 5), 1st instar larvae (lane 6), 2nd instar larvae (lane 7), 3rd instar larvae (lane 8), pupae (lane 9), male head (lane 10), female head (lane 11), male body (lane 12), female body (lane 13), and cloned dHCF cDNA as a positive control (lane 14). Sizes of DNA markers (lane 1) are given in bp. C: The predicted exonintron structure of the dHCF gene. Coding sequences are indicated by filled boxes. Oligonucleotide primers used for RT-PCR analysis are shown above the appropriate exon. Two alternative mRNA splice variants are indicated (labeled 8–11 and 11– 13 splice). The splice variant which deletes exon 12 is based on a single cDNA clone isolated from the embryo library.

    Journal: Journal of cellular physiology

    Article Title: Molecular Cloning of Drosophila HCF Reveals Proteolytic Processing and Self-Association of the Encoded Protein

    doi: 10.1002/jcp.10193

    Figure Lengend Snippet: Drosophila HCF mRNA is present throughout development. A: Northern blot analysis of total RNA (25 µg) prepared from Drosophila SL2 tissue culture cells. RNA was resolved on a 1% denaturing gel and probed with a P 32 -labeled DNA fragment corresponding to the entire dHCF open reading frame. Sizes of RNA molecular weight standards (Gibco-BRL) are given in thousands of nucleotides. An asterisk denotes a non-specific band. B: RT-PCR analysis using oligonucleotide primers derived from dHCF (upper and middle panels) and ribosomal protein 49 (lower part). In the middle panel, cDNA templates were diluted 10-fold prior to amplification. Sources of mRNA were as follows: 0–4 h embryos (lane 2), 4–8 h embryos (lane 3), 8–12 h embryos (lane 4), 12–24 h embryos (lane 5), 1st instar larvae (lane 6), 2nd instar larvae (lane 7), 3rd instar larvae (lane 8), pupae (lane 9), male head (lane 10), female head (lane 11), male body (lane 12), female body (lane 13), and cloned dHCF cDNA as a positive control (lane 14). Sizes of DNA markers (lane 1) are given in bp. C: The predicted exonintron structure of the dHCF gene. Coding sequences are indicated by filled boxes. Oligonucleotide primers used for RT-PCR analysis are shown above the appropriate exon. Two alternative mRNA splice variants are indicated (labeled 8–11 and 11– 13 splice). The splice variant which deletes exon 12 is based on a single cDNA clone isolated from the embryo library.

    Article Snippet: Fragments derived from the dHCF open reading frame were generated by high-fidelity PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim) and subcloned into the mammalian expression vectors pCGN, pCGNGal4(1–94) and pCGT or the in vitro transcription/translation vector pNCITE ( ).

    Techniques: Northern Blot, Labeling, Molecular Weight, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Amplification, Clone Assay, Positive Control, Variant Assay, Isolation