p malariae strains greece  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Roche p malariae strains greece
    Antibody competition titration assays using MSP1 19 proteins from four Plasmodium species. A combined dilution (1:400 of each serum) containing sera from chimpanzees experimentally infected with either P. <t>malariae</t> (Klimatis), P. ovale (Alpert) or P. vivax (Duff) was incubated with the indicated concentrations of the MSP1 19 competitor protein for 1 h at room temperature. Competitor proteins used were: a P. falciparum MSP1 19 ; b P. malariae MSP1 19 ; c P. ovale MSP1 19 ; d P. vivax MSP1 19 . Multiplex bead assays were performed as described in “ Methods ” and the multiplex response in MFI-bg units are plotted versus the competitor concentration. Multiplex responses are presented as a percentage of the assay results for the PBS control
    P Malariae Strains Greece, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 5239 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p malariae strains greece/product/Roche
    Average 93 stars, based on 5239 article reviews
    Price from $9.99 to $1999.99
    p malariae strains greece - by Bioz Stars, 2020-09
    93/100 stars

    Images

    1) Product Images from "Specificity of the IgG antibody response to Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale MSP119 subunit proteins in multiplexed serologic assays"

    Article Title: Specificity of the IgG antibody response to Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale MSP119 subunit proteins in multiplexed serologic assays

    Journal: Malaria Journal

    doi: 10.1186/s12936-018-2566-0

    Antibody competition titration assays using MSP1 19 proteins from four Plasmodium species. A combined dilution (1:400 of each serum) containing sera from chimpanzees experimentally infected with either P. malariae (Klimatis), P. ovale (Alpert) or P. vivax (Duff) was incubated with the indicated concentrations of the MSP1 19 competitor protein for 1 h at room temperature. Competitor proteins used were: a P. falciparum MSP1 19 ; b P. malariae MSP1 19 ; c P. ovale MSP1 19 ; d P. vivax MSP1 19 . Multiplex bead assays were performed as described in “ Methods ” and the multiplex response in MFI-bg units are plotted versus the competitor concentration. Multiplex responses are presented as a percentage of the assay results for the PBS control
    Figure Legend Snippet: Antibody competition titration assays using MSP1 19 proteins from four Plasmodium species. A combined dilution (1:400 of each serum) containing sera from chimpanzees experimentally infected with either P. malariae (Klimatis), P. ovale (Alpert) or P. vivax (Duff) was incubated with the indicated concentrations of the MSP1 19 competitor protein for 1 h at room temperature. Competitor proteins used were: a P. falciparum MSP1 19 ; b P. malariae MSP1 19 ; c P. ovale MSP1 19 ; d P. vivax MSP1 19 . Multiplex bead assays were performed as described in “ Methods ” and the multiplex response in MFI-bg units are plotted versus the competitor concentration. Multiplex responses are presented as a percentage of the assay results for the PBS control

    Techniques Used: Titration, Infection, Incubation, Multiplex Assay, Concentration Assay

    Antibody competition titration assays using homologous MSP1 19 proteins. Dilutions (1:400) of P. falciparum Lot 6 defined human serum or of sera from chimpanzees experimentally infected with either P. malariae (Klimatis), P. ovale (Alpert) or P. vivax (Duff) were incubated with the indicated concentrations of the homologous MSP1 19 competitor protein for 1 h at room temperature. Multiplex bead assays were performed as described in “ Methods ”, and the multiplex responses in MFI-bg units are plotted versus the competitor concentration
    Figure Legend Snippet: Antibody competition titration assays using homologous MSP1 19 proteins. Dilutions (1:400) of P. falciparum Lot 6 defined human serum or of sera from chimpanzees experimentally infected with either P. malariae (Klimatis), P. ovale (Alpert) or P. vivax (Duff) were incubated with the indicated concentrations of the homologous MSP1 19 competitor protein for 1 h at room temperature. Multiplex bead assays were performed as described in “ Methods ”, and the multiplex responses in MFI-bg units are plotted versus the competitor concentration

    Techniques Used: Titration, Infection, Incubation, Multiplex Assay, Concentration Assay

    Alignment of predicted Plasmodium spp. MSP1 19 protein sequences using COBALT [ 61 ]. Residues in the P. malariae sequence that differ from the Cameroon sequence of Birkenmeyer et al. [ 38 ] are shaded. Predicted protein sequences resulting from the oligonucleotides used in PCR amplification are underlined. The positions of residues conserved among all the presented MSP1 19 protein sequences are indicated in the consensus with divergent residues indicated by a dot. GenBank accession numbers are MH577181, P. ovale Nigeria I strain; MH577182, P. malariae China I strain; MH577183, P. malariae Greece I strain; MH577184, P. malariae Uganda I strain; and MH577185, P. malariae Guyana strain
    Figure Legend Snippet: Alignment of predicted Plasmodium spp. MSP1 19 protein sequences using COBALT [ 61 ]. Residues in the P. malariae sequence that differ from the Cameroon sequence of Birkenmeyer et al. [ 38 ] are shaded. Predicted protein sequences resulting from the oligonucleotides used in PCR amplification are underlined. The positions of residues conserved among all the presented MSP1 19 protein sequences are indicated in the consensus with divergent residues indicated by a dot. GenBank accession numbers are MH577181, P. ovale Nigeria I strain; MH577182, P. malariae China I strain; MH577183, P. malariae Greece I strain; MH577184, P. malariae Uganda I strain; and MH577185, P. malariae Guyana strain

    Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification

    2) Product Images from "The invasiveness of human cervical cancer associated to the function of NaV1.6 channels is mediated by MMP-2 activity"

    Article Title: The invasiveness of human cervical cancer associated to the function of NaV1.6 channels is mediated by MMP-2 activity

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-31364-y

    Alternative splicing of SCN8A exon 18 in the neoplasia-carcinoma sequence of human cervical tissue. ( A ) Alternative splicing of SCN8A Exon 18. Expanded genomic structure of exons 17 to 19. Exon 18 N contains an in frame stop codon. Splice variants generated by alternative splicing of Exon 18 are indicated with the PCR product length expected by using primers located in Exons 17 and 19 (see Methods). ( B – E ) End-point PCR electrophoresis results for SCN8A exon 18 variants expressed in non-cancerous cervix, cervical intraepithelial neoplasia, invasive cervical cancer, and cervical cancer cell lines, respectively. HEK-Nav1.6 cells was used as positive control for the adult splice form of SCN8A (18A; far-right line). A 100-bp molecular weight marker was used as reference (far-left line). The SCN8A variants generated for alternative splicing of exon 18: 18A, 18N and Δ18, were identified in the indicated group of samples. Identity of the SCN8A splice forms was confirmed by automated sequencing. The SCN8A splice forms were relatively more abundant in human cervical cancer samples, more clearly for the Δ18 variant; whereas the adult (18A) variant was practically absent in CeCa cell lines. From the two samples (266 and 275) that were present in all western blots experiments, only mRNA from sample 266 was available for performing these PCR analysis.
    Figure Legend Snippet: Alternative splicing of SCN8A exon 18 in the neoplasia-carcinoma sequence of human cervical tissue. ( A ) Alternative splicing of SCN8A Exon 18. Expanded genomic structure of exons 17 to 19. Exon 18 N contains an in frame stop codon. Splice variants generated by alternative splicing of Exon 18 are indicated with the PCR product length expected by using primers located in Exons 17 and 19 (see Methods). ( B – E ) End-point PCR electrophoresis results for SCN8A exon 18 variants expressed in non-cancerous cervix, cervical intraepithelial neoplasia, invasive cervical cancer, and cervical cancer cell lines, respectively. HEK-Nav1.6 cells was used as positive control for the adult splice form of SCN8A (18A; far-right line). A 100-bp molecular weight marker was used as reference (far-left line). The SCN8A variants generated for alternative splicing of exon 18: 18A, 18N and Δ18, were identified in the indicated group of samples. Identity of the SCN8A splice forms was confirmed by automated sequencing. The SCN8A splice forms were relatively more abundant in human cervical cancer samples, more clearly for the Δ18 variant; whereas the adult (18A) variant was practically absent in CeCa cell lines. From the two samples (266 and 275) that were present in all western blots experiments, only mRNA from sample 266 was available for performing these PCR analysis.

    Techniques Used: Sequencing, Generated, Polymerase Chain Reaction, Electrophoresis, Positive Control, Molecular Weight, Marker, Variant Assay, Western Blot

    3) Product Images from "Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms"

    Article Title: Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki199

    Secondary structure models for mtP-RNAs from R.oryzae , R.stolonifer 194667, R.oligosporus , R.spectabilis , M.mucedo , S.culisetae and M.verticillata . Positions in red are invariant in the minimum bacterial consensus ( 32 ); uppercase letters in the mtP-RNAs indicate 100%, lowercase 90%, conservation of the minimum bacterial consensus sequence. The arrows pinpoint experimentally determined termini; arrow length is proportional to the percentage of molecules ending at a defined position. Double hairpin elements are named in green. The few nucleotides colored blue in the R.stolonifer mtP-RNA model are different in its close relative R.oryzae .
    Figure Legend Snippet: Secondary structure models for mtP-RNAs from R.oryzae , R.stolonifer 194667, R.oligosporus , R.spectabilis , M.mucedo , S.culisetae and M.verticillata . Positions in red are invariant in the minimum bacterial consensus ( 32 ); uppercase letters in the mtP-RNAs indicate 100%, lowercase 90%, conservation of the minimum bacterial consensus sequence. The arrows pinpoint experimentally determined termini; arrow length is proportional to the percentage of molecules ending at a defined position. Double hairpin elements are named in green. The few nucleotides colored blue in the R.stolonifer mtP-RNA model are different in its close relative R.oryzae .

    Techniques Used: Sequencing

    4) Product Images from "Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis"

    Article Title: Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis

    Journal: World Journal of Biological Chemistry

    doi: 10.4331/wjbc.v6.i3.249

    Growth of the wild-type and Prx-deficient ΔAhpC_H1, ΔAhpC_H2, ΔB_BCP, and ΔB_TPx B. subtilis strains. A: Bacterial growth was monitored by the optical density at 600 nm (OD600) for up to 25 h after addition of the same
    Figure Legend Snippet: Growth of the wild-type and Prx-deficient ΔAhpC_H1, ΔAhpC_H2, ΔB_BCP, and ΔB_TPx B. subtilis strains. A: Bacterial growth was monitored by the optical density at 600 nm (OD600) for up to 25 h after addition of the same

    Techniques Used:

    5) Product Images from "Neodiversification of homeologous CLAVATA1-like receptor kinase genes in soybean leads to distinct developmental outcomes"

    Article Title: Neodiversification of homeologous CLAVATA1-like receptor kinase genes in soybean leads to distinct developmental outcomes

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-08252-y

    Transcript levels of GmCLV1A and GmTrCLV1A in various tissues of 14 day-old, uninoculated soybean plants. Values were measured using qRT-PCR; n = 3 biological replicates per tissue; error bars indicate SE. TR1 = first 2 cm from taproot tip; TR2 = second 2 cm from taproot tip; LR1 = first 2 cm from lateral root tip; LR2 = second 2 cm from lateral root tip; UF = unifoliate leaf; TF = trifoliate leaf; Vein = vein of trifoliate leaf; Hypo = hypocotyls; Stem = stem above hypocotyl; STip = shoot tip. Note the 10-fold difference in scale.
    Figure Legend Snippet: Transcript levels of GmCLV1A and GmTrCLV1A in various tissues of 14 day-old, uninoculated soybean plants. Values were measured using qRT-PCR; n = 3 biological replicates per tissue; error bars indicate SE. TR1 = first 2 cm from taproot tip; TR2 = second 2 cm from taproot tip; LR1 = first 2 cm from lateral root tip; LR2 = second 2 cm from lateral root tip; UF = unifoliate leaf; TF = trifoliate leaf; Vein = vein of trifoliate leaf; Hypo = hypocotyls; Stem = stem above hypocotyl; STip = shoot tip. Note the 10-fold difference in scale.

    Techniques Used: Quantitative RT-PCR

    Phenotypes of pod, stem (as demonstrated by cotyledonary node branching) and nodulated root systems of the soybean wild type Forrest, and its TILLING-derived mutants , Gmclv1a ( S562L) and Gmnark ( W677* ).
    Figure Legend Snippet: Phenotypes of pod, stem (as demonstrated by cotyledonary node branching) and nodulated root systems of the soybean wild type Forrest, and its TILLING-derived mutants , Gmclv1a ( S562L) and Gmnark ( W677* ).

    Techniques Used: Derivative Assay

    Phenotypes of reciprocally grafted (scion/rootstock) plants between wild-type soybean cv. Forrest and its mutants Gmclv1a ( S562L ) Gmnark ( W677* ). Plants were grafted 12 days after sowing. Data were collected 45 days later. ( A) Nodule number per plant; ( B) lateral root number per plant (in the 5–15 cm region below the crown); ( C) average nodule weight; and ( D) nodulation index ( i.e ., % of root nodulated). Different letters above the bar represent statistically significant differences (Duncan test; P ≤ 0.05). Error bars indicate SE.
    Figure Legend Snippet: Phenotypes of reciprocally grafted (scion/rootstock) plants between wild-type soybean cv. Forrest and its mutants Gmclv1a ( S562L ) Gmnark ( W677* ). Plants were grafted 12 days after sowing. Data were collected 45 days later. ( A) Nodule number per plant; ( B) lateral root number per plant (in the 5–15 cm region below the crown); ( C) average nodule weight; and ( D) nodulation index ( i.e ., % of root nodulated). Different letters above the bar represent statistically significant differences (Duncan test; P ≤ 0.05). Error bars indicate SE.

    Techniques Used:

    Temperature influence on phenotypes of wild-type soybean cv. Forrest, and its mutants Gmclv1a ( S562L ), Gmnark ( W677* ) and the Gmclv1a Gmnark double mutant (DM). Plants were grown at 28/25 °C or 20/17 °C. ( A) Plant height. ( B) Node number. ( C) Leaf number at node 3. ( D) Percentage of plants having at least one vein-bladed leaf; Vein-bladed phenotype were scored 4 weeks after flowering. ( E) Pod number (including both developing and mature pods). ( F) Nodule number per plant. ( G) Shoot dry weight. ( H) Root dry weight. Plant height, node number and leaf number at node 3 were measured 4 weeks after sowing; n = 9–13. Nodule number, shoot and root dry weight were measured 3 weeks after sowing; n = 6. Error bars indicate SE. Nd = ‘not detected’. Different letters above the bar represent statistically significant differences (Duncan test; P ≤ 0.05).
    Figure Legend Snippet: Temperature influence on phenotypes of wild-type soybean cv. Forrest, and its mutants Gmclv1a ( S562L ), Gmnark ( W677* ) and the Gmclv1a Gmnark double mutant (DM). Plants were grown at 28/25 °C or 20/17 °C. ( A) Plant height. ( B) Node number. ( C) Leaf number at node 3. ( D) Percentage of plants having at least one vein-bladed leaf; Vein-bladed phenotype were scored 4 weeks after flowering. ( E) Pod number (including both developing and mature pods). ( F) Nodule number per plant. ( G) Shoot dry weight. ( H) Root dry weight. Plant height, node number and leaf number at node 3 were measured 4 weeks after sowing; n = 9–13. Nodule number, shoot and root dry weight were measured 3 weeks after sowing; n = 6. Error bars indicate SE. Nd = ‘not detected’. Different letters above the bar represent statistically significant differences (Duncan test; P ≤ 0.05).

    Techniques Used: Mutagenesis

    Structural aspects of GmCLV1A and GmTrCLV1A. ( A) Predicted model of the extracellular LRR domain of GmCLV1A , including the site of the S562L mis-sense mutation. The amino acid highlighted in red represent the serine of the predicted glycosylation site that is mutated to a leucine in S562L ( B) Predicted protein domains. SP = signal peptide; LRRNT_2 = Leucine-rich repeat N-terminal; TM = Transmembrane domain. ( C) Protein alignment of the mutated region of S562L compared with that of AtCLV1, GmCLV1A , GmTrCLV1A, GmNARK, MtSUNN, and MtRLP1. The red box highlights the predicted glycosylation site.
    Figure Legend Snippet: Structural aspects of GmCLV1A and GmTrCLV1A. ( A) Predicted model of the extracellular LRR domain of GmCLV1A , including the site of the S562L mis-sense mutation. The amino acid highlighted in red represent the serine of the predicted glycosylation site that is mutated to a leucine in S562L ( B) Predicted protein domains. SP = signal peptide; LRRNT_2 = Leucine-rich repeat N-terminal; TM = Transmembrane domain. ( C) Protein alignment of the mutated region of S562L compared with that of AtCLV1, GmCLV1A , GmTrCLV1A, GmNARK, MtSUNN, and MtRLP1. The red box highlights the predicted glycosylation site.

    Techniques Used: Mutagenesis

    Macro- and microscopic phenotypes of the soybean wild type Forrest, and its mutant S562L . ( A) Stem thickness of 5 month-old plants (plants were intentionally defoliated to enhance visibility of stem architecture); ( B) First trifoliate node showing fasciation and excessive flowering in the mutant; ( C) Vein-bladed leaf structures on the underside of Gmclv1a mutant leaves. ( D) Young pod morphology (dashed line indicates the position of the cross-section seen in ( F ). ( E) Stem section at node 4 of Forrest and S562L mutant plants (4 month-old). ( F) Young pod cross-sections. Note the bifurcated, deformed pod of the S562L mutant. VB = Vascular bundle; Ep = Epidermis; IS = Inner sclerenchyma.
    Figure Legend Snippet: Macro- and microscopic phenotypes of the soybean wild type Forrest, and its mutant S562L . ( A) Stem thickness of 5 month-old plants (plants were intentionally defoliated to enhance visibility of stem architecture); ( B) First trifoliate node showing fasciation and excessive flowering in the mutant; ( C) Vein-bladed leaf structures on the underside of Gmclv1a mutant leaves. ( D) Young pod morphology (dashed line indicates the position of the cross-section seen in ( F ). ( E) Stem section at node 4 of Forrest and S562L mutant plants (4 month-old). ( F) Young pod cross-sections. Note the bifurcated, deformed pod of the S562L mutant. VB = Vascular bundle; Ep = Epidermis; IS = Inner sclerenchyma.

    Techniques Used: Mutagenesis

    Structure and genomic environments of CLAVATA1 and AON-related genes. ( A) Intron and exon positions and sizes of AtCLV1 , GmCLV1A, GmNARK, MtSUNN, LjHAR1, PsSYM29 and PvNARK . ( B ) TILLed regions of GmNARK and GmCLV1A . ( C ) Genomic environment of AtCLV1A , GmCLV1A , GmNARK , LiHAR1 , MtSUNN and PvNARK ; approximately 100 kb is shown. The same number and colour indicates similar genes. The CLV1 and its orthologs in legumes are in grey. The number ‘1’ represents a truncated gene. ( D ) Positioning and size of GmCLV1A with GmTrCLV1A, PvNARK with PvTrNARK and MtSUNN with MtRLP1 .
    Figure Legend Snippet: Structure and genomic environments of CLAVATA1 and AON-related genes. ( A) Intron and exon positions and sizes of AtCLV1 , GmCLV1A, GmNARK, MtSUNN, LjHAR1, PsSYM29 and PvNARK . ( B ) TILLed regions of GmNARK and GmCLV1A . ( C ) Genomic environment of AtCLV1A , GmCLV1A , GmNARK , LiHAR1 , MtSUNN and PvNARK ; approximately 100 kb is shown. The same number and colour indicates similar genes. The CLV1 and its orthologs in legumes are in grey. The number ‘1’ represents a truncated gene. ( D ) Positioning and size of GmCLV1A with GmTrCLV1A, PvNARK with PvTrNARK and MtSUNN with MtRLP1 .

    Techniques Used:

    Branching phenotype of 4 week-old soybean cv. Forrest, its mutant Gmclv1a ( S562L ), and F 2 segregants from a cross between them. CC = wild-type segregants; cc = Gmclv1a segregants. Forrest n = 10, S562L n = 9, CC n = 11 and cc n = 14. Error bars indicate SE. Different letters above bars represent statistically significant differences (Student’s t test; P ≤ 0.05).
    Figure Legend Snippet: Branching phenotype of 4 week-old soybean cv. Forrest, its mutant Gmclv1a ( S562L ), and F 2 segregants from a cross between them. CC = wild-type segregants; cc = Gmclv1a segregants. Forrest n = 10, S562L n = 9, CC n = 11 and cc n = 14. Error bars indicate SE. Different letters above bars represent statistically significant differences (Student’s t test; P ≤ 0.05).

    Techniques Used: Mutagenesis

    6) Product Images from "Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans ▿"

    Article Title: Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans ▿

    Journal:

    doi: 10.1128/IAI.00288-07

    Site-directed mutagenesis of sodC . (A) PCR product of sodC gene. Lanes: 1, sodC ::EZ-Tn5; 2, wild-type sodC . The sizes on the left are in bp. (B) Western blot analysis of Cu,Zn SOD in A. actinomycetemcomitans . Lanes: 1, strain DF2200; 2, sodC mutant strain
    Figure Legend Snippet: Site-directed mutagenesis of sodC . (A) PCR product of sodC gene. Lanes: 1, sodC ::EZ-Tn5; 2, wild-type sodC . The sizes on the left are in bp. (B) Western blot analysis of Cu,Zn SOD in A. actinomycetemcomitans . Lanes: 1, strain DF2200; 2, sodC mutant strain

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Western Blot

    7) Product Images from "The CDK Inhibitor p21Cip1/WAF1 Is Induced by Fc?R Activation and Restricts the Replication of Human Immunodeficiency Virus Type 1 and Related Primate Lentiviruses in Human Macrophages ▿"

    Article Title: The CDK Inhibitor p21Cip1/WAF1 Is Induced by Fc?R Activation and Restricts the Replication of Human Immunodeficiency Virus Type 1 and Related Primate Lentiviruses in Human Macrophages ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01395-09

    PMA and the HDAC inhibitor MS-275 induce p21 expression and inhibit HIV-1 replication in macrophages. (A) Macrophages were treated with PMA (30 and 100 ng/ml) and infected with HIV-1 VSV-G . The luciferase activity was measured 72 h p.i. For the inset,
    Figure Legend Snippet: PMA and the HDAC inhibitor MS-275 induce p21 expression and inhibit HIV-1 replication in macrophages. (A) Macrophages were treated with PMA (30 and 100 ng/ml) and infected with HIV-1 VSV-G . The luciferase activity was measured 72 h p.i. For the inset,

    Techniques Used: Mass Spectrometry, Expressing, Infection, Luciferase, Activity Assay

    p21 restricts HIV-1 reverse transcription and integration in macrophages. Macrophages were transfected with a p21-specific siRNA or an irrelevant siRNA (si-Neg) in the presence (S) or absence (US) of IC. Cells were infected with HIV-1 VSV-G 24 h after
    Figure Legend Snippet: p21 restricts HIV-1 reverse transcription and integration in macrophages. Macrophages were transfected with a p21-specific siRNA or an irrelevant siRNA (si-Neg) in the presence (S) or absence (US) of IC. Cells were infected with HIV-1 VSV-G 24 h after

    Techniques Used: Transfection, Infection

    Degradation of incoming viruses does not account for the defective HIV-1 reverse transcription. (A) Macrophages plated in untreated (unstimulated, US) or IC-coated plates (stimulated, S) were infected with HIV-1 VSV-G . Late reverse transcription products
    Figure Legend Snippet: Degradation of incoming viruses does not account for the defective HIV-1 reverse transcription. (A) Macrophages plated in untreated (unstimulated, US) or IC-coated plates (stimulated, S) were infected with HIV-1 VSV-G . Late reverse transcription products

    Techniques Used: Infection

    FcγR aggregation induces p21 protein expression specifically and irrespective of p53 expression. (A) Uninfected and HIV-1 VSV-G -infected macrophages were either left untreated (US) or stimulated with IC or LPS (100 ng/ml) for 48 h before total
    Figure Legend Snippet: FcγR aggregation induces p21 protein expression specifically and irrespective of p53 expression. (A) Uninfected and HIV-1 VSV-G -infected macrophages were either left untreated (US) or stimulated with IC or LPS (100 ng/ml) for 48 h before total

    Techniques Used: Expressing, Infection

    p21 silencing enhances HIV-1 replication in macrophages. (A) Macrophages were seeded in the presence (S) or absence (US) of IC and immediately transfected with p21-specific siRNA duplexes n.9 and n.12 or SMARTpool for p21 (Dharmacon), or a scrambled siRNA
    Figure Legend Snippet: p21 silencing enhances HIV-1 replication in macrophages. (A) Macrophages were seeded in the presence (S) or absence (US) of IC and immediately transfected with p21-specific siRNA duplexes n.9 and n.12 or SMARTpool for p21 (Dharmacon), or a scrambled siRNA

    Techniques Used: Transfection

    p21 protein interaction with viral components of the HIV-1 PIC is not detected in yeast two-hybrid or in vitro. (A) Two-hybrid assay between p21 and viral components of the PIC. The yeast reporter strain L40, expressing the indicated pairs of hybrid proteins,
    Figure Legend Snippet: p21 protein interaction with viral components of the HIV-1 PIC is not detected in yeast two-hybrid or in vitro. (A) Two-hybrid assay between p21 and viral components of the PIC. The yeast reporter strain L40, expressing the indicated pairs of hybrid proteins,

    Techniques Used: In Vitro, Two Hybrid Assay, Expressing

    8) Product Images from "Tissue-Specific Sequence Alterations in the Human Immunodeficiency Virus Type 1 Envelope Favoring CCR5 Usage Contribute to Persistence of Dual-Tropic Virus in the Brain ▿"

    Article Title: Tissue-Specific Sequence Alterations in the Human Immunodeficiency Virus Type 1 Envelope Favoring CCR5 Usage Contribute to Persistence of Dual-Tropic Virus in the Brain ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02648-08

    Coreceptor usage for HIV-1 entry into PBMC and MDM. PBMC (A and B) or MDM (C and D) were treated with maraviroc (1 μM), AMD3100 (1 μM), or both inhibitors prior to infection with equivalent infectious units of Env-pseudotyped luciferase
    Figure Legend Snippet: Coreceptor usage for HIV-1 entry into PBMC and MDM. PBMC (A and B) or MDM (C and D) were treated with maraviroc (1 μM), AMD3100 (1 μM), or both inhibitors prior to infection with equivalent infectious units of Env-pseudotyped luciferase

    Techniques Used: Infection, Luciferase

    Coreceptor preference for HIV-1 entry into JC53 cells. JC53 cells were treated with maraviroc (1 μM), AMD3100 (1 μM), or both inhibitors prior to infection with equivalent infectious units of Env-pseudotyped luciferase reporter virus,
    Figure Legend Snippet: Coreceptor preference for HIV-1 entry into JC53 cells. JC53 cells were treated with maraviroc (1 μM), AMD3100 (1 μM), or both inhibitors prior to infection with equivalent infectious units of Env-pseudotyped luciferase reporter virus,

    Techniques Used: Infection, Luciferase

    Env V3 determinants influencing coreceptor usage for HIV-1 entry into PBMC and MDM. PBMC (A) or MDM (B) were treated with maraviroc (1 μM), AMD3100 (1 μM), or both inhibitors prior to infection with equivalent infectious units of Env-pseudotyped
    Figure Legend Snippet: Env V3 determinants influencing coreceptor usage for HIV-1 entry into PBMC and MDM. PBMC (A) or MDM (B) were treated with maraviroc (1 μM), AMD3100 (1 μM), or both inhibitors prior to infection with equivalent infectious units of Env-pseudotyped

    Techniques Used: Infection

    9) Product Images from "GapA and CrmA Coexpression Is Essential for Mycoplasma gallisepticum Cytadherence and Virulence "

    Article Title: GapA and CrmA Coexpression Is Essential for Mycoplasma gallisepticum Cytadherence and Virulence

    Journal: Infection and Immunity

    doi: 10.1128/IAI.70.12.6839-6845.2002

    Putative binding and interactive domains of M. gallisepticum GapA (A) and CrmA (B). [ ], transmembrane region (TM); [ ], putative signal peptidase cleavage site; [ ]).
    Figure Legend Snippet: Putative binding and interactive domains of M. gallisepticum GapA (A) and CrmA (B). [ ], transmembrane region (TM); [ ], putative signal peptidase cleavage site; [ ]).

    Techniques Used: Binding Assay

    Characterization of the M. gallisepticum R high transformants SDCA and GCA1 by immunoblotting and DNA hybridization analysis. Lane 1, R high ; lane 2, R low ; lane 3, SDCA c4 ; lane 4, GCA1 c5 . (A) Immunoblots developed with mixed anti-GapA and anti-CrmA sera. (B) Southern blot of Hin dIII-digested total genomic DNAs probed with a 32 P-labeled portion of crmA . Lanes in this digitized image have been reordered by using Adobe PhotoShop.
    Figure Legend Snippet: Characterization of the M. gallisepticum R high transformants SDCA and GCA1 by immunoblotting and DNA hybridization analysis. Lane 1, R high ; lane 2, R low ; lane 3, SDCA c4 ; lane 4, GCA1 c5 . (A) Immunoblots developed with mixed anti-GapA and anti-CrmA sera. (B) Southern blot of Hin dIII-digested total genomic DNAs probed with a 32 P-labeled portion of crmA . Lanes in this digitized image have been reordered by using Adobe PhotoShop.

    Techniques Used: DNA Hybridization, Western Blot, Southern Blot, Labeling

    10) Product Images from "Identification of fur and fldA Homologs and a Pasteurella multocida tbpA Homolog in Histophilus ovis and Effects of Iron Availability on Their Transcription"

    Article Title: Identification of fur and fldA Homologs and a Pasteurella multocida tbpA Homolog in Histophilus ovis and Effects of Iron Availability on Their Transcription

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.184.9.2539-2542.2002

    Genetic organization of the tbpA genes in strains 9L and 3384Y. Putative −35, −10, and Shine-Dalgarno (SD) sequences are underlined, a potential Fur-binding site is in bold italics, start and stop codons are in bold, and inverted repeats, possibly involved in transcriptional termination, are in underlined italics.
    Figure Legend Snippet: Genetic organization of the tbpA genes in strains 9L and 3384Y. Putative −35, −10, and Shine-Dalgarno (SD) sequences are underlined, a potential Fur-binding site is in bold italics, start and stop codons are in bold, and inverted repeats, possibly involved in transcriptional termination, are in underlined italics.

    Techniques Used: Binding Assay

    11) Product Images from "Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare"

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    Journal: Frontiers in Cellular Neuroscience

    doi: 10.3389/fncel.2018.00443

    Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.
    Figure Legend Snippet: Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, BAC Assay, Transgenic Assay

    Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.
    Figure Legend Snippet: Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Techniques Used: Polymerase Chain Reaction, Marker, Mouse Assay

    12) Product Images from "Mycobacterium marinum MMAR_2380, a predicted transmembrane acyltransferase, is essential for the presence of the mannose cap on lipoarabinomannan"

    Article Title: Mycobacterium marinum MMAR_2380, a predicted transmembrane acyltransferase, is essential for the presence of the mannose cap on lipoarabinomannan

    Journal: Microbiology

    doi: 10.1099/mic.0.037507-0

    Enzymic analysis. Mannosyltransferase capping assay with synthetic Ara 6 as acceptor and membranes from M. marinum wild-type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.), and as control, membranes from M. marinum wild-type without acceptor. Shown are means of triplicates; error bars, sd .
    Figure Legend Snippet: Enzymic analysis. Mannosyltransferase capping assay with synthetic Ara 6 as acceptor and membranes from M. marinum wild-type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.), and as control, membranes from M. marinum wild-type without acceptor. Shown are means of triplicates; error bars, sd .

    Techniques Used: Acetylene Reduction Assay

    Physical appearance of liquid-grown M. marinum wild type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.). (a) OD 600 measurements during growth in 7H9+0.05 % Tween 80 with agitation. Shown are means of three independently grown cultures per strain; error bars sd . (b) M. marinum Δ MMAR_2380 shows increased aggregation as compared with the wild-type and the complemented strains (see Supplementary Fig. S4 for colour pictures).
    Figure Legend Snippet: Physical appearance of liquid-grown M. marinum wild type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.). (a) OD 600 measurements during growth in 7H9+0.05 % Tween 80 with agitation. Shown are means of three independently grown cultures per strain; error bars sd . (b) M. marinum Δ MMAR_2380 shows increased aggregation as compared with the wild-type and the complemented strains (see Supplementary Fig. S4 for colour pictures).

    Techniques Used:

    Absence of the mannose cap on mutant LAM. (a) Cell lysates from M. marinum wild-type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.) strains and M. smegmatis wild-type (control for ‘capless’ LAM) were immunoblotted with α -AraLAM antibody F30-5, which recognizes LAM, and α -ManLAM antibody 55.92.1A1, which recognizes the mannose cap. (b) Mannooligosaccharide cap analysis of LAM. Purified and partially degraded LAM was analysed for the presence of the mannose caps by CE. Shown are the profiles of LAM purified from M. marinum E11 (trace 1) and M. marinum Δ MMAR_2380 (trace 2). A, Ara-APTS; M, Man-APTS; S, internal standard, mannoheptose-APTS; AM, Manp- α (1→5)-Ara-APTS (monomannoside cap); AMM, Manp- α (1→2)-Manp- α (1→5)-Ara-APTS (dimannoside cap).
    Figure Legend Snippet: Absence of the mannose cap on mutant LAM. (a) Cell lysates from M. marinum wild-type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.) strains and M. smegmatis wild-type (control for ‘capless’ LAM) were immunoblotted with α -AraLAM antibody F30-5, which recognizes LAM, and α -ManLAM antibody 55.92.1A1, which recognizes the mannose cap. (b) Mannooligosaccharide cap analysis of LAM. Purified and partially degraded LAM was analysed for the presence of the mannose caps by CE. Shown are the profiles of LAM purified from M. marinum E11 (trace 1) and M. marinum Δ MMAR_2380 (trace 2). A, Ara-APTS; M, Man-APTS; S, internal standard, mannoheptose-APTS; AM, Manp- α (1→5)-Ara-APTS (monomannoside cap); AMM, Manp- α (1→2)-Manp- α (1→5)-Ara-APTS (dimannoside cap).

    Techniques Used: Mutagenesis, Laser Capture Microdissection, Purification, Acetylene Reduction Assay

    Reduced [1,2- 14 C]acetate incorporation in the polar lipids PIM 6 , LM and LAM from M. marinum Δ MMAR_2380 . (a) Extracted crude lipoglycans from acetate-labelled delipidated cells (25 μg) from M. marinum wild-type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.) were counted for the incorporation of [1,2- 14 C]acetate and analysed by SDS-PAGE/autoradiography. Shown is the average of two independent experiments. (b) [1,2- 14 C]Acetate-labelled M. marinum cultures were processed and polar lipids were applied (25 000 c.p.m.) to the corners of 6.6×6.6 cm pieces of aluminium-backed TLC plates and analysed using the 2D solvent system E as described in Methods. Plates were dried and autoradiograms were produced by overnight exposure of Kodak X-Omat AR film to the TLC plates to reveal [1,2- 14 C]acetate-labelled lipids. PI, non-mannosylated, diacylated phosphatidylinositol anchor; PIM 2 , phosphatidylinositol dimannoside; PIM 6 , phosphatidylinositol hexamannoside; Ac 1 PIM, tri-acylated PIM; Ac 2 PIM, tetra-acylated PIM. Unassigned spots in the figure are lipooligosaccharides, and in the upper-right corner are diphosphatidylglycerol, phosphatidylethanolamine and unknown phospholipids ( Burguière et al. , 2005 ). Two independently prepared lipid extracts per strain were tested.
    Figure Legend Snippet: Reduced [1,2- 14 C]acetate incorporation in the polar lipids PIM 6 , LM and LAM from M. marinum Δ MMAR_2380 . (a) Extracted crude lipoglycans from acetate-labelled delipidated cells (25 μg) from M. marinum wild-type, Δ MMAR_2380 and complemented Δ MMAR_2380 (Δ MMAR_2380 comp.) were counted for the incorporation of [1,2- 14 C]acetate and analysed by SDS-PAGE/autoradiography. Shown is the average of two independent experiments. (b) [1,2- 14 C]Acetate-labelled M. marinum cultures were processed and polar lipids were applied (25 000 c.p.m.) to the corners of 6.6×6.6 cm pieces of aluminium-backed TLC plates and analysed using the 2D solvent system E as described in Methods. Plates were dried and autoradiograms were produced by overnight exposure of Kodak X-Omat AR film to the TLC plates to reveal [1,2- 14 C]acetate-labelled lipids. PI, non-mannosylated, diacylated phosphatidylinositol anchor; PIM 2 , phosphatidylinositol dimannoside; PIM 6 , phosphatidylinositol hexamannoside; Ac 1 PIM, tri-acylated PIM; Ac 2 PIM, tetra-acylated PIM. Unassigned spots in the figure are lipooligosaccharides, and in the upper-right corner are diphosphatidylglycerol, phosphatidylethanolamine and unknown phospholipids ( Burguière et al. , 2005 ). Two independently prepared lipid extracts per strain were tested.

    Techniques Used: Laser Capture Microdissection, SDS Page, Autoradiography, Thin Layer Chromatography, Produced

    NMR analysis of the glyco part of LAM from M. marinum wild-type (pattern 1) and Δ MMAR_2380 (pattern 2). 2D 1 H- 13 C heteronuclear multiple quantum coherence spectroscopy (1H- 13 C HMQC) spectra of LAM in D 2 O at 313 K are shown with expanded regions ( δ 1 H, 4.80–5.35; δ 13 C, 99–113). The different resonances are labelled with the abbreviated name of the corresponding glycosyl units. See Supplementary Fig. S1 for structure of ManLAM.
    Figure Legend Snippet: NMR analysis of the glyco part of LAM from M. marinum wild-type (pattern 1) and Δ MMAR_2380 (pattern 2). 2D 1 H- 13 C heteronuclear multiple quantum coherence spectroscopy (1H- 13 C HMQC) spectra of LAM in D 2 O at 313 K are shown with expanded regions ( δ 1 H, 4.80–5.35; δ 13 C, 99–113). The different resonances are labelled with the abbreviated name of the corresponding glycosyl units. See Supplementary Fig. S1 for structure of ManLAM.

    Techniques Used: Nuclear Magnetic Resonance, Laser Capture Microdissection, Spectroscopy

    13) Product Images from "The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]"

    Article Title: The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.110.080788

    MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.

    Techniques Used:

    Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.
    Figure Legend Snippet: Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.

    Techniques Used: Binding Assay, In Vitro

    MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.

    Techniques Used:

    Tissue Expression Patterns of MYC3 and MYC4 .
    Figure Legend Snippet: Tissue Expression Patterns of MYC3 and MYC4 .

    Techniques Used: Expressing

    14) Product Images from "The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]"

    Article Title: The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.110.080788

    MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.

    Techniques Used:

    Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.
    Figure Legend Snippet: Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.

    Techniques Used: Binding Assay, In Vitro

    MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.

    Techniques Used:

    Tissue Expression Patterns of MYC3 and MYC4 .
    Figure Legend Snippet: Tissue Expression Patterns of MYC3 and MYC4 .

    Techniques Used: Expressing

    15) Product Images from "A 95 kDa protein of Plasmodium vivax and P. cynomolgi visualized by 3-D tomography in the caveola-vesicle complexes (Sch?ffner's dots) of infected erythrocytes is a member of the PHIST family"

    Article Title: A 95 kDa protein of Plasmodium vivax and P. cynomolgi visualized by 3-D tomography in the caveola-vesicle complexes (Sch?ffner's dots) of infected erythrocytes is a member of the PHIST family

    Journal: Molecular Microbiology

    doi: 10.1111/j.1365-2958.2012.08060.x

    Protein structure and sequence identity of PcyPHIST/CVC-81 95 and its homologs. A. The schematic represents the PvPHIST/CVC-81 95 , PcyPHIST/CVC-81 95 , PkPHIST-105 and PfPHIST-147 proteins, showing their number of amino acids and main features as indicated.
    Figure Legend Snippet: Protein structure and sequence identity of PcyPHIST/CVC-81 95 and its homologs. A. The schematic represents the PvPHIST/CVC-81 95 , PcyPHIST/CVC-81 95 , PkPHIST-105 and PfPHIST-147 proteins, showing their number of amino acids and main features as indicated.

    Techniques Used: Sequencing

    PcyPHIST/CVC-81 95 is expressed in the ring, trophozoite and schizont stages of development.
    Figure Legend Snippet: PcyPHIST/CVC-81 95 is expressed in the ring, trophozoite and schizont stages of development.

    Techniques Used:

    A. P. cynomolgi phist/cvc-81 95 transfection experiments result in retrieval of episomes conferring resistance to pyrimethamine, but without integration in the genome. Results are shown for one of two transfection experiments. A. Schematic of the pcyphist/cvc-81
    Figure Legend Snippet: A. P. cynomolgi phist/cvc-81 95 transfection experiments result in retrieval of episomes conferring resistance to pyrimethamine, but without integration in the genome. Results are shown for one of two transfection experiments. A. Schematic of the pcyphist/cvc-81

    Techniques Used: Transfection

    16) Product Images from "Site-Specific Chemoenzymatic Labeling of Aerolysin Enables the Identification of New Aerolysin Receptors"

    Article Title: Site-Specific Chemoenzymatic Labeling of Aerolysin Enables the Identification of New Aerolysin Receptors

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0109883

    Strategies for site-specific labeling of proaerolysin. A Structure of the proaerolysin monomer (PDB: 1PRE). Proaerolysin consists of several different domains, two of which are responsible for receptor binding (domains 1 and 2), one containsing the trans-membrane domain, and the C-terminal peptide (CP), which functions as a chaperone and dissociates from the rest of the complex upon heptamer association and pore formation. B Sortase reaction mechanism. C-terminal sortagging: sortase cleaves after threonine in the context of its recognition motif resulting in the formation of a new covalent bond with the N-terminus of an added oligoglycine or oligoalanine nucleophile coupled to a label of choice. N-terminal sortagging: the N-terminal glycine of proaerolysin is recognized as a nucleophile by sortase and conjugated to an LPXTG/A probe bearing a label. C Structures of probes used in this study. Not depicted is AAA.Alexa Fluor 647, which is similar to GGG.Alexa Fluor 647, but with alanine replacing glycine. PelB: periplasm targeting sequence, cleaved off by the producer bacteria upon export of proaerolysin to the periplasm. H6: hexahistidine handle for affinity purification. Protease cleavage sites are recognized by target cell surface proteases such as furin. CP: C-terminal peptide, serves as a chaperone for proaerolysin. Upon its loss, proaerolysin is converted to mature aerolysin (AeL). D Scheme for wild type (WT) and sortaggable versions of proaerolysin with their designations. The LPXTG/A pentapeptides are sortase recognition motifs.
    Figure Legend Snippet: Strategies for site-specific labeling of proaerolysin. A Structure of the proaerolysin monomer (PDB: 1PRE). Proaerolysin consists of several different domains, two of which are responsible for receptor binding (domains 1 and 2), one containsing the trans-membrane domain, and the C-terminal peptide (CP), which functions as a chaperone and dissociates from the rest of the complex upon heptamer association and pore formation. B Sortase reaction mechanism. C-terminal sortagging: sortase cleaves after threonine in the context of its recognition motif resulting in the formation of a new covalent bond with the N-terminus of an added oligoglycine or oligoalanine nucleophile coupled to a label of choice. N-terminal sortagging: the N-terminal glycine of proaerolysin is recognized as a nucleophile by sortase and conjugated to an LPXTG/A probe bearing a label. C Structures of probes used in this study. Not depicted is AAA.Alexa Fluor 647, which is similar to GGG.Alexa Fluor 647, but with alanine replacing glycine. PelB: periplasm targeting sequence, cleaved off by the producer bacteria upon export of proaerolysin to the periplasm. H6: hexahistidine handle for affinity purification. Protease cleavage sites are recognized by target cell surface proteases such as furin. CP: C-terminal peptide, serves as a chaperone for proaerolysin. Upon its loss, proaerolysin is converted to mature aerolysin (AeL). D Scheme for wild type (WT) and sortaggable versions of proaerolysin with their designations. The LPXTG/A pentapeptides are sortase recognition motifs.

    Techniques Used: Labeling, Binding Assay, Sequencing, Affinity Purification

    Identification of new aerolysin receptors. Biotin AeL.CP was used to identify new GPI-anchored proteins that bind Aerolysin . A Biotin.LPETG was attached to the N-terminus of proaerolysin via sortagging. The purified reaction product was analyzed by immunoblot. B HeLa cells were incubated with Biotin AeL.CP for 3 hours at 4°C and subsequently lysed with 0.5% NP-40. After pull-down with neutravidin beads, proteins were eluted, analyzed by SDS-PAGE, and subjected to mass spectrometry. Five GPI-anchored proteins were identified. UniProt accession codes are indicated. Peptides identified by mass spectrometry, lipidated amino acids, signal peptides, as well as peptides cleaved off from the pro-proteins are highlighted. C Binding of Biotin AeL.CP to mesothelin and to CD59 was verified by immunoblot.
    Figure Legend Snippet: Identification of new aerolysin receptors. Biotin AeL.CP was used to identify new GPI-anchored proteins that bind Aerolysin . A Biotin.LPETG was attached to the N-terminus of proaerolysin via sortagging. The purified reaction product was analyzed by immunoblot. B HeLa cells were incubated with Biotin AeL.CP for 3 hours at 4°C and subsequently lysed with 0.5% NP-40. After pull-down with neutravidin beads, proteins were eluted, analyzed by SDS-PAGE, and subjected to mass spectrometry. Five GPI-anchored proteins were identified. UniProt accession codes are indicated. Peptides identified by mass spectrometry, lipidated amino acids, signal peptides, as well as peptides cleaved off from the pro-proteins are highlighted. C Binding of Biotin AeL.CP to mesothelin and to CD59 was verified by immunoblot.

    Techniques Used: Purification, Incubation, SDS Page, Mass Spectrometry, Binding Assay

    Double-labeling of proaerolysin. Double-labeling was achieved with a two-step approach. A Schematic representation of the dual labeling strategy of proaerolysin. B We used SrtA Strep to install an oligoalanine coupled to the fluorophore AF647 at the C-terminus of proaerolysin, followed by a gel filtration purification step. C Elution profiles were analyzed by SDS-PAGE, fluorescence scan and coomassie stain. D The reaction product was subjected to the second round of sortagging with SrtA Staph7M and LPETG-coupled TAMRA fluorophore for N-terminal labeling. SrtA Staph does not recognize or cleave LPXTA, hence the C-terminal label remains intact. A single peak is observed on the elution profile as immobilized sortase was used for the reaction and removed prior to gel filtration. E Elution profiles were analyzed by SDS-PAGE followed by fluorescence scan.
    Figure Legend Snippet: Double-labeling of proaerolysin. Double-labeling was achieved with a two-step approach. A Schematic representation of the dual labeling strategy of proaerolysin. B We used SrtA Strep to install an oligoalanine coupled to the fluorophore AF647 at the C-terminus of proaerolysin, followed by a gel filtration purification step. C Elution profiles were analyzed by SDS-PAGE, fluorescence scan and coomassie stain. D The reaction product was subjected to the second round of sortagging with SrtA Staph7M and LPETG-coupled TAMRA fluorophore for N-terminal labeling. SrtA Staph does not recognize or cleave LPXTA, hence the C-terminal label remains intact. A single peak is observed on the elution profile as immobilized sortase was used for the reaction and removed prior to gel filtration. E Elution profiles were analyzed by SDS-PAGE followed by fluorescence scan.

    Techniques Used: Labeling, Filtration, Purification, SDS Page, Fluorescence, Staining

    Installation of a single label on proaerolysin. The fluorophore carboxytetramethylrhodamine (TAMRA) was installed at the N-terminus of aerolysin ( N AeL.CP), at the C-terminus of aerolysin upstream of the CP (AeL C ) and at the C-terminus of the C-terminal peptide (AeL.CP C ) with sortase. A, C, E Schematic representation of the sortagging reactions using of N AeL.CP, AeL.CP C, AeL C respectively. B, D Sortagging of N AeL.CP and AeL.CP C, respectively, with respective control conditions, resolved by SDS PAGE and imaged with a fluorescence scanner. Product is visible by fluorescent signal. SrtA Strep and SrtA Staph recognize and cleave LPXTA and LPXTG motives, respectively. F Purification of labeled AeL TAMRA , gel filtration. The first peak in the A280 elution profile corresponds to aerolysin, the second to sortase, and the third to free nucleophile. G Analysis of the first peak of the gel filtration elution profile with SDS PAGE followed by fluorescence image scan and Coomassie stain. A fraction of Ael C is not converted to fluorescent product.
    Figure Legend Snippet: Installation of a single label on proaerolysin. The fluorophore carboxytetramethylrhodamine (TAMRA) was installed at the N-terminus of aerolysin ( N AeL.CP), at the C-terminus of aerolysin upstream of the CP (AeL C ) and at the C-terminus of the C-terminal peptide (AeL.CP C ) with sortase. A, C, E Schematic representation of the sortagging reactions using of N AeL.CP, AeL.CP C, AeL C respectively. B, D Sortagging of N AeL.CP and AeL.CP C, respectively, with respective control conditions, resolved by SDS PAGE and imaged with a fluorescence scanner. Product is visible by fluorescent signal. SrtA Strep and SrtA Staph recognize and cleave LPXTA and LPXTG motives, respectively. F Purification of labeled AeL TAMRA , gel filtration. The first peak in the A280 elution profile corresponds to aerolysin, the second to sortase, and the third to free nucleophile. G Analysis of the first peak of the gel filtration elution profile with SDS PAGE followed by fluorescence image scan and Coomassie stain. A fraction of Ael C is not converted to fluorescent product.

    Techniques Used: SDS Page, Fluorescence, Purification, Labeling, Filtration, Staining

    17) Product Images from "Critical roles for CCR2 and MCP-3 in monocyte mobilization from bone marrow and recruitment to inflammatory sites"

    Article Title: Critical roles for CCR2 and MCP-3 in monocyte mobilization from bone marrow and recruitment to inflammatory sites

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI29919

    Relative abundance of MCPs in MCP-1 –/– mice and newly created MCP-3 –/– , MCP-5 –/– , and MCP-2 –/– MCP-5 –/– mice.
    Figure Legend Snippet: Relative abundance of MCPs in MCP-1 –/– mice and newly created MCP-3 –/– , MCP-5 –/– , and MCP-2 –/– MCP-5 –/– mice.

    Techniques Used: Mouse Assay

    Monocyte retention in the bone marrow in MCP-1 –/– and MCP-3 –/– mice.
    Figure Legend Snippet: Monocyte retention in the bone marrow in MCP-1 –/– and MCP-3 –/– mice.

    Techniques Used: Mouse Assay

    Decrease in the level of 7/4 bri Ly-6G – monocytes in MCP-3 –/– and MCP-1 –/– mice.
    Figure Legend Snippet: Decrease in the level of 7/4 bri Ly-6G – monocytes in MCP-3 –/– and MCP-1 –/– mice.

    Techniques Used: Mouse Assay

    18) Product Images from "THE MOLECULAR BASIS OF ASSOCIATION OF RECEPTOR ACTIVITY-MODIFYING PROTEIN 3 WITH THE FAMILY B G PROTEIN-COUPLED SECRETIN RECEPTOR #"

    Article Title: THE MOLECULAR BASIS OF ASSOCIATION OF RECEPTOR ACTIVITY-MODIFYING PROTEIN 3 WITH THE FAMILY B G PROTEIN-COUPLED SECRETIN RECEPTOR #

    Journal: Biochemistry

    doi: 10.1021/bi901326k

    Bimolecular fluorescence complementation assays Shown are typical fluorescence images of COS cells expressing the YFP-, YN-, and YC-tagged constructs, as noted. Significant fluorescence was noted at the cell surface (highlighted with arrowheads) when YC-tagged RAMP3 was co-expressed with the calcitonin receptor tagged with YN or with the secretin receptor tagged with YN. RAMP dimerization in the intracellular biosynthetic compartments was observed when RAMP-YN and RAMP-YC were co-expressed. Insets show the boxed regions at higher magnification. Bar 25 μm.
    Figure Legend Snippet: Bimolecular fluorescence complementation assays Shown are typical fluorescence images of COS cells expressing the YFP-, YN-, and YC-tagged constructs, as noted. Significant fluorescence was noted at the cell surface (highlighted with arrowheads) when YC-tagged RAMP3 was co-expressed with the calcitonin receptor tagged with YN or with the secretin receptor tagged with YN. RAMP dimerization in the intracellular biosynthetic compartments was observed when RAMP-YN and RAMP-YC were co-expressed. Insets show the boxed regions at higher magnification. Bar 25 μm.

    Techniques Used: Fluorescence, Expressing, Construct

    BRET analysis of secretin receptor-RAMP3 interaction using the truncated RAMP construct Shown are the static (A) and saturation (B) BRET signals obtained from COS cells coexpressing Rlu-tagged secretin receptor with YFP-tagged amino-terminally-truncated RAMP3. Significant BRET signals above non-specific (shown in the shaded area) are marked **p
    Figure Legend Snippet: BRET analysis of secretin receptor-RAMP3 interaction using the truncated RAMP construct Shown are the static (A) and saturation (B) BRET signals obtained from COS cells coexpressing Rlu-tagged secretin receptor with YFP-tagged amino-terminally-truncated RAMP3. Significant BRET signals above non-specific (shown in the shaded area) are marked **p

    Techniques Used: Bioluminescence Resonance Energy Transfer, Construct

    BRET analysis of association between RAMPs and the secretin receptor Shown are BRET signals in static and saturation assays evaluating the potential interaction of the secretin receptor and RAMPs. In the static assays shown in panel A, background BRET signals were determined by expression of the Rlu-tagged RAMPs and soluble YFP. The co-expression of YFP-tagged RAMP1 and RAMP2 produced only background BRET. In contrast, co-expression of RAMP3 produced a significant BRET signal. This was similar to that produced by the positive control, the co-expression with the Rlu-tagged calcitonin receptor. Panel B shows the saturation BRET data, confirming the significance of the signal generated by co-expression of RAMP3 and the secretin receptor. In panel C, the effects of increasing concentrations of secretin on the BRET signal were studied. The cells were incubated with specified concentrations of secretin at 37°C for 5 min before adding the coelenterazine h (5μM) to initiate the BRET signal. There was no significant effect of agonist on secretin receptor-RAMP3 interaction. The values plotted represent means ± S.E.M. of data from five independent experiments. ** p
    Figure Legend Snippet: BRET analysis of association between RAMPs and the secretin receptor Shown are BRET signals in static and saturation assays evaluating the potential interaction of the secretin receptor and RAMPs. In the static assays shown in panel A, background BRET signals were determined by expression of the Rlu-tagged RAMPs and soluble YFP. The co-expression of YFP-tagged RAMP1 and RAMP2 produced only background BRET. In contrast, co-expression of RAMP3 produced a significant BRET signal. This was similar to that produced by the positive control, the co-expression with the Rlu-tagged calcitonin receptor. Panel B shows the saturation BRET data, confirming the significance of the signal generated by co-expression of RAMP3 and the secretin receptor. In panel C, the effects of increasing concentrations of secretin on the BRET signal were studied. The cells were incubated with specified concentrations of secretin at 37°C for 5 min before adding the coelenterazine h (5μM) to initiate the BRET signal. There was no significant effect of agonist on secretin receptor-RAMP3 interaction. The values plotted represent means ± S.E.M. of data from five independent experiments. ** p

    Techniques Used: Bioluminescence Resonance Energy Transfer, Expressing, Produced, Positive Control, Generated, Incubation

    Morphological RAMP translocation assay Shown are representative confocal microscopic images of COS cells expressing either YFP-tagged RAMPs alone or co-expressed with wild type or amino-terminal region (Δ1-121) truncated or carboxyl-terminal region (Δ376-419) truncated secretin receptor constructs. Each of the truncated secretin receptor constructs translocated the YFP-tagged RAMP3 to the cell surface (arrowheads) similar to wild type secretin receptor. These images shown are representative of four similar experiments. Insets show the boxed regions at higher magnification. Bar 25 μm.
    Figure Legend Snippet: Morphological RAMP translocation assay Shown are representative confocal microscopic images of COS cells expressing either YFP-tagged RAMPs alone or co-expressed with wild type or amino-terminal region (Δ1-121) truncated or carboxyl-terminal region (Δ376-419) truncated secretin receptor constructs. Each of the truncated secretin receptor constructs translocated the YFP-tagged RAMP3 to the cell surface (arrowheads) similar to wild type secretin receptor. These images shown are representative of four similar experiments. Insets show the boxed regions at higher magnification. Bar 25 μm.

    Techniques Used: Translocation Assay, Expressing, Construct

    Morphologic assays for RAMP translocation to the plasma membrane Shown are fluorescence images of the expression of each type of RAMP in COS cells, all localized to biosynthetic compartments, particularly representing the endoplasmic reticulum (left column). The right column shows the changes in distribution of the fluorescence when the calcitonin receptor-like receptor was co-expressed with each YFP-tagged RAMP. In all three conditions, there was significant translocation to the plasma membrane (highlighted with arrowheads). The middle column shows the changes in distribution of the fluorescence when the secretin receptor was co-expressed with each RAMP. Here, only RAMP3 distribution was changed, with significant translocation to the plasma membrane (highlighted with arrowheads). Insets show the boxed regions at higher magnification. The images shown are representative of four similar experiments. Bar 25 μm.
    Figure Legend Snippet: Morphologic assays for RAMP translocation to the plasma membrane Shown are fluorescence images of the expression of each type of RAMP in COS cells, all localized to biosynthetic compartments, particularly representing the endoplasmic reticulum (left column). The right column shows the changes in distribution of the fluorescence when the calcitonin receptor-like receptor was co-expressed with each YFP-tagged RAMP. In all three conditions, there was significant translocation to the plasma membrane (highlighted with arrowheads). The middle column shows the changes in distribution of the fluorescence when the secretin receptor was co-expressed with each RAMP. Here, only RAMP3 distribution was changed, with significant translocation to the plasma membrane (highlighted with arrowheads). Insets show the boxed regions at higher magnification. The images shown are representative of four similar experiments. Bar 25 μm.

    Techniques Used: Translocation Assay, Fluorescence, Expressing

    Morphologic fluorescence analysis of chimeric receptor association with RAMP3 Three chimeric secretin-GLP1 receptor constructs were studied for their abilities to translocate the fluorescent RAMP3 construct to the transfected COS cell surface. Sec(GLP1 TM1-3 )R and Sec(GLP1 TM4-5 )R behaved like wild type secretin receptor, associating with this RAMP and translocating it to the COS cell surface. However, Sec(GLP1 TM6-7 )R did not have this effect, behaving instead like the wild type GLP-1 receptor. This supports the interpretation that the TM6 and TM7 regions of the secretin receptor are responsible for its association with RAMP3. Insets show the boxed regions at higher magnification.Bar 25 μm.
    Figure Legend Snippet: Morphologic fluorescence analysis of chimeric receptor association with RAMP3 Three chimeric secretin-GLP1 receptor constructs were studied for their abilities to translocate the fluorescent RAMP3 construct to the transfected COS cell surface. Sec(GLP1 TM1-3 )R and Sec(GLP1 TM4-5 )R behaved like wild type secretin receptor, associating with this RAMP and translocating it to the COS cell surface. However, Sec(GLP1 TM6-7 )R did not have this effect, behaving instead like the wild type GLP-1 receptor. This supports the interpretation that the TM6 and TM7 regions of the secretin receptor are responsible for its association with RAMP3. Insets show the boxed regions at higher magnification.Bar 25 μm.

    Techniques Used: Fluorescence, Construct, Transfection, Size-exclusion Chromatography

    19) Product Images from "Insights into the complex regulation of rpoS in Borrelia burgdorferi"

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    Journal: Molecular Microbiology

    doi: 10.1111/j.1365-2958.2007.05813.x

    Transcript levels of cat in B. burgdorferi B31-A3 as measured by QRT-PCR. All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.
    Figure Legend Snippet: Transcript levels of cat in B. burgdorferi B31-A3 as measured by QRT-PCR. All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.

    Techniques Used: Quantitative RT-PCR, Standard Deviation, Plasmid Preparation

    Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC as cell density increases RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) as spirochete density increased and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS as cell density increased. Fold changes are expressed relative to the initial inoculum. B. QRT-PCR analysis of ospC as cell density increased. Fold changes are expressed relative to the initial inoculum. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with B31-A3 at corresponding cell densities. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared to the B31-A3 at corresponding cell densities. E. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 as cell density increased. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Cell densities are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).
    Figure Legend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC as cell density increases RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) as spirochete density increased and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS as cell density increased. Fold changes are expressed relative to the initial inoculum. B. QRT-PCR analysis of ospC as cell density increased. Fold changes are expressed relative to the initial inoculum. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with B31-A3 at corresponding cell densities. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared to the B31-A3 at corresponding cell densities. E. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 as cell density increased. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Cell densities are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Techniques Used: Quantitative RT-PCR, Standard Deviation

    Transcript levels of cat in B. burgdorferi A3 ntrA and A3 hk2 as measured by QRT-PCR. cat transcripts levels were measured in B. burgdorferi A3 hk2 and A3 ntrA harbouring plasmids pMB313 (hatched bars) and pMB92S (black bars). Fold changes are relative to strains harbouring pBCAT. All values have been normalized to the internal control, flaB . Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation.
    Figure Legend Snippet: Transcript levels of cat in B. burgdorferi A3 ntrA and A3 hk2 as measured by QRT-PCR. cat transcripts levels were measured in B. burgdorferi A3 hk2 and A3 ntrA harbouring plasmids pMB313 (hatched bars) and pMB92S (black bars). Fold changes are relative to strains harbouring pBCAT. All values have been normalized to the internal control, flaB . Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation.

    Techniques Used: Quantitative RT-PCR, Standard Deviation

    Construction of a B. burgdorferi hk2 mutant A. Schematic representation for inactivation of hk2 in B31-A3. hk2 and rrp2 are represented by black arrows as labelled. A DNA fragment harbouring hk2 was PCR amplified using hk2-BF and hk2-BR primers and insertionally disrupted at a unique SphI site with a kanamycin cassette (grey arrow) as described in the Experimental procedures section. Primers are denoted by short black arrows. B. Agarose gel patterns of PCR products for B31-A3 (lane 2) and A3 hk2 (lane 3) using the hk2-BF and hk2-BR primer pair. Disruption of hk2 by the kanamycin cassette resulted in an increased size PCR product (compare lanes 2 and 3). PCR products for the hk2-BF and kan5′ primer pair (lane 4), and the hk2-BR and kan3′ primer pair (lane 5), confirmed the orientation of the kanamycin cassette with respect to hk2 and rrp2 as diagrammed in panel A. RT-PCR analysis with the rrp2-RTF and rrp2-RTR primer pair confirmed the presence of rrp2 transcript in both B31-A3 (lane 6) and A3 hk2 (lane 7). Lane 1 contains DNA markers with the sizes indicated to the left. C. Immunoblot analysis of B31-A3, A3 ntrA and A3 hk2 grown to high cell density (2 × 10 8 cells ml −1 + 24 h). Whole-cell lysates of B. burgdorferi strains equivalent to ∼10 8 cells were separated on a 12% Tris-glycine gel, immobilized on a nitrocellulose membrane and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples.
    Figure Legend Snippet: Construction of a B. burgdorferi hk2 mutant A. Schematic representation for inactivation of hk2 in B31-A3. hk2 and rrp2 are represented by black arrows as labelled. A DNA fragment harbouring hk2 was PCR amplified using hk2-BF and hk2-BR primers and insertionally disrupted at a unique SphI site with a kanamycin cassette (grey arrow) as described in the Experimental procedures section. Primers are denoted by short black arrows. B. Agarose gel patterns of PCR products for B31-A3 (lane 2) and A3 hk2 (lane 3) using the hk2-BF and hk2-BR primer pair. Disruption of hk2 by the kanamycin cassette resulted in an increased size PCR product (compare lanes 2 and 3). PCR products for the hk2-BF and kan5′ primer pair (lane 4), and the hk2-BR and kan3′ primer pair (lane 5), confirmed the orientation of the kanamycin cassette with respect to hk2 and rrp2 as diagrammed in panel A. RT-PCR analysis with the rrp2-RTF and rrp2-RTR primer pair confirmed the presence of rrp2 transcript in both B31-A3 (lane 6) and A3 hk2 (lane 7). Lane 1 contains DNA markers with the sizes indicated to the left. C. Immunoblot analysis of B31-A3, A3 ntrA and A3 hk2 grown to high cell density (2 × 10 8 cells ml −1 + 24 h). Whole-cell lysates of B. burgdorferi strains equivalent to ∼10 8 cells were separated on a 12% Tris-glycine gel, immobilized on a nitrocellulose membrane and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction

    Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) grown at 23°C and following a temperature shift to 34°C, and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. B. QRT-PCR analysis of ospC following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. E. Growth curves of B31-A3 (grey triangles), A3 ntrA (black diamonds) and A3 hk2 (open circles) following a temperature shift from 23°C to 34°C. F. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 following an increase in growth temperature from 23°C to 34°C. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Time points are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).
    Figure Legend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) grown at 23°C and following a temperature shift to 34°C, and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. B. QRT-PCR analysis of ospC following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. E. Growth curves of B31-A3 (grey triangles), A3 ntrA (black diamonds) and A3 hk2 (open circles) following a temperature shift from 23°C to 34°C. F. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 following an increase in growth temperature from 23°C to 34°C. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Time points are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Techniques Used: Quantitative RT-PCR, Standard Deviation

    Quantitative RT-PCR analysis of rpoS and ospC transcripts following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (low-passage, white bars) and B31-A (high-passage, black bars) grown at 23°C, and at various time points following a temperature shift to 34°C. Levels of transcripts were measured with specific primer/probe sets using Taqman, and values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Fold changes are expressed relative to spirochetes grown at 23°C. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. B. QRT-PCR analysis of ospC following a temperature shift. C. Growth curves of B31-A3 (white squares) and B31-A (black triangles) following a temperature shift from 23 to 34°C.
    Figure Legend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (low-passage, white bars) and B31-A (high-passage, black bars) grown at 23°C, and at various time points following a temperature shift to 34°C. Levels of transcripts were measured with specific primer/probe sets using Taqman, and values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Fold changes are expressed relative to spirochetes grown at 23°C. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. B. QRT-PCR analysis of ospC following a temperature shift. C. Growth curves of B31-A3 (white squares) and B31-A (black triangles) following a temperature shift from 23 to 34°C.

    Techniques Used: Quantitative RT-PCR, Standard Deviation

    20) Product Images from "Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites"

    Article Title: Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2016.00162

    Southern blot analysis to detect the presence of DNA satellites in a sweepovirus-infected sweet potato sample (B3). Total DNA (∼1 μg) was separated on 0.8% agarose gel electrophoresis in TAE, transferred to a positively charged nylon membrane and hybridized with digoxigenin-labeled probes synthesized by PCR from clone SBG53 (satellite, left panel) and the sweet potato leaf curl virus (SPLCV) isolate present in that sample (virus, right panel). Total DNA was digested (right part of each panel) with a restriction enzyme which recognizes a unique site in the satellite ( Pst I) and SPLCV ( Bam HI). The positions of open circular (oc), supercoiled (sc), and single-stranded (ss) DNA forms are indicated with black arrowheads. The positions of linear (lin) DNA forms are indicated with white arrowheads. Mobility of the size marker (1 kb DNA ladder) is given in the right margin.
    Figure Legend Snippet: Southern blot analysis to detect the presence of DNA satellites in a sweepovirus-infected sweet potato sample (B3). Total DNA (∼1 μg) was separated on 0.8% agarose gel electrophoresis in TAE, transferred to a positively charged nylon membrane and hybridized with digoxigenin-labeled probes synthesized by PCR from clone SBG53 (satellite, left panel) and the sweet potato leaf curl virus (SPLCV) isolate present in that sample (virus, right panel). Total DNA was digested (right part of each panel) with a restriction enzyme which recognizes a unique site in the satellite ( Pst I) and SPLCV ( Bam HI). The positions of open circular (oc), supercoiled (sc), and single-stranded (ss) DNA forms are indicated with black arrowheads. The positions of linear (lin) DNA forms are indicated with white arrowheads. Mobility of the size marker (1 kb DNA ladder) is given in the right margin.

    Techniques Used: Southern Blot, Infection, Agarose Gel Electrophoresis, Labeling, Synthesized, Polymerase Chain Reaction, Marker

    21) Product Images from "Stoichiometry of Base Excision Repair Proteins Correlates with Increased Somatic CAG Instability in Striatum over Cerebellum in Huntington's Disease Transgenic Mice"

    Article Title: Stoichiometry of Base Excision Repair Proteins Correlates with Increased Somatic CAG Instability in Striatum over Cerebellum in Huntington's Disease Transgenic Mice

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1000749

    POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative DNA concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative PCR. Error bars are sem.
    Figure Legend Snippet: POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative DNA concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative PCR. Error bars are sem.

    Techniques Used: Mouse Assay, Chromatin Immunoprecipitation, Concentration Assay, Real-time Polymerase Chain Reaction

    22) Product Images from "Differences in Innate Immune Responses (In Vitro) to HeLa Cells Infected with Nondisseminating Serovar E and Disseminating Serovar L2 of Chlamydia trachomatis"

    Article Title: Differences in Innate Immune Responses (In Vitro) to HeLa Cells Infected with Nondisseminating Serovar E and Disseminating Serovar L2 of Chlamydia trachomatis

    Journal: Infection and Immunity

    doi: 10.1128/IAI.70.6.3234-3248.2002

    RT-PCR analysis of IDO mRNA expression in dTHP-1 cells and MdM stimulated for 24 h with C. trachomatis -infected HeLa cell supernatants and in dTHP-1 cells cocultivated with infected HeLa cells for 24 and 48 h. The cDNAs were amplified with IDO (324 bp, top panel) and GAPDH (306 bp, bottom panel) primers for 35 and 22 PCR cycles, respectively. A total of 10 μl of PCR products was loaded on a 2% agarose gel as follows. dTHP-1 cells and MdM were incubated with supernatants from HeLa cells left uninfected (lanes 1 and 6, respectively), infected with serovar E (lanes 2 and 7, respectively) or serovar L2 (lanes 3 and 8, respectively), treated with RPMI alone (lanes 4 and 9, respectively) or E. coli LPS alone (lanes 5 and 10, respectively), or dTHP-1 cells were incubated in coculture for 24 and 48 h with uninfected HeLa cells (lanes 11 and 14, respectively), with serovar E-infected HeLa cells (lanes 12 and 15, respectively), or with serovar L2-infected HeLa cells (lanes 13 and 16, respectively). A negative control for amplification (lane 17) wherein DNA was omitted and a positive control (lane 18) consisting of cDNA from HeLa cells exposed to rhIFN-γ (10 ng/ml for 12 h) were also included in the analysis.
    Figure Legend Snippet: RT-PCR analysis of IDO mRNA expression in dTHP-1 cells and MdM stimulated for 24 h with C. trachomatis -infected HeLa cell supernatants and in dTHP-1 cells cocultivated with infected HeLa cells for 24 and 48 h. The cDNAs were amplified with IDO (324 bp, top panel) and GAPDH (306 bp, bottom panel) primers for 35 and 22 PCR cycles, respectively. A total of 10 μl of PCR products was loaded on a 2% agarose gel as follows. dTHP-1 cells and MdM were incubated with supernatants from HeLa cells left uninfected (lanes 1 and 6, respectively), infected with serovar E (lanes 2 and 7, respectively) or serovar L2 (lanes 3 and 8, respectively), treated with RPMI alone (lanes 4 and 9, respectively) or E. coli LPS alone (lanes 5 and 10, respectively), or dTHP-1 cells were incubated in coculture for 24 and 48 h with uninfected HeLa cells (lanes 11 and 14, respectively), with serovar E-infected HeLa cells (lanes 12 and 15, respectively), or with serovar L2-infected HeLa cells (lanes 13 and 16, respectively). A negative control for amplification (lane 17) wherein DNA was omitted and a positive control (lane 18) consisting of cDNA from HeLa cells exposed to rhIFN-γ (10 ng/ml for 12 h) were also included in the analysis.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Infection, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Incubation, Negative Control, Positive Control

    23) Product Images from "Differences in Innate Immune Responses (In Vitro) to HeLa Cells Infected with Nondisseminating Serovar E and Disseminating Serovar L2 of Chlamydia trachomatis"

    Article Title: Differences in Innate Immune Responses (In Vitro) to HeLa Cells Infected with Nondisseminating Serovar E and Disseminating Serovar L2 of Chlamydia trachomatis

    Journal: Infection and Immunity

    doi: 10.1128/IAI.70.6.3234-3248.2002

    RT-PCR analysis of IDO mRNA expression in dTHP-1 cells and MdM stimulated for 24 h with C. trachomatis -infected HeLa cell supernatants and in dTHP-1 cells cocultivated with infected HeLa cells for 24 and 48 h. The cDNAs were amplified with IDO (324 bp, top panel) and GAPDH (306 bp, bottom panel) primers for 35 and 22 PCR cycles, respectively. A total of 10 μl of PCR products was loaded on a 2% agarose gel as follows. dTHP-1 cells and MdM were incubated with supernatants from HeLa cells left uninfected (lanes 1 and 6, respectively), infected with serovar E (lanes 2 and 7, respectively) or serovar L2 (lanes 3 and 8, respectively), treated with RPMI alone (lanes 4 and 9, respectively) or E. coli LPS alone (lanes 5 and 10, respectively), or dTHP-1 cells were incubated in coculture for 24 and 48 h with uninfected HeLa cells (lanes 11 and 14, respectively), with serovar E-infected HeLa cells (lanes 12 and 15, respectively), or with serovar L2-infected HeLa cells (lanes 13 and 16, respectively). A negative control for amplification (lane 17) wherein DNA was omitted and a positive control (lane 18) consisting of cDNA from HeLa cells exposed to rhIFN-γ (10 ng/ml for 12 h) were also included in the analysis.
    Figure Legend Snippet: RT-PCR analysis of IDO mRNA expression in dTHP-1 cells and MdM stimulated for 24 h with C. trachomatis -infected HeLa cell supernatants and in dTHP-1 cells cocultivated with infected HeLa cells for 24 and 48 h. The cDNAs were amplified with IDO (324 bp, top panel) and GAPDH (306 bp, bottom panel) primers for 35 and 22 PCR cycles, respectively. A total of 10 μl of PCR products was loaded on a 2% agarose gel as follows. dTHP-1 cells and MdM were incubated with supernatants from HeLa cells left uninfected (lanes 1 and 6, respectively), infected with serovar E (lanes 2 and 7, respectively) or serovar L2 (lanes 3 and 8, respectively), treated with RPMI alone (lanes 4 and 9, respectively) or E. coli LPS alone (lanes 5 and 10, respectively), or dTHP-1 cells were incubated in coculture for 24 and 48 h with uninfected HeLa cells (lanes 11 and 14, respectively), with serovar E-infected HeLa cells (lanes 12 and 15, respectively), or with serovar L2-infected HeLa cells (lanes 13 and 16, respectively). A negative control for amplification (lane 17) wherein DNA was omitted and a positive control (lane 18) consisting of cDNA from HeLa cells exposed to rhIFN-γ (10 ng/ml for 12 h) were also included in the analysis.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Infection, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Incubation, Negative Control, Positive Control

    24) Product Images from "Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia"

    Article Title: Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

    Journal: The Journal of molecular diagnostics : JMD

    doi: 10.2353/jmoldx.2006.060089

    Sensitivity of AS-PCR for D816V in paraffin-derived DNA. DNA was extracted from formalin-fixed, paraffin-embedded seminoma heterozygous for KIT D816V (50% mutant allele by denaturing HPLC and direct sequencing) and was diluted with increasing amounts
    Figure Legend Snippet: Sensitivity of AS-PCR for D816V in paraffin-derived DNA. DNA was extracted from formalin-fixed, paraffin-embedded seminoma heterozygous for KIT D816V (50% mutant allele by denaturing HPLC and direct sequencing) and was diluted with increasing amounts

    Techniques Used: Polymerase Chain Reaction, Derivative Assay, Formalin-fixed Paraffin-Embedded, Mutagenesis, High Performance Liquid Chromatography, Sequencing

    25) Product Images from "Identification and Localization of the Cyclic Nucleotide Phosphodiesterase 10A in Bovine Testis and Mature Spermatozoa"

    Article Title: Identification and Localization of the Cyclic Nucleotide Phosphodiesterase 10A in Bovine Testis and Mature Spermatozoa

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0161035

    5’-RACE of cDNA encoding PDE10A in bull testis. Total RNA isolated from bull testes was reverse transcribed and processed for 5’-RACE as described in Materials Methods. The size of the amplified products was visualized after electrophoresis on an agarose gel. Three major amplicons of ≈1100, 700 and 450 bp were obtained. The position of the 1000 and 500 bp standards is indicated on the left. Similar results were obtained with RNA isolated from the testes of 3 different bulls.
    Figure Legend Snippet: 5’-RACE of cDNA encoding PDE10A in bull testis. Total RNA isolated from bull testes was reverse transcribed and processed for 5’-RACE as described in Materials Methods. The size of the amplified products was visualized after electrophoresis on an agarose gel. Three major amplicons of ≈1100, 700 and 450 bp were obtained. The position of the 1000 and 500 bp standards is indicated on the left. Similar results were obtained with RNA isolated from the testes of 3 different bulls.

    Techniques Used: Isolation, Amplification, Electrophoresis, Agarose Gel Electrophoresis

    3’-RACE of cDNA encoding PDE10A in bull testis. Total RNA isolated from bull testes was reverse transcribed and processed for 3’-RACE as described in Materials Methods. The size of the amplified products was visualized after electrophoresis on an agarose gel. The results showing one major amplicon of ≈1500 bp were obtained with 2 different bulls. The position of 500, 1000, 1500 and 3000 bp is indicated on the left. Similar results were obtained using RNA from the testis of another bull.
    Figure Legend Snippet: 3’-RACE of cDNA encoding PDE10A in bull testis. Total RNA isolated from bull testes was reverse transcribed and processed for 3’-RACE as described in Materials Methods. The size of the amplified products was visualized after electrophoresis on an agarose gel. The results showing one major amplicon of ≈1500 bp were obtained with 2 different bulls. The position of 500, 1000, 1500 and 3000 bp is indicated on the left. Similar results were obtained using RNA from the testis of another bull.

    Techniques Used: Isolation, Amplification, Electrophoresis, Agarose Gel Electrophoresis

    26) Product Images from "Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms"

    Article Title: Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki199

    Secondary structure models for mtP-RNAs from R.oryzae , R.stolonifer 194667, R.oligosporus , R.spectabilis , M.mucedo , S.culisetae and M.verticillata . Positions in red are invariant in the minimum bacterial consensus ( 32 ); uppercase letters in the mtP-RNAs indicate 100%, lowercase 90%, conservation of the minimum bacterial consensus sequence. The arrows pinpoint experimentally determined termini; arrow length is proportional to the percentage of molecules ending at a defined position. Double hairpin elements are named in green. The few nucleotides colored blue in the R.stolonifer mtP-RNA model are different in its close relative R.oryzae .
    Figure Legend Snippet: Secondary structure models for mtP-RNAs from R.oryzae , R.stolonifer 194667, R.oligosporus , R.spectabilis , M.mucedo , S.culisetae and M.verticillata . Positions in red are invariant in the minimum bacterial consensus ( 32 ); uppercase letters in the mtP-RNAs indicate 100%, lowercase 90%, conservation of the minimum bacterial consensus sequence. The arrows pinpoint experimentally determined termini; arrow length is proportional to the percentage of molecules ending at a defined position. Double hairpin elements are named in green. The few nucleotides colored blue in the R.stolonifer mtP-RNA model are different in its close relative R.oryzae .

    Techniques Used: Sequencing

    27) Product Images from "The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]"

    Article Title: The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.110.080788

    MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.

    Techniques Used:

    Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.
    Figure Legend Snippet: Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.

    Techniques Used: Binding Assay, In Vitro

    MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.

    Techniques Used:

    Tissue Expression Patterns of MYC3 and MYC4 .
    Figure Legend Snippet: Tissue Expression Patterns of MYC3 and MYC4 .

    Techniques Used: Expressing

    28) Product Images from "Pax3 regulation of FGF signaling affects the progression of embryonic progenitor cells into the myogenic program"

    Article Title: Pax3 regulation of FGF signaling affects the progression of embryonic progenitor cells into the myogenic program

    Journal: Genes & Development

    doi: 10.1101/gad.477908

    Identification of an in vivo Pax3-binding site in the Fgfr4 locus. ( A ) X-Gal staining at E11.5 of a P34 transgenic embryo in which nlacZ expression is regulated by five consensus Pax3-binding sites ( Pax3 ) 5 - tk-nlacZ . The tissue used for ChIP is outlined. ( B ) Real-time quantitative PCR using primers (targets) for the P34 Pax3-binding sites, a functional Pax3 site at −57.5 kb from Myf5 , a control Myf5 flanking sequence, a control Albumin sequence, and the Fgfr4 +19.2-kb sequence, containing sites P4/P5 identified by Chip-chip. Results are expressed as a percentage of input showing enrichment after Pax3 immunoprecipitation, with the serum control subtracted. ( C ) Results of the tiling arrays for Pax3 and for serum controls within the 3′ part of the Fgfr4 locus. Fgfr4 exons are indicated as black boxes. The region of strong Pax3 hybridization signal is outlined. ( D ) The nucleotide sequence of the Fgfr4 (+18,832 to +19,391 bp) distal element in mouse and comparison with a homologous region of the rat, human, and cow genomes, with conserved bases indicated on a gray background. Six putative Pax3 binding sites (P1–P6) are framed in red. E-box consensus sequences for myogenic regulatory factors are also indicated in blue (E1–E4). ( E ) Gel shift mobility assays for Pax3 binding, using a reticulocyte lysate without (lane 1 ) or with (lane 2-9 ) Pax3 protein. A labeled oligonucleotide (30 bp) containing a consensus Pax3 site of the P34 transgene (lanes 1 , 2 ) or an oligonucleotide (60 bp) from the Fgfr4 (559 bp) sequence containing sites P4 and P5 (lanes 3–9 ) shows Pax3 binding ( 3,8,9 ). Lanes 4–9 show competition experiments with 50-fold (lane 4 ) or 150-fold (lane 5 ) excess of wild-type sequence (P4/P5), with this sequence with P5 mutated (P4/P5M) (lanes 6 , 7 ) or with P4 and P5 mutated (P4M/P5M) (lanes 8 , 9 ).
    Figure Legend Snippet: Identification of an in vivo Pax3-binding site in the Fgfr4 locus. ( A ) X-Gal staining at E11.5 of a P34 transgenic embryo in which nlacZ expression is regulated by five consensus Pax3-binding sites ( Pax3 ) 5 - tk-nlacZ . The tissue used for ChIP is outlined. ( B ) Real-time quantitative PCR using primers (targets) for the P34 Pax3-binding sites, a functional Pax3 site at −57.5 kb from Myf5 , a control Myf5 flanking sequence, a control Albumin sequence, and the Fgfr4 +19.2-kb sequence, containing sites P4/P5 identified by Chip-chip. Results are expressed as a percentage of input showing enrichment after Pax3 immunoprecipitation, with the serum control subtracted. ( C ) Results of the tiling arrays for Pax3 and for serum controls within the 3′ part of the Fgfr4 locus. Fgfr4 exons are indicated as black boxes. The region of strong Pax3 hybridization signal is outlined. ( D ) The nucleotide sequence of the Fgfr4 (+18,832 to +19,391 bp) distal element in mouse and comparison with a homologous region of the rat, human, and cow genomes, with conserved bases indicated on a gray background. Six putative Pax3 binding sites (P1–P6) are framed in red. E-box consensus sequences for myogenic regulatory factors are also indicated in blue (E1–E4). ( E ) Gel shift mobility assays for Pax3 binding, using a reticulocyte lysate without (lane 1 ) or with (lane 2-9 ) Pax3 protein. A labeled oligonucleotide (30 bp) containing a consensus Pax3 site of the P34 transgene (lanes 1 , 2 ) or an oligonucleotide (60 bp) from the Fgfr4 (559 bp) sequence containing sites P4 and P5 (lanes 3–9 ) shows Pax3 binding ( 3,8,9 ). Lanes 4–9 show competition experiments with 50-fold (lane 4 ) or 150-fold (lane 5 ) excess of wild-type sequence (P4/P5), with this sequence with P5 mutated (P4/P5M) (lanes 6 , 7 ) or with P4 and P5 mutated (P4M/P5M) (lanes 8 , 9 ).

    Techniques Used: In Vivo, Binding Assay, Staining, Transgenic Assay, Expressing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Functional Assay, Sequencing, Immunoprecipitation, Hybridization, Electrophoretic Mobility Shift Assay, Labeling

    The Fgfr4 distal element directs Pax3-dependent myogenic expression in vivo. ( A , B ) Whole-mount in situ hybridization for Fgfr4 transcripts on embryos at the stages indicated. ( C–F ) X-Gal staining of transient transgenic embryos in which a tk-nlacZ transgene is under the control of the wild-type ( C , D ) Fgfr4 distal element (559 bp) or this element with the six Pax3 sites, mutated ( E , F ). ( G , H ) Coimmunohistochemistry on DAPI-stained transverse sections in the myotome at interlimb level of E10.5 embryos, showing Fgfr4 (green) and DAPI staining ( G ) and Fgfr4 (green) and Pax3 (red) staining ( H ). Insert in H represents a higher magnification of the region outlined in G and H . Examples of colocalization where the plane of section includes a nucleus showing Pax3 staining are indicated by arrowheads. Arrows indicate dorsally located Pax3 + cells. ( I , J ) Coimmunohistochemistry on DAPI-stained sections ( I ) at trunk level of an E11.5 Fgfr4(559bp)-tk-nlacZ transgenic embryo using antibodies to Fgfr4 (green) ( I,J ) and to nuclear β-Gal (red) ( J ). Arrowheads as for H . ( K , L ) Coimmunohistochemistry on transverse sections at interlimb level on an E11.5 ( K ) or E10.5 ( L ) Fgfr4(559bp)-tk-nlacZ transgenic embryo showing expression of Pax3 (red) and β-Gal (green). ( M , N ) Sections of the forelimb (FL) at E11.5 ( M ) or E10.5 ( N ) similarly stained for Pax3 and β-Gal. Arrows point to nuclear coexpression.
    Figure Legend Snippet: The Fgfr4 distal element directs Pax3-dependent myogenic expression in vivo. ( A , B ) Whole-mount in situ hybridization for Fgfr4 transcripts on embryos at the stages indicated. ( C–F ) X-Gal staining of transient transgenic embryos in which a tk-nlacZ transgene is under the control of the wild-type ( C , D ) Fgfr4 distal element (559 bp) or this element with the six Pax3 sites, mutated ( E , F ). ( G , H ) Coimmunohistochemistry on DAPI-stained transverse sections in the myotome at interlimb level of E10.5 embryos, showing Fgfr4 (green) and DAPI staining ( G ) and Fgfr4 (green) and Pax3 (red) staining ( H ). Insert in H represents a higher magnification of the region outlined in G and H . Examples of colocalization where the plane of section includes a nucleus showing Pax3 staining are indicated by arrowheads. Arrows indicate dorsally located Pax3 + cells. ( I , J ) Coimmunohistochemistry on DAPI-stained sections ( I ) at trunk level of an E11.5 Fgfr4(559bp)-tk-nlacZ transgenic embryo using antibodies to Fgfr4 (green) ( I,J ) and to nuclear β-Gal (red) ( J ). Arrowheads as for H . ( K , L ) Coimmunohistochemistry on transverse sections at interlimb level on an E11.5 ( K ) or E10.5 ( L ) Fgfr4(559bp)-tk-nlacZ transgenic embryo showing expression of Pax3 (red) and β-Gal (green). ( M , N ) Sections of the forelimb (FL) at E11.5 ( M ) or E10.5 ( N ) similarly stained for Pax3 and β-Gal. Arrows point to nuclear coexpression.

    Techniques Used: Expressing, In Vivo, In Situ Hybridization, Staining, Transgenic Assay

    Potential myogenic factor regulation of the Fgfr4 element. ( A , B ) Control embryos expressing the Fgfr4(559bp)-tk-nlacZ transgene at E11.75 ( A ) and E12.5 ( B ). ( C , D ) Embryos expressing this transgene with the four E-boxes mutated at E11.75 ( C ) and E12.5 ( D ). ( E , F ) Coimmunohistochemistry on DAPI-stained transverse sections of Fgfr4(559bp)-tk-nlacZ transgenic embryos at E11.5 in the interlimb region (Trunk) ( E ) and forelimb (Limb) ( F ) using antibodies to MyoD (red) and β-Gal (green). Arrowheads point to examples of colocalization.
    Figure Legend Snippet: Potential myogenic factor regulation of the Fgfr4 element. ( A , B ) Control embryos expressing the Fgfr4(559bp)-tk-nlacZ transgene at E11.75 ( A ) and E12.5 ( B ). ( C , D ) Embryos expressing this transgene with the four E-boxes mutated at E11.75 ( C ) and E12.5 ( D ). ( E , F ) Coimmunohistochemistry on DAPI-stained transverse sections of Fgfr4(559bp)-tk-nlacZ transgenic embryos at E11.5 in the interlimb region (Trunk) ( E ) and forelimb (Limb) ( F ) using antibodies to MyoD (red) and β-Gal (green). Arrowheads point to examples of colocalization.

    Techniques Used: Expressing, Staining, Transgenic Assay

    29) Product Images from "The Latency-Associated Nuclear Antigen Homolog of Herpesvirus Saimiri Inhibits Lytic Virus Replication †"

    Article Title: The Latency-Associated Nuclear Antigen Homolog of Herpesvirus Saimiri Inhibits Lytic Virus Replication †

    Journal: Journal of Virology

    doi: 10.1128/JVI.77.10.5911-5925.2003

    ORF73 domains necessary for the transactivation of the ORF50B promoter. (A) Graphical representation of the ORF73 deletion mutants used in this experiment. (B) The subcellular localization of each ORF73 deletion mutant was determined in OMK cells that were grown and transfected in chamber slides with the respective expression constructs according to panel A (1 μg): pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), and pcDNA-HA73MHd15 (ORF73d15). Cells were fixed 24 h later and stained for expression of the HA-tagged proteins as described in the text. (C) Transcriptional activity of the ORF73 deletion mutants of the ORF50B promoter. OMK cells were cotransfected with 0.5 μg of luciferase reporter plasmid pGL3-ORF50B and with 1 μg of expression constructs for either pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), or pcDNA-HA73MHd15 (ORF73d15). Equal amounts of cell lysates were assayed for luciferase activity after 24 h, and values were normalized to that obtained with pGL3-Basic alone. The black and gray bars indicate the relative activities of the ORF50B and pGL3-Basic promoter in the presence of the respective pcDNA-HA73MH constructs and pcDNA-HA-MH control. The mean values obtained from three independent experiments, again performed in triplicate, are shown.
    Figure Legend Snippet: ORF73 domains necessary for the transactivation of the ORF50B promoter. (A) Graphical representation of the ORF73 deletion mutants used in this experiment. (B) The subcellular localization of each ORF73 deletion mutant was determined in OMK cells that were grown and transfected in chamber slides with the respective expression constructs according to panel A (1 μg): pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), and pcDNA-HA73MHd15 (ORF73d15). Cells were fixed 24 h later and stained for expression of the HA-tagged proteins as described in the text. (C) Transcriptional activity of the ORF73 deletion mutants of the ORF50B promoter. OMK cells were cotransfected with 0.5 μg of luciferase reporter plasmid pGL3-ORF50B and with 1 μg of expression constructs for either pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), or pcDNA-HA73MHd15 (ORF73d15). Equal amounts of cell lysates were assayed for luciferase activity after 24 h, and values were normalized to that obtained with pGL3-Basic alone. The black and gray bars indicate the relative activities of the ORF50B and pGL3-Basic promoter in the presence of the respective pcDNA-HA73MH constructs and pcDNA-HA-MH control. The mean values obtained from three independent experiments, again performed in triplicate, are shown.

    Techniques Used: Mutagenesis, Transfection, Expressing, Construct, Negative Control, Staining, Activity Assay, Luciferase, Plasmid Preparation

    30) Product Images from "The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]"

    Article Title: The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses [C] [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.110.080788

    MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Pull-Down Experiments.

    Techniques Used:

    Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.
    Figure Legend Snippet: Identification of MYC2, MYC3, and MYC4 DNA Binding Motifs in Vitro.

    Techniques Used: Binding Assay, In Vitro

    MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.
    Figure Legend Snippet: MYC3 and MYC4 Interact with JAZ Repressors in Yeast Two-Hybrid Assays.

    Techniques Used:

    Tissue Expression Patterns of MYC3 and MYC4 .
    Figure Legend Snippet: Tissue Expression Patterns of MYC3 and MYC4 .

    Techniques Used: Expressing

    31) Product Images from "Regulation of human heme oxygenase in endothelial cells by using sense and antisense retroviral constructs"

    Article Title: Regulation of human heme oxygenase in endothelial cells by using sense and antisense retroviral constructs

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.211399398

    PCR analysis of the genomic DNA extracted from HMEC-1 cells nontransduced or transduced with various retroviral vectors. Different combinations of primers were used to amplify HHO-1, neo r , or chimeric vector/HHO-1 DNA fragments. P1 and P2, primers for amplifying LXSN vector sequence; P3 and P4, primers for neo r gene; P5 and P6, primers for HHO-1 DNA fragment. The combination of P1 and P5 for HHO-1-AS-transduced HMEC-1 cells (HMEC/HOP-HHO-1-AS) detected a 2,441-bp signal that contains partial vector sequence, HOP, and a partial HHO-1-AS DNA fragment. Similarly, a 2,260-bp PCR product containing partial vector sequence, HOP, and a partial HHO-1 gene fragment was amplified from HHO-1-transduced cells (HMEC/HOP-HHO-1) when primers P1 and P6 were used. The primers P1 and P2 amplified a 1,661-bp PCR product from control vector (LSN-HOP)-transduced HMEC-1 cells (HMEC/HOP). The 313-bp neo r DNA fragments were detected in all three kinds of cells mentioned above by using primers P3 and P4.
    Figure Legend Snippet: PCR analysis of the genomic DNA extracted from HMEC-1 cells nontransduced or transduced with various retroviral vectors. Different combinations of primers were used to amplify HHO-1, neo r , or chimeric vector/HHO-1 DNA fragments. P1 and P2, primers for amplifying LXSN vector sequence; P3 and P4, primers for neo r gene; P5 and P6, primers for HHO-1 DNA fragment. The combination of P1 and P5 for HHO-1-AS-transduced HMEC-1 cells (HMEC/HOP-HHO-1-AS) detected a 2,441-bp signal that contains partial vector sequence, HOP, and a partial HHO-1-AS DNA fragment. Similarly, a 2,260-bp PCR product containing partial vector sequence, HOP, and a partial HHO-1 gene fragment was amplified from HHO-1-transduced cells (HMEC/HOP-HHO-1) when primers P1 and P6 were used. The primers P1 and P2 amplified a 1,661-bp PCR product from control vector (LSN-HOP)-transduced HMEC-1 cells (HMEC/HOP). The 313-bp neo r DNA fragments were detected in all three kinds of cells mentioned above by using primers P3 and P4.

    Techniques Used: Polymerase Chain Reaction, Transduction, Plasmid Preparation, Sequencing, Amplification

    ( A ) Northern blot analysis of RNA obtained from PA317 and NIH 3T3 cells nontransduced or transduced with retroviral vector LSN-HHO-1 or LXSN. Lanes 1 and 2, PA317/HHO-1 cells; lane 3, control PA317 retroviral packaging cells; lane 4, PA317/LXSN cells; lane 5, NIH 3T3/LXSN cells; lanes 6 and 7, NIH 3T3/HHO-1 cells; lane 8, control NIH 3T3 cells. ( B ) Reverse transcription (RT)-PCR analysis of PT67 retroviral packaging cells transduced with different retroviral vectors. Lanes 1 and 6, PT67 cells; lanes 2 and 7, PT67/LXSN cells; lanes 3 and 8, PT67/LSN-HOP cells; lanes 4 and 9, PT67/LSN-HOP-HHO-1 cells; Lanes 5 and 10, PT67/LSN-HOP-HHO-1-AS cells. m, Hin dIII-digested λ DNA marker; M, 100-bp DNA ruler; neo r , RT-PCR products of neomycin-resistance gene; HO-1, human HO-1 RT-PCR products. ( C ) Detection of human (h)HO-1 and G3PDH transcripts by Northern blot analysis in RLMV cells transduced with retroviral vectors LSN-HHO-1 or LXSN. Lanes 1, 2, and 5, RLMV cells transduced with LSN-HHO-1; lane 3, control RLMV cells; lane 4, RLMV cells transduced with LXSN.
    Figure Legend Snippet: ( A ) Northern blot analysis of RNA obtained from PA317 and NIH 3T3 cells nontransduced or transduced with retroviral vector LSN-HHO-1 or LXSN. Lanes 1 and 2, PA317/HHO-1 cells; lane 3, control PA317 retroviral packaging cells; lane 4, PA317/LXSN cells; lane 5, NIH 3T3/LXSN cells; lanes 6 and 7, NIH 3T3/HHO-1 cells; lane 8, control NIH 3T3 cells. ( B ) Reverse transcription (RT)-PCR analysis of PT67 retroviral packaging cells transduced with different retroviral vectors. Lanes 1 and 6, PT67 cells; lanes 2 and 7, PT67/LXSN cells; lanes 3 and 8, PT67/LSN-HOP cells; lanes 4 and 9, PT67/LSN-HOP-HHO-1 cells; Lanes 5 and 10, PT67/LSN-HOP-HHO-1-AS cells. m, Hin dIII-digested λ DNA marker; M, 100-bp DNA ruler; neo r , RT-PCR products of neomycin-resistance gene; HO-1, human HO-1 RT-PCR products. ( C ) Detection of human (h)HO-1 and G3PDH transcripts by Northern blot analysis in RLMV cells transduced with retroviral vectors LSN-HHO-1 or LXSN. Lanes 1, 2, and 5, RLMV cells transduced with LSN-HHO-1; lane 3, control RLMV cells; lane 4, RLMV cells transduced with LXSN.

    Techniques Used: Northern Blot, Transduction, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Marker

    32) Product Images from "Role of the Vpe Carbohydrate Permease in Escherichia coli Urovirulence and Fitness In Vivo"

    Article Title: Role of the Vpe Carbohydrate Permease in Escherichia coli Urovirulence and Fitness In Vivo

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00457-12

    Competitive colonization of the urinary tract (UT) by AL511 and AL511 vpeBC . Two independent colonization experiments were performed on a total of 24 mice displaying UT colonization in the bladder 4 days after the simultaneous administration of the two
    Figure Legend Snippet: Competitive colonization of the urinary tract (UT) by AL511 and AL511 vpeBC . Two independent colonization experiments were performed on a total of 24 mice displaying UT colonization in the bladder 4 days after the simultaneous administration of the two

    Techniques Used: Mouse Assay

    Competitive colonization of the mouse intestine by AL511 and AL511 vpeBC . Two independent colonization experiments were performed. Eleven mice had intestinal colonization 1 day after the simultaneous administration of the two strains (1:1 ratio) by oral
    Figure Legend Snippet: Competitive colonization of the mouse intestine by AL511 and AL511 vpeBC . Two independent colonization experiments were performed. Eleven mice had intestinal colonization 1 day after the simultaneous administration of the two strains (1:1 ratio) by oral

    Techniques Used: Mouse Assay

    Survival of independent AL511 vpeBC mutants in coculture experiments. The parental AL511 strain and the AL511 vpeBC mutant were cocultured in both LB broth (A) and human urine (B) for 2 weeks. The mutant was outcompeted by the wild-type strain only in
    Figure Legend Snippet: Survival of independent AL511 vpeBC mutants in coculture experiments. The parental AL511 strain and the AL511 vpeBC mutant were cocultured in both LB broth (A) and human urine (B) for 2 weeks. The mutant was outcompeted by the wild-type strain only in

    Techniques Used: Mutagenesis

    33) Product Images from "Mechanisms of Zoonotic Severe Acute Respiratory Syndrome Coronavirus Host Range Expansion in Human Airway Epithelium ▿"

    Article Title: Mechanisms of Zoonotic Severe Acute Respiratory Syndrome Coronavirus Host Range Expansion in Human Airway Epithelium ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02041-07

    Growth curve analysis of the mutant virus panel in HAE, Vero E6, DBT-hACE2, and DBT cells. (A) HAE cell cultures were infected with 4.4 × 10 4 PFU/200 μl of the indicated viruses for 2 h at 37°C. The inoculum was removed, and the apical surfaces were rinsed with DPBS. Apical-surface washes were performed at 0, 6, 12, 24, 36, 48, and 72 hpi. Virus titers were assessed for Vero E6 cells by a standard plaque assay. (B to D) Vero E6, DBT-hACE2, and DBT cells (respectively) were infected with the indicated viruses at an MOI of 0.01 for 1 h at 37°C. The inoculum was removed, cultures were rinsed with DPBS, and growth medium was added. The medium was sampled at 0, 6, 12, 24, and 36 hpi, and virus titer was assessed by plaque assay on Vero E6 cells. The data presented are representative of two separate experiments.
    Figure Legend Snippet: Growth curve analysis of the mutant virus panel in HAE, Vero E6, DBT-hACE2, and DBT cells. (A) HAE cell cultures were infected with 4.4 × 10 4 PFU/200 μl of the indicated viruses for 2 h at 37°C. The inoculum was removed, and the apical surfaces were rinsed with DPBS. Apical-surface washes were performed at 0, 6, 12, 24, 36, 48, and 72 hpi. Virus titers were assessed for Vero E6 cells by a standard plaque assay. (B to D) Vero E6, DBT-hACE2, and DBT cells (respectively) were infected with the indicated viruses at an MOI of 0.01 for 1 h at 37°C. The inoculum was removed, cultures were rinsed with DPBS, and growth medium was added. The medium was sampled at 0, 6, 12, 24, and 36 hpi, and virus titer was assessed by plaque assay on Vero E6 cells. The data presented are representative of two separate experiments.

    Techniques Used: Mutagenesis, Infection, Plaque Assay

    Rosetta Design modeling of “evolved” mutations that enhance spike protein binding to ACE2. Rosetta Design was used to generate structural models of SZ16 and mutant RBDs that were then superimposed onto the existing crystal structure of the SARS Urbani RBD bound to ACE2. (A) Epidemic strain and hACE2 RBD architecture. (B) SZ16 and hACE2 interaction is inhibited by steric clashing, shown as red dots, of K479 of S and residues K31 and H34 of hACE2. (C) Electrostatic repulsion at residue 479 is eradicated, allowing S and ACE2 binding, but local remodeling within the RBD due to hydrogen bonding differences at residue 487 creates cross-reactions whereby residues 442 and 479 of K479N compete with each other for interaction partners H34, K31, and D32 of hACE2. (D) The Y442F mutation of icSZ16-S K479N D8 restores an optimal RBD, allowing for favorable packing to create an architecture similar to that of the wild type. (E) Leucine 472 of the icSZ16-S K479N and icSZ16-S K479N D8 S interacts with L79 and M82 of ACE2. The icSZ16-S K479N D22 L472F mutation is predicted to have hydrophobic interactions with three potential partners, L79, M82, and Y83, of hACE2 that will increase the stability of the binding. Green dots on hACE2 indicate residues which are within 4 angstroms and thus are predicted to interact with the S residues shown in red.
    Figure Legend Snippet: Rosetta Design modeling of “evolved” mutations that enhance spike protein binding to ACE2. Rosetta Design was used to generate structural models of SZ16 and mutant RBDs that were then superimposed onto the existing crystal structure of the SARS Urbani RBD bound to ACE2. (A) Epidemic strain and hACE2 RBD architecture. (B) SZ16 and hACE2 interaction is inhibited by steric clashing, shown as red dots, of K479 of S and residues K31 and H34 of hACE2. (C) Electrostatic repulsion at residue 479 is eradicated, allowing S and ACE2 binding, but local remodeling within the RBD due to hydrogen bonding differences at residue 487 creates cross-reactions whereby residues 442 and 479 of K479N compete with each other for interaction partners H34, K31, and D32 of hACE2. (D) The Y442F mutation of icSZ16-S K479N D8 restores an optimal RBD, allowing for favorable packing to create an architecture similar to that of the wild type. (E) Leucine 472 of the icSZ16-S K479N and icSZ16-S K479N D8 S interacts with L79 and M82 of ACE2. The icSZ16-S K479N D22 L472F mutation is predicted to have hydrophobic interactions with three potential partners, L79, M82, and Y83, of hACE2 that will increase the stability of the binding. Green dots on hACE2 indicate residues which are within 4 angstroms and thus are predicted to interact with the S residues shown in red.

    Techniques Used: Protein Binding, Mutagenesis, Binding Assay

    34) Product Images from "Genotype Distribution, Viral Load and Clinical Characteristics of Infants with Postnatal or Congenital Cytomegalovirus Infection"

    Article Title: Genotype Distribution, Viral Load and Clinical Characteristics of Infants with Postnatal or Congenital Cytomegalovirus Infection

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0108018

    Log 10 CMV urine load in both postnatally and congenitally infected infants with respect to UL55 genotypes (A) and UL144 genotypes (B). Bar in boxplot represents median viral load after log 10 transformation. Upper and lower limit of boxplot represent 75 th and 25 th percentile, respectively. Whiskers represent 5–95% coincidence interval. Dots represent outliers.
    Figure Legend Snippet: Log 10 CMV urine load in both postnatally and congenitally infected infants with respect to UL55 genotypes (A) and UL144 genotypes (B). Bar in boxplot represents median viral load after log 10 transformation. Upper and lower limit of boxplot represent 75 th and 25 th percentile, respectively. Whiskers represent 5–95% coincidence interval. Dots represent outliers.

    Techniques Used: Infection, Transformation Assay

    35) Product Images from "Use of bexB To Detect the Capsule Locus in Haemophilus influenzae ▿"

    Article Title: Use of bexB To Detect the Capsule Locus in Haemophilus influenzae ▿

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.02509-10

    Schematic representations of the capsule locus. (A) The capsule locus can be categorized based upon its location in the H. influenzae genome relative to either an IS 1016 element or sodC . In one arrangement, the cap locus is flanked by IS 1016 insertion
    Figure Legend Snippet: Schematic representations of the capsule locus. (A) The capsule locus can be categorized based upon its location in the H. influenzae genome relative to either an IS 1016 element or sodC . In one arrangement, the cap locus is flanked by IS 1016 insertion

    Techniques Used:

    Suggested workflow for characterizing H. influenzae strain collections with regard to the capsule locus. Gene names listed within an oval represent detection of that gene via a PCR- or probe-based technique. Identification of “true” NTHI
    Figure Legend Snippet: Suggested workflow for characterizing H. influenzae strain collections with regard to the capsule locus. Gene names listed within an oval represent detection of that gene via a PCR- or probe-based technique. Identification of “true” NTHI

    Techniques Used: Polymerase Chain Reaction

    36) Product Images from "The rare orange-red colored Euphorbia pulcherrima cultivar ‘Harvest Orange’ shows a nonsense mutation in a flavonoid 3’-hydroxylase allele expressed in the bracts"

    Article Title: The rare orange-red colored Euphorbia pulcherrima cultivar ‘Harvest Orange’ shows a nonsense mutation in a flavonoid 3’-hydroxylase allele expressed in the bracts

    Journal: BMC Plant Biology

    doi: 10.1186/s12870-018-1424-0

    Multiple alignment of deduced amino acid sequences of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ ( Ep HO_ F3′H , KY273441), ‘Premium Red’ ( Ep PR_ F3′H , KY489667), ‘Christmas Beauty’ ( Ep CB_ F3′H , KY273439), and ‘Christmas Feeling’ ( Ep CF_ F3′H , KY273440). Grey frames highlight characteristic sequences of the P450 protein family. 1. Proline-rich region [ 40 ]; 2. Oxygen binding pocket [ 41 ]; 3. Heme binding motif (Prosite pattern PS00086, [ 42 ]; 4. Substrate recognition site (SRS) 6 according to Seitz et al. [ 43 ]
    Figure Legend Snippet: Multiple alignment of deduced amino acid sequences of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ ( Ep HO_ F3′H , KY273441), ‘Premium Red’ ( Ep PR_ F3′H , KY489667), ‘Christmas Beauty’ ( Ep CB_ F3′H , KY273439), and ‘Christmas Feeling’ ( Ep CF_ F3′H , KY273440). Grey frames highlight characteristic sequences of the P450 protein family. 1. Proline-rich region [ 40 ]; 2. Oxygen binding pocket [ 41 ]; 3. Heme binding motif (Prosite pattern PS00086, [ 42 ]; 4. Substrate recognition site (SRS) 6 according to Seitz et al. [ 43 ]

    Techniques Used: Clone Assay, Binding Assay

    Quantitative expression of F3′H normalized to glycerine aldehyde 3-phosphate dehydrogenase (GAPDH) in Euphorbia pulcherrima cvs. ‘Harvest Orange’ (HO), ‘Premium Red’ (PR), ‘Christmas Beauty’ (CB), and ‘Christmas Feeling’ (CF). Left: Three year old plants kept in the greenhouse. Right: Plants in their first year cultivated in house under standard conditions. Data were calculated from three biological replicates with at least two technical replicates and with error bars representing standard deviation
    Figure Legend Snippet: Quantitative expression of F3′H normalized to glycerine aldehyde 3-phosphate dehydrogenase (GAPDH) in Euphorbia pulcherrima cvs. ‘Harvest Orange’ (HO), ‘Premium Red’ (PR), ‘Christmas Beauty’ (CB), and ‘Christmas Feeling’ (CF). Left: Three year old plants kept in the greenhouse. Right: Plants in their first year cultivated in house under standard conditions. Data were calculated from three biological replicates with at least two technical replicates and with error bars representing standard deviation

    Techniques Used: Expressing, Standard Deviation

    Multiple alignment of a selected part of the nucleotide sequences at the 5′-terminus of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ ( Ep HO_ F3′H , KY273441), ‘Premium Red’ ( Ep PR_ F3′H , KY489667), ‘Christmas Beauty’ ( Ep CB_ F3′H , KY273439), and ‘Christmas Feeling’ ( Ep CF_ F3′H , KY273440). The grey-shaded frame highlights the repetition of ACCATTTTTTCTGCCATTTT from position 22 to 41 in position 50 to 69 (numbering from Ep HO_ F3′H )
    Figure Legend Snippet: Multiple alignment of a selected part of the nucleotide sequences at the 5′-terminus of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ ( Ep HO_ F3′H , KY273441), ‘Premium Red’ ( Ep PR_ F3′H , KY489667), ‘Christmas Beauty’ ( Ep CB_ F3′H , KY273439), and ‘Christmas Feeling’ ( Ep CF_ F3′H , KY273440). The grey-shaded frame highlights the repetition of ACCATTTTTTCTGCCATTTT from position 22 to 41 in position 50 to 69 (numbering from Ep HO_ F3′H )

    Techniques Used: Clone Assay

    a Simplified overview of the anthocyanin pathway. Abbrev: ANS: anthocyanidin synthase, CHI: chalcone isomerase, CHS: chalcone synthase, DFR: dihydroflavonol 4-reductase, FHT: flavanone 3-hydroxylase, F3′H: flavonoid 3′-hydroxylase, F3′5′H: flavonoid 3′,5′-hydroxylase. b Euphorbia pulcherrima cv. ‘Christmas Feeling’ (CF), cv. ‘Christmas Beauty’ (CB), cv. ‘Premium Red’ (PR), cv. ‘Harvest Orange’ (HO)
    Figure Legend Snippet: a Simplified overview of the anthocyanin pathway. Abbrev: ANS: anthocyanidin synthase, CHI: chalcone isomerase, CHS: chalcone synthase, DFR: dihydroflavonol 4-reductase, FHT: flavanone 3-hydroxylase, F3′H: flavonoid 3′-hydroxylase, F3′5′H: flavonoid 3′,5′-hydroxylase. b Euphorbia pulcherrima cv. ‘Christmas Feeling’ (CF), cv. ‘Christmas Beauty’ (CB), cv. ‘Premium Red’ (PR), cv. ‘Harvest Orange’ (HO)

    Techniques Used:

    Amplification of F3′H with the primer pair Ep F3′H_fraF and Ep F3′H_fraR (Additional file 5 : Table S4) flanking the variable region at the N-terminal end using genomic DNA (a) and cDNA (b) from the four poinsettia cultivars ‘Harvest Orange’ (HO), ‘Premium Red’ (PR), Christmas (CB) and ‘Christmas Feeling’ (CF). For cv. ‘Harvest Orange’, amplification from gDNA delivered two fragments of the expected size (calculated values: 109 and 138 bp), whereas only the larger fragment was obtained with cDNA. With gDNA and cDNA from the other cultivars only a single fragment of the smaller size was obtained. Size marker (M) was the 2-Log DNA Ladder (New England Biolabs, UK) with digested DNA fragments ranging from 100 bp to 10 kbp (100 bp steps between 100 and 1000); 100 and 200 bp fragments are highlighted on the gel with red arrows
    Figure Legend Snippet: Amplification of F3′H with the primer pair Ep F3′H_fraF and Ep F3′H_fraR (Additional file 5 : Table S4) flanking the variable region at the N-terminal end using genomic DNA (a) and cDNA (b) from the four poinsettia cultivars ‘Harvest Orange’ (HO), ‘Premium Red’ (PR), Christmas (CB) and ‘Christmas Feeling’ (CF). For cv. ‘Harvest Orange’, amplification from gDNA delivered two fragments of the expected size (calculated values: 109 and 138 bp), whereas only the larger fragment was obtained with cDNA. With gDNA and cDNA from the other cultivars only a single fragment of the smaller size was obtained. Size marker (M) was the 2-Log DNA Ladder (New England Biolabs, UK) with digested DNA fragments ranging from 100 bp to 10 kbp (100 bp steps between 100 and 1000); 100 and 200 bp fragments are highlighted on the gel with red arrows

    Techniques Used: Amplification, Marker

    37) Product Images from "The Latency-Associated Nuclear Antigen Homolog of Herpesvirus Saimiri Inhibits Lytic Virus Replication †"

    Article Title: The Latency-Associated Nuclear Antigen Homolog of Herpesvirus Saimiri Inhibits Lytic Virus Replication †

    Journal: Journal of Virology

    doi: 10.1128/JVI.77.10.5911-5925.2003

    ORF73 domains necessary for the transactivation of the ORF50B promoter. (A) Graphical representation of the ORF73 deletion mutants used in this experiment. (B) The subcellular localization of each ORF73 deletion mutant was determined in OMK cells that were grown and transfected in chamber slides with the respective expression constructs according to panel A (1 μg): pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), and pcDNA-HA73MHd15 (ORF73d15). Cells were fixed 24 h later and stained for expression of the HA-tagged proteins as described in the text. (C) Transcriptional activity of the ORF73 deletion mutants of the ORF50B promoter. OMK cells were cotransfected with 0.5 μg of luciferase reporter plasmid pGL3-ORF50B and with 1 μg of expression constructs for either pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), or pcDNA-HA73MHd15 (ORF73d15). Equal amounts of cell lysates were assayed for luciferase activity after 24 h, and values were normalized to that obtained with pGL3-Basic alone. The black and gray bars indicate the relative activities of the ORF50B and pGL3-Basic promoter in the presence of the respective pcDNA-HA73MH constructs and pcDNA-HA-MH control. The mean values obtained from three independent experiments, again performed in triplicate, are shown.
    Figure Legend Snippet: ORF73 domains necessary for the transactivation of the ORF50B promoter. (A) Graphical representation of the ORF73 deletion mutants used in this experiment. (B) The subcellular localization of each ORF73 deletion mutant was determined in OMK cells that were grown and transfected in chamber slides with the respective expression constructs according to panel A (1 μg): pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), and pcDNA-HA73MHd15 (ORF73d15). Cells were fixed 24 h later and stained for expression of the HA-tagged proteins as described in the text. (C) Transcriptional activity of the ORF73 deletion mutants of the ORF50B promoter. OMK cells were cotransfected with 0.5 μg of luciferase reporter plasmid pGL3-ORF50B and with 1 μg of expression constructs for either pcDNA-HA-MH (negative control), pcDNA-HA73MH (ORF73), pcDNA-HA73MHd3 (ORF73d3), pcDNA-HA73MHd8 (ORF73d8), or pcDNA-HA73MHd15 (ORF73d15). Equal amounts of cell lysates were assayed for luciferase activity after 24 h, and values were normalized to that obtained with pGL3-Basic alone. The black and gray bars indicate the relative activities of the ORF50B and pGL3-Basic promoter in the presence of the respective pcDNA-HA73MH constructs and pcDNA-HA-MH control. The mean values obtained from three independent experiments, again performed in triplicate, are shown.

    Techniques Used: Mutagenesis, Transfection, Expressing, Construct, Negative Control, Staining, Activity Assay, Luciferase, Plasmid Preparation

    38) Product Images from "Coordinated transcriptional regulation of bone homeostasis by Ebf1 and Zfp521 in both mesenchymal and hematopoietic lineages"

    Article Title: Coordinated transcriptional regulation of bone homeostasis by Ebf1 and Zfp521 in both mesenchymal and hematopoietic lineages

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20121187

    Zfp521 favors bone formation in mature OBs. (A) Generation of null and conditional Zfp521 alleles. Zfp521 genomic region encoding exon 4 is shown. Restriction fragment sizes are indicated as well as the positions of the internal and the two flanking probes used for genotyping analysis (Roman numerals). The shaded area indicates the part of the genomic region included in the targeting vector, and the three different alleles are shown. “neo” is the result of the gene-targeting event. “cko” is the conditional knockout allele derived from the neo allele after Flpe-mediated excision of the PGK-neo cassette. One Frt site and two loxP sites remain in the locus. “ko” is the null allele derived from the “neo” or from the “cko” allele by Cre-mediated recombination between the two loxP sites. Only a single loxP site remains in the modified locus. Splicing of exon 3 to exon 5 generates a frameshift. loxP and Frt sites are indicated as closed and open triangles, respectively. Neo, PGK-em7-neomycin dual selection cassette for bacteria and embryonic stem cells; TK, thymidine kinase cassette for counter-selection in embryonic stem cells; X, XbaI; B, BamHI; N, NotI. The genomic region is not drawn to scale. (B) Results of a Southern blot analysis of BamHI-digested tail DNA, probed with the internal probe (III). (C) Northern blot analysis of whole-brain RNA from 3-wk-old mice using a full-length Zfp521 cDNA probe. The blot was rehybridized with a Gapdh probe as a control for RNA quality. wt, wild type; Δexon4, position of the residual mRNA after removal of exon 4. (D) Genotyping PCR showing deletion of Zfp521 allele in genomic DNA extracted from Zfp521 hOC −/− long bones cleaned of soft tissues and BM. (E) Von Kossa staining of tibia sections in 3-wk-old global Zfp521 −/− mice and Zfp521 +/+ littermate controls. (F) Histomorphometric analysis of samples in E ( n = 5). (G) Trabecular BV (BV/tissue volume [TV]) at distal femoral metaphysis and in second lumbar vertebra in 3-wk-old Zfp521 −/− and control mice measured by μCT ( n = 5). (H) Von Kossa staining of tibia sections in 6-wk-old Zfp521 hOC −/− mice and littermate controls. (I) Histomorphometric analysis of samples in H ( n = 6). (J) Trabecular BV (BV/TV) at distal femoral metaphysis and in second lumbar vertebra in 12-wk-old Zfp521 hOC −/− and control mice measured by μCT ( n = 5–6). (K) Von Kossa staining of tibia sections in 12-wk-old Zfp521 hOC −/− mice and littermate controls. (L) Histomorphometric analysis of samples in K ( n = 6). (M) Serum PINP and CTX levels in 3-wk-old global Zfp521 −/− mice and Zfp521 +/+ littermate controls ( n = 6–9). (N) Serum PINP and CTX levels in 6-wk-old Zfp521 hOC −/− and control mice ( n = 5–6). N.Ob, number of OBs; N.Oc, number of OCs. All data are means ± SD. *, P
    Figure Legend Snippet: Zfp521 favors bone formation in mature OBs. (A) Generation of null and conditional Zfp521 alleles. Zfp521 genomic region encoding exon 4 is shown. Restriction fragment sizes are indicated as well as the positions of the internal and the two flanking probes used for genotyping analysis (Roman numerals). The shaded area indicates the part of the genomic region included in the targeting vector, and the three different alleles are shown. “neo” is the result of the gene-targeting event. “cko” is the conditional knockout allele derived from the neo allele after Flpe-mediated excision of the PGK-neo cassette. One Frt site and two loxP sites remain in the locus. “ko” is the null allele derived from the “neo” or from the “cko” allele by Cre-mediated recombination between the two loxP sites. Only a single loxP site remains in the modified locus. Splicing of exon 3 to exon 5 generates a frameshift. loxP and Frt sites are indicated as closed and open triangles, respectively. Neo, PGK-em7-neomycin dual selection cassette for bacteria and embryonic stem cells; TK, thymidine kinase cassette for counter-selection in embryonic stem cells; X, XbaI; B, BamHI; N, NotI. The genomic region is not drawn to scale. (B) Results of a Southern blot analysis of BamHI-digested tail DNA, probed with the internal probe (III). (C) Northern blot analysis of whole-brain RNA from 3-wk-old mice using a full-length Zfp521 cDNA probe. The blot was rehybridized with a Gapdh probe as a control for RNA quality. wt, wild type; Δexon4, position of the residual mRNA after removal of exon 4. (D) Genotyping PCR showing deletion of Zfp521 allele in genomic DNA extracted from Zfp521 hOC −/− long bones cleaned of soft tissues and BM. (E) Von Kossa staining of tibia sections in 3-wk-old global Zfp521 −/− mice and Zfp521 +/+ littermate controls. (F) Histomorphometric analysis of samples in E ( n = 5). (G) Trabecular BV (BV/tissue volume [TV]) at distal femoral metaphysis and in second lumbar vertebra in 3-wk-old Zfp521 −/− and control mice measured by μCT ( n = 5). (H) Von Kossa staining of tibia sections in 6-wk-old Zfp521 hOC −/− mice and littermate controls. (I) Histomorphometric analysis of samples in H ( n = 6). (J) Trabecular BV (BV/TV) at distal femoral metaphysis and in second lumbar vertebra in 12-wk-old Zfp521 hOC −/− and control mice measured by μCT ( n = 5–6). (K) Von Kossa staining of tibia sections in 12-wk-old Zfp521 hOC −/− mice and littermate controls. (L) Histomorphometric analysis of samples in K ( n = 6). (M) Serum PINP and CTX levels in 3-wk-old global Zfp521 −/− mice and Zfp521 +/+ littermate controls ( n = 6–9). (N) Serum PINP and CTX levels in 6-wk-old Zfp521 hOC −/− and control mice ( n = 5–6). N.Ob, number of OBs; N.Oc, number of OCs. All data are means ± SD. *, P

    Techniques Used: Plasmid Preparation, Knock-Out, Derivative Assay, Modification, Selection, Southern Blot, Northern Blot, Mouse Assay, Polymerase Chain Reaction, Staining

    39) Product Images from "In-phase oscillation of global regulons is orchestrated by a pole-specific organizer"

    Article Title: In-phase oscillation of global regulons is orchestrated by a pole-specific organizer

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1610723113

    ( A ) Relative β-galactosidase activity (in percentage) of various CtrA-regulated target promoters, as indicated, in WT , spmX mutant (Δ spmX ), and Δ spmX ctrA (T170A) double mutant. The values, ±SE, are the average of three independent experiments. ( B ) Growth competition assay of kdpD , kidO , staR , pleC , rpoN , fliM , and lon transposon mutant alleles in the WT and Δ spmX backgrounds. The y axis indicates the proportion of growth (in percentage) of number of cells in each genetic background. ( C ) DIC micrographs of the tacA::kan mutant harboring the vector pMT335 or ectopically expressing TacA from an inducible promoter on pMT335 ( p P van - tacA ). The mean cell size (±SD) of at least 200 cells is given at the bottom of the image. ( D ) DIC micrographs and flow cytometry profiles of Δ spmY tacA::kan double mutant cells harboring pMT335 or expressing TacA from p P van - tacA . Mean cell size (±SD) of at least 200 cells is given at the top of the image. Cells in C and D were induced with 0.5 mM vanillate for 3 h. (Scale bar, 2 μm.)
    Figure Legend Snippet: ( A ) Relative β-galactosidase activity (in percentage) of various CtrA-regulated target promoters, as indicated, in WT , spmX mutant (Δ spmX ), and Δ spmX ctrA (T170A) double mutant. The values, ±SE, are the average of three independent experiments. ( B ) Growth competition assay of kdpD , kidO , staR , pleC , rpoN , fliM , and lon transposon mutant alleles in the WT and Δ spmX backgrounds. The y axis indicates the proportion of growth (in percentage) of number of cells in each genetic background. ( C ) DIC micrographs of the tacA::kan mutant harboring the vector pMT335 or ectopically expressing TacA from an inducible promoter on pMT335 ( p P van - tacA ). The mean cell size (±SD) of at least 200 cells is given at the bottom of the image. ( D ) DIC micrographs and flow cytometry profiles of Δ spmY tacA::kan double mutant cells harboring pMT335 or expressing TacA from p P van - tacA . Mean cell size (±SD) of at least 200 cells is given at the top of the image. Cells in C and D were induced with 0.5 mM vanillate for 3 h. (Scale bar, 2 μm.)

    Techniques Used: Activity Assay, Mutagenesis, Competitive Binding Assay, Plasmid Preparation, Expressing, Flow Cytometry, Cytometry

    SpmX regulates TacA activity through SpmY. ( A ) Schematic summarizing the regulation of the production of StpX. TacA activates the transcription of StaR that in turn activates the transcription of StpX. The activity of TacA is under the control of SpmX. Bold red line, negative posttranslational regulation; dashed green line, positive transcriptional regulation. ( B ) Immunoblot analyses showing the levels of the StpX protein in WT , Δ stpX , Δ spmX , Δ spmY , and Δ spmX Δ spmY cells. MipZ was used as the loading control. ( C ) DIC and fluorescence micrographs showing the ectopic stalks (arrowheads) and the localization of StpX-GFP in these ectopic stalks in cells harboring a transposon mutation in spmY ( spmY::Tn5 ) and producing stpX-gfp from the native stpX promoter. The block diagram shows the domain organization of the SpmY protein. The DUF2336 spans from amino acids 85–318. Black vertical line denotes the position of Tn5 insertion in the strain spmY::Tn5 . ( D ) DIC microscopy images of WT and Δ spmY Caulobacter cells. Arrowheads indicate stalks. ( E ) Swarm plate showing the motility of cells in WT , Δ spmX , Δ spmY , Δ spmX Δ spmY , Δ spmX ctrA (T170A), Δ spmY ctrA (T170A), Δ spmX Δ spmY ctrA (T170A), and WT ctrA (T170A) genetic backgrounds. ( F ) Relative β-galactosidase activity (in percentage) of P spmX -lacZ in WT , Δ spmX , and Δ spmY cells. ( G ) Comparative ChIP-Seq using antibodies to CtrA denoting the occupancy of CtrA on the chromatin of Δ spmX ctrA(T170A) vs. Δ spmX cells. The color key indicates the degree by which the occupancy of CtrA is altered in selected targets by the ctrA (T170A) mutation in Δ spmX , expressed as log 2 for the complete list. ( H ) Relative β-galactosidase activity (in percentage) of P spmY -lacZ in WT , WT ctrA(T170A), Δ spmX , and Δs pmX ctrA (T170A) cells. Values (±SE) in F and H are the average of at least three independent experiments. (Scale bars, 2 μm.)
    Figure Legend Snippet: SpmX regulates TacA activity through SpmY. ( A ) Schematic summarizing the regulation of the production of StpX. TacA activates the transcription of StaR that in turn activates the transcription of StpX. The activity of TacA is under the control of SpmX. Bold red line, negative posttranslational regulation; dashed green line, positive transcriptional regulation. ( B ) Immunoblot analyses showing the levels of the StpX protein in WT , Δ stpX , Δ spmX , Δ spmY , and Δ spmX Δ spmY cells. MipZ was used as the loading control. ( C ) DIC and fluorescence micrographs showing the ectopic stalks (arrowheads) and the localization of StpX-GFP in these ectopic stalks in cells harboring a transposon mutation in spmY ( spmY::Tn5 ) and producing stpX-gfp from the native stpX promoter. The block diagram shows the domain organization of the SpmY protein. The DUF2336 spans from amino acids 85–318. Black vertical line denotes the position of Tn5 insertion in the strain spmY::Tn5 . ( D ) DIC microscopy images of WT and Δ spmY Caulobacter cells. Arrowheads indicate stalks. ( E ) Swarm plate showing the motility of cells in WT , Δ spmX , Δ spmY , Δ spmX Δ spmY , Δ spmX ctrA (T170A), Δ spmY ctrA (T170A), Δ spmX Δ spmY ctrA (T170A), and WT ctrA (T170A) genetic backgrounds. ( F ) Relative β-galactosidase activity (in percentage) of P spmX -lacZ in WT , Δ spmX , and Δ spmY cells. ( G ) Comparative ChIP-Seq using antibodies to CtrA denoting the occupancy of CtrA on the chromatin of Δ spmX ctrA(T170A) vs. Δ spmX cells. The color key indicates the degree by which the occupancy of CtrA is altered in selected targets by the ctrA (T170A) mutation in Δ spmX , expressed as log 2 for the complete list. ( H ) Relative β-galactosidase activity (in percentage) of P spmY -lacZ in WT , WT ctrA(T170A), Δ spmX , and Δs pmX ctrA (T170A) cells. Values (±SE) in F and H are the average of at least three independent experiments. (Scale bars, 2 μm.)

    Techniques Used: Activity Assay, Fluorescence, Mutagenesis, Blocking Assay, Microscopy, Chromatin Immunoprecipitation

    40) Product Images from "Evaluating the potential for undesired genomic effects of the piggyBac transposon system in human cells"

    Article Title: Evaluating the potential for undesired genomic effects of the piggyBac transposon system in human cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv017

    piggyBac does not mobilize endogenous human TR-like sequences. 5′ or 3′ native TRs were replaced with PCR amplified genomic sequences. ( A ) and ( B ) The colony count was used as a measure of stable transposition. Only the native 5′ ( A ) or 3′ ( B ) in presence of the transposase leads to efficient and stable transposition in HEK293 cells. Elimination of the TRs or the transposase led to significantly reduced transposition and serve as negative controls. Genomic sequences similar to the piggyBac TRS did not lead to efficient and stable transposition and were comparable to the negative controls ( N = 3 independent experiments, ANOVA with Bonferroni post-test; *, statistically different from negative control). An excision assay was used to determine whether a transposon is recognized and excised out of the vector by the transposase. A transposon with native TR sequences was efficiently recognized and excised by the piggyBac transposase, so a PCR product was visible on the agarose gels shown (pTpB lanes). Transposons carrying the Genomic TR-like sequences were not recognized and excised from the transposon either in the 5′ ( C ) or 3′ ( D ) position.
    Figure Legend Snippet: piggyBac does not mobilize endogenous human TR-like sequences. 5′ or 3′ native TRs were replaced with PCR amplified genomic sequences. ( A ) and ( B ) The colony count was used as a measure of stable transposition. Only the native 5′ ( A ) or 3′ ( B ) in presence of the transposase leads to efficient and stable transposition in HEK293 cells. Elimination of the TRs or the transposase led to significantly reduced transposition and serve as negative controls. Genomic sequences similar to the piggyBac TRS did not lead to efficient and stable transposition and were comparable to the negative controls ( N = 3 independent experiments, ANOVA with Bonferroni post-test; *, statistically different from negative control). An excision assay was used to determine whether a transposon is recognized and excised out of the vector by the transposase. A transposon with native TR sequences was efficiently recognized and excised by the piggyBac transposase, so a PCR product was visible on the agarose gels shown (pTpB lanes). Transposons carrying the Genomic TR-like sequences were not recognized and excised from the transposon either in the 5′ ( C ) or 3′ ( D ) position.

    Techniques Used: Polymerase Chain Reaction, Amplification, Genomic Sequencing, Negative Control, Excision Assay, Plasmid Preparation

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Dynamic Distribution of Linker Histone H1.5 in Cellular Differentiation
    Article Snippet: .. ChIP–quantitative PCR Real-time PCR was performed on ChIP and input DNA using SYBR Green Real-time PCR Master Mix (Roche). .. For each primer pair, an amplification standard curve was established by gradient amount of input DNA.

    Amplification:

    Article Title: Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms
    Article Snippet: .. PCR amplification of rnpB genes Mitochondrial rnpB genes of R.stolonifer , M.mucedo , R.spectabilis and R.oligosporus were PCR-amplified from ∼100 ng of the respective mtDNAs in a 50 μl reaction mixture [200 μM dNTP, 2.5 mM MgCl2 , 2 nM of primers, 5 μl of 10× buffer and 3 U of DNA polymerases mixture from the Expand high fidelity kit (Roche Catalog no. 1732650) and degenerate primers]. .. The annealing temperature of the PCR amplification was 50°C.

    Article Title: Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis
    Article Snippet: .. The entire coding regions of B. subtilis genes encoding AhpC_H1, AhpC_H2, B_BCP, and B_TPx were amplified by PCR using the High Expand Fidelity kit (Roche Life Science, United States) and primers listed in Table . .. The entire coding region of the E. coli ahpC gene was amplified by PCR using the following primers: forward, 5′-GGG ATC CCA TAT GTC CTT AAT TAA CAC-3′; reverse, 5′-CCT CGA GTT AGA TTT TAC CAA CCA GGT-3′.

    Article Title: Neodiversification of homeologous CLAVATA1-like receptor kinase genes in soybean leads to distinct developmental outcomes
    Article Snippet: .. A central segment of 1,594 bp of GmCLV1A and 1,904 bp of GmNARK were amplified with specific primers: GmCLV1A primers; 5′-AATAACTACCTTAACGGCGCA-3′ and 5′-TCCACCACTGCCAACACTACT-3′, GmNARK primers; 5′-TGAGATTTCCGGCGAATCCCTG-3′ and 5′-TCCACCACTGCCAACACCAAC-3′ using the expand high fidelity PCR system (Roche Applied System, Germany). .. PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol.

    Article Title: Specificity of the IgG antibody response to Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale MSP119 subunit proteins in multiplexed serologic assays
    Article Snippet: .. Comparison of Plasmodium malariae MSP119 sequences from other geographic locations Ten nanograms of DNA from P. malariae strains Greece I, Guyana, and Uganda I were PCR amplified using the forward and reverse long deoxyoligonucleotides described above and the Expand High Fidelity PCR system (Roche Applied Science, Indianapolis, IN, USA). .. Cycle conditions were as follows: 94 °C for 5 min, 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 68 °C for 1 min, and a final extension step of 68 °C for 5 min. Products were purified (StrataPrep PCR purification kit, Stratagene) and sequenced as described above.

    Article Title: Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences
    Article Snippet: .. Probes for I2 homologs were prepared as follows: I2 homologs were PCR-amplified from C. chinense PI159236 total DNA using degenerate primers, PI2H-B1F2 and PI2H-B2R1 (Table ), which amplified at least 19 different I2 homologs as revealed during the development of RGA markers; the DNA fragments from multiple numbers of pepper I2 homologs were gel purified and then labeled using Hi-Prime DIG DNA labeling kit (Roche). .. Cot -1 and Cot -100 DNA were also labeled using the same kit.

    Labeling:

    Article Title: Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences
    Article Snippet: .. Probes for I2 homologs were prepared as follows: I2 homologs were PCR-amplified from C. chinense PI159236 total DNA using degenerate primers, PI2H-B1F2 and PI2H-B2R1 (Table ), which amplified at least 19 different I2 homologs as revealed during the development of RGA markers; the DNA fragments from multiple numbers of pepper I2 homologs were gel purified and then labeled using Hi-Prime DIG DNA labeling kit (Roche). .. Cot -1 and Cot -100 DNA were also labeled using the same kit.

    Purification:

    Article Title: Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences
    Article Snippet: .. Probes for I2 homologs were prepared as follows: I2 homologs were PCR-amplified from C. chinense PI159236 total DNA using degenerate primers, PI2H-B1F2 and PI2H-B2R1 (Table ), which amplified at least 19 different I2 homologs as revealed during the development of RGA markers; the DNA fragments from multiple numbers of pepper I2 homologs were gel purified and then labeled using Hi-Prime DIG DNA labeling kit (Roche). .. Cot -1 and Cot -100 DNA were also labeled using the same kit.

    SYBR Green Assay:

    Article Title: Dynamic Distribution of Linker Histone H1.5 in Cellular Differentiation
    Article Snippet: .. ChIP–quantitative PCR Real-time PCR was performed on ChIP and input DNA using SYBR Green Real-time PCR Master Mix (Roche). .. For each primer pair, an amplification standard curve was established by gradient amount of input DNA.

    Article Title: Silencing of IFN-stimulated gene transcription is regulated by histone H1 and its chaperone TAF-I
    Article Snippet: .. DNA fragments were subjected to qRT-PCR using FastStart SYBR Green Master (Roche) with specific primer sets as shown in the ‘Chromatin immunoprecipitation assay’ section of the Materials and Methods section. .. Reporter gene assay HEK293 cells were transfected with pU6-puro-siTAF-I or pU6-puro-siEGFP together with pISRE-TA-Luc (Clontech) containing the ISRE and pSEAP-Control (Clontech) using Gene Juice (Novagen) according to the manufacturer's protocol.

    Quantitative RT-PCR:

    Article Title: Silencing of IFN-stimulated gene transcription is regulated by histone H1 and its chaperone TAF-I
    Article Snippet: .. DNA fragments were subjected to qRT-PCR using FastStart SYBR Green Master (Roche) with specific primer sets as shown in the ‘Chromatin immunoprecipitation assay’ section of the Materials and Methods section. .. Reporter gene assay HEK293 cells were transfected with pU6-puro-siTAF-I or pU6-puro-siEGFP together with pISRE-TA-Luc (Clontech) containing the ISRE and pSEAP-Control (Clontech) using Gene Juice (Novagen) according to the manufacturer's protocol.

    DNA Labeling:

    Article Title: Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences
    Article Snippet: .. Probes for I2 homologs were prepared as follows: I2 homologs were PCR-amplified from C. chinense PI159236 total DNA using degenerate primers, PI2H-B1F2 and PI2H-B2R1 (Table ), which amplified at least 19 different I2 homologs as revealed during the development of RGA markers; the DNA fragments from multiple numbers of pepper I2 homologs were gel purified and then labeled using Hi-Prime DIG DNA labeling kit (Roche). .. Cot -1 and Cot -100 DNA were also labeled using the same kit.

    Polymerase Chain Reaction:

    Article Title: Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms
    Article Snippet: .. PCR amplification of rnpB genes Mitochondrial rnpB genes of R.stolonifer , M.mucedo , R.spectabilis and R.oligosporus were PCR-amplified from ∼100 ng of the respective mtDNAs in a 50 μl reaction mixture [200 μM dNTP, 2.5 mM MgCl2 , 2 nM of primers, 5 μl of 10× buffer and 3 U of DNA polymerases mixture from the Expand high fidelity kit (Roche Catalog no. 1732650) and degenerate primers]. .. The annealing temperature of the PCR amplification was 50°C.

    Article Title: The invasiveness of human cervical cancer associated to the function of NaV1.6 channels is mediated by MMP-2 activity
    Article Snippet: .. The first strand cDNA product (250 ng) was used as template in 10 µl PCR reactions with final concentrations of 200 µM dNTP, 0.3 µM primers for SCN8A Exon 18 (forward primer 5′-AAGTGGACAGCCTATGGCTTCG-3′, reverse primer 5′-TGTTGACATCTTCAATTTCAAATCGG-3′), 1.5 mM MgCl2 , and 1.3 U of enzyme mix (Expand High Fidelity PCR System, Roche Diagnostics; Mannheim, Germany). ..

    Article Title: Dynamic Distribution of Linker Histone H1.5 in Cellular Differentiation
    Article Snippet: .. ChIP–quantitative PCR Real-time PCR was performed on ChIP and input DNA using SYBR Green Real-time PCR Master Mix (Roche). .. For each primer pair, an amplification standard curve was established by gradient amount of input DNA.

    Article Title: Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis
    Article Snippet: .. The entire coding regions of B. subtilis genes encoding AhpC_H1, AhpC_H2, B_BCP, and B_TPx were amplified by PCR using the High Expand Fidelity kit (Roche Life Science, United States) and primers listed in Table . .. The entire coding region of the E. coli ahpC gene was amplified by PCR using the following primers: forward, 5′-GGG ATC CCA TAT GTC CTT AAT TAA CAC-3′; reverse, 5′-CCT CGA GTT AGA TTT TAC CAA CCA GGT-3′.

    Article Title: Neodiversification of homeologous CLAVATA1-like receptor kinase genes in soybean leads to distinct developmental outcomes
    Article Snippet: .. A central segment of 1,594 bp of GmCLV1A and 1,904 bp of GmNARK were amplified with specific primers: GmCLV1A primers; 5′-AATAACTACCTTAACGGCGCA-3′ and 5′-TCCACCACTGCCAACACTACT-3′, GmNARK primers; 5′-TGAGATTTCCGGCGAATCCCTG-3′ and 5′-TCCACCACTGCCAACACCAAC-3′ using the expand high fidelity PCR system (Roche Applied System, Germany). .. PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol.

    Article Title: Specificity of the IgG antibody response to Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale MSP119 subunit proteins in multiplexed serologic assays
    Article Snippet: .. Comparison of Plasmodium malariae MSP119 sequences from other geographic locations Ten nanograms of DNA from P. malariae strains Greece I, Guyana, and Uganda I were PCR amplified using the forward and reverse long deoxyoligonucleotides described above and the Expand High Fidelity PCR system (Roche Applied Science, Indianapolis, IN, USA). .. Cycle conditions were as follows: 94 °C for 5 min, 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 68 °C for 1 min, and a final extension step of 68 °C for 5 min. Products were purified (StrataPrep PCR purification kit, Stratagene) and sequenced as described above.

    Article Title: Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences
    Article Snippet: .. Probes for I2 homologs were prepared as follows: I2 homologs were PCR-amplified from C. chinense PI159236 total DNA using degenerate primers, PI2H-B1F2 and PI2H-B2R1 (Table ), which amplified at least 19 different I2 homologs as revealed during the development of RGA markers; the DNA fragments from multiple numbers of pepper I2 homologs were gel purified and then labeled using Hi-Prime DIG DNA labeling kit (Roche). .. Cot -1 and Cot -100 DNA were also labeled using the same kit.

    Chromatin Immunoprecipitation:

    Article Title: Dynamic Distribution of Linker Histone H1.5 in Cellular Differentiation
    Article Snippet: .. ChIP–quantitative PCR Real-time PCR was performed on ChIP and input DNA using SYBR Green Real-time PCR Master Mix (Roche). .. For each primer pair, an amplification standard curve was established by gradient amount of input DNA.

    Article Title: Silencing of IFN-stimulated gene transcription is regulated by histone H1 and its chaperone TAF-I
    Article Snippet: .. DNA fragments were subjected to qRT-PCR using FastStart SYBR Green Master (Roche) with specific primer sets as shown in the ‘Chromatin immunoprecipitation assay’ section of the Materials and Methods section. .. Reporter gene assay HEK293 cells were transfected with pU6-puro-siTAF-I or pU6-puro-siEGFP together with pISRE-TA-Luc (Clontech) containing the ISRE and pSEAP-Control (Clontech) using Gene Juice (Novagen) according to the manufacturer's protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Roche expand high fidelity pcr kit
    Characterization of the FirS iron-binding motif. The induction of <t>ygiW</t> (A) and firR (B) in response to Fe 2+ was measured by <t>qRT-PCR.</t> The ability of wild-type 2019, the Δ firS mutant KK009, KHS1 ( firS Y149G, R150T), KHS3 ( firS D148A), KHS4 ( firS E151G, D152S), and KHS5 ( firS + ) to respond to Fe 2+ was tested. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.
    Expand High Fidelity Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 70 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr kit/product/Roche
    Average 90 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr kit - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Characterization of the FirS iron-binding motif. The induction of ygiW (A) and firR (B) in response to Fe 2+ was measured by qRT-PCR. The ability of wild-type 2019, the Δ firS mutant KK009, KHS1 ( firS Y149G, R150T), KHS3 ( firS D148A), KHS4 ( firS E151G, D152S), and KHS5 ( firS + ) to respond to Fe 2+ was tested. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Journal: Journal of Bacteriology

    Article Title: Characterization of a Ferrous Iron-Responsive Two-Component System in Nontypeable Haemophilus influenzae

    doi: 10.1128/JB.01465-12

    Figure Lengend Snippet: Characterization of the FirS iron-binding motif. The induction of ygiW (A) and firR (B) in response to Fe 2+ was measured by qRT-PCR. The ability of wild-type 2019, the Δ firS mutant KK009, KHS1 ( firS Y149G, R150T), KHS3 ( firS D148A), KHS4 ( firS E151G, D152S), and KHS5 ( firS + ) to respond to Fe 2+ was tested. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Article Snippet: For probe synthesis, DNA fragments internal to each gene were amplified by PCR using primers 1709F8 and 1709R7 ( ygiW ) and 1708F3 and 1708R3 ( firR ) and the Expand high-fidelity PCR kit (Roche).

    Techniques: Binding Assay, Quantitative RT-PCR, Mutagenesis, Expressing

    Thermoresponsive induction of ygiW (A) and firR (B). Cultures of wild-type NTHI 2019, the Δ firR mutant (NB004), the Δ firS mutant (KK009), the complemented firR mutant ( firR + ; KHS2), and the complemented firS mutant ( firS + ; KHS5) were grown in sRPMI at 37°C to early log phase and shifted to 9°C for 30 min prior to RNA extraction. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene when cultures were incubated at 37°C. The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Journal: Journal of Bacteriology

    Article Title: Characterization of a Ferrous Iron-Responsive Two-Component System in Nontypeable Haemophilus influenzae

    doi: 10.1128/JB.01465-12

    Figure Lengend Snippet: Thermoresponsive induction of ygiW (A) and firR (B). Cultures of wild-type NTHI 2019, the Δ firR mutant (NB004), the Δ firS mutant (KK009), the complemented firR mutant ( firR + ; KHS2), and the complemented firS mutant ( firS + ; KHS5) were grown in sRPMI at 37°C to early log phase and shifted to 9°C for 30 min prior to RNA extraction. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene when cultures were incubated at 37°C. The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Article Snippet: For probe synthesis, DNA fragments internal to each gene were amplified by PCR using primers 1709F8 and 1709R7 ( ygiW ) and 1708F3 and 1708R3 ( firR ) and the Expand high-fidelity PCR kit (Roche).

    Techniques: Mutagenesis, RNA Extraction, Expressing, Quantitative RT-PCR, Incubation

    Characterization of firR mutants in Fe 2+ -responsive induction of ygiW . The expression of ygiW in wild-type 2019, NB004 (Δ firR ), JWJ154 ( firR D51A), and KHS2 ( firR + ) was measured by qRT-PCR. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Journal: Journal of Bacteriology

    Article Title: Characterization of a Ferrous Iron-Responsive Two-Component System in Nontypeable Haemophilus influenzae

    doi: 10.1128/JB.01465-12

    Figure Lengend Snippet: Characterization of firR mutants in Fe 2+ -responsive induction of ygiW . The expression of ygiW in wild-type 2019, NB004 (Δ firR ), JWJ154 ( firR D51A), and KHS2 ( firR + ) was measured by qRT-PCR. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Article Snippet: For probe synthesis, DNA fragments internal to each gene were amplified by PCR using primers 1709F8 and 1709R7 ( ygiW ) and 1708F3 and 1708R3 ( firR ) and the Expand high-fidelity PCR kit (Roche).

    Techniques: Expressing, Quantitative RT-PCR

    Transcriptional organization of the NCgl2816 -lldD locus in C. glutamicum analyzed by RT-PCR. (A) Scheme showing the NCgl2816 -lldD locus in C. glutamicum and the RT-PCRs used to determine cotranscription of NCgl2816 and lldD . RNA from wild-type C. glutamicum

    Journal:

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production †

    doi: 10.1128/AEM.71.10.5920-5928.2005

    Figure Lengend Snippet: Transcriptional organization of the NCgl2816 -lldD locus in C. glutamicum analyzed by RT-PCR. (A) Scheme showing the NCgl2816 -lldD locus in C. glutamicum and the RT-PCRs used to determine cotranscription of NCgl2816 and lldD . RNA from wild-type C. glutamicum

    Article Snippet: Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template.

    Techniques: Reverse Transcription Polymerase Chain Reaction

    S-opsin knock-in targeting strategy created a severely hypomorphic allele ( Opn1sw Neo ) a. Schematic of Opn1sw targeting strategy . The targeting vector comprised a Neomycin resistance cassette (Neo) flanked by FRT recombination sites (arrowheads) and homologous sequences (4.5 Kb 3’ and 816 bp 5’) to the Opn1sw gene locus (the calumenin gene, which abuts the 5’ end of the Opn1sw gene and is transcribed in the reverse direction on the complementary strand). The asterisk indicates the site of a targeted point mutation. Southern blotting and PCR confirmed successful targeting. b. Real-time quantitative PCR results . The threshold cycle ( C T ) of Taq-Man PCR reactions with primers for S-opsin (purple), M-opsin (green) and β-actin (gray) message are plotted against C T for reactions with primers for rhodopsin message. Three dilutions of cDNA templates generated from Opn1sw neo/neo (circles) and WT littermate control (squares) and served as the input to the PCR reactions. Primer sequences spanned exon junctions 1–2 (filled or bottom half-filled) or 4–5 (top half-filled) symbols. Data were obtained from mRNA extracted from the entire eyes of an Opn1sw Neo/Neo and a WT littermate control. Error bars are standard deviations: observations with 1X dilution of the cDNA from the reverse transcriptase reaction were replicated 2X for each data point, those with 1/4 dilution 4X and those with 1/16 dilution 8X. The straight lines, fitted by least-squares to the data, are very nearly parallel (slopes varied by 10%, ranging from 1.13 to 1.24), so that the vertical offset of the lines representing the same transcript in Opn1sw Neo/Neo and WT retinas provide load-independent estimates of differences in the transcripts. c. Immunoblotting with an anti-S-opsin antibody detects no S-opsin in the Opn1sw Neo/Neo retina . Extracts of WT and Opn1sw Neo/Neo retinas containing 60 pmol rhodopsin (corresponding to ~ 10% of the total retina) were loaded into adjacent gel lanes, and probed with antibodies for S-opsin (left panel, grayscale presentation), or for S-opsin (right panel, red) and rhodopsin (green). No S-opsin is detected in Opn1sw Neo/Neo ) show that ~ 30 fmol S-opsin would be detectable.

    Journal: Vision research

    Article Title: A Mouse M-opsin Monochromat: Retinal Cone Photoreceptors have increased M-Opsin Expression when S-Opsin is knocked out

    doi: 10.1016/j.visres.2010.12.017

    Figure Lengend Snippet: S-opsin knock-in targeting strategy created a severely hypomorphic allele ( Opn1sw Neo ) a. Schematic of Opn1sw targeting strategy . The targeting vector comprised a Neomycin resistance cassette (Neo) flanked by FRT recombination sites (arrowheads) and homologous sequences (4.5 Kb 3’ and 816 bp 5’) to the Opn1sw gene locus (the calumenin gene, which abuts the 5’ end of the Opn1sw gene and is transcribed in the reverse direction on the complementary strand). The asterisk indicates the site of a targeted point mutation. Southern blotting and PCR confirmed successful targeting. b. Real-time quantitative PCR results . The threshold cycle ( C T ) of Taq-Man PCR reactions with primers for S-opsin (purple), M-opsin (green) and β-actin (gray) message are plotted against C T for reactions with primers for rhodopsin message. Three dilutions of cDNA templates generated from Opn1sw neo/neo (circles) and WT littermate control (squares) and served as the input to the PCR reactions. Primer sequences spanned exon junctions 1–2 (filled or bottom half-filled) or 4–5 (top half-filled) symbols. Data were obtained from mRNA extracted from the entire eyes of an Opn1sw Neo/Neo and a WT littermate control. Error bars are standard deviations: observations with 1X dilution of the cDNA from the reverse transcriptase reaction were replicated 2X for each data point, those with 1/4 dilution 4X and those with 1/16 dilution 8X. The straight lines, fitted by least-squares to the data, are very nearly parallel (slopes varied by 10%, ranging from 1.13 to 1.24), so that the vertical offset of the lines representing the same transcript in Opn1sw Neo/Neo and WT retinas provide load-independent estimates of differences in the transcripts. c. Immunoblotting with an anti-S-opsin antibody detects no S-opsin in the Opn1sw Neo/Neo retina . Extracts of WT and Opn1sw Neo/Neo retinas containing 60 pmol rhodopsin (corresponding to ~ 10% of the total retina) were loaded into adjacent gel lanes, and probed with antibodies for S-opsin (left panel, grayscale presentation), or for S-opsin (right panel, red) and rhodopsin (green). No S-opsin is detected in Opn1sw Neo/Neo ) show that ~ 30 fmol S-opsin would be detectable.

    Article Snippet: A f lox ed tetracycline resistance (Tcr ) fragment flanked by homology to Opn1sw intron 3 was generated by PCR (Expand High Fidelity PCR Kit, Roche Labs, 1732641) and ligated into pLM179 at the pme-l site.

    Techniques: Knock-In, Plasmid Preparation, Mutagenesis, Southern Blot, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Generated