Structured Review

TaKaRa exonuclease i
( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.
Exonuclease I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/exonuclease i/product/TaKaRa
Average 94 stars, based on 13 article reviews
Price from $9.99 to $1999.99
exonuclease i - by Bioz Stars, 2019-12
94/100 stars

Images

1) Product Images from "Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion"

Article Title: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion

Journal: Scientific Reports

doi: 10.1038/srep14979

( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.
Figure Legend Snippet: ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.

Techniques Used: Chromatin Immunoprecipitation, Amplification, Imaging, Agarose Gel Electrophoresis

Related Articles

Amplification:

Article Title: Epidemiology study of HBV genotypes and antiviral drug resistance in multi-ethnic regions from Western China
Article Snippet: The RT coding region was amplified by designed primers as follows: F: 5′-GTTGCCCGTTTGTCCTC-3′, R: 5′-GACAAACTTTCCAATCAATAGG-3′. .. A typical amplification was performed in a 20 μl reaction volume containing 1 μl HBV DNA and 0.2 μl Ex Taq HS (TaKaRa Bio, Tokyo, Japan) at 95 °C for 5 min, followed by 40 cycles at 95 °C for 45 sec, 58 °C for 45 sec, and 72 °C for 30 sec, and final extension at 72 °C for 5 min. PCR products were identified using agarose gel electrophoresis and digested by the mixture of shrimp alkaline phosphatase (SAP) and exonuclease I (TaKaRa Bio, Tokyo, Japan) to eliminate the redundant single-strand DNA. .. Sample processing, PCR, products identification and digestion was done in separate laboratory rooms which were certified for molecular diagnostics using standard precautions to prevent contamination.

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: The markers were amplified following the thermal cycle conditions: 5 min at 95 °C followed by 35 cycles of: 30 s at 94 °C, 1 min at 40 °C, and 1 min 30 s at 72 °C, and followed by a 7 min extension at 72 °C for COI ; 5 min at 95 °C and then 35 cycles of: 1 min at 95 °C, 1 min at 52 °C, and 2 min at 72 °C, followed by a 7 min extension at 72 °C for 16S-rDNA; and 5 min at 95 °C then 35 cycles of: 1 min at 94 °C, 1 min at 50 °C, and 2 min at 72 °C, followed by a 10 min extension at 72 °C for ITS-rDNA. .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan). .. Molecular phylogenetic analyses .

Article Title: De novo mutations of TUBA3D are associated with keratoconus
Article Snippet: Every target fragment was amplified using Taq DNA polymerase (Takara, Dalian, China). .. The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA).

Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
Article Snippet: For sequencing of IDH1/2 and TP53 , target DNA fragments were amplified in a total 10μl reaction volume which containing 1μl of cell lysate, 1μl of MgCl2 (25mM), 1μl of 10*PCR buffer II, 0.2μl of each deoxyribonucleoside triphosphate (10mM), 0.3μl of each forward and reverse primers of target DNA fragment (10nmol), 0.075μl of AmpliTaq Gold DNA polymerase (Life Technologies Corporation, Hong Kong, China). .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min.

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequence ... The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: Paragraph title: Global cDNA amplification and target-specific PCR from single neurons and axon tips ... Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: The thermal cycler conditions of multiplex PCR amplification were as follows: initial denaturation at 95°C for 5 min and amplification for 35 cycles at 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min, followed by a final elongation step at 72°C for 10 min. .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: The thermal cycler conditions for multiplex PCR amplification were as follows: initial denaturation, 95°C for 5 min, amplification for 35 cycles at 94°C for 30 s, 65°C for 30 s and 72°C for 1 min, followed by a final elongation step at 72°C for 10 min. .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ).

Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
Article Snippet: The partial regions of the gag gene were amplified by RT-PCR using the primer set, aSRV-F1167 and aSRV-R1710, as described above. .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan).

Filtration:

Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
Article Snippet: To confirm circular integrity of cohesin-released ssDNA after exonuclease III treatment, the supernatant fraction was passed through a G-25 gel filtration spin column, equilibrated with exoI buffer (67 mM Glycine-KOH pH 9.5, 1 mM DTT and 6.7 mM MgCl2 ). .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

Synthesized:

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced. .. Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced.

Construct:

Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
Article Snippet: The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan).

Real-time Polymerase Chain Reaction:

Article Title: De novo mutations of TUBA3D are associated with keratoconus
Article Snippet: The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA). .. The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA).

Multiplex Assay:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Paragraph title: SNaPshot multiplex assay for point mutations ... The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis in a 2.5% agarose gel. .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT). .. Finally, 1.5 μ L of SNaPshot products was genotyped in the platform of ABI 3730 Genetic Analyzer before they were mixed with 8 μ L of HiDi™ formamide and 0.5 μ L of GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis on a 2.5% agarose gel. .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ). .. Finally, 1.5 μl of SNaPshot products were genotyped using the ABI 3730 Genetic Analyzer before they were mixed with 8 μl HiDiTM formamide and 0.5 μl GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: A functional SNP upstream of the ADRB2 gene is associated with COPD
Article Snippet: In brief, multiplex PCR was performed by primers given in Supplementary Table 1 with FastStart Taq DNA polymerase (Roche, Basel, Switzerland). .. After alkaline phosphatase (Shrimp, Takara-Bio Inc., Kusatsu, Japan) and exonuclease I (Takara Bio Inc.) clean-up, single base extension was performed by SNaPshot Multiplex Ready Reaction Mix (Thermo Fisher Scientific) and the products were analyzed on ABI PRISM 3730 sequencer (Thermo Fisher Scientific). .. Human bronchus normal epithelial cells Beas-2B (#CRL-9609; American Type Culture Collection, Manassas, VA, USA) were cultured in 1640 medium (Thermo Fisher Scientific) with 10% fetal bovine serum (Thermo Fisher Scientific) in 5% CO2 at 37°C.

Incubation:

Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
Article Snippet: To confirm circular integrity of cohesin-released ssDNA after exonuclease III treatment, the supernatant fraction was passed through a G-25 gel filtration spin column, equilibrated with exoI buffer (67 mM Glycine-KOH pH 9.5, 1 mM DTT and 6.7 mM MgCl2 ). .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min. .. The reactions were terminated by addition of 2.5 μl of stop solution (1% SDS, 10 mM EDTA and 4 mg/ml protease K), incubated at 37°C for 20 min, and analyzed by 1% agarose gel electrophoresis.

Article Title: Correction: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA GenesApplication of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: The correct sentences are: The SPE conditions consisted of initial denaturation at 98°C for 2 min, cooling to 55°C at 0.3°C/s, and elongation at 68°C for 10 min. .. Subsequently, excess primers were digested by addition of 4 μl of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. ..

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: The SPE conditions consisted of initial denaturation at 98°C for 2 min, cooling to 68°C at 0.3°C/s, and elongation at 68°C for 10 min. .. Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver. .. 2, and 0.4 μl of MightyAmp DNA polymerase.

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: Reverse transcriptase (5 U, Invitrogen) was added to the RNA/Oligo(dT) mixture and the tubes incubated at 50°C for 50 min. .. Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Formalin-fixed Paraffin-Embedded:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Formalin-fixed, paraffin-embedded tumor samples were cut at 4 μm, and tissue sections were deparaffinized and lightly stained with methyl green. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Chloramphenicol Acetyltransferase Assay:

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: The ITS-rDNA was amplified with the following primer pairs: either ITSf (5’-CTA GTA AGC GCG AGT CAT CAG C-3’) and ITSr (5’-GGT AGC CTT GCC TGA TCT GA-3’) (both ) or Zoan-f (5’-CTT GAT CAT TTA GAG GGA GT-3’) and Zoan-r (5’-CGG AGA TTT CAA ATT TGA GCT-3’) (both ). .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan).

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: The ITS-rDNA region was amplified using the specific primer set ITSf (5’-CTA GTA AGC GCG AGT CAT CAG C-3’) and ITSr (5’-GGT AGC CTT GCC TGA TCT GA-3’) ( ). mt 16S-rDNA was amplified using the universal primer 16Sar (5’-CGC CTG TTT ATC AAA AAC AT-3’) (Palumbi et al. 1996) and the specific primer 16SBmoH (5’-CGA ACA GCC AAC CCT TGG3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Countercurrent Chromatography:

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: COI was amplified with the following primers: COIZoanF (5’-TGA TAA GGT TAG AAC TTT CTG CCC CGG AAC-3’) ( ) and COIantr (5’-GCC CAC ACA ATA AAG CCC AA TAY YCC AAT-3’) ( ). .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan).

Ligation:

Article Title: High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System
Article Snippet: Paragraph title: Ligation of Fragmented DNA ... The fragmented DNA samples were first checked by introducing ssDNA-specific nuclease, Exonuclease I (TaKaRa Biotechnology (Dalian) Co., Ltd, China), which can digesting ssDNA but not dsDNA.

Transferring:

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: These pipette tips were dipped into the RNAse inhibitor solution and RT-PCR performed as for the axon tip aspirates. .. Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: These pipette tips were dipped into the RNAse inhibitor solution and RT-PCR performed as for the axon tip aspirates. .. Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
Article Snippet: The partial regions of the gag gene were amplified by RT-PCR using the primer set, aSRV-F1167 and aSRV-R1710, as described above. .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

DNA Sequencing:

Article Title: De novo mutations of TUBA3D are associated with keratoconus
Article Snippet: Every target fragment was amplified using Taq DNA polymerase (Takara, Dalian, China). .. The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA). .. Sequences were aligned and analyzed using the DNASTAR software package (DNASTAR Inc., USA).

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver. .. Thermal cycling consisted of initial denaturation at 98°C for 2 min, followed by 40 cycles of 98°C for 10 s, 55°C for 15 s, and 68°C for 30 s. Finally, 15 μl of each PCR product was subjected to agarose gel electrophoresis, and the band of the expected size was excised and purified using a Nucleospin column (TaKaRa Bio).

Polymerase Chain Reaction:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: After RT, the primer was removed by Exonuclease I (TaKaRa) digestion at 37 °C for 30 min. .. After RT, the primer was removed by Exonuclease I (TaKaRa) digestion at 37 °C for 30 min.

Article Title: Epidemiology study of HBV genotypes and antiviral drug resistance in multi-ethnic regions from Western China
Article Snippet: The RT coding region was amplified by designed primers as follows: F: 5′-GTTGCCCGTTTGTCCTC-3′, R: 5′-GACAAACTTTCCAATCAATAGG-3′. .. A typical amplification was performed in a 20 μl reaction volume containing 1 μl HBV DNA and 0.2 μl Ex Taq HS (TaKaRa Bio, Tokyo, Japan) at 95 °C for 5 min, followed by 40 cycles at 95 °C for 45 sec, 58 °C for 45 sec, and 72 °C for 30 sec, and final extension at 72 °C for 5 min. PCR products were identified using agarose gel electrophoresis and digested by the mixture of shrimp alkaline phosphatase (SAP) and exonuclease I (TaKaRa Bio, Tokyo, Japan) to eliminate the redundant single-strand DNA. .. Sample processing, PCR, products identification and digestion was done in separate laboratory rooms which were certified for molecular diagnostics using standard precautions to prevent contamination.

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: The markers were amplified following the thermal cycle conditions: 5 min at 95 °C followed by 35 cycles of: 30 s at 94 °C, 1 min at 40 °C, and 1 min 30 s at 72 °C, and followed by a 7 min extension at 72 °C for COI ; 5 min at 95 °C and then 35 cycles of: 1 min at 95 °C, 1 min at 52 °C, and 2 min at 72 °C, followed by a 7 min extension at 72 °C for 16S-rDNA; and 5 min at 95 °C then 35 cycles of: 1 min at 94 °C, 1 min at 50 °C, and 2 min at 72 °C, followed by a 10 min extension at 72 °C for ITS-rDNA. .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan). .. Molecular phylogenetic analyses .

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced. .. Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced.

Article Title: De novo mutations of TUBA3D are associated with keratoconus
Article Snippet: The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA). .. The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA).

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Primers were designed to amplify DNA fragments containing codons 746–750 and 858 for EGFR ; codons 12, 13, and 61 for KRAS and HRAS ; codons 12 and 61 for NRAS ; codons 542, 545, and 1047 for PIK3CA; codon 600 for BRAF; and codon 17 for AKT1 ( ). .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates. .. A single-base extension multiplex assay was performed using a SNaPshot Multiplex Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.

Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
Article Snippet: PCR for TERT promoter region was performed in 10μl reaction mixture containing 1μl of cell lysate, 0.3μl of each forward and reverse primers of target DNA fragment (10nmol), and 5μl of KAPA HiFi HotStart ReadyMix DNA Polymerase (Kapa Biosystems Wilmington, DE, USA). .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min. .. Sequencing of target DNA fragment was performed using BigDye Terminator Cycle Sequencing kit v.1.1 (Life Technologies).

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: PCR products were checked using 1.0% agarose gel electrophoresis. .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan). .. Obtained DNA sequences were initially checked using the Basic Local Alignment Search Tool (BLAST , National Center for Biotechnology Information).

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: The SPE conditions consisted of initial denaturation at 98°C for 2 min, cooling to 68°C at 0.3°C/s, and elongation at 68°C for 10 min. .. Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver. .. 2, and 0.4 μl of MightyAmp DNA polymerase.

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: Paragraph title: Global cDNA amplification and target-specific PCR from single neurons and axon tips ... Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis in a 2.5% agarose gel. .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT). .. Finally, 1.5 μ L of SNaPshot products was genotyped in the platform of ABI 3730 Genetic Analyzer before they were mixed with 8 μ L of HiDi™ formamide and 0.5 μ L of GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis on a 2.5% agarose gel. .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ). .. Finally, 1.5 μl of SNaPshot products were genotyped using the ABI 3730 Genetic Analyzer before they were mixed with 8 μl HiDiTM formamide and 0.5 μl GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
Article Snippet: The partial regions of the gag gene were amplified by RT-PCR using the primer set, aSRV-F1167 and aSRV-R1710, as described above. .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

Article Title: A functional SNP upstream of the ADRB2 gene is associated with COPD
Article Snippet: In brief, multiplex PCR was performed by primers given in Supplementary Table 1 with FastStart Taq DNA polymerase (Roche, Basel, Switzerland). .. After alkaline phosphatase (Shrimp, Takara-Bio Inc., Kusatsu, Japan) and exonuclease I (Takara Bio Inc.) clean-up, single base extension was performed by SNaPshot Multiplex Ready Reaction Mix (Thermo Fisher Scientific) and the products were analyzed on ABI PRISM 3730 sequencer (Thermo Fisher Scientific).

Cellular Antioxidant Activity Assay:

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: The ITS-rDNA was amplified with the following primer pairs: either ITSf (5’-CTA GTA AGC GCG AGT CAT CAG C-3’) and ITSr (5’-GGT AGC CTT GCC TGA TCT GA-3’) (both ) or Zoan-f (5’-CTT GAT CAT TTA GAG GGA GT-3’) and Zoan-r (5’-CGG AGA TTT CAA ATT TGA GCT-3’) (both ). .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan).

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: The COI gene was amplified using the universal primer set LCO1490 (5’-GGT CAA CAA ATC ATA AAG ATA TTG G-3’) and HCO2198 (5’-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

DNA Extraction:

Article Title: Epidemiology study of HBV genotypes and antiviral drug resistance in multi-ethnic regions from Western China
Article Snippet: Paragraph title: HBV DNA extraction and amplification ... A typical amplification was performed in a 20 μl reaction volume containing 1 μl HBV DNA and 0.2 μl Ex Taq HS (TaKaRa Bio, Tokyo, Japan) at 95 °C for 5 min, followed by 40 cycles at 95 °C for 45 sec, 58 °C for 45 sec, and 72 °C for 30 sec, and final extension at 72 °C for 5 min. PCR products were identified using agarose gel electrophoresis and digested by the mixture of shrimp alkaline phosphatase (SAP) and exonuclease I (TaKaRa Bio, Tokyo, Japan) to eliminate the redundant single-strand DNA.

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequence ... The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Paragraph title: 2.2. Genomic DNA Extraction and Genotyping Analysis ... Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Paragraph title: Genomic DNA Extraction and Genotyping ... Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ).

Mutagenesis:

Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
Article Snippet: Paragraph title: Mutation analysis of IDH1/2 , TERT promoter and TP53 ... PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min.

Size-exclusion Chromatography:

Article Title: Epidemiology study of HBV genotypes and antiviral drug resistance in multi-ethnic regions from Western China
Article Snippet: The RT coding region was amplified by designed primers as follows: F: 5′-GTTGCCCGTTTGTCCTC-3′, R: 5′-GACAAACTTTCCAATCAATAGG-3′. .. A typical amplification was performed in a 20 μl reaction volume containing 1 μl HBV DNA and 0.2 μl Ex Taq HS (TaKaRa Bio, Tokyo, Japan) at 95 °C for 5 min, followed by 40 cycles at 95 °C for 45 sec, 58 °C for 45 sec, and 72 °C for 30 sec, and final extension at 72 °C for 5 min. PCR products were identified using agarose gel electrophoresis and digested by the mixture of shrimp alkaline phosphatase (SAP) and exonuclease I (TaKaRa Bio, Tokyo, Japan) to eliminate the redundant single-strand DNA. .. Sample processing, PCR, products identification and digestion was done in separate laboratory rooms which were certified for molecular diagnostics using standard precautions to prevent contamination.

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced. .. Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced.

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates. .. The final reaction mix (10 μl) contained 3 μl of the treated PCR product, 5 μl of SNaPshot ready reaction premix containing fluorescent dideoxynucleotides (A = ddR6G, green; C = ddTAMRA, black; G = ddR110, blue; and T = ddROX, red) and probe primers.

Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
Article Snippet: PCR for TERT promoter region was performed in 10μl reaction mixture containing 1μl of cell lysate, 0.3μl of each forward and reverse primers of target DNA fragment (10nmol), and 5μl of KAPA HiFi HotStart ReadyMix DNA Polymerase (Kapa Biosystems Wilmington, DE, USA). .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min. .. Sequencing of target DNA fragment was performed using BigDye Terminator Cycle Sequencing kit v.1.1 (Life Technologies).

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min. .. PCR reaction consisted of Taq PCR buffer (1×), MgCl2 (2 mM), dNTPs (0.4 mM), primer V3(dT)24 [0.68 μM, 5′-ATATCTCGAGGGCGCGCCGGATCC(T)24 -3′, IDT], V1(dT)24 (0.68 μM), and GoTaq (0.05 U/μl, Promega) to make a total volume of 25 μl.

Microscopy:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Tumor tissues only were scraped under a dissecting microscope using a serial hematoxylin and eosin-stained section as a guide. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Purification:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: After RT, the primer was removed by Exonuclease I (TaKaRa) digestion at 37 °C for 30 min. .. After RT, the primer was removed by Exonuclease I (TaKaRa) digestion at 37 °C for 30 min.

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: The initial denaturation at 94°C for 60 sec was followed by 40 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec and 120 sec. PCR products (5 μ L) migrated through an agarose gel as a single band of approximately 318 bp. .. Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced. .. Sequencing results were analyzed using Chromas v.1.62 software, and samples were individually confirmed manually.

Article Title: De novo mutations of TUBA3D are associated with keratoconus
Article Snippet: Every target fragment was amplified using Taq DNA polymerase (Takara, Dalian, China). .. The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA). .. Sequences were aligned and analyzed using the DNASTAR software package (DNASTAR Inc., USA).

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver. .. Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver.

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: Positive or negative control tubes in each RT experiment used 1–100 pg of total RNA purified from the lamprey CNS, with and without RT enzyme, respectively. .. Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis in a 2.5% agarose gel. .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT). .. Finally, 1.5 μ L of SNaPshot products was genotyped in the platform of ABI 3730 Genetic Analyzer before they were mixed with 8 μ L of HiDi™ formamide and 0.5 μ L of GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis on a 2.5% agarose gel. .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ). .. Finally, 1.5 μl of SNaPshot products were genotyped using the ABI 3730 Genetic Analyzer before they were mixed with 8 μl HiDiTM formamide and 0.5 μl GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
Article Snippet: The partial regions of the gag gene were amplified by RT-PCR using the primer set, aSRV-F1167 and aSRV-R1710, as described above. .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

Sequencing:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: Paragraph title: mRNA sample preparation and Illumina sequencing ... After RT, the primer was removed by Exonuclease I (TaKaRa) digestion at 37 °C for 30 min.

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: Paragraph title: 2.4. Sequence Detection of Poly-T and TG-Repeats in the CFTR Gene ... Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced.

Article Title: De novo mutations of TUBA3D are associated with keratoconus
Article Snippet: Every target fragment was amplified using Taq DNA polymerase (Takara, Dalian, China). .. The products were purified with alkaline phosphatase (Shrimp) (Takara, Dalian, China) and exonuclease I (Takara, Dalian, China), and subjected to direct DNA sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing kit and ABI PRISM 3730 sequencer (Applied Biosystems Inc., USA). .. Sequences were aligned and analyzed using the DNASTAR software package (DNASTAR Inc., USA).

Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
Article Snippet: For sequencing of IDH1/2 and TP53 , target DNA fragments were amplified in a total 10μl reaction volume which containing 1μl of cell lysate, 1μl of MgCl2 (25mM), 1μl of 10*PCR buffer II, 0.2μl of each deoxyribonucleoside triphosphate (10mM), 0.3μl of each forward and reverse primers of target DNA fragment (10nmol), 0.075μl of AmpliTaq Gold DNA polymerase (Life Technologies Corporation, Hong Kong, China). .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min.

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequence ... The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver. .. Thermal cycling consisted of initial denaturation at 98°C for 2 min, followed by 40 cycles of 98°C for 10 s, 55°C for 15 s, and 68°C for 30 s. Finally, 15 μl of each PCR product was subjected to agarose gel electrophoresis, and the band of the expected size was excised and purified using a Nucleospin column (TaKaRa Bio).

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis in a 2.5% agarose gel. .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT). .. Finally, 1.5 μ L of SNaPshot products was genotyped in the platform of ABI 3730 Genetic Analyzer before they were mixed with 8 μ L of HiDi™ formamide and 0.5 μ L of GeneScan-120LIZ size standard (Applied Biosystems).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Subsequently, the PCR products were examined by electrophoresis on a 2.5% agarose gel. .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ). .. Finally, 1.5 μl of SNaPshot products were genotyped using the ABI 3730 Genetic Analyzer before they were mixed with 8 μl HiDiTM formamide and 0.5 μl GeneScan-120LIZ size standard (Applied Biosystems).

IA:

Article Title: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion
Article Snippet: Preparation of templates All oligodeoxynucleotides were purchased from Integrated DNA Technologies, Inc (Coralville, IA, USA). .. Non-circularized linear oligonucleotides were removed by reaction with 25 U/mL exonuclease I (Takara Bio) and 1000 U/mL exonuclease III (Takara Bio) at 37 °C for 30 min.

Agarose Gel Electrophoresis:

Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
Article Snippet: The NaCl concentration was now adjusted to 500 mM in 15 μl and incubated on ice for 15 min, before the supernatant and beads fractions were analyzed by 1% agarose gel electrophoresis as described above. .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

Article Title: Epidemiology study of HBV genotypes and antiviral drug resistance in multi-ethnic regions from Western China
Article Snippet: The RT coding region was amplified by designed primers as follows: F: 5′-GTTGCCCGTTTGTCCTC-3′, R: 5′-GACAAACTTTCCAATCAATAGG-3′. .. A typical amplification was performed in a 20 μl reaction volume containing 1 μl HBV DNA and 0.2 μl Ex Taq HS (TaKaRa Bio, Tokyo, Japan) at 95 °C for 5 min, followed by 40 cycles at 95 °C for 45 sec, 58 °C for 45 sec, and 72 °C for 30 sec, and final extension at 72 °C for 5 min. PCR products were identified using agarose gel electrophoresis and digested by the mixture of shrimp alkaline phosphatase (SAP) and exonuclease I (TaKaRa Bio, Tokyo, Japan) to eliminate the redundant single-strand DNA. .. Sample processing, PCR, products identification and digestion was done in separate laboratory rooms which were certified for molecular diagnostics using standard precautions to prevent contamination.

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: The markers were amplified following the thermal cycle conditions: 5 min at 95 °C followed by 35 cycles of: 30 s at 94 °C, 1 min at 40 °C, and 1 min 30 s at 72 °C, and followed by a 7 min extension at 72 °C for COI ; 5 min at 95 °C and then 35 cycles of: 1 min at 95 °C, 1 min at 52 °C, and 2 min at 72 °C, followed by a 7 min extension at 72 °C for 16S-rDNA; and 5 min at 95 °C then 35 cycles of: 1 min at 94 °C, 1 min at 50 °C, and 2 min at 72 °C, followed by a 10 min extension at 72 °C for ITS-rDNA. .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan). .. Molecular phylogenetic analyses .

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced. .. Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced.

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver. .. Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver.

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT). .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ). .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ).

Activated Clotting Time Assay:

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: The COI gene was amplified using the universal primer set LCO1490 (5’-GGT CAA CAA ATC ATA AAG ATA TTG G-3’) and HCO2198 (5’-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Software:

Article Title: The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens
Article Snippet: The following primers flanking the poly-T and TG-repeat regions of the CFTR gene were designed with Primer 5.0 software: sense 5′-TGGGCAAATATCTTAGTTT-3′ and antisense 5′-GAGTACCAAGAAGTGAGAA-3′. .. Amplicons were purified using shrimp alkaline phosphatase and exonuclease I (TaKaRa Biotechnology) and subsequently were sequenced.

Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
Article Snippet: PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min. .. Sequencing of target DNA fragment was performed using BigDye Terminator Cycle Sequencing kit v.1.1 (Life Technologies).

Electrophoresis:

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT). .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ). .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ).

Negative Control:

Article Title: Protein Synthetic Machinery and mRNA in Regenerating Tips of Spinal Cord Axons in Lamprey
Article Snippet: Positive or negative control tubes in each RT experiment used 1–100 pg of total RNA purified from the lamprey CNS, with and without RT enzyme, respectively. .. Any DNA in samples and unused V1(dT)24 were digested with (5 U) exonuclease I (5 U, Takara, Japan) at 37°C for 45 min.

Sample Prep:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: Paragraph title: mRNA sample preparation and Illumina sequencing ... After RT, the primer was removed by Exonuclease I (TaKaRa) digestion at 37 °C for 30 min.

Spectrophotometry:

Article Title: High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System
Article Snippet: The fragmented DNA samples were first checked by introducing ssDNA-specific nuclease, Exonuclease I (TaKaRa Biotechnology (Dalian) Co., Ltd, China), which can digesting ssDNA but not dsDNA. .. The fragmented DNA samples were first checked by introducing ssDNA-specific nuclease, Exonuclease I (TaKaRa Biotechnology (Dalian) Co., Ltd, China), which can digesting ssDNA but not dsDNA.

Concentration Assay:

Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
Article Snippet: The NaCl concentration was now adjusted to 500 mM in 15 μl and incubated on ice for 15 min, before the supernatant and beads fractions were analyzed by 1% agarose gel electrophoresis as described above. .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

Article Title: High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System
Article Snippet: The fragmented DNA samples were first checked by introducing ssDNA-specific nuclease, Exonuclease I (TaKaRa Biotechnology (Dalian) Co., Ltd, China), which can digesting ssDNA but not dsDNA. .. The fragmented DNA samples were first checked by introducing ssDNA-specific nuclease, Exonuclease I (TaKaRa Biotechnology (Dalian) Co., Ltd, China), which can digesting ssDNA but not dsDNA.

Article Title: Association of Fucosyltransferase 2 Gene Polymorphisms with Inflammatory Bowel Disease in Patients from Southeast China
Article Snippet: Firstly, 10 ng of genomic DNA was added to a 10 μ L PCR mixture containing 20 μ mol dNTPs (Promega, Wisconsin, USA), 0.5 U of FastStart Taq DNA polymerase (Roche, Basel, Switzerland), 1 μ L 10x PCR buffer with MgCl2 (15 mmol/L) (Roche, Basel, Switzerland), and amplification primers with a terminal concentration of 0.1 μ mol/L. .. Secondly, we purified the PCR products using a mix of 2 U of Exonuclease I (TaKaRa, Dalian, China) and 1.5 U of shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) at 37°C for 80 min and then 85°C for 15 min. Thirdly, the multiplex SNaPshot sequencing reactions were performed in a final volume of 7 μ L containing 2 μ L of purified multiple PCR products, 1 μ L of SNaPshot Multiplex Mix, 1 μ L of 5x sequencing buffer (Applied Biosystems), and 3 μ L of SNaPshot sequencing primers (C357T: 18T -TGGCAGAACTACCACCTGAA; A385T: 38T -TGGAGGAGGAATACCGCCAC; G428A: CACCGGCTACCCCTGCTCCT).

Article Title: Association of Ulcerative Colitis with FUT2 and FUT3 Polymorphisms in Patients from Southeast China
Article Snippet: First, 10 ng of genomic DNA was added to a 10 μl PCR mixture containing 20 μmol dNTPs (Promega, Wisconsin, USA), 0.5 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland), 1μl 10×PCR buffer with MgCl2 (15 mmol/L) (Roche, Basel, Switzerland) and amplification primers with a specific final concentration ( ). .. Second, we purified the PCR product using a mix of 1.5 U shrimp alkaline phosphatase (SAP) (New England Biolabs, Massachusetts, USA) and 2 U Exonuclease I (TAKARA, Dalian, China) at 37°C for 80 min, then 85°C for 15 min. Third, the multiplex SNaPshot sequencing reactions were carried out in a final volume of 7 μl containing 2 μl of purified multiple PCR products, 1 μl SNaPshot Multiplex Mix, 1 μl 5×Sequencing buffer (Applied Biosystems) and 3 μl SNaPshot sequencing primers (the final concentrations are listed in ).

CTG Assay:

Article Title: Three new species and the molecular phylogeny of Antipathozoanthus from the Indo-Pacific Ocean ( Anthozoa, Hexacorallia, Zoantharia)
Article Snippet: COI was amplified with the following primers: COIZoanF (5’-TGA TAA GGT TAG AAC TTT CTG CCC CGG AAC-3’) ( ) and COIantr (5’-GCC CAC ACA ATA AAG CCC AA TAY YCC AAT-3’) ( ). .. Amplified PCR products were checked by 1.5 % agarose gel and positive PCR products were sequenced in both directions by Fasmac (Kanagawa, Japan) after clean up using shrimp alkaline phosphatase ( SAP ) and Exonuclease I (Takara Bio Inc., Shiga, Japan).

Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
Article Snippet: The ITS-rDNA region was amplified using the specific primer set ITSf (5’-CTA GTA AGC GCG AGT CAT CAG C-3’) and ITSr (5’-GGT AGC CTT GCC TGA TCT GA-3’) ( ). mt 16S-rDNA was amplified using the universal primer 16Sar (5’-CGC CTG TTT ATC AAA AAC AT-3’) (Palumbi et al. 1996) and the specific primer 16SBmoH (5’-CGA ACA GCC AAC CCT TGG3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

Staining:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Formalin-fixed, paraffin-embedded tumor samples were cut at 4 μm, and tissue sections were deparaffinized and lightly stained with methyl green. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Environmental Sampling:

Article Title: Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes
Article Snippet: The amount of template DNA was 300 pg for environmental samples, and 2.0 × 104 copies of 16S rRNA gene were used for the analysis of a mock microbial community sample. .. Subsequently, excess primers were digested by addition of 4 of Exonuclease I (5 U/μl, TaKaRa Bio) and incubation at 37°C for 120 min, followed by inactivation of the enzyme by incubation at 80°C for 30 min. A 5-μl volume of the SPE product was used for the first-round PCR; each 20-μl reaction contained 0.3 μM N8-U806R and F2-primers , 1× MightyAmp buffer ver.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 81
    TaKaRa e coli exonuclease i
    Further Characterization of ssDNA-Cohesin Interactions, Related to   Figure 3 (A) ssDNA and dsDNA binding of cohesin were analyzed by electrophoretic mobility shift experiments using the indicated cohesin concentrations and single or double stranded pBluescript as the substrate. (B) ssDNA is topologically entrapped by cohesin. A schematic of the DNA-release experiment following ssDNA to dsDNA conversion is shown together with a gel image of the input and recovered DNAs at the indicated stages. (C) Cohesin releases circular ssDNA. The released DNA from cohesin following dsDNA to ssDNA conversion, as shown in   Figure 3 D, was treated with  E. coli  exonuclease I that digests linear but not circular ssDNA. No detectable digestion was observed, suggesting that released ssDNA remained circular. As a control for the effectiveness of exonuclease I treatment, heat-denatured nicked circular DNA was treated with exonuclease I in the same way. Linear, but not circular ssDNA was readily digested under these conditions. Note that two nicks were present in the circular DNA before denaturation. This generated two linear ssDNA, only the longer one of which is visible on the gel. (D) ssDNA stimulates the cohesin ATPase. Mis4-Ssl3 and DNA-dependent ATP hydrolysis by cohesin was measured in the presence of indicated proteins and DNAs.
    E Coli Exonuclease I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 81/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli exonuclease i/product/TaKaRa
    Average 81 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    e coli exonuclease i - by Bioz Stars, 2019-12
    81/100 stars
      Buy from Supplier

    89
    TaKaRa exonuclease i mixture
    Further Characterization of ssDNA-Cohesin Interactions, Related to   Figure 3 (A) ssDNA and dsDNA binding of cohesin were analyzed by electrophoretic mobility shift experiments using the indicated cohesin concentrations and single or double stranded pBluescript as the substrate. (B) ssDNA is topologically entrapped by cohesin. A schematic of the DNA-release experiment following ssDNA to dsDNA conversion is shown together with a gel image of the input and recovered DNAs at the indicated stages. (C) Cohesin releases circular ssDNA. The released DNA from cohesin following dsDNA to ssDNA conversion, as shown in   Figure 3 D, was treated with  E. coli  exonuclease I that digests linear but not circular ssDNA. No detectable digestion was observed, suggesting that released ssDNA remained circular. As a control for the effectiveness of exonuclease I treatment, heat-denatured nicked circular DNA was treated with exonuclease I in the same way. Linear, but not circular ssDNA was readily digested under these conditions. Note that two nicks were present in the circular DNA before denaturation. This generated two linear ssDNA, only the longer one of which is visible on the gel. (D) ssDNA stimulates the cohesin ATPase. Mis4-Ssl3 and DNA-dependent ATP hydrolysis by cohesin was measured in the presence of indicated proteins and DNAs.
    Exonuclease I Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i mixture/product/TaKaRa
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    exonuclease i mixture - by Bioz Stars, 2019-12
    89/100 stars
      Buy from Supplier

    Image Search Results


    Further Characterization of ssDNA-Cohesin Interactions, Related to   Figure 3 (A) ssDNA and dsDNA binding of cohesin were analyzed by electrophoretic mobility shift experiments using the indicated cohesin concentrations and single or double stranded pBluescript as the substrate. (B) ssDNA is topologically entrapped by cohesin. A schematic of the DNA-release experiment following ssDNA to dsDNA conversion is shown together with a gel image of the input and recovered DNAs at the indicated stages. (C) Cohesin releases circular ssDNA. The released DNA from cohesin following dsDNA to ssDNA conversion, as shown in   Figure 3 D, was treated with  E. coli  exonuclease I that digests linear but not circular ssDNA. No detectable digestion was observed, suggesting that released ssDNA remained circular. As a control for the effectiveness of exonuclease I treatment, heat-denatured nicked circular DNA was treated with exonuclease I in the same way. Linear, but not circular ssDNA was readily digested under these conditions. Note that two nicks were present in the circular DNA before denaturation. This generated two linear ssDNA, only the longer one of which is visible on the gel. (D) ssDNA stimulates the cohesin ATPase. Mis4-Ssl3 and DNA-dependent ATP hydrolysis by cohesin was measured in the presence of indicated proteins and DNAs.

    Journal: Cell

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring

    doi: 10.1016/j.cell.2017.12.021

    Figure Lengend Snippet: Further Characterization of ssDNA-Cohesin Interactions, Related to Figure 3 (A) ssDNA and dsDNA binding of cohesin were analyzed by electrophoretic mobility shift experiments using the indicated cohesin concentrations and single or double stranded pBluescript as the substrate. (B) ssDNA is topologically entrapped by cohesin. A schematic of the DNA-release experiment following ssDNA to dsDNA conversion is shown together with a gel image of the input and recovered DNAs at the indicated stages. (C) Cohesin releases circular ssDNA. The released DNA from cohesin following dsDNA to ssDNA conversion, as shown in Figure 3 D, was treated with E. coli exonuclease I that digests linear but not circular ssDNA. No detectable digestion was observed, suggesting that released ssDNA remained circular. As a control for the effectiveness of exonuclease I treatment, heat-denatured nicked circular DNA was treated with exonuclease I in the same way. Linear, but not circular ssDNA was readily digested under these conditions. Note that two nicks were present in the circular DNA before denaturation. This generated two linear ssDNA, only the longer one of which is visible on the gel. (D) ssDNA stimulates the cohesin ATPase. Mis4-Ssl3 and DNA-dependent ATP hydrolysis by cohesin was measured in the presence of indicated proteins and DNAs.

    Article Snippet: The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Generated

    ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.

    Journal: Scientific Reports

    Article Title: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion

    doi: 10.1038/srep14979

    Figure Lengend Snippet: ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.

    Article Snippet: Non-circularized linear oligonucleotides were removed by reaction with 25 U/mL exonuclease I (Takara Bio) and 1000 U/mL exonuclease III (Takara Bio) at 37 °C for 30 min.

    Techniques: Chromatin Immunoprecipitation, Amplification, Imaging, Agarose Gel Electrophoresis