exonuclease i  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    Exonuclease I
    Description:
    E coli Exonuclease I is a 3 to 5 exonuclease for single stranded DNA degradation resulting in the production of 5 phosphate mononucleotides from the 3 hydroxyl termini of single stranded DNA This 3 to 5 exonuclease is highly specific for single stranded DNA and does not react with double stranded DNA or RNA Exonuclease I is inactivated by heat treatment at 80°C for 15 minutes
    Catalog Number:
    2650b
    Price:
    None
    Size:
    3 750 Units
    Category:
    Exonuclease I Nucleases Modifying enzymes Cloning
    Buy from Supplier


    Structured Review

    TaKaRa exonuclease i
    Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U <t>exonuclease</t> I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.
    E coli Exonuclease I is a 3 to 5 exonuclease for single stranded DNA degradation resulting in the production of 5 phosphate mononucleotides from the 3 hydroxyl termini of single stranded DNA This 3 to 5 exonuclease is highly specific for single stranded DNA and does not react with double stranded DNA or RNA Exonuclease I is inactivated by heat treatment at 80°C for 15 minutes
    https://www.bioz.com/result/exonuclease i/product/TaKaRa
    Average 96 stars, based on 81 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2020-08
    96/100 stars

    Images

    1) Product Images from "Regulation of DNA nucleases by molecular crowding"

    Article Title: Regulation of DNA nucleases by molecular crowding

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm445

    Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U exonuclease I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.
    Figure Legend Snippet: Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U exonuclease I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.

    Techniques Used:

    Initial velocities ( v ) for the DNase I ( A ) and exonuclease I ( B ) hydrolysis reactions in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) PEG (closed diamonds). The DNase I reaction was carried out in a buffer containing 100 mM NaCl, 5 mM MgCl 2 and 50 mM HEPES (pH 7.2) at 25°C in the absence or presence of PEG 4000. The exonuclease I reaction was carried out in a buffer containing 100 mM NaCl, 6.7 mM MgCl 2 , 10 mM 2-mercaptoethanol and 67 mM glycine-KOH (pH 9.5) at 37°C in the absence or presence of PEG 8000. The dsDNA and ssDNA concentrations in kinetic assays were 0.1–20 μM for DNase I and 0.1–10 μM for exonuclease I. The value of v was plotted versus the concentration of substrate DNA. Error bars (smaller than ±1%) were omitted for clarity.
    Figure Legend Snippet: Initial velocities ( v ) for the DNase I ( A ) and exonuclease I ( B ) hydrolysis reactions in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) PEG (closed diamonds). The DNase I reaction was carried out in a buffer containing 100 mM NaCl, 5 mM MgCl 2 and 50 mM HEPES (pH 7.2) at 25°C in the absence or presence of PEG 4000. The exonuclease I reaction was carried out in a buffer containing 100 mM NaCl, 6.7 mM MgCl 2 , 10 mM 2-mercaptoethanol and 67 mM glycine-KOH (pH 9.5) at 37°C in the absence or presence of PEG 8000. The dsDNA and ssDNA concentrations in kinetic assays were 0.1–20 μM for DNase I and 0.1–10 μM for exonuclease I. The value of v was plotted versus the concentration of substrate DNA. Error bars (smaller than ±1%) were omitted for clarity.

    Techniques Used: Concentration Assay

    Residual activities of DNase I and exonuclease I after incubation for 0–30 min at 60°C. Hydrolysis by DNase I in the absence (open circles) or presence (closed circles) of 20% (w/v) PEG 4000 was carried out for 10 min at 25°C. Hydrolysis by exonuclease I in the absence (open triangles) or presence (closed triangles) of 20% (w/v) PEG 8000 was carried out for 10 min at 37°C.
    Figure Legend Snippet: Residual activities of DNase I and exonuclease I after incubation for 0–30 min at 60°C. Hydrolysis by DNase I in the absence (open circles) or presence (closed circles) of 20% (w/v) PEG 4000 was carried out for 10 min at 25°C. Hydrolysis by exonuclease I in the absence (open triangles) or presence (closed triangles) of 20% (w/v) PEG 8000 was carried out for 10 min at 37°C.

    Techniques Used: Incubation

    2) Product Images from "An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules"

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm194

    Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. ( A ) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with 32 P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. ( B ) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I SS , structure-dependent inhibition by salt in the medium; I SC , structure-dependent inhibition by compound; I SSC , structure-dependent inhibition by salt and compound; I NSC , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.
    Figure Legend Snippet: Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. ( A ) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with 32 P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. ( B ) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I SS , structure-dependent inhibition by salt in the medium; I SC , structure-dependent inhibition by compound; I SSC , structure-dependent inhibition by salt and compound; I NSC , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.

    Techniques Used: Inhibition, Labeling, Nucleic Acid Electrophoresis, Hydrolysis Assay, Concentration Assay

    Effect of TMPyP4 on oligonucleotides. ( A and B ) Hydrolysis of T24G21 (filled circles) and T24RG21 (open circles) by exonuclease I (3 U) for 1 h in the presence of 150 mM of (A) K + or (B) Li + . ( C ) Thermal stability of (G 3 T 2 A) 3 G 3 quadruplex in the absence and presence of equimolar TMPyP4. Curves were nudged along vertical axis to avoid overlap. ( D ) Electrophoresis behavior of T24G21 and T24RG21 in 12% native gel. Data in (A) represent the mean of two hydrolysis experiments with range. Samples in (D) were prepared as in (A) but without exonuclease hydrolysis.
    Figure Legend Snippet: Effect of TMPyP4 on oligonucleotides. ( A and B ) Hydrolysis of T24G21 (filled circles) and T24RG21 (open circles) by exonuclease I (3 U) for 1 h in the presence of 150 mM of (A) K + or (B) Li + . ( C ) Thermal stability of (G 3 T 2 A) 3 G 3 quadruplex in the absence and presence of equimolar TMPyP4. Curves were nudged along vertical axis to avoid overlap. ( D ) Electrophoresis behavior of T24G21 and T24RG21 in 12% native gel. Data in (A) represent the mean of two hydrolysis experiments with range. Samples in (D) were prepared as in (A) but without exonuclease hydrolysis.

    Techniques Used: Electrophoresis

    Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. ( A ) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K + . ( B ) Quadruplex formation by (G 3 T 2 A) 3 G 3 as a function of K + concentration examined by fluorescence resonance energy transfer (FRET). ( C ) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K + concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K + . LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.
    Figure Legend Snippet: Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. ( A ) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K + . ( B ) Quadruplex formation by (G 3 T 2 A) 3 G 3 as a function of K + concentration examined by fluorescence resonance energy transfer (FRET). ( C ) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K + concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K + . LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.

    Techniques Used: Electrophoresis, Concentration Assay, Fluorescence, Förster Resonance Energy Transfer, Nucleic Acid Electrophoresis, Standard Deviation

    Effect of ( A ) TMPyP4, ( B ) BMVC and ( C ) DODC on the hydrolysis of the  c-myc  gene sequence T24c-myc22 (T 24 GAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I. Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range.
    Figure Legend Snippet: Effect of ( A ) TMPyP4, ( B ) BMVC and ( C ) DODC on the hydrolysis of the c-myc gene sequence T24c-myc22 (T 24 GAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I. Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range.

    Techniques Used: Sequencing

    3) Product Images from "An Exonuclease I-Based Quencher-Free Fluorescent Method Using DNA Hairpin Probes for Rapid Detection of MicroRNA"

    Article Title: An Exonuclease I-Based Quencher-Free Fluorescent Method Using DNA Hairpin Probes for Rapid Detection of MicroRNA

    Journal: Sensors (Basel, Switzerland)

    doi: 10.3390/s17040760

    Schematic showing the principle of the quencher-free fluorescence-based method for the detection of microRNA. Exo I: Exonuclease I.
    Figure Legend Snippet: Schematic showing the principle of the quencher-free fluorescence-based method for the detection of microRNA. Exo I: Exonuclease I.

    Techniques Used: Fluorescence

    4) Product Images from "Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion"

    Article Title: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion

    Journal: Scientific Reports

    doi: 10.1038/srep14979

    ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.
    Figure Legend Snippet: ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.

    Techniques Used: Chromatin Immunoprecipitation, Amplification, Imaging, Agarose Gel Electrophoresis

    Related Articles

    Amplification:

    Article Title: Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer
    Article Snippet: .. The 2.5-kbp genomic sequences in the POLD1 and POLE genes that encompass the regions encoding the proofreading domains of pol delta and epsilon ( ) were amplified by PCR using Taq polymerase with the 3′ exonuclease activity, EX Taq (TaKaRa Bio Inc., Otsu, Japan), and the oligonucleotide primers shown in . .. PCR products were directly used as a template for cycle sequencing reactions using BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and the reaction products were loaded onto ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Mutagenesis:

    Article Title: A GALECTIN-3-DEPENDENT PATHWAY UPREGULATES INTERLEUKIN-6 IN THE MICROENVIRONMENT OF HUMAN NEUROBLASTOMA
    Article Snippet: .. IL-6 promoter deletion mutants in the pGL2-IL-6-Luc construct were generated either by Exonuclease III digestion using the Deletion Kit for kilo sequencing (Takara) in accordance with the instructions of the manufacturer (deletion −1041) or by restriction endonuclease digestion with KpnI and NheI (deletion mutant −212) followed by Klenow fragment reaction at 37°C for 15 minutes. .. Construct −97 was created by PCR reaction using a forward primer: 5’-CCC GGT ACC CAC CCT CAC CCT CCA AC-3’ and the IL-6 reverse primer described above.

    Genomic Sequencing:

    Article Title: Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer
    Article Snippet: .. The 2.5-kbp genomic sequences in the POLD1 and POLE genes that encompass the regions encoding the proofreading domains of pol delta and epsilon ( ) were amplified by PCR using Taq polymerase with the 3′ exonuclease activity, EX Taq (TaKaRa Bio Inc., Otsu, Japan), and the oligonucleotide primers shown in . .. PCR products were directly used as a template for cycle sequencing reactions using BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and the reaction products were loaded onto ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Generated:

    Article Title: A GALECTIN-3-DEPENDENT PATHWAY UPREGULATES INTERLEUKIN-6 IN THE MICROENVIRONMENT OF HUMAN NEUROBLASTOMA
    Article Snippet: .. IL-6 promoter deletion mutants in the pGL2-IL-6-Luc construct were generated either by Exonuclease III digestion using the Deletion Kit for kilo sequencing (Takara) in accordance with the instructions of the manufacturer (deletion −1041) or by restriction endonuclease digestion with KpnI and NheI (deletion mutant −212) followed by Klenow fragment reaction at 37°C for 15 minutes. .. Construct −97 was created by PCR reaction using a forward primer: 5’-CCC GGT ACC CAC CCT CAC CCT CCA AC-3’ and the IL-6 reverse primer described above.

    Construct:

    Article Title: A GALECTIN-3-DEPENDENT PATHWAY UPREGULATES INTERLEUKIN-6 IN THE MICROENVIRONMENT OF HUMAN NEUROBLASTOMA
    Article Snippet: .. IL-6 promoter deletion mutants in the pGL2-IL-6-Luc construct were generated either by Exonuclease III digestion using the Deletion Kit for kilo sequencing (Takara) in accordance with the instructions of the manufacturer (deletion −1041) or by restriction endonuclease digestion with KpnI and NheI (deletion mutant −212) followed by Klenow fragment reaction at 37°C for 15 minutes. .. Construct −97 was created by PCR reaction using a forward primer: 5’-CCC GGT ACC CAC CCT CAC CCT CCA AC-3’ and the IL-6 reverse primer described above.

    Sequencing:

    Article Title: A GALECTIN-3-DEPENDENT PATHWAY UPREGULATES INTERLEUKIN-6 IN THE MICROENVIRONMENT OF HUMAN NEUROBLASTOMA
    Article Snippet: .. IL-6 promoter deletion mutants in the pGL2-IL-6-Luc construct were generated either by Exonuclease III digestion using the Deletion Kit for kilo sequencing (Takara) in accordance with the instructions of the manufacturer (deletion −1041) or by restriction endonuclease digestion with KpnI and NheI (deletion mutant −212) followed by Klenow fragment reaction at 37°C for 15 minutes. .. Construct −97 was created by PCR reaction using a forward primer: 5’-CCC GGT ACC CAC CCT CAC CCT CCA AC-3’ and the IL-6 reverse primer described above.

    Incubation:

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
    Article Snippet: .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min. .. The reactions were terminated by addition of 2.5 μl of stop solution (1% SDS, 10 mM EDTA and 4 mg/ml protease K), incubated at 37°C for 20 min, and analyzed by 1% agarose gel electrophoresis.

    Activity Assay:

    Article Title: Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer
    Article Snippet: .. The 2.5-kbp genomic sequences in the POLD1 and POLE genes that encompass the regions encoding the proofreading domains of pol delta and epsilon ( ) were amplified by PCR using Taq polymerase with the 3′ exonuclease activity, EX Taq (TaKaRa Bio Inc., Otsu, Japan), and the oligonucleotide primers shown in . .. PCR products were directly used as a template for cycle sequencing reactions using BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and the reaction products were loaded onto ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer
    Article Snippet: .. The 2.5-kbp genomic sequences in the POLD1 and POLE genes that encompass the regions encoding the proofreading domains of pol delta and epsilon ( ) were amplified by PCR using Taq polymerase with the 3′ exonuclease activity, EX Taq (TaKaRa Bio Inc., Otsu, Japan), and the oligonucleotide primers shown in . .. PCR products were directly used as a template for cycle sequencing reactions using BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and the reaction products were loaded onto ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Recombinant:

    Article Title: An Exonuclease I-Based Quencher-Free Fluorescent Method Using DNA Hairpin Probes for Rapid Detection of MicroRNA
    Article Snippet: .. Exonuclease I, 10× exonuclease I buffer (670 mM Glycine-KOH, 10 mM Dithiothreitol (DTT), 67 mM MgCl2 , pH 9.5), recombinant RNase inhibitor (RRI), and RNase-free water were obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    TaKaRa exonuclease i
    Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U <t>exonuclease</t> I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.
    Exonuclease I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i/product/TaKaRa
    Average 96 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2020-08
    96/100 stars
      Buy from Supplier

    Image Search Results


    Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U exonuclease I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.

    Journal: Nucleic Acids Research

    Article Title: Regulation of DNA nucleases by molecular crowding

    doi: 10.1093/nar/gkm445

    Figure Lengend Snippet: Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U exonuclease I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.

    Article Snippet: Exonuclease I from Escherichia coli , S1 nuclease from Asergillus oryzae and exonuclease III from E. coli were purchased from Takara Bio (Tokyo, Japan).

    Techniques:

    Initial velocities ( v ) for the DNase I ( A ) and exonuclease I ( B ) hydrolysis reactions in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) PEG (closed diamonds). The DNase I reaction was carried out in a buffer containing 100 mM NaCl, 5 mM MgCl 2 and 50 mM HEPES (pH 7.2) at 25°C in the absence or presence of PEG 4000. The exonuclease I reaction was carried out in a buffer containing 100 mM NaCl, 6.7 mM MgCl 2 , 10 mM 2-mercaptoethanol and 67 mM glycine-KOH (pH 9.5) at 37°C in the absence or presence of PEG 8000. The dsDNA and ssDNA concentrations in kinetic assays were 0.1–20 μM for DNase I and 0.1–10 μM for exonuclease I. The value of v was plotted versus the concentration of substrate DNA. Error bars (smaller than ±1%) were omitted for clarity.

    Journal: Nucleic Acids Research

    Article Title: Regulation of DNA nucleases by molecular crowding

    doi: 10.1093/nar/gkm445

    Figure Lengend Snippet: Initial velocities ( v ) for the DNase I ( A ) and exonuclease I ( B ) hydrolysis reactions in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) PEG (closed diamonds). The DNase I reaction was carried out in a buffer containing 100 mM NaCl, 5 mM MgCl 2 and 50 mM HEPES (pH 7.2) at 25°C in the absence or presence of PEG 4000. The exonuclease I reaction was carried out in a buffer containing 100 mM NaCl, 6.7 mM MgCl 2 , 10 mM 2-mercaptoethanol and 67 mM glycine-KOH (pH 9.5) at 37°C in the absence or presence of PEG 8000. The dsDNA and ssDNA concentrations in kinetic assays were 0.1–20 μM for DNase I and 0.1–10 μM for exonuclease I. The value of v was plotted versus the concentration of substrate DNA. Error bars (smaller than ±1%) were omitted for clarity.

    Article Snippet: Exonuclease I from Escherichia coli , S1 nuclease from Asergillus oryzae and exonuclease III from E. coli were purchased from Takara Bio (Tokyo, Japan).

    Techniques: Concentration Assay

    Residual activities of DNase I and exonuclease I after incubation for 0–30 min at 60°C. Hydrolysis by DNase I in the absence (open circles) or presence (closed circles) of 20% (w/v) PEG 4000 was carried out for 10 min at 25°C. Hydrolysis by exonuclease I in the absence (open triangles) or presence (closed triangles) of 20% (w/v) PEG 8000 was carried out for 10 min at 37°C.

    Journal: Nucleic Acids Research

    Article Title: Regulation of DNA nucleases by molecular crowding

    doi: 10.1093/nar/gkm445

    Figure Lengend Snippet: Residual activities of DNase I and exonuclease I after incubation for 0–30 min at 60°C. Hydrolysis by DNase I in the absence (open circles) or presence (closed circles) of 20% (w/v) PEG 4000 was carried out for 10 min at 25°C. Hydrolysis by exonuclease I in the absence (open triangles) or presence (closed triangles) of 20% (w/v) PEG 8000 was carried out for 10 min at 37°C.

    Article Snippet: Exonuclease I from Escherichia coli , S1 nuclease from Asergillus oryzae and exonuclease III from E. coli were purchased from Takara Bio (Tokyo, Japan).

    Techniques: Incubation

    Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. ( A ) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with 32 P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. ( B ) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I SS , structure-dependent inhibition by salt in the medium; I SC , structure-dependent inhibition by compound; I SSC , structure-dependent inhibition by salt and compound; I NSC , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.

    Journal: Nucleic Acids Research

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules

    doi: 10.1093/nar/gkm194

    Figure Lengend Snippet: Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. ( A ) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with 32 P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. ( B ) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I SS , structure-dependent inhibition by salt in the medium; I SC , structure-dependent inhibition by compound; I SSC , structure-dependent inhibition by salt and compound; I NSC , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.

    Article Snippet: Exonuclease I from Escherichia coli was purchased from TaKaRa Biotechnology.

    Techniques: Inhibition, Labeling, Nucleic Acid Electrophoresis, Hydrolysis Assay, Concentration Assay

    Effect of TMPyP4 on oligonucleotides. ( A and B ) Hydrolysis of T24G21 (filled circles) and T24RG21 (open circles) by exonuclease I (3 U) for 1 h in the presence of 150 mM of (A) K + or (B) Li + . ( C ) Thermal stability of (G 3 T 2 A) 3 G 3 quadruplex in the absence and presence of equimolar TMPyP4. Curves were nudged along vertical axis to avoid overlap. ( D ) Electrophoresis behavior of T24G21 and T24RG21 in 12% native gel. Data in (A) represent the mean of two hydrolysis experiments with range. Samples in (D) were prepared as in (A) but without exonuclease hydrolysis.

    Journal: Nucleic Acids Research

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules

    doi: 10.1093/nar/gkm194

    Figure Lengend Snippet: Effect of TMPyP4 on oligonucleotides. ( A and B ) Hydrolysis of T24G21 (filled circles) and T24RG21 (open circles) by exonuclease I (3 U) for 1 h in the presence of 150 mM of (A) K + or (B) Li + . ( C ) Thermal stability of (G 3 T 2 A) 3 G 3 quadruplex in the absence and presence of equimolar TMPyP4. Curves were nudged along vertical axis to avoid overlap. ( D ) Electrophoresis behavior of T24G21 and T24RG21 in 12% native gel. Data in (A) represent the mean of two hydrolysis experiments with range. Samples in (D) were prepared as in (A) but without exonuclease hydrolysis.

    Article Snippet: Exonuclease I from Escherichia coli was purchased from TaKaRa Biotechnology.

    Techniques: Electrophoresis

    Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. ( A ) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K + . ( B ) Quadruplex formation by (G 3 T 2 A) 3 G 3 as a function of K + concentration examined by fluorescence resonance energy transfer (FRET). ( C ) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K + concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K + . LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.

    Journal: Nucleic Acids Research

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules

    doi: 10.1093/nar/gkm194

    Figure Lengend Snippet: Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. ( A ) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K + . ( B ) Quadruplex formation by (G 3 T 2 A) 3 G 3 as a function of K + concentration examined by fluorescence resonance energy transfer (FRET). ( C ) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K + concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K + . LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.

    Article Snippet: Exonuclease I from Escherichia coli was purchased from TaKaRa Biotechnology.

    Techniques: Electrophoresis, Concentration Assay, Fluorescence, Förster Resonance Energy Transfer, Nucleic Acid Electrophoresis, Standard Deviation

    Effect of ( A ) TMPyP4, ( B ) BMVC and ( C ) DODC on the hydrolysis of the  c-myc  gene sequence T24c-myc22 (T 24 GAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I. Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range.

    Journal: Nucleic Acids Research

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules

    doi: 10.1093/nar/gkm194

    Figure Lengend Snippet: Effect of ( A ) TMPyP4, ( B ) BMVC and ( C ) DODC on the hydrolysis of the c-myc gene sequence T24c-myc22 (T 24 GAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I. Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range.

    Article Snippet: Exonuclease I from Escherichia coli was purchased from TaKaRa Biotechnology.

    Techniques: Sequencing

    The genomic structures of the  POLD1  ( a ) and  POLE  ( b ) genes and the functional domains in their protein products. The exons corresponding to the 3′ exonuclease, that is, proofreading, domains are indicated in red and the genomic regions sequenced

    Journal: European Journal of Human Genetics

    Article Title: Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer

    doi: 10.1038/ejhg.2010.216

    Figure Lengend Snippet: The genomic structures of the POLD1 ( a ) and POLE ( b ) genes and the functional domains in their protein products. The exons corresponding to the 3′ exonuclease, that is, proofreading, domains are indicated in red and the genomic regions sequenced

    Article Snippet: The 2.5-kbp genomic sequences in the POLD1 and POLE genes that encompass the regions encoding the proofreading domains of pol delta and epsilon ( ) were amplified by PCR using Taq polymerase with the 3′ exonuclease activity, EX Taq (TaKaRa Bio Inc., Otsu, Japan), and the oligonucleotide primers shown in .

    Techniques: Functional Assay

    Further Characterization of ssDNA-Cohesin Interactions, Related to Figure 3 (A) ssDNA and dsDNA binding of cohesin were analyzed by electrophoretic mobility shift experiments using the indicated cohesin concentrations and single or double stranded pBluescript as the substrate. (B) ssDNA is topologically entrapped by cohesin. A schematic of the DNA-release experiment following ssDNA to dsDNA conversion is shown together with a gel image of the input and recovered DNAs at the indicated stages. (C) Cohesin releases circular ssDNA. The released DNA from cohesin following dsDNA to ssDNA conversion, as shown in Figure 3 D, was treated with E. coli exonuclease I that digests linear but not circular ssDNA. No detectable digestion was observed, suggesting that released ssDNA remained circular. As a control for the effectiveness of exonuclease I treatment, heat-denatured nicked circular DNA was treated with exonuclease I in the same way. Linear, but not circular ssDNA was readily digested under these conditions. Note that two nicks were present in the circular DNA before denaturation. This generated two linear ssDNA, only the longer one of which is visible on the gel. (D) ssDNA stimulates the cohesin ATPase. Mis4-Ssl3 and DNA-dependent ATP hydrolysis by cohesin was measured in the presence of indicated proteins and DNAs.

    Journal: Cell

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring

    doi: 10.1016/j.cell.2017.12.021

    Figure Lengend Snippet: Further Characterization of ssDNA-Cohesin Interactions, Related to Figure 3 (A) ssDNA and dsDNA binding of cohesin were analyzed by electrophoretic mobility shift experiments using the indicated cohesin concentrations and single or double stranded pBluescript as the substrate. (B) ssDNA is topologically entrapped by cohesin. A schematic of the DNA-release experiment following ssDNA to dsDNA conversion is shown together with a gel image of the input and recovered DNAs at the indicated stages. (C) Cohesin releases circular ssDNA. The released DNA from cohesin following dsDNA to ssDNA conversion, as shown in Figure 3 D, was treated with E. coli exonuclease I that digests linear but not circular ssDNA. No detectable digestion was observed, suggesting that released ssDNA remained circular. As a control for the effectiveness of exonuclease I treatment, heat-denatured nicked circular DNA was treated with exonuclease I in the same way. Linear, but not circular ssDNA was readily digested under these conditions. Note that two nicks were present in the circular DNA before denaturation. This generated two linear ssDNA, only the longer one of which is visible on the gel. (D) ssDNA stimulates the cohesin ATPase. Mis4-Ssl3 and DNA-dependent ATP hydrolysis by cohesin was measured in the presence of indicated proteins and DNAs.

    Article Snippet: The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Generated