exonuclease i  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Exonuclease I
    Description:
    E coli Exonuclease I is a 3 to 5 exonuclease for single stranded DNA degradation resulting in the production of 5 phosphate mononucleotides from the 3 hydroxyl termini of single stranded DNA This 3 to 5 exonuclease is highly specific for single stranded DNA and does not react with double stranded DNA or RNA Exonuclease I is inactivated by heat treatment at 80°C for 15 minutes
    Catalog Number:
    2650b
    Price:
    None
    Size:
    3 750 Units
    Category:
    Exonuclease I Nucleases Modifying enzymes Cloning
    Buy from Supplier


    Structured Review

    TaKaRa exonuclease i
    ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.
    E coli Exonuclease I is a 3 to 5 exonuclease for single stranded DNA degradation resulting in the production of 5 phosphate mononucleotides from the 3 hydroxyl termini of single stranded DNA This 3 to 5 exonuclease is highly specific for single stranded DNA and does not react with double stranded DNA or RNA Exonuclease I is inactivated by heat treatment at 80°C for 15 minutes
    https://www.bioz.com/result/exonuclease i/product/TaKaRa
    Average 90 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion"

    Article Title: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion

    Journal: Scientific Reports

    doi: 10.1038/srep14979

    ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.
    Figure Legend Snippet: ( a ) Chip analysis of tripodna amplification. Lane 1, non-ligated template; lane 2, ligated template; lane 3, non-ligated template digested by exonuclease I/III; lane 4, ligated template digested by exonuclease I/III. ( B–D ) AFM imaging of the RCA products. ( b ) 0 h (before initiation of the RCA reaction), ( c ) 1 h, ( d ) 4 h. ( e ) RCA product after 16-h reaction. ( f ) Agarose gel analysis of RCA product. Lane 1, 1-kbp ladder; lane 2, RCA product.

    Techniques Used: Chromatin Immunoprecipitation, Amplification, Imaging, Agarose Gel Electrophoresis

    2) Product Images from "An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules"

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm194

    Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. ( A ) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with 32 P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. ( B ) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I SS , structure-dependent inhibition by salt in the medium; I SC , structure-dependent inhibition by compound; I SSC , structure-dependent inhibition by salt and compound; I NSC , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.
    Figure Legend Snippet: Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. ( A ) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with 32 P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. ( B ) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I SS , structure-dependent inhibition by salt in the medium; I SC , structure-dependent inhibition by compound; I SSC , structure-dependent inhibition by salt and compound; I NSC , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.

    Techniques Used: Inhibition, Labeling, Nucleic Acid Electrophoresis, Hydrolysis Assay, Concentration Assay

    Effect of TMPyP4 on oligonucleotides. ( A and B ) Hydrolysis of T24G21 (filled circles) and T24RG21 (open circles) by exonuclease I (3 U) for 1 h in the presence of 150 mM of (A) K + or (B) Li + . ( C ) Thermal stability of (G 3 T 2 A) 3 G 3 quadruplex in the absence and presence of equimolar TMPyP4. Curves were nudged along vertical axis to avoid overlap. ( D ) Electrophoresis behavior of T24G21 and T24RG21 in 12% native gel. Data in (A) represent the mean of two hydrolysis experiments with range. Samples in (D) were prepared as in (A) but without exonuclease hydrolysis.
    Figure Legend Snippet: Effect of TMPyP4 on oligonucleotides. ( A and B ) Hydrolysis of T24G21 (filled circles) and T24RG21 (open circles) by exonuclease I (3 U) for 1 h in the presence of 150 mM of (A) K + or (B) Li + . ( C ) Thermal stability of (G 3 T 2 A) 3 G 3 quadruplex in the absence and presence of equimolar TMPyP4. Curves were nudged along vertical axis to avoid overlap. ( D ) Electrophoresis behavior of T24G21 and T24RG21 in 12% native gel. Data in (A) represent the mean of two hydrolysis experiments with range. Samples in (D) were prepared as in (A) but without exonuclease hydrolysis.

    Techniques Used: Electrophoresis

    Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. ( A ) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K + . ( B ) Quadruplex formation by (G 3 T 2 A) 3 G 3 as a function of K + concentration examined by fluorescence resonance energy transfer (FRET). ( C ) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K + concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K + . LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.
    Figure Legend Snippet: Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. ( A ) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K + . ( B ) Quadruplex formation by (G 3 T 2 A) 3 G 3 as a function of K + concentration examined by fluorescence resonance energy transfer (FRET). ( C ) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K + concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K + . LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.

    Techniques Used: Electrophoresis, Concentration Assay, Fluorescence, Förster Resonance Energy Transfer, Nucleic Acid Electrophoresis, Standard Deviation

    Effect of ( A ) TMPyP4, ( B ) BMVC and ( C ) DODC on the hydrolysis of the  c-myc  gene sequence T24c-myc22 (T 24 GAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I. Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range.
    Figure Legend Snippet: Effect of ( A ) TMPyP4, ( B ) BMVC and ( C ) DODC on the hydrolysis of the c-myc gene sequence T24c-myc22 (T 24 GAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I. Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range.

    Techniques Used: Sequencing

    3) Product Images from "Regulation of DNA nucleases by molecular crowding"

    Article Title: Regulation of DNA nucleases by molecular crowding

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm445

    Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U exonuclease I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.
    Figure Legend Snippet: Amount of residual DNAs in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) (closed diamonds) of PEG and ( A ) 0.1 U DNase I, ( B ) 0.15 U S1 nuclease, ( C ) 1 U exonuclease III (inset shows 10 U), ( D ) 0.5 U exonuclease I (inset shows 5 U). A ssDNA was used as a substrate for S1 nuclease and exonuclease I and a dsDNA was used as a substrate for DNase I and exonuclease III. PEG 4000 was used as the crowding agent for DNase I and S1 nuclease reactions, and PEG 8000 was used for exonucleases III and I. Error bars (smaller than ±2%) were omitted for clarity.

    Techniques Used:

    Initial velocities ( v ) for the DNase I ( A ) and exonuclease I ( B ) hydrolysis reactions in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) PEG (closed diamonds). The DNase I reaction was carried out in a buffer containing 100 mM NaCl, 5 mM MgCl 2 and 50 mM HEPES (pH 7.2) at 25°C in the absence or presence of PEG 4000. The exonuclease I reaction was carried out in a buffer containing 100 mM NaCl, 6.7 mM MgCl 2 , 10 mM 2-mercaptoethanol and 67 mM glycine-KOH (pH 9.5) at 37°C in the absence or presence of PEG 8000. The dsDNA and ssDNA concentrations in kinetic assays were 0.1–20 μM for DNase I and 0.1–10 μM for exonuclease I. The value of v was plotted versus the concentration of substrate DNA. Error bars (smaller than ±1%) were omitted for clarity.
    Figure Legend Snippet: Initial velocities ( v ) for the DNase I ( A ) and exonuclease I ( B ) hydrolysis reactions in the presence of 0% (w/v) (open circles), 5% (w/v) (closed circles), 10% (w/v) (closed triangles), 15% (w/v) (closed squares) and 20% (w/v) PEG (closed diamonds). The DNase I reaction was carried out in a buffer containing 100 mM NaCl, 5 mM MgCl 2 and 50 mM HEPES (pH 7.2) at 25°C in the absence or presence of PEG 4000. The exonuclease I reaction was carried out in a buffer containing 100 mM NaCl, 6.7 mM MgCl 2 , 10 mM 2-mercaptoethanol and 67 mM glycine-KOH (pH 9.5) at 37°C in the absence or presence of PEG 8000. The dsDNA and ssDNA concentrations in kinetic assays were 0.1–20 μM for DNase I and 0.1–10 μM for exonuclease I. The value of v was plotted versus the concentration of substrate DNA. Error bars (smaller than ±1%) were omitted for clarity.

    Techniques Used: Concentration Assay

    Residual activities of DNase I and exonuclease I after incubation for 0–30 min at 60°C. Hydrolysis by DNase I in the absence (open circles) or presence (closed circles) of 20% (w/v) PEG 4000 was carried out for 10 min at 25°C. Hydrolysis by exonuclease I in the absence (open triangles) or presence (closed triangles) of 20% (w/v) PEG 8000 was carried out for 10 min at 37°C.
    Figure Legend Snippet: Residual activities of DNase I and exonuclease I after incubation for 0–30 min at 60°C. Hydrolysis by DNase I in the absence (open circles) or presence (closed circles) of 20% (w/v) PEG 4000 was carried out for 10 min at 25°C. Hydrolysis by exonuclease I in the absence (open triangles) or presence (closed triangles) of 20% (w/v) PEG 8000 was carried out for 10 min at 37°C.

    Techniques Used: Incubation

    4) Product Images from "An Exonuclease I-Based Quencher-Free Fluorescent Method Using DNA Hairpin Probes for Rapid Detection of MicroRNA"

    Article Title: An Exonuclease I-Based Quencher-Free Fluorescent Method Using DNA Hairpin Probes for Rapid Detection of MicroRNA

    Journal: Sensors (Basel, Switzerland)

    doi: 10.3390/s17040760

    Schematic showing the principle of the quencher-free fluorescence-based method for the detection of microRNA. Exo I: Exonuclease I.
    Figure Legend Snippet: Schematic showing the principle of the quencher-free fluorescence-based method for the detection of microRNA. Exo I: Exonuclease I.

    Techniques Used: Fluorescence

    Related Articles

    Clone Assay:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. Sequencing of 48 clones from a library indicated that the insert rate was > 97% (47/48 clones) and that none of the clones contained a stop codon in their random region.

    Amplification:

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequence ... The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: The amplification was performed in an ABI 9700 thermal cycler using an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 65°C for 30 s, 72°C for 1 min, and finally 72°C for 10 min. .. The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min.

    Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
    Article Snippet: For sequencing of IDH1/2 and TP53 , target DNA fragments were amplified in a total 10μl reaction volume which containing 1μl of cell lysate, 1μl of MgCl2 (25mM), 1μl of 10*PCR buffer II, 0.2μl of each deoxyribonucleoside triphosphate (10mM), 0.3μl of each forward and reverse primers of target DNA fragment (10nmol), 0.075μl of AmpliTaq Gold DNA polymerase (Life Technologies Corporation, Hong Kong, China). .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min.

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: Paragraph title: RNA amplification ... First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min.

    Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
    Article Snippet: Phylogenetic analysis The partial regions of the gag gene were amplified by RT-PCR using the primer set, aSRV-F1167 and aSRV-R1710, as described above. .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan).

    Filtration:

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
    Article Snippet: To confirm circular integrity of cohesin-released ssDNA after exonuclease III treatment, the supernatant fraction was passed through a G-25 gel filtration spin column, equilibrated with exoI buffer (67 mM Glycine-KOH pH 9.5, 1 mM DTT and 6.7 mM MgCl2 ). .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

    Synthesized:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: Forward oligonucleotides, including 8 random codons ( 5′-GCTACGCTGCAGCGCGT VNKVNKVNKVNK TAT VNKVNKVNKVNK TTCGACTACTGGGGTCAGGGTAC-3′ ) (0.1 nmol), and reverse oligonucleotides ( 5′-CTAGTAGCGGCCGCTTATCTACCGCTGGAAACGGTAACCAGAGTACCCTGACCCCAGTAGTCGA-3′ ) (1 nmol) were mixed, and complementary strands were synthesized with Ex Taq (Takara Bio Inc.). .. The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation.

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: .. First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min. .. The cDNA products were divided into four tubes, and the second strand of the poly(dA)-tailed cDNAs was synthesized with another oligo(dT)-tagged primer,V3(dT)24 in an initial 1-cycle PCR reaction consisting of 95°C for 3 min, 50°C for 2 min, and 72°C for 3 min, followed by a second 20-cycle PCR reaction consisting of 95°C for 3 sec, 67°C for 1 min, and 72°C for 3 min plus 6 additional seconds per cycle, and a final extension for 10 min at 72°C.

    Article Title: Modulation of long interspersed nuclear element-1 in the mouse hippocampus during maturation
    Article Snippet: .. To remove the ssDNA or DNA/RNA hybrids in each genomic DNA sample, 1 U RNaseH (New England Biolabs, Ipswich, MA, USA) and 20 U exonuclease I (TaKaRa Bio, Shiga, Japan) were used to treat 10 ng genomic DNA in surplus. mRNA was isolated from non-fixed tissue using RNeasy Mini Kit (Qiagen Hamburg, Germany) and synthesized cDNA was generated using Omniscript Reverse Transcription Kit (Qiagen). .. Genomic DNA and cDNA were analyzed by qPCR using TaqMan probe methods with EagleTaq Master Mix (ROX) (Roche Diagnostics, Mannheim, Germany) and SsoAdvanced Universal Probes Supermix (Bio-Rad Laboratories, Hercules, CA, USA).

    Construct:

    Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
    Article Snippet: The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Phylogenetic trees were constructed using the neighbor-joining (NJ) method with MEGA 6.0 .

    Electrophoresis:

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min. .. The SNaPshot extension products were separated using capillary electrophoresis (3730xl Genetic Analyzer, Applied Biosystems) and analyzed using GeneMapper 4.0 (Applied Biosystems).

    Incubation:

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
    Article Snippet: .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min. .. The reactions were terminated by addition of 2.5 μl of stop solution (1% SDS, 10 mM EDTA and 4 mg/ml protease K), incubated at 37°C for 20 min, and analyzed by 1% agarose gel electrophoresis.

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: Proteinase K was added to a final concentration of 2g/l and the mixture was incubated at 55°C for 2 hours and then at 98°C for 10 min. .. PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan).

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: .. The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min. .. The SNaPshot multiplex sequencing reaction was performed in a final volume of 7 μ L containing 2 μ L PCR purification product, 1 μ L SNaPshot Multiplex Mix, 1 μ L 5× seq buffer, and 0.2 μ M of specific primer.

    Article Title: Virome Profiling of Bats from Myanmar by Metagenomic Analysis of Tissue Samples Reveals More Novel Mammalian Viruses
    Article Snippet: .. Double Stranded cDNA (dscDNA) Synthesis with Klenow Fragment To synthesize dscDNA, a 3′–5′exo– Klenow fragment (5 U; New England Biolabs, Beijing, China) was added to the cDNA mixture and barcode primers, then incubated at 37°C for 60 min, after which the enzyme was inactivated at 75°C for 10 min. To remove phosphates and free single-stranded bases in the dscDNA reaction, 2 U shrimp alkaline phosphatase (SAP, TaKaRa) and 2.5 U exonuclease I (TaKaRa) were added to the dscDNA reaction mixture along with 10×SAP buffer and ddH2 O to a final volume of 50 µl, then incubated at 37°C for 60 min and inactivated at 75°C for 10 min. .. Sequence-independent Single Primer Amplification (SISPA) and Purification of PCR Products To obtain sufficient viral nucleic acid, SISPA was employed to amplify the dscDNA with the Accuprime Taq DNA Polymerase System (Invitrogen) according to the manufacturer’s protocol.

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: The biopsied single blastomeres collected in cell lysis buffer and containing oligo (dT)-tagged primer V1 (dT)24 , were incubated for 90 sec at 70°C, for cell lysis and RNA denaturalization. .. First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
    Article Snippet: SNaPshot multiplex assay for point mutations Formalin-fixed, paraffin-embedded tumor samples were cut at 4 μm, and tissue sections were deparaffinized and lightly stained with methyl green. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

    Article Title: Modulation of long interspersed nuclear element-1 in the mouse hippocampus during maturation
    Article Snippet: Genomic DNA was isolated from formalin-fixed tissue using the ReliaPrep™ FFPE gDNA Miniprep System (Promega, Madison, WI, USA) and from non-fixed tissue using the QuickGene nucleic acid isolation system (Kurabo Industries, Osaka, Japan). .. To remove the ssDNA or DNA/RNA hybrids in each genomic DNA sample, 1 U RNaseH (New England Biolabs, Ipswich, MA, USA) and 20 U exonuclease I (TaKaRa Bio, Shiga, Japan) were used to treat 10 ng genomic DNA in surplus. mRNA was isolated from non-fixed tissue using RNeasy Mini Kit (Qiagen Hamburg, Germany) and synthesized cDNA was generated using Omniscript Reverse Transcription Kit (Qiagen).

    Activated Clotting Time Assay:

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: The COI gene was amplified using the universal primer set LCO1490 (5’-GGT CAA CAA ATC ATA AAG ATA TTG G-3’) and HCO2198 (5’-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    Electroporation:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. The digested dsDNA (3 pmol) was inserted into Pst I- and Not I-digested pHishot12 (0.3 pmol) using T4 DNA ligase (Takara Bio Inc.) in a ligation buffer (60 mM Tris buffer (pH 7.5) containing 60 mM MgCl2 , 50 mM NaCl, 70 mM 2-mercaptoethanol, 1 mM ATP, 20 mM dithiothreitol, 10 mM spermidine, and 1 mg/mL bovine serum albumin (BSA)) at 14°C for 18 h. The plasmid was purified by phenol–chloroform extraction, precipitated with 10 µg of tRNA by ethanol precipitation, and transferred into E. coli DH5α electrocompetent cells (Takara Bio Inc.) by electroporation (MicroPulser electroporator; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

    Ligation:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. The digested dsDNA (3 pmol) was inserted into Pst I- and Not I-digested pHishot12 (0.3 pmol) using T4 DNA ligase (Takara Bio Inc.) in a ligation buffer (60 mM Tris buffer (pH 7.5) containing 60 mM MgCl2 , 50 mM NaCl, 70 mM 2-mercaptoethanol, 1 mM ATP, 20 mM dithiothreitol, 10 mM spermidine, and 1 mg/mL bovine serum albumin (BSA)) at 14°C for 18 h. The plasmid was purified by phenol–chloroform extraction, precipitated with 10 µg of tRNA by ethanol precipitation, and transferred into E. coli DH5α electrocompetent cells (Takara Bio Inc.) by electroporation (MicroPulser electroporator; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
    Article Snippet: .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

    Generated:

    Article Title: Modulation of long interspersed nuclear element-1 in the mouse hippocampus during maturation
    Article Snippet: .. To remove the ssDNA or DNA/RNA hybrids in each genomic DNA sample, 1 U RNaseH (New England Biolabs, Ipswich, MA, USA) and 20 U exonuclease I (TaKaRa Bio, Shiga, Japan) were used to treat 10 ng genomic DNA in surplus. mRNA was isolated from non-fixed tissue using RNeasy Mini Kit (Qiagen Hamburg, Germany) and synthesized cDNA was generated using Omniscript Reverse Transcription Kit (Qiagen). .. Genomic DNA and cDNA were analyzed by qPCR using TaqMan probe methods with EagleTaq Master Mix (ROX) (Roche Diagnostics, Mannheim, Germany) and SsoAdvanced Universal Probes Supermix (Bio-Rad Laboratories, Hercules, CA, USA).

    Sequencing:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. Sequencing of 48 clones from a library indicated that the insert rate was > 97% (47/48 clones) and that none of the clones contained a stop codon in their random region.

    Article Title: First evidence of asexual recruitment of Pocillopora acuta in Okinawa Island using genotypic identification
    Article Snippet: Mitochondrial haplotypes were confirmed by sequencing the mtORF region. .. PCR products were cleaned with Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara).

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequence ... The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: Mutation Analysis of IDH1/IDH2 Mutational hotspots of IDH1 at codon 132 and IDH2 at codon 172 were evaluated by direct sequencing. .. PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan).

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min. .. The SNaPshot multiplex sequencing reaction was performed in a final volume of 7 μ L containing 2 μ L PCR purification product, 1 μ L SNaPshot Multiplex Mix, 1 μ L 5× seq buffer, and 0.2 μ M of specific primer.

    Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
    Article Snippet: For sequencing of IDH1/2 and TP53 , target DNA fragments were amplified in a total 10μl reaction volume which containing 1μl of cell lysate, 1μl of MgCl2 (25mM), 1μl of 10*PCR buffer II, 0.2μl of each deoxyribonucleoside triphosphate (10mM), 0.3μl of each forward and reverse primers of target DNA fragment (10nmol), 0.075μl of AmpliTaq Gold DNA polymerase (Life Technologies Corporation, Hong Kong, China). .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min.

    Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
    Article Snippet: The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

    Article Title: Modulation of long interspersed nuclear element-1 in the mouse hippocampus during maturation
    Article Snippet: To remove the ssDNA or DNA/RNA hybrids in each genomic DNA sample, 1 U RNaseH (New England Biolabs, Ipswich, MA, USA) and 20 U exonuclease I (TaKaRa Bio, Shiga, Japan) were used to treat 10 ng genomic DNA in surplus. mRNA was isolated from non-fixed tissue using RNeasy Mini Kit (Qiagen Hamburg, Germany) and synthesized cDNA was generated using Omniscript Reverse Transcription Kit (Qiagen). .. The TaqMan probe (5′-AGGCGGTCTCCCATCCAA-3′) and primers used for detecting the L1-5 ' UTR were designed using the nucleotide sequence reported by Muotri et al.

    Article Title: Microsatellite markers for multiple Pocillopora genetic lineages offer new insights about coral populations
    Article Snippet: .. The PCR protocol consisted of 94 °C for 1 min, followed by 40 cycles at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 75 s, with a final extension at 72 °C for 5 min. After reaction of Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara) to clean up PCR products, sequencing was conducted by Macrogen Japan. mtORF sequences obtained were aligned with others from previous studies , , , including unpublished work of Mayfield et al ., using MUSCLE in MEGA ver. ..

    Cellular Antioxidant Activity Assay:

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: The COI gene was amplified using the universal primer set LCO1490 (5’-GGT CAA CAA ATC ATA AAG ATA TTG G-3’) and HCO2198 (5’-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    DNA Extraction:

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequence ... The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: Paragraph title: 2.2. Genomic DNA Extraction and Genotype Analysis ... The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min.

    Mutagenesis:

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: Paragraph title: Mutation Analysis of IDH1/IDH2 ... PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan).

    Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
    Article Snippet: Paragraph title: Mutation analysis of IDH1/2 , TERT promoter and TP53 ... PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min.

    Isolation:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: .. The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. The digested dsDNA (3 pmol) was inserted into Pst I- and Not I-digested pHishot12 (0.3 pmol) using T4 DNA ligase (Takara Bio Inc.) in a ligation buffer (60 mM Tris buffer (pH 7.5) containing 60 mM MgCl2 , 50 mM NaCl, 70 mM 2-mercaptoethanol, 1 mM ATP, 20 mM dithiothreitol, 10 mM spermidine, and 1 mg/mL bovine serum albumin (BSA)) at 14°C for 18 h. The plasmid was purified by phenol–chloroform extraction, precipitated with 10 µg of tRNA by ethanol precipitation, and transferred into E. coli DH5α electrocompetent cells (Takara Bio Inc.) by electroporation (MicroPulser electroporator; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

    Article Title: Modulation of long interspersed nuclear element-1 in the mouse hippocampus during maturation
    Article Snippet: .. To remove the ssDNA or DNA/RNA hybrids in each genomic DNA sample, 1 U RNaseH (New England Biolabs, Ipswich, MA, USA) and 20 U exonuclease I (TaKaRa Bio, Shiga, Japan) were used to treat 10 ng genomic DNA in surplus. mRNA was isolated from non-fixed tissue using RNeasy Mini Kit (Qiagen Hamburg, Germany) and synthesized cDNA was generated using Omniscript Reverse Transcription Kit (Qiagen). .. Genomic DNA and cDNA were analyzed by qPCR using TaqMan probe methods with EagleTaq Master Mix (ROX) (Roche Diagnostics, Mannheim, Germany) and SsoAdvanced Universal Probes Supermix (Bio-Rad Laboratories, Hercules, CA, USA).

    Size-exclusion Chromatography:

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: .. PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan). .. Sequencing was performed using BigDye Terminator Cycle Sequencing kit v1.1.

    Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
    Article Snippet: .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min. .. Sequencing of target DNA fragment was performed using BigDye Terminator Cycle Sequencing kit v.1.1 (Life Technologies).

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: The biopsied single blastomeres collected in cell lysis buffer and containing oligo (dT)-tagged primer V1 (dT)24 , were incubated for 90 sec at 70°C, for cell lysis and RNA denaturalization. .. First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min.

    Microscopy:

    Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
    Article Snippet: Tumor tissues only were scraped under a dissecting microscope using a serial hematoxylin and eosin-stained section as a guide. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

    Purification:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: .. The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. The digested dsDNA (3 pmol) was inserted into Pst I- and Not I-digested pHishot12 (0.3 pmol) using T4 DNA ligase (Takara Bio Inc.) in a ligation buffer (60 mM Tris buffer (pH 7.5) containing 60 mM MgCl2 , 50 mM NaCl, 70 mM 2-mercaptoethanol, 1 mM ATP, 20 mM dithiothreitol, 10 mM spermidine, and 1 mg/mL bovine serum albumin (BSA)) at 14°C for 18 h. The plasmid was purified by phenol–chloroform extraction, precipitated with 10 µg of tRNA by ethanol precipitation, and transferred into E. coli DH5α electrocompetent cells (Takara Bio Inc.) by electroporation (MicroPulser electroporator; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: .. The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min. .. The SNaPshot multiplex sequencing reaction was performed in a final volume of 7 μ L containing 2 μ L PCR purification product, 1 μ L SNaPshot Multiplex Mix, 1 μ L 5× seq buffer, and 0.2 μ M of specific primer.

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min. .. PCR products were put together and purified with the DNA Clean & Concentrator™ Kit (Zymo Research, CA, USA), eluted with 30 µl of double distilled water (Gibco BRL, CA, USA) and quantified with a Nanodrop spectrophotometer (NanoDrop Technologies, DW, USA).

    Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
    Article Snippet: .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
    Article Snippet: .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates. .. A single-base extension multiplex assay was performed using a SNaPshot Multiplex Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.

    Article Title: First evidence of asexual recruitment of Pocillopora acuta in Okinawa Island using genotypic identification
    Article Snippet: .. PCR products were cleaned with Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara). .. Sequencing was performed by Macrogen Japan, and sequences obtained were aligned with mtORF sequences reported in and to identify the genetic species of Pocillopora and Stylophora , respectively.

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan). .. Phylogenetic analyses Obtained DNA sequences were initially checked using the Basic Local Alignment Search Tool (BLAST , National Center for Biotechnology Information).

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: .. PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan). .. Sequencing was performed using BigDye Terminator Cycle Sequencing kit v1.1.

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: .. The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min. .. The SNaPshot multiplex sequencing reaction was performed in a final volume of 7 μ L containing 2 μ L PCR purification product, 1 μ L SNaPshot Multiplex Mix, 1 μ L 5× seq buffer, and 0.2 μ M of specific primer.

    Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
    Article Snippet: .. PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min. .. Sequencing of target DNA fragment was performed using BigDye Terminator Cycle Sequencing kit v.1.1 (Life Technologies).

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min. .. The cDNA products were divided into four tubes, and the second strand of the poly(dA)-tailed cDNAs was synthesized with another oligo(dT)-tagged primer,V3(dT)24 in an initial 1-cycle PCR reaction consisting of 95°C for 3 min, 50°C for 2 min, and 72°C for 3 min, followed by a second 20-cycle PCR reaction consisting of 95°C for 3 sec, 67°C for 1 min, and 72°C for 3 min plus 6 additional seconds per cycle, and a final extension for 10 min at 72°C.

    Article Title: Emergence of infectious malignant thrombocytopenia in Japanese macaques (Macaca fuscata) by SRV-4 after transmission to a novel host
    Article Snippet: .. The RT-PCR products were purified using MinElute PCR Purification Kits (Qiagen) or cleaned enzymatically with Calf intestine Alkaline Phosphatase (TOYOBO, Osaka, Japan) and Exonuclease I (TaKaRa, Otsu, Japan). .. Direct sequencing was performed with a Dye Terminator Cycle Sequencing Kit and an ABI 3130xl generic analyzer (Applied Biosystems).

    Article Title: Microsatellite markers for multiple Pocillopora genetic lineages offer new insights about coral populations
    Article Snippet: .. The PCR protocol consisted of 94 °C for 1 min, followed by 40 cycles at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 75 s, with a final extension at 72 °C for 5 min. After reaction of Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara) to clean up PCR products, sequencing was conducted by Macrogen Japan. mtORF sequences obtained were aligned with others from previous studies , , , including unpublished work of Mayfield et al ., using MUSCLE in MEGA ver. ..

    Labeling:

    Article Title: An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules
    Article Snippet: Fluorescent (G3 T2 A)3 G3 labeled at the 5′ end with a fluorescein (FAM) and the 3′ end a tetramethylrhodamine (TMR) was purchased from TaKaRa Biotech (Dalian, China). .. Exonuclease I from Escherichia coli was purchased from TaKaRa Biotechnology.

    Staining:

    Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
    Article Snippet: SNaPshot multiplex assay for point mutations Formalin-fixed, paraffin-embedded tumor samples were cut at 4 μm, and tissue sections were deparaffinized and lightly stained with methyl green. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: The ITS-rDNA region was amplified using the specific primer set ITSf (5’-CTA GTA AGC GCG AGT CAT CAG C-3’) and ITSr (5’-GGT AGC CTT GCC TGA TCT GA-3’) ( ). mt 16S-rDNA was amplified using the universal primer 16Sar (5’-CGC CTG TTT ATC AAA AAC AT-3’) (Palumbi et al. 1996) and the specific primer 16SBmoH (5’-CGA ACA GCC AAC CCT TGG3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    Plasmid Preparation:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: Library for Hishot display A plasmid library was made by inserting a synthetic CDR3 region containing random peptide sequences into pHishot12. .. The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation.

    Software:

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan). .. The products were resolved in the Genetic Analyzer 3130xl and analyzed by Sequencing Analysis software.

    Article Title: Not all 1p/19q non-codeleted oligodendroglial tumors are astrocytic
    Article Snippet: PCR reaction started with a denature procedure of 95°C for 10 min, then followed by 45 cycles of 95°C for 20 sec, annealing temperature ( ) for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with Exonuclease I (TakaRa Biotechnology Limited, Dalian, China) of 2μl (0.25U/μl) per 5μl PCR product at 37°C for 15min followed by 80°C for 15min. .. The Genetic Analyzer 3130xl was used for the following sequencing and the results were analyzed by Sequencing Analysis Software.

    Real-time Polymerase Chain Reaction:

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min. .. In this step, amplified cDNA products were checked by qPCR with a ribosomal gene (RPL19 ) to positively identify amplified cells.

    Article Title: Modulation of long interspersed nuclear element-1 in the mouse hippocampus during maturation
    Article Snippet: To remove the ssDNA or DNA/RNA hybrids in each genomic DNA sample, 1 U RNaseH (New England Biolabs, Ipswich, MA, USA) and 20 U exonuclease I (TaKaRa Bio, Shiga, Japan) were used to treat 10 ng genomic DNA in surplus. mRNA was isolated from non-fixed tissue using RNeasy Mini Kit (Qiagen Hamburg, Germany) and synthesized cDNA was generated using Omniscript Reverse Transcription Kit (Qiagen). .. Genomic DNA and cDNA were analyzed by qPCR using TaqMan probe methods with EagleTaq Master Mix (ROX) (Roche Diagnostics, Mannheim, Germany) and SsoAdvanced Universal Probes Supermix (Bio-Rad Laboratories, Hercules, CA, USA).

    Multiplex Assay:

    Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
    Article Snippet: Paragraph title: SNaPshot multiplex assay for point mutations ... The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min. .. The SNaPshot multiplex sequencing reaction was performed in a final volume of 7 μ L containing 2 μ L PCR purification product, 1 μ L SNaPshot Multiplex Mix, 1 μ L 5× seq buffer, and 0.2 μ M of specific primer.

    Agarose Gel Electrophoresis:

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
    Article Snippet: The NaCl concentration was now adjusted to 500 mM in 15 μl and incubated on ice for 15 min, before the supernatant and beads fractions were analyzed by 1% agarose gel electrophoresis as described above. .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: .. The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. The digested dsDNA (3 pmol) was inserted into Pst I- and Not I-digested pHishot12 (0.3 pmol) using T4 DNA ligase (Takara Bio Inc.) in a ligation buffer (60 mM Tris buffer (pH 7.5) containing 60 mM MgCl2 , 50 mM NaCl, 70 mM 2-mercaptoethanol, 1 mM ATP, 20 mM dithiothreitol, 10 mM spermidine, and 1 mg/mL bovine serum albumin (BSA)) at 14°C for 18 h. The plasmid was purified by phenol–chloroform extraction, precipitated with 10 µg of tRNA by ethanol precipitation, and transferred into E. coli DH5α electrocompetent cells (Takara Bio Inc.) by electroporation (MicroPulser electroporator; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

    Ethanol Precipitation:

    Article Title: Hishot Display--A New Combinatorial Display for Obtaining Target-Recognizing Peptides
    Article Snippet: .. The DNA was isolated by ethanol precipitation and treated with exonuclease I (Takara Bio Inc.) at 37°C for 18 h. Double-stranded DNA (dsDNA) was purified by phenol–chloroform extraction, digested with Pst I and Not I, resolved by agarose gel electrophoresis using 3% NuSieve GTG agarose (Takara Bio Inc.), extracted with thermostable β-agarase (Nippon Gene Co., Ltd., Tokyo, Japan), and purified by phenol extraction, phenol–chloroform extraction, and ethanol precipitation. .. The digested dsDNA (3 pmol) was inserted into Pst I- and Not I-digested pHishot12 (0.3 pmol) using T4 DNA ligase (Takara Bio Inc.) in a ligation buffer (60 mM Tris buffer (pH 7.5) containing 60 mM MgCl2 , 50 mM NaCl, 70 mM 2-mercaptoethanol, 1 mM ATP, 20 mM dithiothreitol, 10 mM spermidine, and 1 mg/mL bovine serum albumin (BSA)) at 14°C for 18 h. The plasmid was purified by phenol–chloroform extraction, precipitated with 10 µg of tRNA by ethanol precipitation, and transferred into E. coli DH5α electrocompetent cells (Takara Bio Inc.) by electroporation (MicroPulser electroporator; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

    Spectrophotometry:

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min. .. PCR products were put together and purified with the DNA Clean & Concentrator™ Kit (Zymo Research, CA, USA), eluted with 30 µl of double distilled water (Gibco BRL, CA, USA) and quantified with a Nanodrop spectrophotometer (NanoDrop Technologies, DW, USA).

    Concentration Assay:

    Article Title: Establishment of DNA-DNA Interactions by the Cohesin Ring
    Article Snippet: The NaCl concentration was now adjusted to 500 mM in 15 μl and incubated on ice for 15 min, before the supernatant and beads fractions were analyzed by 1% agarose gel electrophoresis as described above. .. The recovered DNA was incubated with E. coli exonuclease I (0.5 U/ μl, TaKaRa Bio) in 10 μl of exoI buffer at 30°C for 15 min.

    Article Title: First evidence of asexual recruitment of Pocillopora acuta in Okinawa Island using genotypic identification
    Article Snippet: PCR reaction mixtures (10 µL) contained template DNA ( < 50 ng/µL), AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific), and primers (final concentration: 2 µM for each primer) for mtORF: FATP6.1 (5′-TTTGGGSATTCGTTTAGCAG-3′) and RORF (5′-SCCAATATGTTAAACASCATGTCA-3′). .. PCR products were cleaned with Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara).

    Article Title: Mutation Analysis of IDH1 in Paired Gliomas Revealed IDH1 Mutation Was Not Associated with Malignant Progression but Predicted Longer Survival
    Article Snippet: Proteinase K was added to a final concentration of 2g/l and the mixture was incubated at 55°C for 2 hours and then at 98°C for 10 min. .. PCR was initiated at 95°C for 10 min, followed by 45 cycles of 95°C for 20 sec, 60°C for 20 sec and 72°C for 30 sec, and a final extension step of 72°C for 3 min. Products were then treated with exonuclease I and alkaline phosphatase (TakaRa, Japan).

    Article Title: Association of Ulcerative Colitis with FOXP3 Gene Polymorphisms and Its Colonic Expression in Chinese Patients
    Article Snippet: Briefly, the polymerase chain reaction (PCR) protocol was carried out in 10 μ L as follows: 1 μ L genomic DNA (10 ng), 1 μ L 10× PCR buffer with MgCl2 (Roche, Basel, Switzerland), 1 μ L dNTPs (Promega, WI, USA), 0.5 U of FastStart Taq DNA polymerase (Roche, Basel, Switzerland), and a defined concentration (0.1 μ mol/L) of each amplification primer. .. The purification was conducted on 7.4 mL volume including 2 mL PCR product, 2 U of Exonuclease I (TaKaRa, Dalian, China), and 1.5 U of SAP (New England Biolabs, MA, USA), which were incubated for 80 min at 37°C and enzyme-inactivated at 85°C for 15 min.

    Article Title: Microsatellite markers for multiple Pocillopora genetic lineages offer new insights about coral populations
    Article Snippet: PCR reaction mixtures consisted of: (10 μL) containing < 30 ng/μL template DNA, AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific), and the primers (final concentration: 2 μM for each primer) for mtORF: FATP6.1 (5ʹ-TTTGGGSATTCGTTTAGCAG-3ʹ) and RORF (5ʹ-SCCAATATGTTAAACASCATGTCA-3ʹ) . .. The PCR protocol consisted of 94 °C for 1 min, followed by 40 cycles at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 75 s, with a final extension at 72 °C for 5 min. After reaction of Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara) to clean up PCR products, sequencing was conducted by Macrogen Japan. mtORF sequences obtained were aligned with others from previous studies , , , including unpublished work of Mayfield et al ., using MUSCLE in MEGA ver.

    CTG Assay:

    Article Title: Unexpected diversity and a new species of Epizoanthus ( Anthozoa, Hexacorallia) attached to eunicid worm tubes from the Pacific Ocean
    Article Snippet: The ITS-rDNA region was amplified using the specific primer set ITSf (5’-CTA GTA AGC GCG AGT CAT CAG C-3’) and ITSr (5’-GGT AGC CTT GCC TGA TCT GA-3’) ( ). mt 16S-rDNA was amplified using the universal primer 16Sar (5’-CGC CTG TTT ATC AAA AAC AT-3’) (Palumbi et al. 1996) and the specific primer 16SBmoH (5’-CGA ACA GCC AAC CCT TGG3’) ( ). .. The positive PCR products were cleaned using shrimp alkaline phosphatase (SAP) and Exonuclease I (Takara Bio Inc., Shiga, Japan), and then sequenced by Fasmac (Kanagawa, Japan).

    Lysis:

    Article Title: Functional Genomics of 5- to 8-Cell Stage Human Embryos by Blastomere Single-Cell cDNA Analysis
    Article Snippet: The biopsied single blastomeres collected in cell lysis buffer and containing oligo (dT)-tagged primer V1 (dT)24 , were incubated for 90 sec at 70°C, for cell lysis and RNA denaturalization. .. First-strand cDNAs were synthesized by retro-transcription (RT) with the SSIII (Invitrogen) for 20 min at 50°C and later inactivation at 70°C for 10 min. After RT, the remnant primer was degraded by exonuclease I (Takara Bio, Japan) at 37°C for 30 min and a later inactivation at 80°C for 25 min. cDNAs were then tailed with poly(dA) by terminal deoxynucleotidyl transferase (TdT) (Invitrogen, CA, USA) at 37°C for 15 min and a later inactivation at 70°C for 10 min.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa exonuclease i
    Exonuclease I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i/product/TaKaRa
    Average 90 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results