exonuclease iii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Exonuclease III E coli
    Description:
    Exonuclease III E coli 25 000 units
    Catalog Number:
    m0206l
    Price:
    244
    Size:
    25 000 units
    Category:
    Exonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs exonuclease iii
    Exonuclease III E coli
    Exonuclease III E coli 25 000 units
    https://www.bioz.com/result/exonuclease iii/product/New England Biolabs
    Average 90 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    exonuclease iii - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates"

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    Journal: Nucleic Acids Research

    doi:

    PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.
    Figure Legend Snippet: PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.

    Techniques Used: Polymerase Chain Reaction, Southern Blot, Amplification

    Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).
    Figure Legend Snippet: Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).

    Techniques Used: Polymerase Chain Reaction, Amplification

    Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.
    Figure Legend Snippet: Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.
    Figure Legend Snippet: Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).
    Figure Legend Snippet: Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).

    Techniques Used: Polymerase Chain Reaction, Amplification

    2) Product Images from "Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates"

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    Journal: Nucleic Acids Research

    doi:

    PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.
    Figure Legend Snippet: PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.

    Techniques Used: Polymerase Chain Reaction, Southern Blot, Amplification

    Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).
    Figure Legend Snippet: Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).

    Techniques Used: Polymerase Chain Reaction, Amplification

    Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.
    Figure Legend Snippet: Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.
    Figure Legend Snippet: Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).
    Figure Legend Snippet: Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).

    Techniques Used: Polymerase Chain Reaction, Amplification

    3) Product Images from "T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR"

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR

    Journal: Journal of Virology

    doi: 10.1128/JVI.01117-18

    T5 Exo and Exo III remove HBV replicative intermediates without affecting cccDNA. HepG2 hNTCP cells were seeded in a 6-well plate and infected at an mge/cell of 3,000. To block entry, Myrcludex B (2 μM) was used as a control. (A) On day 7 p.i., cytosolic DNA samples were extracted as described in Materials and Methods and hydrolyzed by Exo I (5 U, 60 min), Exo III (25 U, 60 min), Exo I and III (5 U plus 25 U, 60 min), T5 Exo (5 U, 60 min), PSD (10 U, 60 min), and EcoRI (10 U, 60 min) at 37°C for 1 h, and later on, all enzymes were heat denatured at 70°C. Samples were analyzed by Southern blotting (left) and PCR with pp466-541 (right). (B) HepG2 hNTCP cells were infected in a 6-well plate format for 7 days, and the DNA samples were Hirt extracted and hydrolyzed by the respective enzymes prior to Southern blotting (left) and cccDNA-specific PCR using pp1040-1996 (right).
    Figure Legend Snippet: T5 Exo and Exo III remove HBV replicative intermediates without affecting cccDNA. HepG2 hNTCP cells were seeded in a 6-well plate and infected at an mge/cell of 3,000. To block entry, Myrcludex B (2 μM) was used as a control. (A) On day 7 p.i., cytosolic DNA samples were extracted as described in Materials and Methods and hydrolyzed by Exo I (5 U, 60 min), Exo III (25 U, 60 min), Exo I and III (5 U plus 25 U, 60 min), T5 Exo (5 U, 60 min), PSD (10 U, 60 min), and EcoRI (10 U, 60 min) at 37°C for 1 h, and later on, all enzymes were heat denatured at 70°C. Samples were analyzed by Southern blotting (left) and PCR with pp466-541 (right). (B) HepG2 hNTCP cells were infected in a 6-well plate format for 7 days, and the DNA samples were Hirt extracted and hydrolyzed by the respective enzymes prior to Southern blotting (left) and cccDNA-specific PCR using pp1040-1996 (right).

    Techniques Used: Infection, Blocking Assay, Southern Blot, Polymerase Chain Reaction

    4) Product Images from "Strand break-induced replication fork collapse leads to C-circles, C-overhangs and telomeric recombination"

    Article Title: Strand break-induced replication fork collapse leads to C-circles, C-overhangs and telomeric recombination

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007925

    C-circles and 5' C-overhangs are linked to DNA damage-induced replication fork collapse. (A) Replication fork stalling induced by HU or aphidicolin decreases abundance of C-circles in U2OS cells. U2OS cells were treated with HU (hydroxyurea, 2mM) or aphidicolin (Aphi, 1μg/mL) for 24h and genomic DNA was purified for C-circle assay. Error bars represent the mean ± SEM of three independent experiments. Two-tailed unpaired student’s t- test was used to calculate P-values. *P
    Figure Legend Snippet: C-circles and 5' C-overhangs are linked to DNA damage-induced replication fork collapse. (A) Replication fork stalling induced by HU or aphidicolin decreases abundance of C-circles in U2OS cells. U2OS cells were treated with HU (hydroxyurea, 2mM) or aphidicolin (Aphi, 1μg/mL) for 24h and genomic DNA was purified for C-circle assay. Error bars represent the mean ± SEM of three independent experiments. Two-tailed unpaired student’s t- test was used to calculate P-values. *P

    Techniques Used: Purification, Two Tailed Test

    Endogenous ssDNA break/gap or induced ssDNA break in C-rich strand stimulates formation of C-circles and 5' C-overhangs. (A) Experimental protocol to study strand specific (G-rich or C-rich) breaks/gaps on telomere is shown schematically. HinfI and RsaI digested genomic DNA was purified and further digested with Exo III to examine potential breaks/gaps on G-strand or C-strand of telomeres. If breaks/gaps occur on C-strand, Exo III would degrade all C-strand, leaving single-stranded G-strand that can be detected by hybridization with C-rich probe under native or denatured condition. Contrariwise, only C-strand can be detected if breaks/gaps occur on G-strand. (B) Breaks/gaps occur more frequently on C-rich strand of telomere. Exo III digestion produces single-stranded DNA that is less in molecular weight than corresponding double-stranded DNA, thereby migrating faster during electrophoresis. (C) Methyl-methane sulfonate (MMS) stimulates formation of C-circle DNA in U2OS cells. U2OS cells were treated with MMS (0.25mM) for 24h and genomic DNA was purified for C-circle assay. Error bars represent the mean ± SEM of three independent experiments. Two-tailed unpaired student’s t -test was used to calculate P-values. ***P
    Figure Legend Snippet: Endogenous ssDNA break/gap or induced ssDNA break in C-rich strand stimulates formation of C-circles and 5' C-overhangs. (A) Experimental protocol to study strand specific (G-rich or C-rich) breaks/gaps on telomere is shown schematically. HinfI and RsaI digested genomic DNA was purified and further digested with Exo III to examine potential breaks/gaps on G-strand or C-strand of telomeres. If breaks/gaps occur on C-strand, Exo III would degrade all C-strand, leaving single-stranded G-strand that can be detected by hybridization with C-rich probe under native or denatured condition. Contrariwise, only C-strand can be detected if breaks/gaps occur on G-strand. (B) Breaks/gaps occur more frequently on C-rich strand of telomere. Exo III digestion produces single-stranded DNA that is less in molecular weight than corresponding double-stranded DNA, thereby migrating faster during electrophoresis. (C) Methyl-methane sulfonate (MMS) stimulates formation of C-circle DNA in U2OS cells. U2OS cells were treated with MMS (0.25mM) for 24h and genomic DNA was purified for C-circle assay. Error bars represent the mean ± SEM of three independent experiments. Two-tailed unpaired student’s t -test was used to calculate P-values. ***P

    Techniques Used: Purification, Hybridization, Molecular Weight, Electrophoresis, Two Tailed Test

    Nascent C-circles and 5' C-overhangs are generated during telomere replication. (A) FACS analysis of G1/S synchronized U2OS cells. Cells were synchronized by double thymidine block, then released and harvested at the indicated time. (B) C-circle assay was performed at the indicated time after release from G1/S. (C) Representative image and statistical analysis showing that RPA2 foci colocalize with telomere at each time point. Cells with more than 5 colocalized foci/cell were scored positively, > 100 cells were counted per time point. Error bars represent the mean ± SEM of three independent experiments.(D) BrdU pulse-labeling strategy. U2OS cells were synchronized at G1/S, released in presence of BrdU for 12h. (E) Leading, lagging and unreplicated telomeric fractions were resolved by CsCl gradient ultracentrifugation and hybridized with telomeric probe. Non-BrdU labeled U2OS was used as a negative control (upper figure). “Area under peak” for leading, lagging and unreplicated telomeres was analyzed by Graphpad Prism and the relative amount of telomeres was indicated above individual peak. (F) Nascent C-circle is predominantly associated with lagging strand DNA synthesis. C-circle assay analysis of CsCl gradient fractions in (E). The amount of C-circle in leading, lagging and unreplicated telomeres was calculated by determining
    Figure Legend Snippet: Nascent C-circles and 5' C-overhangs are generated during telomere replication. (A) FACS analysis of G1/S synchronized U2OS cells. Cells were synchronized by double thymidine block, then released and harvested at the indicated time. (B) C-circle assay was performed at the indicated time after release from G1/S. (C) Representative image and statistical analysis showing that RPA2 foci colocalize with telomere at each time point. Cells with more than 5 colocalized foci/cell were scored positively, > 100 cells were counted per time point. Error bars represent the mean ± SEM of three independent experiments.(D) BrdU pulse-labeling strategy. U2OS cells were synchronized at G1/S, released in presence of BrdU for 12h. (E) Leading, lagging and unreplicated telomeric fractions were resolved by CsCl gradient ultracentrifugation and hybridized with telomeric probe. Non-BrdU labeled U2OS was used as a negative control (upper figure). “Area under peak” for leading, lagging and unreplicated telomeres was analyzed by Graphpad Prism and the relative amount of telomeres was indicated above individual peak. (F) Nascent C-circle is predominantly associated with lagging strand DNA synthesis. C-circle assay analysis of CsCl gradient fractions in (E). The amount of C-circle in leading, lagging and unreplicated telomeres was calculated by determining "area under peak" using Graphpad Prism. The relative amount of C-circles was indicated above individual peak. (G) Schematic of the migration of linear dsDNA, ssDNA (C-overhangs) and telomeric open circles (T-circle) during 2D agarose gel electrophoresis and hybridization to a telomere-specific G-rich probe under native or denatured condition. (H) 5' C-overhang DNA is predominantly associated with leading strand DNA synthesis. The fractions corresponding to leading, lagging or non-replication telomeres from 12h BrdU labeled sample in (E) were pooled. DNA was incubated with or without RecJf, analyzed by 2D agarose gel electrophoresis and hybridized with G-rich telomeric probe under native and denaturing conditions. C-overhangs were indicated by red arrows. C-overhangs abundance was expressed as a ratio between the native and denatured signals. Values were then normalized with leading C-overhangs to obtain relative abundance.

    Techniques Used: Generated, FACS, Blocking Assay, Labeling, Negative Control, DNA Synthesis, Migration, Agarose Gel Electrophoresis, Hybridization, Incubation

    5) Product Images from "Fluorescence spectroscopic detection and measurement of single telomere molecules"

    Article Title: Fluorescence spectroscopic detection and measurement of single telomere molecules

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky627

    Principle of telomere measurement by PHAST. ( A ) The biological effects of telomeres are mediated primarily by the proportion of telomeres below a critical length. ( i ) This most commonly happens in ageing, where the telomeres in a cell population shorten with doubling. However, the proportion of short telomeres can also reach critical levels when the average telomere length is normal. ( ii ) This can happen due to the naturally occurring diversity in the shape of the distribution between individuals, or ( iii ) if the telomere distribution is highly heterogeneous. ( B ) To perform our assay, cells are lyzed to release the DNA from the nucleus, and incubated with biotinylated PNA probes. Telomeric DNA is separated from genomic DNA using magnetic beads, and released after washing, whereupon fluorescent probes are hybridized to the telomeric sequences. ( C ) The labelled DNA is then flowed through a microchannel, and excited by a laser through an objective as it transits the observation volume (OV). These peaks can then be processed to yield the telomere distribution.
    Figure Legend Snippet: Principle of telomere measurement by PHAST. ( A ) The biological effects of telomeres are mediated primarily by the proportion of telomeres below a critical length. ( i ) This most commonly happens in ageing, where the telomeres in a cell population shorten with doubling. However, the proportion of short telomeres can also reach critical levels when the average telomere length is normal. ( ii ) This can happen due to the naturally occurring diversity in the shape of the distribution between individuals, or ( iii ) if the telomere distribution is highly heterogeneous. ( B ) To perform our assay, cells are lyzed to release the DNA from the nucleus, and incubated with biotinylated PNA probes. Telomeric DNA is separated from genomic DNA using magnetic beads, and released after washing, whereupon fluorescent probes are hybridized to the telomeric sequences. ( C ) The labelled DNA is then flowed through a microchannel, and excited by a laser through an objective as it transits the observation volume (OV). These peaks can then be processed to yield the telomere distribution.

    Techniques Used: Incubation, Magnetic Beads

    Telomere length (TL) determination using peak height. ( A ) Peak height is converted to TL using a simple linear equation derived from telomere standards of known lengths. The resulting three sets of TL estimates are nearly identical despite having been performed at 6-month intervals, with high linearity ( R 2 > 0.99). This reproducibility demonstrates the ability of PHAST to provide absolute telomere lengths with minimal calibration. ( B ) The six standards can be distinguished from each other by PHAST even when pre-mixed prior to detection, and have a smaller CV as the TL increases, as evidenced by the narrowing of the distributions with longer TL. ( C ) We have demonstrated the robustness of PHAST, by detecting a 2.4 kb telomere standard with and without a large excess of genomic DNA. Because the spurious peaks far outnumber the real peaks (by a factor of 10 to 1), the traces are normalized for clarity. After gating, the sample with genomic DNA (red solid trace) was essentially the same as that without any genomic DNA (black dashed trace). ( D ) To determine the ability to detect short telomeres using PHAST, 200-bp telomere standard is mixed at varying proportions with the 900-bp standard (0–50%). ( E ) After gating and counting the two sub-populations, the measured proportion was plotted against the nominal proportion. The two numbers were very consistent, with a slightly higher proportion measured than expected. This is attributed to incomplete labeling of some of the longer telomeres, which are misidentified as short telomeres. ( F ) Q – Q plots for the telomere estimates determined by PHAST and q-FISH are presented with three different cell lines (WI-83, U2OS and R83). This allows the distributions between two measurement methods to be compared directly even in the absence of common units and when the number of data points differs. Although PHAST and q-FISH are different methods, they yielded similar distribution shapes, as evidenced by the largely linear relationship between the corresponding quantiles. The red dashed line in each plot is the extrapolation of the interquartile range.
    Figure Legend Snippet: Telomere length (TL) determination using peak height. ( A ) Peak height is converted to TL using a simple linear equation derived from telomere standards of known lengths. The resulting three sets of TL estimates are nearly identical despite having been performed at 6-month intervals, with high linearity ( R 2 > 0.99). This reproducibility demonstrates the ability of PHAST to provide absolute telomere lengths with minimal calibration. ( B ) The six standards can be distinguished from each other by PHAST even when pre-mixed prior to detection, and have a smaller CV as the TL increases, as evidenced by the narrowing of the distributions with longer TL. ( C ) We have demonstrated the robustness of PHAST, by detecting a 2.4 kb telomere standard with and without a large excess of genomic DNA. Because the spurious peaks far outnumber the real peaks (by a factor of 10 to 1), the traces are normalized for clarity. After gating, the sample with genomic DNA (red solid trace) was essentially the same as that without any genomic DNA (black dashed trace). ( D ) To determine the ability to detect short telomeres using PHAST, 200-bp telomere standard is mixed at varying proportions with the 900-bp standard (0–50%). ( E ) After gating and counting the two sub-populations, the measured proportion was plotted against the nominal proportion. The two numbers were very consistent, with a slightly higher proportion measured than expected. This is attributed to incomplete labeling of some of the longer telomeres, which are misidentified as short telomeres. ( F ) Q – Q plots for the telomere estimates determined by PHAST and q-FISH are presented with three different cell lines (WI-83, U2OS and R83). This allows the distributions between two measurement methods to be compared directly even in the absence of common units and when the number of data points differs. Although PHAST and q-FISH are different methods, they yielded similar distribution shapes, as evidenced by the largely linear relationship between the corresponding quantiles. The red dashed line in each plot is the extrapolation of the interquartile range.

    Techniques Used: Derivative Assay, Labeling, Fluorescence In Situ Hybridization

    6) Product Images from "High-Discrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells"

    Article Title: High-Discrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells

    Journal: Theranostics

    doi: 10.7150/thno.23852

    Enzymatic resistance of phosphorothioate-modified Au-TDNNs. (A, B) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by DNase I. (C, D) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by Exo III.
    Figure Legend Snippet: Enzymatic resistance of phosphorothioate-modified Au-TDNNs. (A, B) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by DNase I. (C, D) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by Exo III.

    Techniques Used: Modification, Fluorescence

    7) Product Images from "Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition"

    Article Title: Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition

    Journal: eLife

    doi: 10.7554/eLife.39611

    Footprint analysis of IS 1535 deletion substrate LE(v54-20v) containing the minimal transposon sequences required for efficient PEC assembly. ( A ) DNase I footprints of PEC assembly reactions on 5′- 32 P-labeled bottom and top strands of LE(v54-20v). TnpA concentrations were from 4 to 128 nM in 2-fold increasing amounts. Shaded rectangles on the left of the gels denote the positions of transposon sequences; coordinates labeled with v are vector sequences with vH being the equivalent locations of host DNA. The bars on the right of the gels denote regions of significant changes in DNase I reactivity by TnpA with dashes indicating weakly protected regions. ( B ) Exonuclease III delineated boundaries of TnpA binding. TnpA concentrations are the same as in panel A. ( C ) Summary of DNase I (strongly protected regions, blue) and Exo III digestion boundaries on the LE(v54-20v) sequence. Small letters denote vector sequence.
    Figure Legend Snippet: Footprint analysis of IS 1535 deletion substrate LE(v54-20v) containing the minimal transposon sequences required for efficient PEC assembly. ( A ) DNase I footprints of PEC assembly reactions on 5′- 32 P-labeled bottom and top strands of LE(v54-20v). TnpA concentrations were from 4 to 128 nM in 2-fold increasing amounts. Shaded rectangles on the left of the gels denote the positions of transposon sequences; coordinates labeled with v are vector sequences with vH being the equivalent locations of host DNA. The bars on the right of the gels denote regions of significant changes in DNase I reactivity by TnpA with dashes indicating weakly protected regions. ( B ) Exonuclease III delineated boundaries of TnpA binding. TnpA concentrations are the same as in panel A. ( C ) Summary of DNase I (strongly protected regions, blue) and Exo III digestion boundaries on the LE(v54-20v) sequence. Small letters denote vector sequence.

    Techniques Used: Labeling, Plasmid Preparation, Binding Assay, Sequencing

    8) Product Images from "High-Discrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells"

    Article Title: High-Discrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells

    Journal: Theranostics

    doi: 10.7150/thno.23852

    Enzymatic resistance of phosphorothioate-modified Au-TDNNs. (A, B) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by DNase I. (C, D) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by Exo III.
    Figure Legend Snippet: Enzymatic resistance of phosphorothioate-modified Au-TDNNs. (A, B) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by DNase I. (C, D) Fluorescence time graph depicting terminal-modified Au-TDNN and overall-modified Au-TDNN degradation by Exo III.

    Techniques Used: Modification, Fluorescence

    9) Product Images from "Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition"

    Article Title: Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition

    Journal: eLife

    doi: 10.7554/eLife.39611

    Footprint analysis of IS 1535 deletion substrate LE(v54-20v) containing the minimal transposon sequences required for efficient PEC assembly. ( A ) DNase I footprints of PEC assembly reactions on 5′- 32 P-labeled bottom and top strands of LE(v54-20v). TnpA concentrations were from 4 to 128 nM in 2-fold increasing amounts. Shaded rectangles on the left of the gels denote the positions of transposon sequences; coordinates labeled with v are vector sequences with vH being the equivalent locations of host DNA. The bars on the right of the gels denote regions of significant changes in DNase I reactivity by TnpA with dashes indicating weakly protected regions. ( B ) Exonuclease III delineated boundaries of TnpA binding. TnpA concentrations are the same as in panel A. ( C ) Summary of DNase I (strongly protected regions, blue) and Exo III digestion boundaries on the LE(v54-20v) sequence. Small letters denote vector sequence.
    Figure Legend Snippet: Footprint analysis of IS 1535 deletion substrate LE(v54-20v) containing the minimal transposon sequences required for efficient PEC assembly. ( A ) DNase I footprints of PEC assembly reactions on 5′- 32 P-labeled bottom and top strands of LE(v54-20v). TnpA concentrations were from 4 to 128 nM in 2-fold increasing amounts. Shaded rectangles on the left of the gels denote the positions of transposon sequences; coordinates labeled with v are vector sequences with vH being the equivalent locations of host DNA. The bars on the right of the gels denote regions of significant changes in DNase I reactivity by TnpA with dashes indicating weakly protected regions. ( B ) Exonuclease III delineated boundaries of TnpA binding. TnpA concentrations are the same as in panel A. ( C ) Summary of DNase I (strongly protected regions, blue) and Exo III digestion boundaries on the LE(v54-20v) sequence. Small letters denote vector sequence.

    Techniques Used: Labeling, Plasmid Preparation, Binding Assay, Sequencing

    10) Product Images from "Quantum Dot Doping-Induced Photoluminescence for Facile, Label-Free, and Sensitive Pyrophosphatase Activity Assay and Inhibitor Screening"

    Article Title: Quantum Dot Doping-Induced Photoluminescence for Facile, Label-Free, and Sensitive Pyrophosphatase Activity Assay and Inhibitor Screening

    Journal: Nanomaterials

    doi: 10.3390/nano9010111

    ( A ) Fluorescence spectra of QD upon incubation of different concentrations of PPase from 0 to 20 mU/mL; ( B ) Relationship of the fluorescence intensity of QD at 510 nm, with the PPase concentration. Inset shows the corresponding linear range. ( C ) The specificity of the proposed sensing strategy toward PPase, against Exo I, Exo III, GOx, and lysozyme. The concentration of PPase was 10 mU/mL, and the concentrations for all other proteins were 0.1 U/mL. ( D ) The fluorescence intensities of QD, into the mixture of Cu 2+ (10 µM), Cu 2+ (10 µM) + PPi (20 µM), and Cu 2+ (10 µM) + PPi (20 µM) + PPase (1, 10 mU/mL), respectively, in the buffer solution and 5% diluted fetal bovine serum (FBS). Error bars in ( B – D ), for each data point, indicate the standard deviations, which were calculated on the basis of three repetitive experiments.
    Figure Legend Snippet: ( A ) Fluorescence spectra of QD upon incubation of different concentrations of PPase from 0 to 20 mU/mL; ( B ) Relationship of the fluorescence intensity of QD at 510 nm, with the PPase concentration. Inset shows the corresponding linear range. ( C ) The specificity of the proposed sensing strategy toward PPase, against Exo I, Exo III, GOx, and lysozyme. The concentration of PPase was 10 mU/mL, and the concentrations for all other proteins were 0.1 U/mL. ( D ) The fluorescence intensities of QD, into the mixture of Cu 2+ (10 µM), Cu 2+ (10 µM) + PPi (20 µM), and Cu 2+ (10 µM) + PPi (20 µM) + PPase (1, 10 mU/mL), respectively, in the buffer solution and 5% diluted fetal bovine serum (FBS). Error bars in ( B – D ), for each data point, indicate the standard deviations, which were calculated on the basis of three repetitive experiments.

    Techniques Used: Fluorescence, Incubation, Concentration Assay

    11) Product Images from "Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes"

    Article Title: Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes

    Journal: Scientific Reports

    doi: 10.1038/srep28474

    Differential inhibition of dumbbell decoy activity by DNA adducts of BBR 3464 as compared with cisplatin and transplatin in HEK293-NF-кB-luciferase reporter cell line. The percentage of inhibition of the specific decoy activity was calculated by measuring, for each experiment, the difference between luciferase activities obtained with cells transfected with platinated DUMBBELL-кB and nonplatinated DUMBBELL-kB divided by the difference between luciferase activities obtained with cells transfected with nonplatinated scrambled and specific (κB-site containing) DUMBBELL decoy oligonucleotides. Data represent the mean ± SD obtained from triplicate wells and are representative of at least three independent experiments. Data for ciplatin and transplatin were taken from ref. 10 .
    Figure Legend Snippet: Differential inhibition of dumbbell decoy activity by DNA adducts of BBR 3464 as compared with cisplatin and transplatin in HEK293-NF-кB-luciferase reporter cell line. The percentage of inhibition of the specific decoy activity was calculated by measuring, for each experiment, the difference between luciferase activities obtained with cells transfected with platinated DUMBBELL-кB and nonplatinated DUMBBELL-kB divided by the difference between luciferase activities obtained with cells transfected with nonplatinated scrambled and specific (κB-site containing) DUMBBELL decoy oligonucleotides. Data represent the mean ± SD obtained from triplicate wells and are representative of at least three independent experiments. Data for ciplatin and transplatin were taken from ref. 10 .

    Techniques Used: Inhibition, Activity Assay, Luciferase, Transfection

    Binding of NF-кB proteins to the DNA duplex containing the кB site. ( A ) The nucleotide sequence of the 22-bp oligodeoxyribonucleotide duplex containing κB site (DUPLEX-κB). The bold letters in the sequence indicate the κB recognition sequence. Left panels in Fig. 2B–D. Binding of p50/p65 heterodimer and p50/p50 and p65/p65 homodimers to the DUPLEX-κB containing the кB site (( B–D ), respectively). The panels show autoradiograms of the EMSA experiments showing the binding of p50/p65 heterodimer (Fig. 2B), p50/p50 (Fig. 2C) and p65/p65 (Fig. 2D) homodimers to the DUPLEX-κB. Lanes 1 and 2, non-modified duplex; lanes 3–5, duplex globally modified by BBR3464 at r b = 0.023, 0.045, or 0.091, respectively. The gel mobility shift assay was performed as described in the section Materials and Methods; concentration of the oligonucleotide duplex was 1 nM and the concentrations of p50/p50, p65/p65 and p50/p65 were 10, 15 and 15 nM, respectively. Right panels in Fig. 2B–D. Plots of the amount of the DUPLEX-κB modified by BBR3464 (full line), cisplatin (dashed line) or transplatin (dotted line) in complex with p50/p65 heterodimer (Fig. 2B), p50/p50 (Fig. 2C) and p65/p65 homodimers (Fig. 2D) on r b ; the data for cisplatin and transplatin were taken from ref. 10 . Data are the mean ± SD obtained from three different experiments.
    Figure Legend Snippet: Binding of NF-кB proteins to the DNA duplex containing the кB site. ( A ) The nucleotide sequence of the 22-bp oligodeoxyribonucleotide duplex containing κB site (DUPLEX-κB). The bold letters in the sequence indicate the κB recognition sequence. Left panels in Fig. 2B–D. Binding of p50/p65 heterodimer and p50/p50 and p65/p65 homodimers to the DUPLEX-κB containing the кB site (( B–D ), respectively). The panels show autoradiograms of the EMSA experiments showing the binding of p50/p65 heterodimer (Fig. 2B), p50/p50 (Fig. 2C) and p65/p65 (Fig. 2D) homodimers to the DUPLEX-κB. Lanes 1 and 2, non-modified duplex; lanes 3–5, duplex globally modified by BBR3464 at r b = 0.023, 0.045, or 0.091, respectively. The gel mobility shift assay was performed as described in the section Materials and Methods; concentration of the oligonucleotide duplex was 1 nM and the concentrations of p50/p50, p65/p65 and p50/p65 were 10, 15 and 15 nM, respectively. Right panels in Fig. 2B–D. Plots of the amount of the DUPLEX-κB modified by BBR3464 (full line), cisplatin (dashed line) or transplatin (dotted line) in complex with p50/p65 heterodimer (Fig. 2B), p50/p50 (Fig. 2C) and p65/p65 homodimers (Fig. 2D) on r b ; the data for cisplatin and transplatin were taken from ref. 10 . Data are the mean ± SD obtained from three different experiments.

    Techniques Used: Binding Assay, Sequencing, Modification, Mobility Shift, Concentration Assay

    12) Product Images from "Sensitive RNA detection by combining three-way junction formation and primer generation-rolling circle amplification"

    Article Title: Sensitive RNA detection by combining three-way junction formation and primer generation-rolling circle amplification

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr909

    RNA detection mechanism by three-way junction probe and primer generation-rolling circle amplification. ( A ) Three-way junction (3WJ) probes (primer and template) are designed to form a 3WJ structure on target RNA, however they do not interact each other without target RNA because their complementary sequence is only 6–8 bases. ( B ) Addition of DNA polymerase and nicking enzyme initiates a reaction cycle of primer extension, nicking reaction and signal primer generation under an isothermal condition to generate signal primers. ( C ) The generated signal primers can be detected by primer generation-rolling circle amplification.
    Figure Legend Snippet: RNA detection mechanism by three-way junction probe and primer generation-rolling circle amplification. ( A ) Three-way junction (3WJ) probes (primer and template) are designed to form a 3WJ structure on target RNA, however they do not interact each other without target RNA because their complementary sequence is only 6–8 bases. ( B ) Addition of DNA polymerase and nicking enzyme initiates a reaction cycle of primer extension, nicking reaction and signal primer generation under an isothermal condition to generate signal primers. ( C ) The generated signal primers can be detected by primer generation-rolling circle amplification.

    Techniques Used: RNA Detection, Amplification, Sequencing, Generated

    13) Product Images from "A Label-Free and Sensitive Fluorescent Qualitative Assay for Bisphenol A Based on Rolling Circle Amplification/Exonuclease III-Combined Cascade Amplification"

    Article Title: A Label-Free and Sensitive Fluorescent Qualitative Assay for Bisphenol A Based on Rolling Circle Amplification/Exonuclease III-Combined Cascade Amplification

    Journal: Nanomaterials

    doi: 10.3390/nano6100190

    Fluorescence-emission spectra of zinc(II)-protoporphyrin IX (ZnPPIX)/G-quadruplex supramolecular fluorescent labels under different conditions: ( a ) Buffer; ( b ) Buffer + ZnPPIX; ( c ) RP (DNA duplex probe) + Circle DNA + hairpin probes (GHP) + Exonuclease III (Exo III) + ZnPPIX; ( d ) BPA + RP + Circle DNA + GHP + Exo III + ZnPPIX; C BPA = 1.0 μM, C RP = 1.0 μM, C Circle DNA = 100 nM, C GHP = 25 μM, C Exo III = 100 U, C ZnPPIX = 20 μM, RCA reaction time 1.5 h.
    Figure Legend Snippet: Fluorescence-emission spectra of zinc(II)-protoporphyrin IX (ZnPPIX)/G-quadruplex supramolecular fluorescent labels under different conditions: ( a ) Buffer; ( b ) Buffer + ZnPPIX; ( c ) RP (DNA duplex probe) + Circle DNA + hairpin probes (GHP) + Exonuclease III (Exo III) + ZnPPIX; ( d ) BPA + RP + Circle DNA + GHP + Exo III + ZnPPIX; C BPA = 1.0 μM, C RP = 1.0 μM, C Circle DNA = 100 nM, C GHP = 25 μM, C Exo III = 100 U, C ZnPPIX = 20 μM, RCA reaction time 1.5 h.

    Techniques Used: Fluorescence

    Schematic illustration the principle of the fluorescent assay of Bisphenol A (BPA) based on the rolling circle amplification (RCA)/Exo III-combined cascade signal amplification strategy.
    Figure Legend Snippet: Schematic illustration the principle of the fluorescent assay of Bisphenol A (BPA) based on the rolling circle amplification (RCA)/Exo III-combined cascade signal amplification strategy.

    Techniques Used: Fluorescence, Amplification

    ( a ) Agarose gel (0.7%) electrophoresis: (1) DNA 1 alone; (2) P 1 alone; (3) Circle DNA alone; (4) GHP alone; (5) RP + Circle DNA; (6) BPA + RP + Circle DNA; (7) RP + Circle DNA + GHP; (8) BPA + RP + Circle DNA + GHP; ( b ) Atomic force microscope (AFM) images of amplification products of RCA/Exo III-combined cascade signal amplification reaction. C DNA1 = 1.0 μM, C P1 = 1.0 μM, C RP = 1.0 μM, C Circle DNA = 100 nM, C GHP = 25 μM, C Exo III = 100 U, RCA reaction time 1.5 h.
    Figure Legend Snippet: ( a ) Agarose gel (0.7%) electrophoresis: (1) DNA 1 alone; (2) P 1 alone; (3) Circle DNA alone; (4) GHP alone; (5) RP + Circle DNA; (6) BPA + RP + Circle DNA; (7) RP + Circle DNA + GHP; (8) BPA + RP + Circle DNA + GHP; ( b ) Atomic force microscope (AFM) images of amplification products of RCA/Exo III-combined cascade signal amplification reaction. C DNA1 = 1.0 μM, C P1 = 1.0 μM, C RP = 1.0 μM, C Circle DNA = 100 nM, C GHP = 25 μM, C Exo III = 100 U, RCA reaction time 1.5 h.

    Techniques Used: Agarose Gel Electrophoresis, Electrophoresis, Microscopy, Amplification

    14) Product Images from "Molecular interactions of Escherichia coli ExoIX and identification of its associated 3?-5? exonuclease activity"

    Article Title: Molecular interactions of Escherichia coli ExoIX and identification of its associated 3?-5? exonuclease activity

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm396

    Chromatographic separation of 3′-5′ exodeoxyribonuclease activity associated with preparations of Exonuclease IX. ( A ) SDS–PAGE analysis of the purification of ExoIX from cell lysate of induced BL21 (pJONEX/ xni , pcI857). SPL, cleared cell lysate applied to SP/first Heparin column (28 µg); QL, Q load (6 µg); H2L, second Heparin column load (5 µg); IX, concentrated ExoIX eluate from second Heparin (7.5 µg). (B–D). Eluted fractions from first Heparin column were separated by SDS–PAGE. ( B ) Ethidium bromide stained substrate gel. High molecular weight DNA cast in the gel fluoresces with UV, while regions of DNA degradation appear as darker bands. Early fractions (lanes 1–4), contain detectable exonuclease activity. ( C ) The same gel counter-stained with Coomassie G250. Over-expressed ExoIX is eluted in later fractions (lanes 5 and 6). ( D ) Superimposition of images in panels B and C, demonstrating that exonuclease activity can be resolved from ExoIX. A fraction represented in lane 4 was used for subsequent enrichment and identification of the co-purifying nuclease. Lanes, 1–6, heparin fractions (2.5 µl); 7, loading sample (5 µl); 8, flow through (5 µl). ( E ) Highly purified ExoIX lacks activity on a single-stranded DNA substrate (34-mer). Protein samples taken during the purification of ExoIX were incubated with 15 fmol 32 P-labelled 34-mer at 37°C for 10 min in the presence of 10 mM MgCl 2 and the reaction products separated by denaturing PAGE. Reactions (10 µl) contained varying amounts of protein. SPL, 0.7 and 0.07 µg of protein from cell-free extract of induced cells expressing ExoIX; QL, 0.1 and 0.01 µg of protein loaded on to first anion exchange column; H2L, 3 and 0.3 µg of protein from sample loaded onto second heparin column; IX, contains samples from final purified fraction of ExoIX eluted from second heparin column, 5 and 0.5 µg; two positive controls are also shown, bacteriophage T5 D15 exonuclease (T5), 0.1 and 0.01 µg and exonuclease III (III), 0.03 and 0.003 µg.
    Figure Legend Snippet: Chromatographic separation of 3′-5′ exodeoxyribonuclease activity associated with preparations of Exonuclease IX. ( A ) SDS–PAGE analysis of the purification of ExoIX from cell lysate of induced BL21 (pJONEX/ xni , pcI857). SPL, cleared cell lysate applied to SP/first Heparin column (28 µg); QL, Q load (6 µg); H2L, second Heparin column load (5 µg); IX, concentrated ExoIX eluate from second Heparin (7.5 µg). (B–D). Eluted fractions from first Heparin column were separated by SDS–PAGE. ( B ) Ethidium bromide stained substrate gel. High molecular weight DNA cast in the gel fluoresces with UV, while regions of DNA degradation appear as darker bands. Early fractions (lanes 1–4), contain detectable exonuclease activity. ( C ) The same gel counter-stained with Coomassie G250. Over-expressed ExoIX is eluted in later fractions (lanes 5 and 6). ( D ) Superimposition of images in panels B and C, demonstrating that exonuclease activity can be resolved from ExoIX. A fraction represented in lane 4 was used for subsequent enrichment and identification of the co-purifying nuclease. Lanes, 1–6, heparin fractions (2.5 µl); 7, loading sample (5 µl); 8, flow through (5 µl). ( E ) Highly purified ExoIX lacks activity on a single-stranded DNA substrate (34-mer). Protein samples taken during the purification of ExoIX were incubated with 15 fmol 32 P-labelled 34-mer at 37°C for 10 min in the presence of 10 mM MgCl 2 and the reaction products separated by denaturing PAGE. Reactions (10 µl) contained varying amounts of protein. SPL, 0.7 and 0.07 µg of protein from cell-free extract of induced cells expressing ExoIX; QL, 0.1 and 0.01 µg of protein loaded on to first anion exchange column; H2L, 3 and 0.3 µg of protein from sample loaded onto second heparin column; IX, contains samples from final purified fraction of ExoIX eluted from second heparin column, 5 and 0.5 µg; two positive controls are also shown, bacteriophage T5 D15 exonuclease (T5), 0.1 and 0.01 µg and exonuclease III (III), 0.03 and 0.003 µg.

    Techniques Used: Activity Assay, SDS Page, Purification, Staining, Molecular Weight, Flow Cytometry, Incubation, Polyacrylamide Gel Electrophoresis, Expressing

    Related Articles

    Clone Assay:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The pPI1-His construct was obtained by PCR-mediated amplification of pi1 from pPCR102-2 using primers OD5: 5′-CG GGATCC ATGGATCTGTCTCAGTCTCAGTCTC -3′ and OD6: 5′-CCC GATATC AGACAGAGACAATCCATTCGAACAGA -3′, (annealing sequences are underlined and extensions containing BamHI and EcoRV restriction sites are shown in bold) followed by cloning of the BamHI/EcoRV-digested pi1 -encoding PCR product into BamHI/EcoRV-restricted pEF6/V5-His-TOPO (Invitrogen, Carlsbad, CA), in-frame with histidine tag and stop codon.

    Amplification:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: The products of the first amplification round were diluted 1:20 in H2 O and used as template for the second PCR employing identical primers and reaction conditions. .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Stable Transfection:

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR
    Article Snippet: HepG2, HepaRG, Hepa1-6, Hepa56D, and HeLa cells stably expressing hNTCP were cultivated as described previously ( , ). .. T5 Exo (M0363), BAL-31 nuclease (M0213), exonuclease I (M0293), exonuclease III (M0206), exonuclease V (RecBCD, M0345), mung bean nuclease (M0250), EcoRI (R0101), and Nb.BtsI (R0707) were purchased from New England Biolabs.

    Polymerase Chain Reaction:

    Article Title: Direct Detection and Sequencing of Damaged DNA Bases
    Article Snippet: Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (NEB; Ipswich, MA) and Exonuclease VII (USB; Cleveland, OH) at 37°C for 30 minutes. .. SMRTbell templates were purified using QIAquick PCR Purification columns (Qiagen; Valencia, CA).

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA. .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL.

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. ..

    Article Title: Proofreading dynamics of a processive DNA polymerase
    Article Snippet: The newly generated 3′ end was cleaved with 0.3 μl of Exonuclease III (100 U/μl) (New England Biolabs) in the nicking enzyme buffer for 2 min at 37°C, in order to create a ∼400 nucleotide long ssDNA gap. .. The DNA was purified with the Qiagen PCR Purification Kit (Qiagen) and digested with Hin dIII and Bam HI restriction endonucleases (New England Biolabs) following the manufacturer's reaction conditions.

    Construct:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The pPI1-His construct was obtained by PCR-mediated amplification of pi1 from pPCR102-2 using primers OD5: 5′-CG GGATCC ATGGATCTGTCTCAGTCTCAGTCTC -3′ and OD6: 5′-CCC GATATC AGACAGAGACAATCCATTCGAACAGA -3′, (annealing sequences are underlined and extensions containing BamHI and EcoRV restriction sites are shown in bold) followed by cloning of the BamHI/EcoRV-digested pi1 -encoding PCR product into BamHI/EcoRV-restricted pEF6/V5-His-TOPO (Invitrogen, Carlsbad, CA), in-frame with histidine tag and stop codon.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: The titer of the library was determined using the p24 ELISA assay (NEK-050, Perkin Elmer, Boston, MA). .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    IA:

    Article Title: Direct Detection and Sequencing of Damaged DNA Bases
    Article Snippet: Methods Custom oligonucleotides containing modified bases were purchased from Bio-synthesis (Lewisville, TX), Trilink BioTechnologies (San Diego, CA), ChemGenes (Wilmington, MA) and Integrated DNA Technologies (Coralville, IA). .. Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (NEB; Ipswich, MA) and Exonuclease VII (USB; Cleveland, OH) at 37°C for 30 minutes.

    Article Title: Roles of Translesion Synthesis DNA Polymerases in the Potent Mutagenicity of Tobacco-Specific Nitrosamine-Derived O2-Alkylthymidines in Human Cells
    Article Snippet: All enzymes, including EcoR V restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, uracil DNA glycosylase, and exonuclease III, were obtained from New England Bioloabs (Beverly, MA). .. The siRNA for REV3 was purchased from Integrated DNA Technologies (Coralville, IA).

    Incubation:

    Article Title: Elongation complexes of Thermus thermophilus RNA polymerase that possess distinct translocation conformations
    Article Snippet: EC15 was obtained by incubation of EC14 with substrate ATP for 2 min at 60°C. .. Exonuclease III (Exo III) (NEB, 0.1 U/μl) was added for 5–10 min at 37°C.

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: For the probe hybridization phase, these mixtures were incubated in a thermocycler (Bio-Rad) with a heated lid at 98°C for 3 min, 85°C for 30 min, 60°C for 60 min, and 56°C for 120 min. For the gap-fill and ligation phase, we added 300 picomoles each dNTPs (NEB), 7.5 micromoles betaine (Sigma), 20 nanomoles NAD+ (NEB), 1 μL of 10× Ampligase buffer, 5 units of Ampligase DNA ligase (Epicentre), 3.2 units of Phusion DNA polymerase (NEB), and molecular biology grade water to 10 mL for a total reaction volume of 20 μL. .. Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA.

    Article Title: Saccharomyces cerevisiae Red1 protein exhibits nonhomologous DNA end–joining activity and potentiates Hop1-promoted pairing of double-stranded DNA
    Article Snippet: .. After incubation at 30 °C for 30 min, 2 μl of T4 DNA ligase buffer and 10 units of T4 DNA ligase (Thermo Scientific) were added, and the incubation was extended at 30 °C for 20 min. For reactions involving exonuclease III (Exo III), samples were further incubated at 37 °C for 30 min in the presence of 5 units of Exo III (New England Biolabs). .. The reactions were terminated by the addition of 1 μl of 20% SDS and 1 μl of 10 mg/ml proteinase K and incubated at 37 °C for 30 min.

    Article Title: Streamlined circular proximity ligation assay provides high stringency and compatibility with low-affinity antibodies
    Article Snippet: Ligation was terminated by adding 10 μL of exonuclease mixture and incubated for 30 min at 37 °C followed by heat inactivation of exonuclease enzymes for 20 min at 80 °C. .. Exonuclease mixture contained 2 U/μL exonuclease I (New England Biolabs) and 2 U/μL exonuclease III (New England Biolabs) in 1× NEBuffer 1 containing 10 mM Bis⋅Tris⋅Propane⋅HCl, pH 7.0, 10 mM MgCl2 , and 1 mM DTT (New England Biolabs).

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: Then ligase (10 U) was added to the mixture and further incubated at 28°C for 15 min. .. If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution.

    Expressing:

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR
    Article Snippet: HepG2, HepaRG, Hepa1-6, Hepa56D, and HeLa cells stably expressing hNTCP were cultivated as described previously ( , ). .. T5 Exo (M0363), BAL-31 nuclease (M0213), exonuclease I (M0293), exonuclease III (M0206), exonuclease V (RecBCD, M0345), mung bean nuclease (M0250), EcoRI (R0101), and Nb.BtsI (R0707) were purchased from New England Biolabs.

    Modification:

    Article Title: Direct Detection and Sequencing of Damaged DNA Bases
    Article Snippet: SMRTbell templates were generated by ligating several synthetic oligonucleotides, one of which contained two instances of a chemical base modification (Additional File ). .. Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (NEB; Ipswich, MA) and Exonuclease VII (USB; Cleveland, OH) at 37°C for 30 minutes.

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR
    Article Snippet: HepG2hNTCP , Hepa1-6hNTCP , Hepa56DhNTCP , and HeLahNTCP cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 2 mM l -glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 1 mM nonessential amino acids. .. T5 Exo (M0363), BAL-31 nuclease (M0213), exonuclease I (M0293), exonuclease III (M0206), exonuclease V (RecBCD, M0345), mung bean nuclease (M0250), EcoRI (R0101), and Nb.BtsI (R0707) were purchased from New England Biolabs.

    Hybridization:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: For the probe hybridization phase, these mixtures were incubated in a thermocycler (Bio-Rad) with a heated lid at 98°C for 3 min, 85°C for 30 min, 60°C for 60 min, and 56°C for 120 min. For the gap-fill and ligation phase, we added 300 picomoles each dNTPs (NEB), 7.5 micromoles betaine (Sigma), 20 nanomoles NAD+ (NEB), 1 μL of 10× Ampligase buffer, 5 units of Ampligase DNA ligase (Epicentre), 3.2 units of Phusion DNA polymerase (NEB), and molecular biology grade water to 10 mL for a total reaction volume of 20 μL. .. Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA.

    Flow Cytometry:

    Article Title: Capturing native long-range contiguity by in situ library construction and optical sequencing
    Article Snippet: .. After ligation, we removed unligated genomic DNA and adaptors by adding 1 µL of exonuclease III (NEB) and 0.5 µL of exonuclease VII (Epicentre) and incubating the reaction at 37 °C for 3 h. Finally, we removed the uracil bases by adding 2 µL of USER (NEB) and incubating the reaction at 37 °C for 30 min to generate single-stranded flow cell complementary 3′-tails. .. We performed a final size selection on a 1% agarose gel run at 100 V for 2 h and quantified the libraries on a Qubit (Invitrogen).

    DNA Ligation:

    Article Title: Saccharomyces cerevisiae Red1 protein exhibits nonhomologous DNA end–joining activity and potentiates Hop1-promoted pairing of double-stranded DNA
    Article Snippet: Paragraph title: DNA ligation assay ... After incubation at 30 °C for 30 min, 2 μl of T4 DNA ligase buffer and 10 units of T4 DNA ligase (Thermo Scientific) were added, and the incubation was extended at 30 °C for 20 min. For reactions involving exonuclease III (Exo III), samples were further incubated at 37 °C for 30 min in the presence of 5 units of Exo III (New England Biolabs).

    Ligation:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: .. Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA. ..

    Article Title: Streamlined circular proximity ligation assay provides high stringency and compatibility with low-affinity antibodies
    Article Snippet: Paragraph title: Ligation Step for c-PLA. ... Exonuclease mixture contained 2 U/μL exonuclease I (New England Biolabs) and 2 U/μL exonuclease III (New England Biolabs) in 1× NEBuffer 1 containing 10 mM Bis⋅Tris⋅Propane⋅HCl, pH 7.0, 10 mM MgCl2 , and 1 mM DTT (New England Biolabs).

    Article Title: Capturing native long-range contiguity by in situ library construction and optical sequencing
    Article Snippet: .. After ligation, we removed unligated genomic DNA and adaptors by adding 1 µL of exonuclease III (NEB) and 0.5 µL of exonuclease VII (Epicentre) and incubating the reaction at 37 °C for 3 h. Finally, we removed the uracil bases by adding 2 µL of USER (NEB) and incubating the reaction at 37 °C for 30 min to generate single-stranded flow cell complementary 3′-tails. .. We performed a final size selection on a 1% agarose gel run at 100 V for 2 h and quantified the libraries on a Qubit (Invitrogen).

    Immunohistofluorescence:

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: T4-ligase mediated DNA circularization assay One of the major properties of IHF/HU proteins is their ability to bend DNA, which is reflected in the induction of DNA circularization in the presence of T4 ligase ( ). .. If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution.

    Footprinting:

    Article Title: Elongation complexes of Thermus thermophilus RNA polymerase that possess distinct translocation conformations
    Article Snippet: Paragraph title: Footprinting assay ... Exonuclease III (Exo III) (NEB, 0.1 U/μl) was added for 5–10 min at 37°C.

    Cell Culture:

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR
    Article Snippet: HepG2hNTCP , Hepa1-6hNTCP , Hepa56DhNTCP , and HeLahNTCP cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 2 mM l -glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 1 mM nonessential amino acids. .. T5 Exo (M0363), BAL-31 nuclease (M0213), exonuclease I (M0293), exonuclease III (M0206), exonuclease V (RecBCD, M0345), mung bean nuclease (M0250), EcoRI (R0101), and Nb.BtsI (R0707) were purchased from New England Biolabs.

    Generated:

    Article Title: Direct Detection and Sequencing of Damaged DNA Bases
    Article Snippet: SMRTbell templates were generated by ligating several synthetic oligonucleotides, one of which contained two instances of a chemical base modification (Additional File ). .. Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (NEB; Ipswich, MA) and Exonuclease VII (USB; Cleveland, OH) at 37°C for 30 minutes.

    Article Title: Saccharomyces cerevisiae Red1 protein exhibits nonhomologous DNA end–joining activity and potentiates Hop1-promoted pairing of double-stranded DNA
    Article Snippet: One hundred ng of blunt-ended 2.6-kb pUC19 DNA (generated by digestion of circular pUC19 DNA with SmaI) was incubated in the absence or presence of specified concentrations of Red1 and Hop1 in a 20-μl reaction mixture containing 20 m m Tris-HCl (pH 8). .. After incubation at 30 °C for 30 min, 2 μl of T4 DNA ligase buffer and 10 units of T4 DNA ligase (Thermo Scientific) were added, and the incubation was extended at 30 °C for 20 min. For reactions involving exonuclease III (Exo III), samples were further incubated at 37 °C for 30 min in the presence of 5 units of Exo III (New England Biolabs).

    Article Title: Proofreading dynamics of a processive DNA polymerase
    Article Snippet: .. The newly generated 3′ end was cleaved with 0.3 μl of Exonuclease III (100 U/μl) (New England Biolabs) in the nicking enzyme buffer for 2 min at 37°C, in order to create a ∼400 nucleotide long ssDNA gap. ..

    other:

    Article Title: No Structure-Switching Required: A Generalizable Exonuclease-Mediated Aptamer-Based Assay for Small-Molecule Detection
    Article Snippet: Exonuclease III and exonuclease I (both from E. coli) were purchased from New England Biolabs.

    Article Title: The aflatoxin B1 formamidopyrimidine adduct plays a major role in causing the types of mutations observed in human hepatocellular carcinoma
    Article Snippet: Eco RI, Hae III, Hinf I, T4 polynucleotide kinase (ATP: 5′-dephosphopolynucleotide 5′phosphotransferase, 2.7.1.78), T4 DNA ligase [poly(deoxyribonucleotide): poly(deoxyribonucleotide) ligase (AMP forming), 6.5.11], exonuclease III (exodeoxyribonuclease III, 3.1.11.2), and uracil DNA glycolsylase (UDG) were from New England Biolabs.

    Electroporation Bacterial Transformation:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The digestion products were blunted using Mung Bean Nuclease (BD Biosciences, Palo Alto, CA) and recircularized followed by bacterial transformation and plasmid DNA purification.

    Isolation:

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR
    Article Snippet: PHH were isolated from liver specimens obtained after partial hepatectomy and following written informed consent of the patients (approved by the ethics commission of Hannover Medical School/Ethik-Kommission der MHH, no. 252-2008). .. T5 Exo (M0363), BAL-31 nuclease (M0213), exonuclease I (M0293), exonuclease III (M0206), exonuclease V (RecBCD, M0345), mung bean nuclease (M0250), EcoRI (R0101), and Nb.BtsI (R0707) were purchased from New England Biolabs.

    Size-exclusion Chromatography:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA. .. PCR cycling conditions were an initial denaturation step for 2 min at 95°C, followed by 26 cycles of: 15 sec at 98°C, 15 sec at 65°C, and 45 sec at 72°C.

    Purification:

    Article Title: Direct Detection and Sequencing of Damaged DNA Bases
    Article Snippet: Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (NEB; Ipswich, MA) and Exonuclease VII (USB; Cleveland, OH) at 37°C for 30 minutes. .. SMRTbell templates were purified using QIAquick PCR Purification columns (Qiagen; Valencia, CA).

    Article Title: Sequence-targeted nucleosome sliding in vivo by a hybrid Chd1 chromatin remodeler
    Article Snippet: Briefly, 200 mL of cells was grown to OD600 = 0.4–0.6, crosslinked with 1% formaldehyde, quenched with glycine, spheroplasted with zymolyase (100T), pelleted, split into three separate reactions, and digested with 10, 20, or 40 units of MNase (Worthington) in the presence of 30 units of exonuclease III (NEB) for 10 min at 37°C. .. DNA was extracted by phenol/chloroform extraction, then ethanol precipitated, and treated with RNase A. Appropriately digested samples (resulting in ∼80% mononucleosomes) were treated with 10 units of alkaline phosphatase (NEB), and the mononucleosomal band was purified by gel extraction from low-melt agarose (GeneMate).

    Article Title: Proofreading dynamics of a processive DNA polymerase
    Article Snippet: The newly generated 3′ end was cleaved with 0.3 μl of Exonuclease III (100 U/μl) (New England Biolabs) in the nicking enzyme buffer for 2 min at 37°C, in order to create a ∼400 nucleotide long ssDNA gap. .. The DNA was purified with the Qiagen PCR Purification Kit (Qiagen) and digested with Hin dIII and Bam HI restriction endonucleases (New England Biolabs) following the manufacturer's reaction conditions.

    Article Title: Capturing native long-range contiguity by in situ library construction and optical sequencing
    Article Snippet: We loaded the entire volume across 12 lanes on a 1% agarose gel and ran it at 100 V for 2 h. We size selected appropriate bands (1–8 kb), purified the DNA (1–3 kb libraries were purified on the Boreal Genomics Aurora or with a Qiagen QIAquick Gel Extraction Kit; 5–8 kb libraries were purified exclusively on the Aurora), and end-repaired the molecules (End-It; Epicentre). .. After ligation, we removed unligated genomic DNA and adaptors by adding 1 µL of exonuclease III (NEB) and 0.5 µL of exonuclease VII (Epicentre) and incubating the reaction at 37 °C for 3 h. Finally, we removed the uracil bases by adding 2 µL of USER (NEB) and incubating the reaction at 37 °C for 30 min to generate single-stranded flow cell complementary 3′-tails.

    Sequencing:

    Article Title: Direct Detection and Sequencing of Damaged DNA Bases
    Article Snippet: Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (NEB; Ipswich, MA) and Exonuclease VII (USB; Cleveland, OH) at 37°C for 30 minutes. .. SMRTbell templates were subjected to standard SMRT sequencing using an engineered phi29 DNA polymerase, as described [ , ].

    Article Title: Global methylation state at base-pair resolution of the Caulobacter genome throughout the cell cycle
    Article Snippet: Paragraph title: Sequencing. ... Incompletely formed SMRTbell templates were digested with a combination of Exonuclease III (New England Biolabs) and exonuclease VII (Affymetrix).

    Article Title: Sequence-targeted nucleosome sliding in vivo by a hybrid Chd1 chromatin remodeler
    Article Snippet: Paragraph title: MNase digestion and sequencing of nucleosomal DNA ... Briefly, 200 mL of cells was grown to OD600 = 0.4–0.6, crosslinked with 1% formaldehyde, quenched with glycine, spheroplasted with zymolyase (100T), pelleted, split into three separate reactions, and digested with 10, 20, or 40 units of MNase (Worthington) in the presence of 30 units of exonuclease III (NEB) for 10 min at 37°C.

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: The novel cDNA sequence contained within pPCR102-2 has been deposited in the GenBank database (accession no. ). .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Gel Extraction:

    Article Title: Sequence-targeted nucleosome sliding in vivo by a hybrid Chd1 chromatin remodeler
    Article Snippet: Briefly, 200 mL of cells was grown to OD600 = 0.4–0.6, crosslinked with 1% formaldehyde, quenched with glycine, spheroplasted with zymolyase (100T), pelleted, split into three separate reactions, and digested with 10, 20, or 40 units of MNase (Worthington) in the presence of 30 units of exonuclease III (NEB) for 10 min at 37°C. .. DNA was extracted by phenol/chloroform extraction, then ethanol precipitated, and treated with RNase A. Appropriately digested samples (resulting in ∼80% mononucleosomes) were treated with 10 units of alkaline phosphatase (NEB), and the mononucleosomal band was purified by gel extraction from low-melt agarose (GeneMate).

    Article Title: Capturing native long-range contiguity by in situ library construction and optical sequencing
    Article Snippet: We loaded the entire volume across 12 lanes on a 1% agarose gel and ran it at 100 V for 2 h. We size selected appropriate bands (1–8 kb), purified the DNA (1–3 kb libraries were purified on the Boreal Genomics Aurora or with a Qiagen QIAquick Gel Extraction Kit; 5–8 kb libraries were purified exclusively on the Aurora), and end-repaired the molecules (End-It; Epicentre). .. After ligation, we removed unligated genomic DNA and adaptors by adding 1 µL of exonuclease III (NEB) and 0.5 µL of exonuclease VII (Epicentre) and incubating the reaction at 37 °C for 3 h. Finally, we removed the uracil bases by adding 2 µL of USER (NEB) and incubating the reaction at 37 °C for 30 min to generate single-stranded flow cell complementary 3′-tails.

    cDNA Library Assay:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: Paragraph title: Construction of plasmids and the cDNA library ... All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Sample Prep:

    Article Title: Sequence-targeted nucleosome sliding in vivo by a hybrid Chd1 chromatin remodeler
    Article Snippet: Briefly, 200 mL of cells was grown to OD600 = 0.4–0.6, crosslinked with 1% formaldehyde, quenched with glycine, spheroplasted with zymolyase (100T), pelleted, split into three separate reactions, and digested with 10, 20, or 40 units of MNase (Worthington) in the presence of 30 units of exonuclease III (NEB) for 10 min at 37°C. .. Sequencing libraries were created from purified phosphatase-treated mononucleosomal DNA using the Illumina TruSeq sample prep kit.

    Plasmid Preparation:

    Article Title: Global methylation state at base-pair resolution of the Caulobacter genome throughout the cell cycle
    Article Snippet: Plasmid DNA was sheared to ∼800 bp. .. Incompletely formed SMRTbell templates were digested with a combination of Exonuclease III (New England Biolabs) and exonuclease VII (Affymetrix).

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The digestion products were blunted using Mung Bean Nuclease (BD Biosciences, Palo Alto, CA) and recircularized followed by bacterial transformation and plasmid DNA purification.

    Article Title: Proofreading dynamics of a processive DNA polymerase
    Article Snippet: The pBacgus11 (Novagen) dsDNA vector (8041 bp, 0.66 μg) was nicked at a single position with the NBbvIA nicking enzyme (New England Biolabs) following the manufacturer's reaction conditions. .. The newly generated 3′ end was cleaved with 0.3 μl of Exonuclease III (100 U/μl) (New England Biolabs) in the nicking enzyme buffer for 2 min at 37°C, in order to create a ∼400 nucleotide long ssDNA gap.

    SYBR Green Assay:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA. .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL.

    Negative Control:

    Article Title: Roles of Translesion Synthesis DNA Polymerases in the Potent Mutagenicity of Tobacco-Specific Nitrosamine-Derived O2-Alkylthymidines in Human Cells
    Article Snippet: All enzymes, including EcoR V restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, uracil DNA glycosylase, and exonuclease III, were obtained from New England Bioloabs (Beverly, MA). .. E. coli DH10B cells was purchased form Life Technologies, Inc. (Grand Island, NY) siRNAs: Synthetic siRNA duplexes against POLH (SI02663619), POLK (SI04930884), POLI (SI03033310), REV1 (SI00115311), and All Stars negative control siRNA (1027280) were purchased from Qiagen (Valencia, CA).

    Selection:

    Article Title: Capturing native long-range contiguity by in situ library construction and optical sequencing
    Article Snippet: After ligation, we removed unligated genomic DNA and adaptors by adding 1 µL of exonuclease III (NEB) and 0.5 µL of exonuclease VII (Epicentre) and incubating the reaction at 37 °C for 3 h. Finally, we removed the uracil bases by adding 2 µL of USER (NEB) and incubating the reaction at 37 °C for 30 min to generate single-stranded flow cell complementary 3′-tails. .. We performed a final size selection on a 1% agarose gel run at 100 V for 2 h and quantified the libraries on a Qubit (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution. .. DNA samples were finally resuspended in 1× DNA loading buffer and analyzed on 8% TAE-PAGE gel or 0.8% TAE agarose gel, and stained with 0.1% ethidium bromide.

    Article Title: Capturing native long-range contiguity by in situ library construction and optical sequencing
    Article Snippet: We loaded the entire volume across 12 lanes on a 1% agarose gel and ran it at 100 V for 2 h. We size selected appropriate bands (1–8 kb), purified the DNA (1–3 kb libraries were purified on the Boreal Genomics Aurora or with a Qiagen QIAquick Gel Extraction Kit; 5–8 kb libraries were purified exclusively on the Aurora), and end-repaired the molecules (End-It; Epicentre). .. After ligation, we removed unligated genomic DNA and adaptors by adding 1 µL of exonuclease III (NEB) and 0.5 µL of exonuclease VII (Epicentre) and incubating the reaction at 37 °C for 3 h. Finally, we removed the uracil bases by adding 2 µL of USER (NEB) and incubating the reaction at 37 °C for 30 min to generate single-stranded flow cell complementary 3′-tails.

    Ethanol Precipitation:

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: The DNA was then phenol–chloroform extracted and collected by ethanol precipitation. .. If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution.

    DNA Purification:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The digestion products were blunted using Mung Bean Nuclease (BD Biosciences, Palo Alto, CA) and recircularized followed by bacterial transformation and plasmid DNA purification.

    Staining:

    Article Title: Saccharomyces cerevisiae Red1 protein exhibits nonhomologous DNA end–joining activity and potentiates Hop1-promoted pairing of double-stranded DNA
    Article Snippet: After incubation at 30 °C for 30 min, 2 μl of T4 DNA ligase buffer and 10 units of T4 DNA ligase (Thermo Scientific) were added, and the incubation was extended at 30 °C for 20 min. For reactions involving exonuclease III (Exo III), samples were further incubated at 37 °C for 30 min in the presence of 5 units of Exo III (New England Biolabs). .. The samples were electrophoresed through 1.1% agarose in 45 m m Tris borate buffer (pH 8.3) containing 1 m m EDTA at 80 V for 7 h and visualized by staining with ethidium bromide.

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution. .. DNA samples were finally resuspended in 1× DNA loading buffer and analyzed on 8% TAE-PAGE gel or 0.8% TAE agarose gel, and stained with 0.1% ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs exonuclease iii
    <t>PCR</t> product ratio (with/without exonuclease <t>III)</t> as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.
    Exonuclease Iii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease iii/product/New England Biolabs
    Average 90 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    exonuclease iii - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.

    Article Snippet: Finally, the beneficial effect of exonuclease III on long PCR was similar with exonuclease III purchased from New England Biolabs or from Life Technologies (data not shown).

    Techniques: Polymerase Chain Reaction, Southern Blot, Amplification

    Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).

    Article Snippet: Finally, the beneficial effect of exonuclease III on long PCR was similar with exonuclease III purchased from New England Biolabs or from Life Technologies (data not shown).

    Techniques: Polymerase Chain Reaction, Amplification

    Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Article Snippet: Finally, the beneficial effect of exonuclease III on long PCR was similar with exonuclease III purchased from New England Biolabs or from Life Technologies (data not shown).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Article Snippet: Finally, the beneficial effect of exonuclease III on long PCR was similar with exonuclease III purchased from New England Biolabs or from Life Technologies (data not shown).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).

    Article Snippet: Finally, the beneficial effect of exonuclease III on long PCR was similar with exonuclease III purchased from New England Biolabs or from Life Technologies (data not shown).

    Techniques: Polymerase Chain Reaction, Amplification

    T5 Exo and Exo III remove HBV replicative intermediates without affecting cccDNA. HepG2 hNTCP cells were seeded in a 6-well plate and infected at an mge/cell of 3,000. To block entry, Myrcludex B (2 μM) was used as a control. (A) On day 7 p.i., cytosolic DNA samples were extracted as described in Materials and Methods and hydrolyzed by Exo I (5 U, 60 min), Exo III (25 U, 60 min), Exo I and III (5 U plus 25 U, 60 min), T5 Exo (5 U, 60 min), PSD (10 U, 60 min), and EcoRI (10 U, 60 min) at 37°C for 1 h, and later on, all enzymes were heat denatured at 70°C. Samples were analyzed by Southern blotting (left) and PCR with pp466-541 (right). (B) HepG2 hNTCP cells were infected in a 6-well plate format for 7 days, and the DNA samples were Hirt extracted and hydrolyzed by the respective enzymes prior to Southern blotting (left) and cccDNA-specific PCR using pp1040-1996 (right).

    Journal: Journal of Virology

    Article Title: T5 Exonuclease Hydrolysis of Hepatitis B Virus Replicative Intermediates Allows Reliable Quantification and Fast Drug Efficacy Testing of Covalently Closed Circular DNA by PCR

    doi: 10.1128/JVI.01117-18

    Figure Lengend Snippet: T5 Exo and Exo III remove HBV replicative intermediates without affecting cccDNA. HepG2 hNTCP cells were seeded in a 6-well plate and infected at an mge/cell of 3,000. To block entry, Myrcludex B (2 μM) was used as a control. (A) On day 7 p.i., cytosolic DNA samples were extracted as described in Materials and Methods and hydrolyzed by Exo I (5 U, 60 min), Exo III (25 U, 60 min), Exo I and III (5 U plus 25 U, 60 min), T5 Exo (5 U, 60 min), PSD (10 U, 60 min), and EcoRI (10 U, 60 min) at 37°C for 1 h, and later on, all enzymes were heat denatured at 70°C. Samples were analyzed by Southern blotting (left) and PCR with pp466-541 (right). (B) HepG2 hNTCP cells were infected in a 6-well plate format for 7 days, and the DNA samples were Hirt extracted and hydrolyzed by the respective enzymes prior to Southern blotting (left) and cccDNA-specific PCR using pp1040-1996 (right).

    Article Snippet: T5 Exo (M0363), BAL-31 nuclease (M0213), exonuclease I (M0293), exonuclease III (M0206), exonuclease V (RecBCD, M0345), mung bean nuclease (M0250), EcoRI (R0101), and Nb.BtsI (R0707) were purchased from New England Biolabs.

    Techniques: Infection, Blocking Assay, Southern Blot, Polymerase Chain Reaction