exonuclease iii e coli  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Exonuclease III E coli
    Description:
    Exonuclease III E coli 25 000 units
    Catalog Number:
    m0206l
    Price:
    248
    Size:
    25 000 units
    Category:
    Exonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs exonuclease iii e coli
    Exonuclease III E coli
    Exonuclease III E coli 25 000 units
    https://www.bioz.com/result/exonuclease iii e coli/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    exonuclease iii e coli - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq"

    Article Title: Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq

    Journal: Nature Communications

    doi: 10.1038/ncomms15335

    Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.
    Figure Legend Snippet: Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.

    Techniques Used: Mutagenesis, Two Tailed Test

    2) Product Images from "Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq"

    Article Title: Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq

    Journal: Nature Communications

    doi: 10.1038/ncomms15335

    Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.
    Figure Legend Snippet: Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.

    Techniques Used: Mutagenesis, Two Tailed Test

    3) Product Images from "Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq"

    Article Title: Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq

    Journal: Nature Communications

    doi: 10.1038/ncomms15335

    Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.
    Figure Legend Snippet: Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.

    Techniques Used: Mutagenesis, Two Tailed Test

    4) Product Images from "Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq"

    Article Title: Ultrasensitive and high-efficiency screen of de novo low-frequency mutations by o2n-seq

    Journal: Nature Communications

    doi: 10.1038/ncomms15335

    Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.
    Figure Legend Snippet: Performance of o2n-seq for detecting mutations with 1% and 0.1% allele frequency. ( a , b ) Sensitivity and FPR of mutation detection of o2n-seq (three experimental replicates, orange), Cir-seq (three experimental replicates, blue) and o2n-seq after filtering with frequency (o2n-seq-f, green) under different CSs criteria for the 1:100 mixture of E. coli (means±s.d.). Two-tailed Student's t -test was used for statistical analysis. ( c ) Mutation frequency distribution of FP and TP variants detected by o2n-seq under different CSs (1 × and 2 × ) for the 1:100 mixture of E. coli . 3 × -5 × CSs were showed in Supplementary Fig. 5 . ( d ) MAFs of TP mutations detected by o2n-seq for the 1:100 mixture of E. coli . The MAFs of three experimental replicates was plotted. The dashed horizontal line indicates the theoretical MAF (0.99%). ( e , f ) Sensitivity and FPR of mutation detection of o2n-seq by different CSs criteria (3 × −9 × ) under different total CSs coverage (5,000–25,000 × ) for the 1:1,000 mix of phix174 . The results of the other experimental replicate were shown in Supplementary Fig. 6 . Dash lines were used to display the overlapped results better.

    Techniques Used: Mutagenesis, Two Tailed Test

    Related Articles

    Clone Assay:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The pPI1-His construct was obtained by PCR-mediated amplification of pi1 from pPCR102-2 using primers OD5: 5′-CG GGATCC ATGGATCTGTCTCAGTCTCAGTCTC -3′ and OD6: 5′-CCC GATATC AGACAGAGACAATCCATTCGAACAGA -3′, (annealing sequences are underlined and extensions containing BamHI and EcoRV restriction sites are shown in bold) followed by cloning of the BamHI/EcoRV-digested pi1 -encoding PCR product into BamHI/EcoRV-restricted pEF6/V5-His-TOPO (Invitrogen, Carlsbad, CA), in-frame with histidine tag and stop codon.

    Centrifugation:

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: The insoluble materials containing viral replicative intermediates and most of the cellular DNA were removed by centrifugation, and the resultant supernatant containing viral cccDNA was extracted with phenol. .. To remove the transfected linear viral DNA, the nucleic acid obtained was treated with Exonuclease III (New England Biolabs) at 37°C for 1 h, followed by treatment with mung bean nuclease (New England Biolabs) at 37°C for 30 min.

    Amplification:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: The products of the first amplification round were diluted 1:20 in H2 O and used as template for the second PCR employing identical primers and reaction conditions. .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Positive Control:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: .. As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease. .. An AP endonuclease activity should generate a radioactive labeled 7 mer fragment.

    Polymerase Chain Reaction:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. ..

    Construct:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The pPI1-His construct was obtained by PCR-mediated amplification of pi1 from pPCR102-2 using primers OD5: 5′-CG GGATCC ATGGATCTGTCTCAGTCTCAGTCTC -3′ and OD6: 5′-CCC GATATC AGACAGAGACAATCCATTCGAACAGA -3′, (annealing sequences are underlined and extensions containing BamHI and EcoRV restriction sites are shown in bold) followed by cloning of the BamHI/EcoRV-digested pi1 -encoding PCR product into BamHI/EcoRV-restricted pEF6/V5-His-TOPO (Invitrogen, Carlsbad, CA), in-frame with histidine tag and stop codon.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: The titer of the library was determined using the p24 ELISA assay (NEK-050, Perkin Elmer, Boston, MA). .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Incubation:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: .. As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease. .. An AP endonuclease activity should generate a radioactive labeled 7 mer fragment.

    Article Title: Elongation complexes of Thermus thermophilus RNA polymerase that possess distinct translocation conformations
    Article Snippet: EC15 was obtained by incubation of EC14 with substrate ATP for 2 min at 60°C. .. Exonuclease III (Exo III) (NEB, 0.1 U/μl) was added for 5–10 min at 37°C.

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium
    Article Snippet: Nuclease protection of supercoiled pBR322, linear pBR322 (cut by EcoRV ) or ss phiX174 virion was tested with 0.1 U DNase I (Promega), 200 U Exonuclease III (NEB) or 1 U Mung Bean Nuclease (Promega), respectively. .. 2 μl of the respective 10 X nuclease buffer provided by the manufacturer, and nuclease were then added and the samples were incubated at 30°C for 5 min for DNase I, 30 min for Exonuclease III or 15 min for Mung Bean Nuclease.

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: DNA was incubated with or without histone-like proteins in 20 μl of reaction mixture containing 1× T4 DNA ligase buffer (New England Biolab, Beverly, MA, USA) and 5 mM ATP for 15 min at 28°C. .. If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution.

    Activity Assay:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: Paragraph title: 2.8 AP endonuclease activity assay ... As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease.

    Article Title: Attenuation of DNA charge transport by compaction into a nucleosome core particle
    Article Snippet: T4 Polynucleotide Kinase (PNK), T4 DNA Ligase (T4 Lig) and Exonuclease III (ExoIII) were purchased from New England Biolabs. .. [γ-32 P]ATP (5 mCi/mL, 3000 Ci/mmol specific activity) was supplied by Perkin Elmer.

    Article Title: Molecular interactions of Escherichia coli ExoIX and identification of its associated 3?-5? exonuclease activity
    Article Snippet: Similarly, the GST–ExoIX fusion protein also appeared to lack any significant nuclease activity. .. Two positive controls, T5 D15 5′-3′ exonuclease ( ) and exonuclease III (New England Biolabs) were also included in the assays.

    High Performance Liquid Chromatography:

    Article Title: Validation of DNA Sequences Using Mass Spectrometry Coupled with Nucleoside Mass Tagging
    Article Snippet: We have separated four types of 13 C/15 N-labeled nucleosides by reverse-phase high-performance liquid chromatography (HPLC) (Vydac C18 reverse phase 218TP54 HPLC column). .. Exonuclease III and Hph I restriction enzymes were purchased from New England Biolabs.

    Transfection:

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: .. To remove the transfected linear viral DNA, the nucleic acid obtained was treated with Exonuclease III (New England Biolabs) at 37°C for 1 h, followed by treatment with mung bean nuclease (New England Biolabs) at 37°C for 30 min. ..

    Fluorescence:

    Article Title: High-Discrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells
    Article Snippet: Enzymatic resistance of Au-TDNNs Digestion of the two groups of phosphorothioate-protected Au-TDNNs was probed using the Agilent Cary Eclipse to detect generation of nonspecific FAM fluorescence signals. .. For both human DNase I (Thermo Scientific) and exonuclease III (New England Biolabs) digestion, a common concentration of 3 U/mL was used to digest 2 nM Au-TDNNs samples in PBS.

    Footprinting:

    Article Title: Elongation complexes of Thermus thermophilus RNA polymerase that possess distinct translocation conformations
    Article Snippet: Paragraph title: Footprinting assay ... Exonuclease III (Exo III) (NEB, 0.1 U/μl) was added for 5–10 min at 37°C.

    Electroporation Bacterial Transformation:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The digestion products were blunted using Mung Bean Nuclease (BD Biosciences, Palo Alto, CA) and recircularized followed by bacterial transformation and plasmid DNA purification.

    Recombinant:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: .. As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease. .. An AP endonuclease activity should generate a radioactive labeled 7 mer fragment.

    Molecular Weight:

    Article Title: Validation of DNA Sequences Using Mass Spectrometry Coupled with Nucleoside Mass Tagging
    Article Snippet: Dialysis tubing with 3500 Da molecular weight cutoff was obtained from Pierce. .. Exonuclease III and Hph I restriction enzymes were purchased from New England Biolabs.

    Sensitive Assay:

    Article Title: Molecular interactions of Escherichia coli ExoIX and identification of its associated 3?-5? exonuclease activity
    Article Snippet: Two positive controls, T5 D15 5′-3′ exonuclease ( ) and exonuclease III (New England Biolabs) were also included in the assays. .. We then deployed a sensitive assay using radiolabelled oligonucleotides.

    Labeling:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: Labeled oligos were detected using a phosphorimager device (BioRad). .. As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease.

    Purification:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: .. As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease. .. An AP endonuclease activity should generate a radioactive labeled 7 mer fragment.

    Article Title: Molecular interactions of Escherichia coli ExoIX and identification of its associated 3?-5? exonuclease activity
    Article Snippet: Paragraph title: Purification of DNase-free ExoIX ... Two positive controls, T5 D15 5′-3′ exonuclease ( ) and exonuclease III (New England Biolabs) were also included in the assays.

    Sequencing:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: The novel cDNA sequence contained within pPCR102-2 has been deposited in the GenBank database (accession no. ). .. All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Lysis:

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: Briefly, the transfected cells in 100-mm-diameter dishes were lysed at 37°C for 5 min in 1 ml of lysis buffer (50 mM Tris-Cl [pH 8.0]–10 mM EDTA–150 mM NaCl–1% SDS). .. To remove the transfected linear viral DNA, the nucleic acid obtained was treated with Exonuclease III (New England Biolabs) at 37°C for 1 h, followed by treatment with mung bean nuclease (New England Biolabs) at 37°C for 30 min.

    cDNA Library Assay:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: Paragraph title: Construction of plasmids and the cDNA library ... All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Plasmid Preparation:

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium
    Article Snippet: Nuclease protection of supercoiled pBR322, linear pBR322 (cut by EcoRV ) or ss phiX174 virion was tested with 0.1 U DNase I (Promega), 200 U Exonuclease III (NEB) or 1 U Mung Bean Nuclease (Promega), respectively. .. 200 ng of ds circular DNA, linear plasmid DNA or ss circular DNA were pre-incubated for 15 min at 4°C in the absence or the presence of DdrC (7 μM, 7 μM, and 2 μM, respectively) in 20 μl of buffer A.

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The digestion products were blunted using Mung Bean Nuclease (BD Biosciences, Palo Alto, CA) and recircularized followed by bacterial transformation and plasmid DNA purification.

    SYBR Green Assay:

    Article Title: Highly Sensitive Detection of Uracil-DNA Glycosylase Activity Based on Self-Initiating Multiple Rolling Circle Amplification
    Article Snippet: 4.1 Materials and Reagents Uracil-DNA glycosylase (UDG), human alkyladenine glycosylase (hAAG), uracil glycosylase inhibitor (UGI), T4 DNA ligase, exonuclease I (Exo I), exonuclease III (Exo III), endonuclease IV (Endo IV), and 10× NEBuffer 2 (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2 , 10 mM dithiothreitol) were purchased from New England Biolabs (Ipswich, MA, USA). .. 10× SYBR Green I was purchased from Zeesan (Xiamen, China).

    Negative Control:

    Article Title: Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase
    Article Snippet: As a negative control the untreated oligo AP was used. .. As positive control, the oligo AP was incubated with 1U Endo III (E . coli NTH1, New England Biolabs), or with 2U Exonuclease III (Exo III, E . coli AP endonuclease, New England Biolabs) or with 1 μg of purified recombinant TcAP1 T . cruzi AP endonuclease.

    Agarose Gel Electrophoresis:

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution. .. DNA samples were finally resuspended in 1× DNA loading buffer and analyzed on 8% TAE-PAGE gel or 0.8% TAE agarose gel, and stained with 0.1% ethidium bromide.

    Concentration Assay:

    Article Title: High-Discrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells
    Article Snippet: .. For both human DNase I (Thermo Scientific) and exonuclease III (New England Biolabs) digestion, a common concentration of 3 U/mL was used to digest 2 nM Au-TDNNs samples in PBS. .. FAM fluorescence signals were monitored and recorded over a period of 3 h at 30 min intervals and at 37 °C.

    Article Title: The Binding Site of Transcription Factor YY1 Is Required for Intramolecular Recombination between Terminally Repeated Sequences of Linear Replicative Hepatitis B Virus DNA
    Article Snippet: Cell lysate was collected with a cell scraper, and protein-detergent complex was precipitated by treatment with 0.25 volumes of 2.5 M KCl (final concentration, 0.5 M KCl) at 4°C for 5 min. .. To remove the transfected linear viral DNA, the nucleic acid obtained was treated with Exonuclease III (New England Biolabs) at 37°C for 1 h, followed by treatment with mung bean nuclease (New England Biolabs) at 37°C for 30 min.

    Article Title: The activation-induced cytidine deaminase (AID) efficiently targets DNA in nucleosomes but only during transcription
    Article Snippet: Reactions were performed with 20 nM of sucrose gradient–purified nucleosomes and 30 U exonuclease III (New England Biolabs, Inc.) in buffer 1 (New England Biolabs, Inc.). .. At each time point, a 10-µl aliquot of the reaction was quenched with EDTA to a final concentration of 20 mM EDTA.

    DNA Purification:

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning
    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively. .. The digestion products were blunted using Mung Bean Nuclease (BD Biosciences, Palo Alto, CA) and recircularized followed by bacterial transformation and plasmid DNA purification.

    Staining:

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3
    Article Snippet: If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution. .. DNA samples were finally resuspended in 1× DNA loading buffer and analyzed on 8% TAE-PAGE gel or 0.8% TAE agarose gel, and stained with 0.1% ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs exonuclease iii
    Proliferation-inducing capacity of <t>pPCR102-2</t> and derivatives in HUVECs. HUVECs were transiently transfected with either pPCR102-2 ( A ), pND-A8 ( B ), pND-A2 ( C ) or pPI1-His ( D ) in order to assess their proliferation-inducing potential. Forty-eight hours post transfection, the cell populations were transduced with a GFP-encoding oncoretroviral vector, which exclusively targets proliferating cells. Forty-eight hours post-transduction, GFP-mediated fluorescence was quantified by FACS. Fluorescence values were calculated by multiplying the number of GFP-expressing cells by the average intensity of GFP expression. The relative fluorescence units were obtained by comparison with GFP-mediated fluorescence control populations (cntrl) transfected with isogenic pcDNA3.1/V5-His-TOPO. Corresponding FACS histograms are also shown. All values are representative of at least <t>three</t> independent experiments. FS, forward scatter; FL, fluoresence.
    Exonuclease Iii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease iii/product/New England Biolabs
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    exonuclease iii - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Proliferation-inducing capacity of pPCR102-2 and derivatives in HUVECs. HUVECs were transiently transfected with either pPCR102-2 ( A ), pND-A8 ( B ), pND-A2 ( C ) or pPI1-His ( D ) in order to assess their proliferation-inducing potential. Forty-eight hours post transfection, the cell populations were transduced with a GFP-encoding oncoretroviral vector, which exclusively targets proliferating cells. Forty-eight hours post-transduction, GFP-mediated fluorescence was quantified by FACS. Fluorescence values were calculated by multiplying the number of GFP-expressing cells by the average intensity of GFP expression. The relative fluorescence units were obtained by comparison with GFP-mediated fluorescence control populations (cntrl) transfected with isogenic pcDNA3.1/V5-His-TOPO. Corresponding FACS histograms are also shown. All values are representative of at least three independent experiments. FS, forward scatter; FL, fluoresence.

    Journal: Nucleic Acids Research

    Article Title: Identification of a novel proliferation-inducing determinant using lentiviral expression cloning

    doi: 10.1093/nar/gng115

    Figure Lengend Snippet: Proliferation-inducing capacity of pPCR102-2 and derivatives in HUVECs. HUVECs were transiently transfected with either pPCR102-2 ( A ), pND-A8 ( B ), pND-A2 ( C ) or pPI1-His ( D ) in order to assess their proliferation-inducing potential. Forty-eight hours post transfection, the cell populations were transduced with a GFP-encoding oncoretroviral vector, which exclusively targets proliferating cells. Forty-eight hours post-transduction, GFP-mediated fluorescence was quantified by FACS. Fluorescence values were calculated by multiplying the number of GFP-expressing cells by the average intensity of GFP expression. The relative fluorescence units were obtained by comparison with GFP-mediated fluorescence control populations (cntrl) transfected with isogenic pcDNA3.1/V5-His-TOPO. Corresponding FACS histograms are also shown. All values are representative of at least three independent experiments. FS, forward scatter; FL, fluoresence.

    Article Snippet: All PCR reactions were conducted using DyNAzyme.EXT polymerase (Finnzymes, Oulu, Finland). pND-A2 and pND-A8 represent nested deletions of pPCR102-2 which were performed by restricting pPCR102-2 with KpnI and BamHI followed by Exonuclease III (NEB, Beverly, MA) mediated digestion at 37°C for 1, 2 and 3 min, respectively.

    Techniques: Transfection, Transduction, Plasmid Preparation, Fluorescence, FACS, Expressing

    Structural characterization of AQ-157TG rNCPs. ( A ) Exonuclease III footprinting of AQ-157TG rNCPs (lane 1) and free AQ-157TG (lane 2). The restriction of ExoIII activity to the ∼10 bp proximal to AQ in the AQ-157TG rNCPs is evident. ( B ) Autoradiogram of hydroxyl radical footprinting on AQ-157TG rNCPs (lanes 1 and 2) and free AQ-157TG (lane 3). ( C ) Partial scan of the footprint in B of both free AQ-157TG (bottom) and AQ-157TG rNCPs (top). The 10 bp periodic cutting in the rNCPs is apparent.

    Journal: Nucleic Acids Research

    Article Title: Attenuation of DNA charge transport by compaction into a nucleosome core particle

    doi: 10.1093/nar/gkl030

    Figure Lengend Snippet: Structural characterization of AQ-157TG rNCPs. ( A ) Exonuclease III footprinting of AQ-157TG rNCPs (lane 1) and free AQ-157TG (lane 2). The restriction of ExoIII activity to the ∼10 bp proximal to AQ in the AQ-157TG rNCPs is evident. ( B ) Autoradiogram of hydroxyl radical footprinting on AQ-157TG rNCPs (lanes 1 and 2) and free AQ-157TG (lane 3). ( C ) Partial scan of the footprint in B of both free AQ-157TG (bottom) and AQ-157TG rNCPs (top). The 10 bp periodic cutting in the rNCPs is apparent.

    Article Snippet: T4 Polynucleotide Kinase (PNK), T4 DNA Ligase (T4 Lig) and Exonuclease III (ExoIII) were purchased from New England Biolabs.

    Techniques: Footprinting, Activity Assay

    HCc3 promotes ligase-mediated DNA concatenation. All images are presented as negative images. ( a ) Concatenation of 125-bp (left panel) and 2.8-kb (right panel) DNA fragments to a higher level in the presence of HCc3 at respective dimer/bp ratios. The linearity of the resulting products was confirmed by Exo III digestion (marked with ‘+/−’ signs). The 125-bp product was resolved on a 8% non-denaturing polyacrylamide gel, and the 2.8-kb product on a 1% TAE agarose gel. ( b ) Variations in intensity of DNA concatenation in the presence of HCc3 at different dimer/bp ratios. The marker bands indicate DNA sizes from 3 to 12 kb at 1-kb increments.

    Journal: Nucleic Acids Research

    Article Title: Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3

    doi: 10.1093/nar/gkm165

    Figure Lengend Snippet: HCc3 promotes ligase-mediated DNA concatenation. All images are presented as negative images. ( a ) Concatenation of 125-bp (left panel) and 2.8-kb (right panel) DNA fragments to a higher level in the presence of HCc3 at respective dimer/bp ratios. The linearity of the resulting products was confirmed by Exo III digestion (marked with ‘+/−’ signs). The 125-bp product was resolved on a 8% non-denaturing polyacrylamide gel, and the 2.8-kb product on a 1% TAE agarose gel. ( b ) Variations in intensity of DNA concatenation in the presence of HCc3 at different dimer/bp ratios. The marker bands indicate DNA sizes from 3 to 12 kb at 1-kb increments.

    Article Snippet: If samples were to be treated with Exonuclease III (Exo III) digestion, an equal volume of 2× digestion mixture (2× NEBuffer 1 and 1 U/μl Exonuclease III; New England Biolab) was added to the reaction and the digestion occurred at 37°C for 1 h, prior to the addition of stop solution.

    Techniques: Agarose Gel Electrophoresis, Marker

    Probing of the EC translocation conformations. ( A ) Exo III footprints of EC14 and EC15. Tth EC14 (lanes 1 and 2) was assembled as described in Materials and Methods. EC15 (lanes 3 and 4) was obtained by incubation of EC14 with substrate ATP for 2 min at 60°C. Exo III (0.02 U/μl) was added for 5 (lanes 1 and 3) or 10 (lanes 2 and 4) min at 37°C. ( B ) Schematics of RNAP front edge oscillations in EC14 and EC15. ( C ) Photo cross-linking patterns of Tth EC14 and EC15, EC14 and EC15 containing 5′ 32 P-labeled RNA primers were prepared as illustrated (left). The photo cross-linking analog 4-thio UTP (50 μM) was incorporated into the transcript for 2 min at 60°C followed UV light irradiation for 5 min at RT. The cross-linked species were separated using gel electrophoresis (right).

    Journal: Nucleic Acids Research

    Article Title: Elongation complexes of Thermus thermophilus RNA polymerase that possess distinct translocation conformations

    doi: 10.1093/nar/gkl559

    Figure Lengend Snippet: Probing of the EC translocation conformations. ( A ) Exo III footprints of EC14 and EC15. Tth EC14 (lanes 1 and 2) was assembled as described in Materials and Methods. EC15 (lanes 3 and 4) was obtained by incubation of EC14 with substrate ATP for 2 min at 60°C. Exo III (0.02 U/μl) was added for 5 (lanes 1 and 3) or 10 (lanes 2 and 4) min at 37°C. ( B ) Schematics of RNAP front edge oscillations in EC14 and EC15. ( C ) Photo cross-linking patterns of Tth EC14 and EC15, EC14 and EC15 containing 5′ 32 P-labeled RNA primers were prepared as illustrated (left). The photo cross-linking analog 4-thio UTP (50 μM) was incorporated into the transcript for 2 min at 60°C followed UV light irradiation for 5 min at RT. The cross-linked species were separated using gel electrophoresis (right).

    Article Snippet: Exonuclease III (Exo III) (NEB, 0.1 U/μl) was added for 5–10 min at 37°C.

    Techniques: Translocation Assay, Incubation, Labeling, Irradiation, Nucleic Acid Electrophoresis