Journal: Nucleic Acids Research

Article Title: Anticodon-edited transfer RNAs (ACE-tRNAs) encoded as therapeutic nonviral minimal DNA vectors

doi: 10.1093/nar/gkag082

Figure Lengend Snippet: ACE-tRNAs can be encoded in minimal DNA vectors (minivectors). ( A ) Circular double-stranded DNA (dsDNA) minivectors (minicircles) containing a single copy of an ACE-tRNA expression cassette were produced from blunt-end ligation of ACE-tRNA-containing PCR products. Primers containing a 5′-phosphate were utilized to allow for ligation with T4 DNA ligase and the nonspecific DNA-binding/bending activity of the protein TFAM was used to ensure efficient circularization of minicircle product . Production of T5 exonuclease-resistant product in the absence of specific endonuclease activity (Bsu36I) indicates the covalent closure of the minicircles. ( B ) Circular dsDNA minivectors containing multiple copies of an ACE-tRNA expression cassette were produced using a commercially available minivector production system, which allows for plasmid vector backbone removal based on the activity of PhiC31 integrase and I-SceI homing endonuclease in the ZYCY10P3S2T E. coli strain (described in ). ( C ) Linear dsDNA minivectors with covalently closed DNA ends (CEDTs), containing either a single or multiple ACE-tRNA expression cassette(s), were produced from PCR products containing 54 bp telRL sites, which are recognized by the cleaving/joining enzyme TelN . Production of T5 exonuclease-resistant product in the absence of specific endonuclease activity (Bsu36I) indicates the covalent closure of the CEDT ends.

Article Snippet: Residual unreacted MC PCR product was removed by addition of T5 exonuclease (NEB, M0663S) with ∼20 μl of 10 unit/μl T5 exonuclease added per 50 ml MC ligation reaction.

Techniques: Expressing, Produced, Ligation, Binding Assay, Activity Assay, Plasmid Preparation

Journal: Mikrochimica Acta

Article Title: Selection of ssDNA aptamers targeting the serine protease SPSFQ of Acinetobacter baumannii and development of an electrochemical impedance spectroscopy-based ultrasensitive SPSFQ biosensor

doi: 10.1007/s00604-026-07866-2

Figure Lengend Snippet: (A) Agarose gel electrophoresis images of dsDNA sequences obtained after PCR during SELEX rounds, (B) Agarose gel image of ssDNA after digestion with lambda exonuclease (DNA marker: Thermo Scientific, GeneRuler Ultra Low Range DNA Ladder, SM1211)

Article Snippet: The consumables used in PCR studies were supplied by Thermofisher Scientific (Waltham, USA), agarose from Condalab (Madrid, Spain), lambda exonuclease from New England Biolabs (USA), and PCR clean-up kit from Macherey-Nagel (Düren, Germany).

Techniques: Agarose Gel Electrophoresis, Marker

Journal: PLOS Genetics

Article Title: High-throughput analyses of a reconstituted diversity-generating retroelement identify intrinsic and extrinsic determinants of diversification

doi: 10.1371/journal.pgen.1012038

Figure Lengend Snippet: (A) Left, Chromosomal locations of reporter insertion. Right, Bar graph comparing the repair efficiency of reporters at the indicated chromosomal locations in MG1655. E. coli strains used in this experiment were: 63°(HCL34), 156°(HCL19), 291°(HCL24), and 317°(HCL26). (B) Schematic of Tn-seq workflow to identify factors affecting DGR-mediated reporter repair. See Methods for details. (C) Normalized Illumina read counts from each transposon insertion of the Input and Output libraries. Bump out shows changes in transposon distribution within the reporter cassette in the Input and Output libraries. (D) Volcano plot of transposon sequencing results. Vertical dotted lines represent thresholds for a four-fold increase or decrease in read counts. Data above the horizontal dotted line have Mann-Whitney p -value of 0.01 or less. (E) Normalized Illumina read counts from each transposon insertion surrounding the sbcB gene in the Input and Output libraries. (F) Bar graph showing the repair frequency of a chromosomal reporter in E. coli with the MG1655 (HCL26) vs ∆ sbcB (HCL84) with and without a functional bRT. Error bars represent standard deviation of at least biological triplicates. bRT(SMAA) denotes catalytically inactive bRT expressed from a derivative of the pDGR2 plasmid. (G) Experiments were performed as in ( F ) except that reporter repair was read-out by sequencing reporters in the cell population without kanamycin selection. Shown are the frequency (in reads per million) of sequencing reads containing the expected 18 nucleotide insertion. n = 2 biological replicates. (H) Bar graph comparing the repair frequency of a chromosomally integrated reporter in MG1655 (WT) or ∆ sbcB (HCL84) strain. These strains also contained either an empty vector pNEB309 (–), pNEB310 (expressing sbcB ) or pNEB311 (expressing the nuclease-deficient sbcB Mut ). (I) Cell-lysate-based ssDNA nuclease assay. A 5’ Alexa488 fluorescently labelled ssDNA (see for sequence) was incubated for 10 minutes at room temperature with lysates prepared from strains used in (H) or commercially available purified ExoI (NEB MS293). These samples and the unreacted ssDNA substrate (–) were resolved on a 15% polyacrylamide gel before fluorescence imaging. (J) Bar graph showing the relative abundance of TR -RNA-cDNA hybrid in MG1655 vs ∆ sbcB (HCL84) strain as measured by qRT-PCR. Error bars: standard error of the mean (SEM). n = 3 biological replicates. p-value was calculated by unpaired, two-tailed t-test.

Article Snippet: For the assay, 40 μL reactions containing 20 μL clarified cell lysates and 0.1 μM 5’ Alexa488-labeled ssDNA probe with the sequence Alexa488N/AAGGGCAGGCTGGGAAATAACGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTAATAACGGGGCGCGCGGCGTCTG (ordered from IDT) was prepared in 1X ExoI reaction buffer (NEB, MS0293) and incubated at room temperature for 10 minutes.

Techniques: Sequencing, MANN-WHITNEY, Functional Assay, Standard Deviation, Plasmid Preparation, Selection, Expressing, Nuclease Assay, Incubation, Purification, Fluorescence, Imaging, Quantitative RT-PCR, Two Tailed Test

Journal: PLOS Genetics

Article Title: High-throughput analyses of a reconstituted diversity-generating retroelement identify intrinsic and extrinsic determinants of diversification

doi: 10.1371/journal.pgen.1012038

Figure Lengend Snippet: Kanamycin repair assay was performed as described previously . Stepwise enhancement of DGR activity was achieved by i) aligning the target gene orientation with DNA replication, ii) moving the target closer to replication origin, iii) optimizing the expression of DGR components, and iv) removing the ExoI inhibitor. Relevant reporter strains and pDGR plasmids (arranged from left to right) were: HCL19/pDGR1, HCL20/pDGR1, HCL26/pDGR1, HCL26/pDGR2 and HCL84/pDGR2. Data shown here are from independent biological replicates performed separately from those presented in , , and . Bar heights represent the mean of n = 3 biological replicates; error bars indicate the standard deviation.

Article Snippet: For the assay, 40 μL reactions containing 20 μL clarified cell lysates and 0.1 μM 5’ Alexa488-labeled ssDNA probe with the sequence Alexa488N/AAGGGCAGGCTGGGAAATAACGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTAATAACGGGGCGCGCGGCGTCTG (ordered from IDT) was prepared in 1X ExoI reaction buffer (NEB, MS0293) and incubated at room temperature for 10 minutes.

Techniques: Activity Assay, Expressing, Standard Deviation