exonuclease i  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher exonuclease i
    Exonuclease I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 527 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i/product/Thermo Fisher
    Average 99 stars, based on 527 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: Paragraph title: cDNA cloning and sequencing ... Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100).

    Centrifugation:

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States). .. The sequencing reactions were purified using the protocol of BigDye Terminator v3.1 Cycle Sequencing kit except centrifugation was performed with 1109 × g and 100 × g and, before adding formamide, samples were dried at +37°C for 10 min. Sequencing was carried out with 3130xl Genetic Analyzer (Applied Biosystems/HITACHI; Foster City, California, United States).

    Amplification:

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: PCR amplification of CD4 was performed using Phusion High-Fidelity PCR Master Mix (New England Biolabs; #M0531S) containing ∼50 ng of cDNA and 0.2-μM final concentration of each PCR primer CD4-5′ UTR forward 5′-GGGCAAGAAAGACGCAAGC-3′ and CD4-3′ UTR reverse 5′-ATCTGCCTGGCCTCGTG-3′ in a final volume of 50 μL. .. PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′.

    Article Title: Dynamic range expansion leads to establishment of a new, genetically distinct wolf population in Central Europe
    Article Snippet: To analyze the matrilineal genealogy we amplified the left variable domain of the mitochondrial control region using primers L15995 and H16498 . .. PCR products were purified using exonuclease I and FastAP alkaline phosphatase (ThermoScientific) and sequenced on ABI3730/xl Genetic Analyzer (Applied Biosystems).

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: .. Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures. .. Sequencing of the products used BigDye® Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Life Technologies Polska, Warsaw, Poland).

    Article Title: More than one antibody of individual B cells revealed by single-cell immune profiling
    Article Snippet: .. After this, the free primers were removed by Exonuclease I, and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase (TdT) (Invitrogen, cat. no. 10533-065) for cDNA amplification. .. Then, the single-cell cDNA was amplified by 20 plus five cycles of PCR.

    Article Title: Comprehensive Pharmacogenetic Analysis of Irinotecan Neutropenia and Pharmacokinetics
    Article Snippet: Amplification was performed in a 9600 thermal cycler with an initial denaturing step at 95°C for 15 minutes followed by 14 cycles of 95°C for 30 seconds, 71°C for 30 seconds (touch down, 0.5°C per cycle), and 72°C for 1 minutes; then 25 cycles of 95°C for 30 seconds, 64°C for 30 seconds, and 72°C for 1 minute; and a final extension step at 72°C for 10 minutes. .. Before SBE reaction, PCR products were purified by treatment with shrimp alkaline phosphatase (Roche, Indianapolis, IN) and exonuclease I (USB Corporation, Cleveland, OH) at 37°C for 45 minutes.

    Article Title: Charcot-Marie-Tooth type 4B2 demyelinating neuropathy in miniature Schnauzer dogs caused by a novel splicing SBF2 (MTMR13) genetic variant: a new spontaneous clinical model
    Article Snippet: Genomic DNA was amplified using a standard touchdown PCR reaction. .. Enzymatic clean-up with Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) was carried out and subsequent sequencing performed.

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: CRISPR locus of pCRISPR-crRNA, pCRISPR-multi-crRNA and pCRISPR-control plasmid were amplified with PCR using one bacterial colony as a template with primers spacerseqF and spacerseqR (Supplementary Table 1). .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States).

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: CES2 baboon cDNAs were PCR amplified as 3 overlapping fragments from each first strand sample using: fragment 1 (698 bp – 2532 bp) forward primer (5’ – TTTGCTCAAGCGGTTCCTTC -3’) and reverse primer (5’ – TCATGTGCGGTGGCCTGATGTTCT -3’); fragment 2 (1171 bp – 2532 bp) forward primer (5’ – AACCGAGACCAGCGAGCCGACCAT -3’) and reverse primer (5’ – TCATGTGCGGTGGCCTGATGTTCT -3’); and fragment 3 (2429 bp – 3862 bp) forward primer (5’ – GCGGACTCCATGTTTGTGATCCCT -3’) and reverse primer (5’ – ACTTAGGTGTGGGCAACATTCTTC -3’) designed from human sequence data [ ]. .. Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100).

    Article Title: Comprehensive Pharmacogenetic Analysis of Irinotecan Neutropenia and Pharmacokinetics
    Article Snippet: Amplification was performed in a GeneAmp PCR System 9600 thermal cycler (Applied Biosystems) with an initial denaturation step of 15 minutes at 95°C followed by 40 cycles of 95°C for 15 seconds, 56°C for 15 seconds, and 72°C for 45 seconds, and then an extension step of 72°C for 10 minutes. .. PCR products were purified by treatment with shrimp alkaline phosphatase (Roche) and exonuclease I (USB Corporation) at 37°C for 45 minutes before the SBE reaction.

    Article Title: Mutations in Folate Transporter Genes and Risk for Human Myelomeningocele
    Article Snippet: .. The amplified products were treated with exonuclease I and rapid alkaline phosphatase (United States Biochemicals, Affymetrix, Cleveland, OH) to remove excess primers and nucleotides before sequencing. .. Sanger sequencing was conducted using the BigDye Terminator Protocol (LifeTechnologies Inc., Foster City, CA) with nested-sequencing primers.

    Article Title: In vitro effects of FBXW7 mutation in serous endometrial cancer: increased levels of potentially druggable proteins and sensitivity to SI-2 and dinaciclib
    Article Snippet: Paragraph title: DNA isolation / polymerase chain reaction (PCR) amplification/Sanger sequencing ... PCR reactions were subjected to exonuclease I (Epicentre, Madison, WI)/shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) purification prior to Sanger sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA).

    Construct:

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: Baboon CES1 and CES2 cDNAs were sequenced from the PCR fragments and a tiling path of sequencing primers for each gene was constructed ( ). cDNA samples for each baboon were sequenced using these primers and Big Dye v3.1 chemistry (Applied Biosystems Cat. No. 4337455). .. Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100).

    Electrophoresis:

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures. .. Electrophoresis and analysis were performed according to manufacturer procedures using an ABI PRISM 3100-Avant machine (Data Collection Software v2.0, Sequencing Analysis Software v5.4; Applied Biosystems).

    Incubation:

    Article Title: The northernmost record of a blood-sucking ectoparasite, Lipoptenafortisetosa Maa ( Diptera: Hippoboscidae), in Estonia
    Article Snippet: The extraction was carried out following the manufacturer’s instructions, with the exception that the first incubation step was 55ºC for two hours rather than one hour. .. PCR products were visualised on a 1.6% agarose gel and 10 μl of the PCR solution was treated with FastAP thermosensitive alkaline phosphatase and exonuclease I (Thermo Scientific).

    Mass Spectrometry:

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: Then, from these wells, cells were split into four equal proportion and each was transferred into 20 mL of MS medium supplemented with the corresponding AMP in four different concentrations in the range that slowed down growth by two-fold in the microtitre plate. .. Each of the selected plasmid samples was digested overnight with a mixture of lambda exonuclease and exonuclease I (Fermentas) at 37 °C to remove the genomic DNA background.

    Touchdown PCR:

    Article Title: Charcot-Marie-Tooth type 4B2 demyelinating neuropathy in miniature Schnauzer dogs caused by a novel splicing SBF2 (MTMR13) genetic variant: a new spontaneous clinical model
    Article Snippet: Genomic DNA was amplified using a standard touchdown PCR reaction. .. Enzymatic clean-up with Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) was carried out and subsequent sequencing performed.

    Transformation Assay:

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: Escape mutants The survived escape mutant colonies from the conjugation and transformation were re-isolated by plating them on chloramphenicol-ampicillin. .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States).

    Derivative Assay:

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: These archived RNA samples, which had previously been utilized for other genetic analyses in 2013 , were derived from blood collected as part of each animal’s annual veterinary medical examination under the approval of the MD Anderson Cancer Center’s Institutional Animal Care and Use Committee. .. PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′.

    Conjugation Assay:

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: Escape mutants The survived escape mutant colonies from the conjugation and transformation were re-isolated by plating them on chloramphenicol-ampicillin. .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States).

    Transferring:

    Article Title: More than one antibody of individual B cells revealed by single-cell immune profiling
    Article Snippet: In brief, a single B cell was first isolated and put into lysate buffer by mouth pipette. .. After this, the free primers were removed by Exonuclease I, and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase (TdT) (Invitrogen, cat. no. 10533-065) for cDNA amplification.

    Polymerase Chain Reaction:

    Article Title: The northernmost record of a blood-sucking ectoparasite, Lipoptenafortisetosa Maa ( Diptera: Hippoboscidae), in Estonia
    Article Snippet: .. PCR products were visualised on a 1.6% agarose gel and 10 μl of the PCR solution was treated with FastAP thermosensitive alkaline phosphatase and exonuclease I (Thermo Scientific). .. One unit of both enzymes was added to the PCR solution, which was incubated for 15 min at 37°C, followed by 15 min inactivation at 80°C.

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: .. PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′. ..

    Article Title: Dynamic range expansion leads to establishment of a new, genetically distinct wolf population in Central Europe
    Article Snippet: .. PCR products were purified using exonuclease I and FastAP alkaline phosphatase (ThermoScientific) and sequenced on ABI3730/xl Genetic Analyzer (Applied Biosystems). ..

    Article Title: History-driven population structure and asymmetric gene flow in a recovering large carnivore at the rear-edge of its European range
    Article Snippet: .. PCRs were performed in a T1 plus Thermocycler (Biometra GmbH, Göttingen, Germany) with an initial denaturation step of 95 °C for 5 min, followed by 38 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final elongation step of 72 °C for 7 min. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min. Purified PCR products were diluted 1:40 and both strands sequenced on an ABI3730 DNA Analyzer (Life Technologies GmbH, Darmstadt, Germany). .. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min.

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: .. Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures. .. Sequencing of the products used BigDye® Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Life Technologies Polska, Warsaw, Poland).

    Article Title: More than one antibody of individual B cells revealed by single-cell immune profiling
    Article Snippet: After this, the free primers were removed by Exonuclease I, and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase (TdT) (Invitrogen, cat. no. 10533-065) for cDNA amplification. .. Then, the single-cell cDNA was amplified by 20 plus five cycles of PCR.

    Article Title: Comprehensive Pharmacogenetic Analysis of Irinotecan Neutropenia and Pharmacokinetics
    Article Snippet: .. Before SBE reaction, PCR products were purified by treatment with shrimp alkaline phosphatase (Roche, Indianapolis, IN) and exonuclease I (USB Corporation, Cleveland, OH) at 37°C for 45 minutes. .. SBE reactions were carried out in a 10-μL volume containing 1 μM of SBE primer, 250 μM each of four dideoxynucleotide triphosphates (ddNTPs), 1.25 U of ThermoSequenase (GE Healthcare, Piscataway, NJ), and 6 μL of purified PCR products.

    Article Title: Charcot-Marie-Tooth type 4B2 demyelinating neuropathy in miniature Schnauzer dogs caused by a novel splicing SBF2 (MTMR13) genetic variant: a new spontaneous clinical model
    Article Snippet: Enzymatic clean-up with Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) was carried out and subsequent sequencing performed. .. PCR primers were used for sequencing along with BigDye Terminator v.1.1 cycle sequencing kit (Applied Biosystems).

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States). .. Sequencing-PCR of ExoSAP-treated DNA was performed with BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems; Foster City, California, United States) according to the manufacturer’s protocol.

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: Baboon CES1 and CES2 cDNAs were sequenced from the PCR fragments and a tiling path of sequencing primers for each gene was constructed ( ). cDNA samples for each baboon were sequenced using these primers and Big Dye v3.1 chemistry (Applied Biosystems Cat. No. 4337455). .. Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100).

    Article Title: Comprehensive Pharmacogenetic Analysis of Irinotecan Neutropenia and Pharmacokinetics
    Article Snippet: .. PCR products were purified by treatment with shrimp alkaline phosphatase (Roche) and exonuclease I (USB Corporation) at 37°C for 45 minutes before the SBE reaction. .. Duplex SBE reactions were carried out in 12.6 μL containing 1 μM of each SBE primer, 250 μM each of four ddNTPs, 7.2 μL of purified PCR product, and 1.5 U of ThermoSequenase (GE Healthcare) in 1× Reaction buffer provided by the manufacturer.

    Article Title: Mutations in Folate Transporter Genes and Risk for Human Myelomeningocele
    Article Snippet: Paragraph title: Polymerase Chain Reaction Amplification ... The amplified products were treated with exonuclease I and rapid alkaline phosphatase (United States Biochemicals, Affymetrix, Cleveland, OH) to remove excess primers and nucleotides before sequencing.

    Article Title: In vitro effects of FBXW7 mutation in serous endometrial cancer: increased levels of potentially druggable proteins and sensitivity to SI-2 and dinaciclib
    Article Snippet: .. PCR reactions were subjected to exonuclease I (Epicentre, Madison, WI)/shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) purification prior to Sanger sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA). .. Sequence traces were reviewed using Sequencher™ 5.4.6 (Gene Codes Corporation, Ann Arbor, MI).

    Recombinant:

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: .. PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′. ..

    DNA Extraction:

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: Plasmid DNA isolation was performed using innuPREP plasmid mini Kit (Analytik Jena AG) according to the manufacturer’s instructions. .. To remove the genomic DNA contamination, the isolated plasmid DNA samples were digested overnight with Lambda exonuclease and exonuclease I (Fermentas) at 37 °C.

    Article Title: History-driven population structure and asymmetric gene flow in a recovering large carnivore at the rear-edge of its European range
    Article Snippet: Paragraph title: DNA extraction, microsatellite and mitochondrial analysis ... PCRs were performed in a T1 plus Thermocycler (Biometra GmbH, Göttingen, Germany) with an initial denaturation step of 95 °C for 5 min, followed by 38 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final elongation step of 72 °C for 7 min. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min. Purified PCR products were diluted 1:40 and both strands sequenced on an ABI3730 DNA Analyzer (Life Technologies GmbH, Darmstadt, Germany).

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: Genomic DNA was extracted either from peripheral blood leukocytes (keloid patients) or from cordial blood leukocytes (newborn infants) using a commercially available DNA isolation kit (QIAamp Blood DNA Mini Kit, QIAGEN, Germany). .. Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures.

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: The rationale for this 2-step process was to maintain competition in exponential phase for 12 generations of growth, efficiently control the growth rate in a reproducible manner and obtain the plasmid pool with standard DNA isolation protocol (innuPREP plasmid mini Kit, Analytik Jena AG) in a yield that is enough for the downstream analysis. .. Each of the selected plasmid samples was digested overnight with a mixture of lambda exonuclease and exonuclease I (Fermentas) at 37 °C to remove the genomic DNA background.

    Article Title: In vitro effects of FBXW7 mutation in serous endometrial cancer: increased levels of potentially druggable proteins and sensitivity to SI-2 and dinaciclib
    Article Snippet: Paragraph title: DNA isolation / polymerase chain reaction (PCR) amplification/Sanger sequencing ... PCR reactions were subjected to exonuclease I (Epicentre, Madison, WI)/shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) purification prior to Sanger sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA).

    Mutagenesis:

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: Escape mutants The survived escape mutant colonies from the conjugation and transformation were re-isolated by plating them on chloramphenicol-ampicillin. .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States).

    Isolation:

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: .. To remove the genomic DNA contamination, the isolated plasmid DNA samples were digested overnight with Lambda exonuclease and exonuclease I (Fermentas) at 37 °C. .. The digested plasmid DNA samples were purified with DNA Clean & ConcentratorTM (Zymo) kit according to the manufacturer’s instructions.

    Article Title: Dynamic range expansion leads to establishment of a new, genetically distinct wolf population in Central Europe
    Article Snippet: DNA from tissues and precipitated urine samples was isolated with Exgene™ Tissue SV kit (GeneAll Biotechnology). .. PCR products were purified using exonuclease I and FastAP alkaline phosphatase (ThermoScientific) and sequenced on ABI3730/xl Genetic Analyzer (Applied Biosystems).

    Article Title: More than one antibody of individual B cells revealed by single-cell immune profiling
    Article Snippet: In brief, a single B cell was first isolated and put into lysate buffer by mouth pipette. .. After this, the free primers were removed by Exonuclease I, and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase (TdT) (Invitrogen, cat. no. 10533-065) for cDNA amplification.

    Article Title: In vitro effects of FBXW7 mutation in serous endometrial cancer: increased levels of potentially druggable proteins and sensitivity to SI-2 and dinaciclib
    Article Snippet: DNA was isolated from cell lines using the Gentra® Puregene® Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. .. PCR reactions were subjected to exonuclease I (Epicentre, Madison, WI)/shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) purification prior to Sanger sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA).

    Hot Start PCR:

    Article Title: Mutations in Folate Transporter Genes and Risk for Human Myelomeningocele
    Article Snippet: The exons were amplified by hot-start-PCR with MyTaq-HS DNA Polymerase (Bioline USA Inc, Tuanton, MA) using the MJ Research PTC-100 Thermal Cycler (MJ Research, Waltham, MA). .. The amplified products were treated with exonuclease I and rapid alkaline phosphatase (United States Biochemicals, Affymetrix, Cleveland, OH) to remove excess primers and nucleotides before sequencing.

    Sequencing:

    Article Title: The northernmost record of a blood-sucking ectoparasite, Lipoptenafortisetosa Maa ( Diptera: Hippoboscidae), in Estonia
    Article Snippet: PCR products were visualised on a 1.6% agarose gel and 10 μl of the PCR solution was treated with FastAP thermosensitive alkaline phosphatase and exonuclease I (Thermo Scientific). .. The DNA cycle sequencing was performed in a total volume of 10 μl using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA).

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: .. PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′. ..

    Article Title: History-driven population structure and asymmetric gene flow in a recovering large carnivore at the rear-edge of its European range
    Article Snippet: A total of 60 samples, which were determined to belong to different individuals as per the microsatellite analysis, were used to sequence a 271 bp stretch of the mitochondrial control region. .. PCRs were performed in a T1 plus Thermocycler (Biometra GmbH, Göttingen, Germany) with an initial denaturation step of 95 °C for 5 min, followed by 38 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final elongation step of 72 °C for 7 min. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min. Purified PCR products were diluted 1:40 and both strands sequenced on an ABI3730 DNA Analyzer (Life Technologies GmbH, Darmstadt, Germany).

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: Amplification of the 540-bp TP53 sequence including rs1042522 and rs17878362 was performed by using PCR with 5′-AACCCCAGCCCCCTAGCAGAGACC-3′ as the forward primer and 5′-GGGGATACGG CCAGGCATTGAAGT-3′ as the reverse primer. .. Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures.

    Article Title: Charcot-Marie-Tooth type 4B2 demyelinating neuropathy in miniature Schnauzer dogs caused by a novel splicing SBF2 (MTMR13) genetic variant: a new spontaneous clinical model
    Article Snippet: .. Enzymatic clean-up with Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) was carried out and subsequent sequencing performed. .. PCR primers were used for sequencing along with BigDye Terminator v.1.1 cycle sequencing kit (Applied Biosystems).

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States). .. Sequencing-PCR of ExoSAP-treated DNA was performed with BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems; Foster City, California, United States) according to the manufacturer’s protocol.

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: .. Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100). .. Sequence data were imported into Sequencher (Gene Codes, Inc.) for alignment.

    Article Title: Mutations in Folate Transporter Genes and Risk for Human Myelomeningocele
    Article Snippet: .. The amplified products were treated with exonuclease I and rapid alkaline phosphatase (United States Biochemicals, Affymetrix, Cleveland, OH) to remove excess primers and nucleotides before sequencing. .. Sanger sequencing was conducted using the BigDye Terminator Protocol (LifeTechnologies Inc., Foster City, CA) with nested-sequencing primers.

    Article Title: In vitro effects of FBXW7 mutation in serous endometrial cancer: increased levels of potentially druggable proteins and sensitivity to SI-2 and dinaciclib
    Article Snippet: .. PCR reactions were subjected to exonuclease I (Epicentre, Madison, WI)/shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) purification prior to Sanger sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA). .. Sequence traces were reviewed using Sequencher™ 5.4.6 (Gene Codes Corporation, Ann Arbor, MI).

    CRISPR:

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: CRISPR locus of pCRISPR-crRNA, pCRISPR-multi-crRNA and pCRISPR-control plasmid were amplified with PCR using one bacterial colony as a template with primers spacerseqF and spacerseqR (Supplementary Table 1). .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States).

    Nested PCR:

    Article Title: More than one antibody of individual B cells revealed by single-cell immune profiling
    Article Snippet: After this, the free primers were removed by Exonuclease I, and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase (TdT) (Invitrogen, cat. no. 10533-065) for cDNA amplification. .. The amplified cDNA of a single B cell was used to amplify Igs by nested PCR.

    Purification:

    Article Title: The northernmost record of a blood-sucking ectoparasite, Lipoptenafortisetosa Maa ( Diptera: Hippoboscidae), in Estonia
    Article Snippet: PCR was performed in a total volume of 20 μl, with the reaction mixture containing 1X BD Advantage 2 PCR buffer, 1U BD Advantage 2 Polymerase mix (BD Biosciences, San Jose, USA), 0.2 mM dNTP (Thermo Scientific, Pittsburgh, USA), 5 pmol of primers LCO1490 (5'-ggtcaacaaatcataaagatattgg-3') and HC02198 (5'-taaacttcagggtgaccaaaaaatca-3') ( ) (replaced by MLepF1 (5’- GCTTTCCCACGAATAAATAATA-3’) ( ) and LepR1 (5’-TAAACTTCTGGATGTCCAAAAAATCA-3’) ( ) for degraded samples) and 20–80 ng of purified genomic DNA. .. PCR products were visualised on a 1.6% agarose gel and 10 μl of the PCR solution was treated with FastAP thermosensitive alkaline phosphatase and exonuclease I (Thermo Scientific).

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: Paragraph title: Plasmid DNA preparation and purification ... To remove the genomic DNA contamination, the isolated plasmid DNA samples were digested overnight with Lambda exonuclease and exonuclease I (Fermentas) at 37 °C.

    Article Title: Dynamic range expansion leads to establishment of a new, genetically distinct wolf population in Central Europe
    Article Snippet: .. PCR products were purified using exonuclease I and FastAP alkaline phosphatase (ThermoScientific) and sequenced on ABI3730/xl Genetic Analyzer (Applied Biosystems). ..

    Article Title: History-driven population structure and asymmetric gene flow in a recovering large carnivore at the rear-edge of its European range
    Article Snippet: .. PCRs were performed in a T1 plus Thermocycler (Biometra GmbH, Göttingen, Germany) with an initial denaturation step of 95 °C for 5 min, followed by 38 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final elongation step of 72 °C for 7 min. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min. Purified PCR products were diluted 1:40 and both strands sequenced on an ABI3730 DNA Analyzer (Life Technologies GmbH, Darmstadt, Germany). .. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min.

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: .. Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures. .. Sequencing of the products used BigDye® Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Life Technologies Polska, Warsaw, Poland).

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: Each of the selected plasmid samples was digested overnight with a mixture of lambda exonuclease and exonuclease I (Fermentas) at 37 °C to remove the genomic DNA background. .. The digested plasmid DNA samples were purified with DNA Clean & ConcentratorTM (Zymo) kit according to the manufacturer’s instructions.

    Article Title: Comprehensive Pharmacogenetic Analysis of Irinotecan Neutropenia and Pharmacokinetics
    Article Snippet: .. Before SBE reaction, PCR products were purified by treatment with shrimp alkaline phosphatase (Roche, Indianapolis, IN) and exonuclease I (USB Corporation, Cleveland, OH) at 37°C for 45 minutes. .. SBE reactions were carried out in a 10-μL volume containing 1 μM of SBE primer, 250 μM each of four dideoxynucleotide triphosphates (ddNTPs), 1.25 U of ThermoSequenase (GE Healthcare, Piscataway, NJ), and 6 μL of purified PCR products.

    Article Title: Charcot-Marie-Tooth type 4B2 demyelinating neuropathy in miniature Schnauzer dogs caused by a novel splicing SBF2 (MTMR13) genetic variant: a new spontaneous clinical model
    Article Snippet: Enzymatic clean-up with Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) was carried out and subsequent sequencing performed. .. Sequencing reaction products were purified using sephadex columns and then run on a 3730xl DNA Analyzer.

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States). .. Sequencing-PCR of ExoSAP-treated DNA was performed with BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems; Foster City, California, United States) according to the manufacturer’s protocol.

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: .. Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100). .. Sequence data were imported into Sequencher (Gene Codes, Inc.) for alignment.

    Article Title: Comprehensive Pharmacogenetic Analysis of Irinotecan Neutropenia and Pharmacokinetics
    Article Snippet: .. PCR products were purified by treatment with shrimp alkaline phosphatase (Roche) and exonuclease I (USB Corporation) at 37°C for 45 minutes before the SBE reaction. .. Duplex SBE reactions were carried out in 12.6 μL containing 1 μM of each SBE primer, 250 μM each of four ddNTPs, 7.2 μL of purified PCR product, and 1.5 U of ThermoSequenase (GE Healthcare) in 1× Reaction buffer provided by the manufacturer.

    Article Title: In vitro effects of FBXW7 mutation in serous endometrial cancer: increased levels of potentially druggable proteins and sensitivity to SI-2 and dinaciclib
    Article Snippet: .. PCR reactions were subjected to exonuclease I (Epicentre, Madison, WI)/shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA) purification prior to Sanger sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA). .. Sequence traces were reviewed using Sequencher™ 5.4.6 (Gene Codes Corporation, Ann Arbor, MI).

    Plasmid Preparation:

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: .. To remove the genomic DNA contamination, the isolated plasmid DNA samples were digested overnight with Lambda exonuclease and exonuclease I (Fermentas) at 37 °C. .. The digested plasmid DNA samples were purified with DNA Clean & ConcentratorTM (Zymo) kit according to the manufacturer’s instructions.

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: .. Each of the selected plasmid samples was digested overnight with a mixture of lambda exonuclease and exonuclease I (Fermentas) at 37 °C to remove the genomic DNA background. .. The digested plasmid DNA samples were purified with DNA Clean & ConcentratorTM (Zymo) kit according to the manufacturer’s instructions.

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: CRISPR locus of pCRISPR-crRNA, pCRISPR-multi-crRNA and pCRISPR-control plasmid were amplified with PCR using one bacterial colony as a template with primers spacerseqF and spacerseqR (Supplementary Table 1). .. PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States).

    Software:

    Article Title: History-driven population structure and asymmetric gene flow in a recovering large carnivore at the rear-edge of its European range
    Article Snippet: PCR products were run in an automated sequencer (ABI 310) and genotypes were determined using ABI Genescan and Genotyper version 2.1 software. .. PCRs were performed in a T1 plus Thermocycler (Biometra GmbH, Göttingen, Germany) with an initial denaturation step of 95 °C for 5 min, followed by 38 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final elongation step of 72 °C for 7 min. PCR products were purified by adding 4 µl of Exonuclease I and 1.6 µl of FastAP™ Thermosensitive Alkaline Phosphatase (Thermo Scientific, Waltham, MA USA) at 37 °C for 15 min followed by 80 °C for 15 min. Purified PCR products were diluted 1:40 and both strands sequenced on an ABI3730 DNA Analyzer (Life Technologies GmbH, Darmstadt, Germany).

    Article Title: Two Functional TP53 Genetic Variants and Predisposition to Keloid Scarring in Caucasians
    Article Snippet: Subsequently, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific Inc., Waltham, MA, USA) according to manufacturer procedures. .. Electrophoresis and analysis were performed according to manufacturer procedures using an ABI PRISM 3100-Avant machine (Data Collection Software v2.0, Sequencing Analysis Software v5.4; Applied Biosystems).

    Article Title: Midbiotics: conjugative plasmids for genetic engineering of natural gut flora
    Article Snippet: PCR product was purified from primers and nucleotides with 0.4 U of Exonuclease I (20 U/µl, ThermoScientific; Waltham, Massachusetts, United States) and 0.4 U of FastAP Thermosensitive Alkaline phosphatase (1U/µl, ThermoScientific; Waltham, Massachusetts, United States). .. The basecalling was performed with Sequencing Analysis Software v6.0 (Applied Biosystems; Foster City, California, United States), and the sequences were analyzed for deletions or mutations in CRISPR locus by mapping them against the original sequence by using Geneious 8.1.9 (Biomatters Ltd; Auckland, New Zealand).

    Article Title: Baboon Carboxylesterases 1 and 2: Sequences, Structures and Phylogenetic Relationships with Human and other Primate Carboxylesterases
    Article Snippet: .. Sequencing products were purified using Exonuclease I (10ul/ul, USB Cat. No. 70073Z) and Shrimp Alkaline Phosphatase (SAP) (1u/ul, USB Cat. No. 70092Z) and analyzed on an automated sequencer (Applied Biosystems 3100) using Sequence Analysis software (Applied Biosystems 3100). .. Sequence data were imported into Sequencher (Gene Codes, Inc.) for alignment.

    Negative Control:

    Article Title: Chemical-genetic profiling reveals limited cross-resistance between antimicrobial peptides with different modes of action
    Article Snippet: Each of the selected plasmid samples was digested overnight with a mixture of lambda exonuclease and exonuclease I (Fermentas) at 37 °C to remove the genomic DNA background. .. E. coli BW25113 strain carrying the empty vector was used as a negative control to measure read counts originating from genomic DNA contamination during plasmid preparation (background).

    Agarose Gel Electrophoresis:

    Article Title: The northernmost record of a blood-sucking ectoparasite, Lipoptenafortisetosa Maa ( Diptera: Hippoboscidae), in Estonia
    Article Snippet: .. PCR products were visualised on a 1.6% agarose gel and 10 μl of the PCR solution was treated with FastAP thermosensitive alkaline phosphatase and exonuclease I (Thermo Scientific). .. One unit of both enzymes was added to the PCR solution, which was incubated for 15 min at 37°C, followed by 15 min inactivation at 80°C.

    Next-Generation Sequencing:

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′. .. These sequences were then truncated to the first 1.311 nucleotides (of 1,377 total), partially omitting the C terminus of CD4, which was poorly resolved by next generation sequencing and could not be accurately phased ( ).

    Concentration Assay:

    Article Title: A glycan shield on chimpanzee CD4 protects against infection by primate lentiviruses (HIV/SIV)
    Article Snippet: PCR amplification of CD4 was performed using Phusion High-Fidelity PCR Master Mix (New England Biolabs; #M0531S) containing ∼50 ng of cDNA and 0.2-μM final concentration of each PCR primer CD4-5′ UTR forward 5′-GGGCAAGAAAGACGCAAGC-3′ and CD4-3′ UTR reverse 5′-ATCTGCCTGGCCTCGTG-3′ in a final volume of 50 μL. .. PCR clean-up was performed using Exonuclease-I and recombinant Shrimp Alkaline Phosphatase treatment (Affymetrix) for 15 min at 37 °C, and then the cleaned-up products were Sanger sequenced using the following sequencing primers: CD4-forward 5′-GGGCAAGAAAGACGCAAGC-3′, 5′-TTCTGCGGGCTCAGGTCC-3′, 5′-TAGTGTTCGGATTGACTGC-3′, 5′-TACCCAGGACCCTAAGC-3′, and CD4-reverse 5′-ATCTGCCTGGCCTCGTG-3′, 5′-TTTACCCCTTGGACTCC-3′, 5′-GGTTCACTTCCTGATGC-3′.

    Article Title: Dynamic range expansion leads to establishment of a new, genetically distinct wolf population in Central Europe
    Article Snippet: PCR was performed in 15 μl reaction volume containing 1X DreamTaq Green PCR Master Mix (ThermoScientific), primers at concentration of 0.33 μM each, 0.17 μg/μl BSA and 3 μl DNA extract (typically 5–20 ng DNA). .. PCR products were purified using exonuclease I and FastAP alkaline phosphatase (ThermoScientific) and sequenced on ABI3730/xl Genetic Analyzer (Applied Biosystems).

    Lysis:

    Article Title: More than one antibody of individual B cells revealed by single-cell immune profiling
    Article Snippet: Extraction and reverse transcription of RNA in single cells The protocol of single-cell lysis and reverse transcription of total RNA was performed as described in Tang’s masterpiece . .. After this, the free primers were removed by Exonuclease I, and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase (TdT) (Invitrogen, cat. no. 10533-065) for cDNA amplification.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher en0581
    En0581, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 528 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/en0581/product/Thermo Fisher
    Average 90 stars, based on 528 article reviews
    Price from $9.99 to $1999.99
    en0581 - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    Description Exonuclease I hydrolyzes single stranded DNA in the 3 →5 direction releasing 5 mononucleotides and leaving the terminal 5 dinucleotide intact Hydrolysis is processive and cannot proceed if the
      Buy from Supplier

    Image Search Results