ex taq dna polymerase hot start version  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TaKaRa Ex Taq DNA Polymerase Hot Start Version
    Description:
    Takara Ex Taq HS DNA Polymerase is the hot start version of our high performing Takara Ex Taq polymerase a blend of Takara Taq and a proofreading exonuclease offering high yield excellent sensitivity and fidelity that is 4 5 times higher than Taq polymerase Antibody mediated hot start gives lower background higher specificity and allows room temperature reaction assembly Takara Ex Taq HS DNA polymerase is supplied with 10X buffer Mg2 and dNTP mix
    Catalog Number:
    rr006b
    Price:
    None
    Size:
    1 000 Units
    Category:
    Ex Taq polymerase hot start Ex Taq products High yield PCR PCR
    Buy from Supplier


    Structured Review

    TaKaRa ex taq dna polymerase hot start version
    Takara Ex Taq HS DNA Polymerase is the hot start version of our high performing Takara Ex Taq polymerase a blend of Takara Taq and a proofreading exonuclease offering high yield excellent sensitivity and fidelity that is 4 5 times higher than Taq polymerase Antibody mediated hot start gives lower background higher specificity and allows room temperature reaction assembly Takara Ex Taq HS DNA polymerase is supplied with 10X buffer Mg2 and dNTP mix
    https://www.bioz.com/result/ex taq dna polymerase hot start version/product/TaKaRa
    Average 99 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    ex taq dna polymerase hot start version - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Efficacy of adjuvant chemotherapy for non-small cell lung cancer assessed by metastatic potential associated with ACTN4
    Article Snippet: .. Transfection ACTN4 cDNA was amplified by PCR using TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio Inc., Kyoto, Japan) and the primers: ACCATGGACTACAAGGACGACGATGACAAGATGGTGGACTACCACGCGG and TCATCTATCTAGATCTTCACAGGTCGCTCTCGCCATAC. .. The PCR product was cloned into the pcDNA 3.1/V5-His TOPO TA vector (Life Technologies).

    Amplification:

    Article Title: Efficacy of adjuvant chemotherapy for non-small cell lung cancer assessed by metastatic potential associated with ACTN4
    Article Snippet: .. Transfection ACTN4 cDNA was amplified by PCR using TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio Inc., Kyoto, Japan) and the primers: ACCATGGACTACAAGGACGACGATGACAAGATGGTGGACTACCACGCGG and TCATCTATCTAGATCTTCACAGGTCGCTCTCGCCATAC. .. The PCR product was cloned into the pcDNA 3.1/V5-His TOPO TA vector (Life Technologies).

    Article Title: De novo DNA methylation during monkey pre-implantation embryogenesis
    Article Snippet: .. Following the second-strand cDNA synthesis with TaKaRa Ex Taq HS DNA polymerase (Takara) and a poly (T) primer containing a different anchor sequence (UP2) at the 5′ end, the cDNA was amplified using the following condition: 18 cycles of 95 °C for 30 s, 67 °C for 1 min, 72 °C for 8 min with an extra 6 s added in each cycle. .. The amplified cDNA was purified with QIAquick PCR purification Kit (Qiagen) and was further amplified for 9 cycles using poly (T) primers with an anchor sequence containing a 5′ end blocked by amine at the C6 position (NH2-UP1 and NH2-UP2).

    Article Title: Thyroid Disruption by Di-n-Butyl Phthalate (DBP) and Mono-n-Butyl Phthalate (MBP) in Xenopus laevis
    Article Snippet: .. Each 10-µL DNA amplification reaction containing 0.5 µL of diluted cDNA, 0.5 µM each of forward and reverse primer, 200 µM dNTPs, 1× PCR buffer, 1.25 U of Ex Taq Hot Start DNA Polymerase (Takara Bio, Tokyo, Japan) and 0.2 µmol of EvaGreen (Biotum, USA). .. We included controls lacking cDNA template orTaq DNA polymerase to determine the specificity of target cDNA amplification.

    Synthesized:

    Article Title: Wnt-β-Catenin Signaling Promotes the Maturation of Mast Cells
    Article Snippet: .. The cDNA was synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies), and semiquantitative PCR was then performed using TAKARA Ex Taq HS DNA polymerase (Takara). .. The level of HDC, MCP5, CPA, Axin2, and Tcf7 mRNA was quantified using the SYBR Green detection system (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Combinatorial analysis of lupulin gland transcription factors from R2R3Myb, bHLH and WDR families indicates a complex regulation of chs_H1 genes essential for prenylflavonoid biosynthesis in hop (Humulus Lupulus L.)
    Article Snippet: .. Four micrograms of total RNA were reverse transcribed using oligo dT18 primer and SuperscriptII reverse transcriptase (Invitrogen) at 42°C for 60 min. A total of 5 μl of 50 × diluted cDNA was used for a 20 μl PCR reaction with 0.6 units of Hot Start Ex Taq polymerase (TaKaRa Bio), Taq buffer 1 ×, dNTPs 200 μM each, SYBR Green 1:20,000 (Molecular Probes) and primers 375 nM each. .. All amplifications were carried out on a Bio-Rad IQ5 cycler for 40 cycles (94°C for 20 s, 59°C for 30 s, 72°C for 30 s) following an initial denaturation/Taq activation step (94°C for 5 min).

    Concentration Assay:

    Article Title: Exome sequencing of senescence-accelerated mice (SAM) reveals deleterious mutations in degenerative disease-causing genes
    Article Snippet: .. PCR reactions were carried out in 10-μl reaction mixtures containing a 0.5 μM concentration of each primer, 0.2 mM dNTPs, 0.25U Ex Taq DNA Polymerase Hot-Start Version, 1.0 μl 10×Ex Taq Buffer (Takara Bio, Shiga, Japan), and 1 μl of extracted DNA. .. The amplification conditions were 1 cycle at 96°C for 5 min of denaturation, 40 cycles of 94°C for 30 s, 55-68°C for 45 s of annealing in proportion to the Tm value of each primer, and extension at 72°C for 45 s, followed by a final extension at 72°C for 10 min. PCR products were purified by using a MultiScreenHTS PCR 96-Well Plate (Millipore, Billerica, Massachusetts, US) for sequences.

    Polymerase Chain Reaction:

    Article Title: Wnt-β-Catenin Signaling Promotes the Maturation of Mast Cells
    Article Snippet: .. The cDNA was synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies), and semiquantitative PCR was then performed using TAKARA Ex Taq HS DNA polymerase (Takara). .. The level of HDC, MCP5, CPA, Axin2, and Tcf7 mRNA was quantified using the SYBR Green detection system (Applied Biosystems).

    Article Title: Exome sequencing of senescence-accelerated mice (SAM) reveals deleterious mutations in degenerative disease-causing genes
    Article Snippet: .. PCR reactions were carried out in 10-μl reaction mixtures containing a 0.5 μM concentration of each primer, 0.2 mM dNTPs, 0.25U Ex Taq DNA Polymerase Hot-Start Version, 1.0 μl 10×Ex Taq Buffer (Takara Bio, Shiga, Japan), and 1 μl of extracted DNA. .. The amplification conditions were 1 cycle at 96°C for 5 min of denaturation, 40 cycles of 94°C for 30 s, 55-68°C for 45 s of annealing in proportion to the Tm value of each primer, and extension at 72°C for 45 s, followed by a final extension at 72°C for 10 min. PCR products were purified by using a MultiScreenHTS PCR 96-Well Plate (Millipore, Billerica, Massachusetts, US) for sequences.

    Article Title: Efficacy of adjuvant chemotherapy for non-small cell lung cancer assessed by metastatic potential associated with ACTN4
    Article Snippet: .. Transfection ACTN4 cDNA was amplified by PCR using TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio Inc., Kyoto, Japan) and the primers: ACCATGGACTACAAGGACGACGATGACAAGATGGTGGACTACCACGCGG and TCATCTATCTAGATCTTCACAGGTCGCTCTCGCCATAC. .. The PCR product was cloned into the pcDNA 3.1/V5-His TOPO TA vector (Life Technologies).

    Article Title: Thyroid Disruption by Di-n-Butyl Phthalate (DBP) and Mono-n-Butyl Phthalate (MBP) in Xenopus laevis
    Article Snippet: .. Each 10-µL DNA amplification reaction containing 0.5 µL of diluted cDNA, 0.5 µM each of forward and reverse primer, 200 µM dNTPs, 1× PCR buffer, 1.25 U of Ex Taq Hot Start DNA Polymerase (Takara Bio, Tokyo, Japan) and 0.2 µmol of EvaGreen (Biotum, USA). .. We included controls lacking cDNA template orTaq DNA polymerase to determine the specificity of target cDNA amplification.

    Article Title: Combinatorial analysis of lupulin gland transcription factors from R2R3Myb, bHLH and WDR families indicates a complex regulation of chs_H1 genes essential for prenylflavonoid biosynthesis in hop (Humulus Lupulus L.)
    Article Snippet: .. Four micrograms of total RNA were reverse transcribed using oligo dT18 primer and SuperscriptII reverse transcriptase (Invitrogen) at 42°C for 60 min. A total of 5 μl of 50 × diluted cDNA was used for a 20 μl PCR reaction with 0.6 units of Hot Start Ex Taq polymerase (TaKaRa Bio), Taq buffer 1 ×, dNTPs 200 μM each, SYBR Green 1:20,000 (Molecular Probes) and primers 375 nM each. .. All amplifications were carried out on a Bio-Rad IQ5 cycler for 40 cycles (94°C for 20 s, 59°C for 30 s, 72°C for 30 s) following an initial denaturation/Taq activation step (94°C for 5 min).

    Sequencing:

    Article Title: De novo DNA methylation during monkey pre-implantation embryogenesis
    Article Snippet: .. Following the second-strand cDNA synthesis with TaKaRa Ex Taq HS DNA polymerase (Takara) and a poly (T) primer containing a different anchor sequence (UP2) at the 5′ end, the cDNA was amplified using the following condition: 18 cycles of 95 °C for 30 s, 67 °C for 1 min, 72 °C for 8 min with an extra 6 s added in each cycle. .. The amplified cDNA was purified with QIAquick PCR purification Kit (Qiagen) and was further amplified for 9 cycles using poly (T) primers with an anchor sequence containing a 5′ end blocked by amine at the C6 position (NH2-UP1 and NH2-UP2).

    Variant Assay:

    Article Title: Compound phenotype of osteogenesis imperfecta and Ehlers–Danlos syndrome caused by combined mutations in COL1A1 and COL5A1
    Article Snippet: .. We used genomic DNA to amplify the region of the respective variant using Takara ExTaq® Hot Start Version (RR006A; Takara, Shiga, Japan). .. The Beijing Genomics Institute performed the purification of the PCR-amplified DNA and Sanger sequencing (using an ABI 3730XL sequencer).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    TaKaRa ex taq hot start version
    Ex Taq Hot Start Version, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq hot start version/product/TaKaRa
    Average 92 stars, based on 206 article reviews
    Price from $9.99 to $1999.99
    ex taq hot start version - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    91
    TaKaRa ex taq hot start version pcr kit
    Ex Taq Hot Start Version Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq hot start version pcr kit/product/TaKaRa
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ex taq hot start version pcr kit - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    99
    TaKaRa premix ex taq hot start version
    Premix Ex Taq Hot Start Version, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/premix ex taq hot start version/product/TaKaRa
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    premix ex taq hot start version - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results