evagreen  (Biotium)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    20X EvaGreen
    Description:

    Catalog Number:
    31000
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Biotium evagreen
    Performance of SYBR Green I and <t>EvaGreen</t> detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).

    https://www.bioz.com/result/evagreen/product/Biotium
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    evagreen - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages"

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0174223

    Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).
    Figure Legend Snippet: Performance of SYBR Green I and EvaGreen detection chemistries during qPCR assays. (A) Standard curves generated from amplification of serially diluted L . lactis phage P220 genome detected with the corresponding chemistries; (B) the corresponding performance parameters; and (C) amplification plots detected with SYBR Green I (brown) and EvaGreen (green).

    Techniques Used: SYBR Green Assay, Real-time Polymerase Chain Reaction, Generated, Amplification

    2) Product Images from "Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics"

    Article Title: Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-05436-4

    Droplet fusion and subsequent single-cell WGA in sd-MDA. ( a ) Histograms of droplets before (Cell lysate droplet: blue) and after fusion (SAG droplet: red). ( b ) Fluorescence image of droplets after the 1 st -round MDA reaction. E. coli cells were introduced at 0.1 cells/droplet and their genomes were amplified for 2 h with Evagreen dye. Scale bar; 100 μm. (c) Time-dependent appearance of the fluorescence signal during amplification of single E. coli genome. All data are presented as averaged intensities of fluorescent positive droplets measured with SD, and 100 droplets were analyzed at each time point. ( d ) Relationship between introduced E. coli cell concentration and the number of fluorescent positive droplets.
    Figure Legend Snippet: Droplet fusion and subsequent single-cell WGA in sd-MDA. ( a ) Histograms of droplets before (Cell lysate droplet: blue) and after fusion (SAG droplet: red). ( b ) Fluorescence image of droplets after the 1 st -round MDA reaction. E. coli cells were introduced at 0.1 cells/droplet and their genomes were amplified for 2 h with Evagreen dye. Scale bar; 100 μm. (c) Time-dependent appearance of the fluorescence signal during amplification of single E. coli genome. All data are presented as averaged intensities of fluorescent positive droplets measured with SD, and 100 droplets were analyzed at each time point. ( d ) Relationship between introduced E. coli cell concentration and the number of fluorescent positive droplets.

    Techniques Used: Whole Genome Amplification, Multiple Displacement Amplification, Fluorescence, Amplification, Concentration Assay

    3) Product Images from "Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection"

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection

    Journal: Scientific Reports

    doi: 10.1038/srep12543

    Concept of the Tm mapping method. ( A ) The strategy for the primer designs is shown. Nested PCR is performed using seven bacterial universal primer sets, and then the seven Tm values are obtained. ( B ) Mapping the seven Tm values on two dimensions leads to the identification of the unique bacterial species-specific shape. The average of all seven Tm values includes the measurement error among trials; however, the Tm mapping shape is not affected by this type of error. ( C ) Using an analytical instrument with a high degree of thermal accuracy among PCR tubes and Tm value analysis with EvaGreen dye in 36 samples of the same bacterial DNA in the same trial, the tube-to-tube variation is within ±0.1 °C. ( D ) In order to analyze the Tm mapping “shape”, we developed a method to measure the distance of each individual Tm value from the average value. Tm values above the average receive a “+” designation, while those below the average receive a “−” designation. The Tm mapping shape is identified by comparing the seven distances obtained from the unknown bacteria to those in the database. ( E ) In order to identify a bacterial isolate, the identification software program calculates the Difference Values using the indicated formula. The closer the Difference Value is to zero, the more similar the Tm mapping shape is to the shape of a given species of pathogenic bacteria in the database.
    Figure Legend Snippet: Concept of the Tm mapping method. ( A ) The strategy for the primer designs is shown. Nested PCR is performed using seven bacterial universal primer sets, and then the seven Tm values are obtained. ( B ) Mapping the seven Tm values on two dimensions leads to the identification of the unique bacterial species-specific shape. The average of all seven Tm values includes the measurement error among trials; however, the Tm mapping shape is not affected by this type of error. ( C ) Using an analytical instrument with a high degree of thermal accuracy among PCR tubes and Tm value analysis with EvaGreen dye in 36 samples of the same bacterial DNA in the same trial, the tube-to-tube variation is within ±0.1 °C. ( D ) In order to analyze the Tm mapping “shape”, we developed a method to measure the distance of each individual Tm value from the average value. Tm values above the average receive a “+” designation, while those below the average receive a “−” designation. The Tm mapping shape is identified by comparing the seven distances obtained from the unknown bacteria to those in the database. ( E ) In order to identify a bacterial isolate, the identification software program calculates the Difference Values using the indicated formula. The closer the Difference Value is to zero, the more similar the Tm mapping shape is to the shape of a given species of pathogenic bacteria in the database.

    Techniques Used: Nested PCR, Polymerase Chain Reaction, Software

    4) Product Images from "Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme"

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0038371

    Reverse transcriptase assays. A. Fluorogenic assay. RT activity was measured by detection of RNA:DNA heteroduplex by fluorescence of EvaGreen binding. Oligo dT primed poly A was incubated at 37°C and 65°C in the presence of indicated Pol enzymes in manufacturer recommended buffers and dTTP. Fluorescence measurements were obtained every 6 seconds for 10 minutes. The initial slopes from a plot of RFU vs. time in seconds were determined by linear least square regression from 30 to 150 seconds at 37°C and from 30 to 90 seconds at 65°C. Error bars are standard error of regression slope. B. RT primer extension assay. HEX-labeled dT 20 primed poly A was incubated 10 minutes at 37°C and then 10 minutes at 65°C in the presence of indicated Pol enzymes and dTTP in manufacturer recommended buffers. Primer extension products were resolved by 10% denaturing PAGE and imaged on a Molecular Imager FX (Bio-Rad). Left facing triangle indicates migration of unextended dT20 primer and asterisk indicates bromophenol blue dye front. C. RT MS2-specific primer extension. 5′-labeled primer was annealed to MS2 RNA and incubated 10 minutes at 37°C and then 30 minutes at 65°C in the presence of indicated Pol enzymes with dNTPS (N = A,C,G,T) in manufacturer recommended buffers. Primer extension products were resolved by 5% denaturing PAGE. Lane 1 No RNA+MMLV RT; Lane 2: MS2 RNA No RT; Lane 3 MS2 RNA+MMLV RT, Lane 3 MS2 RNA+3173 Pol. Molecular weight in bases indicted. Red Arrow: ∼650 base MMLV extension product. Blue Arrow: ∼715 base PyroScript extension product. Green arrow: Non-templated MMLV reaction product.
    Figure Legend Snippet: Reverse transcriptase assays. A. Fluorogenic assay. RT activity was measured by detection of RNA:DNA heteroduplex by fluorescence of EvaGreen binding. Oligo dT primed poly A was incubated at 37°C and 65°C in the presence of indicated Pol enzymes in manufacturer recommended buffers and dTTP. Fluorescence measurements were obtained every 6 seconds for 10 minutes. The initial slopes from a plot of RFU vs. time in seconds were determined by linear least square regression from 30 to 150 seconds at 37°C and from 30 to 90 seconds at 65°C. Error bars are standard error of regression slope. B. RT primer extension assay. HEX-labeled dT 20 primed poly A was incubated 10 minutes at 37°C and then 10 minutes at 65°C in the presence of indicated Pol enzymes and dTTP in manufacturer recommended buffers. Primer extension products were resolved by 10% denaturing PAGE and imaged on a Molecular Imager FX (Bio-Rad). Left facing triangle indicates migration of unextended dT20 primer and asterisk indicates bromophenol blue dye front. C. RT MS2-specific primer extension. 5′-labeled primer was annealed to MS2 RNA and incubated 10 minutes at 37°C and then 30 minutes at 65°C in the presence of indicated Pol enzymes with dNTPS (N = A,C,G,T) in manufacturer recommended buffers. Primer extension products were resolved by 5% denaturing PAGE. Lane 1 No RNA+MMLV RT; Lane 2: MS2 RNA No RT; Lane 3 MS2 RNA+MMLV RT, Lane 3 MS2 RNA+3173 Pol. Molecular weight in bases indicted. Red Arrow: ∼650 base MMLV extension product. Blue Arrow: ∼715 base PyroScript extension product. Green arrow: Non-templated MMLV reaction product.

    Techniques Used: Activity Assay, Fluorescence, Binding Assay, Incubation, Primer Extension Assay, Labeling, Polyacrylamide Gel Electrophoresis, Migration, Molecular Weight

    5) Product Images from "Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification"

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0138733

    Droplet MDA of low-input lambda DNA. (a) Sequential fluorescent images of droplets encapsulating lambda DNA at a concentration of 265 ag/droplet (5 copies lambda DNA per droplet) with Evagreen dye. (b) Time-dependent appearance of the fluorescence signal during compartmentalized amplification of the denatured lambda DNA (input concentration 54 ag/droplet (1 copy lamda DNA per droplet) and 265 ag/droplet). All data are presented as averaged intensities of fluorescent positive droplets measured with SEM, and 100 droplets were analyzed at each time point.
    Figure Legend Snippet: Droplet MDA of low-input lambda DNA. (a) Sequential fluorescent images of droplets encapsulating lambda DNA at a concentration of 265 ag/droplet (5 copies lambda DNA per droplet) with Evagreen dye. (b) Time-dependent appearance of the fluorescence signal during compartmentalized amplification of the denatured lambda DNA (input concentration 54 ag/droplet (1 copy lamda DNA per droplet) and 265 ag/droplet). All data are presented as averaged intensities of fluorescent positive droplets measured with SEM, and 100 droplets were analyzed at each time point.

    Techniques Used: Multiple Displacement Amplification, Lambda DNA Preparation, Concentration Assay, Fluorescence, Amplification

    6) Product Images from "Programming an in vitro DNA oscillator using a molecular networking strategy"

    Article Title: Programming an in vitro DNA oscillator using a molecular networking strategy

    Journal: Molecular Systems Biology

    doi: 10.1038/msb.2010.120

    Experimental assembly. All the reactions shown were performed at 38.5°C, initiated with 0.1 nM α and monitored (ex. 490 nM; em. 510 nM) using EvaGreen-induced fluorescence. ( A ) One-node positive-feedback loop (autocatalytic module). In the presence of Bst Polymerase (80 U ml −1 ) and nicking enzyme Nt.bstNBI (200 U ml −1 ), template T 1 (60 nM) performs an exponential amplification of its input α. The fluorescence reaches a plateau when the template gets saturated with α. The low subsequent increase is due to the accumulation of single-stranded α, weakly fluorescent in these conditions. In the presence of exonuclease RecJ f (30 U ml −1 ), the reaction reaches a flat steady state instead. ( B ) Inhibited amplification. Increasing amounts of inhibitor (from 0 to 1 eq. of T 1 ) decrease the amplification rate of the previous system (−RecJ f ). ( C ) Oscillator. Production of Inh is connected to the presence of α as in Figure 1F . This three-templates (T 1 and T 3 : 30 nM; T 2 : 5 nM) three-enzymes (Bst, Nt.BstNBI, RecJ f ) system produces sustained fluorescent oscillations with a period of 100 min, in good agreement with the predicted evolution of the total concentration of base pairs ( D ).
    Figure Legend Snippet: Experimental assembly. All the reactions shown were performed at 38.5°C, initiated with 0.1 nM α and monitored (ex. 490 nM; em. 510 nM) using EvaGreen-induced fluorescence. ( A ) One-node positive-feedback loop (autocatalytic module). In the presence of Bst Polymerase (80 U ml −1 ) and nicking enzyme Nt.bstNBI (200 U ml −1 ), template T 1 (60 nM) performs an exponential amplification of its input α. The fluorescence reaches a plateau when the template gets saturated with α. The low subsequent increase is due to the accumulation of single-stranded α, weakly fluorescent in these conditions. In the presence of exonuclease RecJ f (30 U ml −1 ), the reaction reaches a flat steady state instead. ( B ) Inhibited amplification. Increasing amounts of inhibitor (from 0 to 1 eq. of T 1 ) decrease the amplification rate of the previous system (−RecJ f ). ( C ) Oscillator. Production of Inh is connected to the presence of α as in Figure 1F . This three-templates (T 1 and T 3 : 30 nM; T 2 : 5 nM) three-enzymes (Bst, Nt.BstNBI, RecJ f ) system produces sustained fluorescent oscillations with a period of 100 min, in good agreement with the predicted evolution of the total concentration of base pairs ( D ).

    Techniques Used: Electron Microscopy, Fluorescence, Amplification, Concentration Assay

    7) Product Images from "Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR"

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR

    Journal: Infectious Agents and Cancer

    doi: 10.1186/1750-9378-5-9

    Complete and minimum E6-1 preamplification mixtures used to perform E6-2 nested qPCR amplification . ( A ) Complete preamplification series. Successive stages: 1) preparation of E6-1 preamplification mixture containing; 2)
    Figure Legend Snippet: Complete and minimum E6-1 preamplification mixtures used to perform E6-2 nested qPCR amplification . ( A ) Complete preamplification series. Successive stages: 1) preparation of E6-1 preamplification mixture containing; 2) "preamplification" by conventional PCR; 3) E6-2 amplification in "nested" qPCR mixtures containing EvaGreen and 1/50 volume of the E6-1 preamplified mixture. Tubes 1, a, b, c and d: positive control preamplification mixtures with serial logarithmic dilutions of pHV101 in the range of 2.5 × 10 6 -2.5 × 10 2 molecules per tube. Tube 2: Blank preamplification (without DNA). Tube 3: Problem preamplification (50 ng of SiHa DNA). Tubes 4 and 5: Negative preamplification controls (50 ng "carrier" normal human blood DNA). Asterisks indicate preamplified mixtures. ( B ) Minimum preamplification series. Successive stages: 1) preparation of E6-1 preamplification mixture including only the positive control ("calibration") with the highest pHV101 content; 2a) E6-1 "preamplification" by conventional PCR; 2b) serial logarithmic dilutions of the preamplified calibration mixture; 3) amplification of E6-2 in nested qPCR mixtures containing EvaGreen, the E6-2 primers and 1/50 volume of E6-1 preamplified mixtures. Tube 1: Positive control amplification mixture with 2.5 × 10 6 pHV101 molecules. Tube 2: Blank preamplification mixture (without DNA). Tube 3: Problem preamplification mixture (50 ng of SiHa DNA). Tubes 4 and 5: Negative preamplification controls (50 ng "carrier" normal human blood DNA). Tubes a, b, c, and d: serial logarithmic dilutions from the preamplified positive control mixture used to prepare nested qPCR mixtures equivalent to those preamplified with 2.5 × 10 5 -2.5 × 10 2 pHV101 molecules. Asterisks of numbered tubes indicate preamplified mixtures.

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Positive Control

    8) Product Images from "Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress"

    Article Title: Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv573

    Early S-phase cells undergo senescence-like proliferation arrest in response to HS. ( A and B ) Human HeLa cells that were untreated or treated with HS (45.5°C, 30 min) were allowed to recover for 72 h and then either pulse-labelled with EdU (A; 10 μM, 30 min) or stained for SA-β-gal activity (B). EdU was revealed by Click Chemistry (red). The DNA was stained with DAPI (blue). Cells with enlarged nuclei are indicated by white arrows or circles. Scale bar: 25 μm. ( C ) Human HeLa cells that were either untreated, treated with HS (45.5°C, 30 min), or treated with HS and allowed to recover for the indicated time intervals (6, 24 and 72 h) were subjected to gene expression analysis using qRT-PCR and WB. The expression of p21 CIP1 and p16 INK4a was analysed using EvaGreen-based qRT-PCR. The amplification levels of the cDNA were normalised to the level of GAPDH cDNA. The data are represented as the mean ± SEM. WB was carried out with an antibody against p21; histone H3 was used as the loading control. ( D ) Experimental design for comparison of the effects HS on HeLa cells at different cell cycle phases. ( E ) Cell cycle profiles of the cells treated and allowed to recover as in (D). ( F ) Early and late S-phase HeLa cells obtained using a double-thymidine block were heat treated (45.5°C, 30 min), allowed to recover for 72 h and either pulse-labelled with EdU (10 μM, 30 min) or stained for cyclin B1, p21 or SA-β-gal activity. EdU was revealed by Click Chemistry (red). The DNA was stained with DAPI (blue). The control represents HeLa cells synchronised by a double-thymidine block and released for 72 h. Scale bar: 25 μm.
    Figure Legend Snippet: Early S-phase cells undergo senescence-like proliferation arrest in response to HS. ( A and B ) Human HeLa cells that were untreated or treated with HS (45.5°C, 30 min) were allowed to recover for 72 h and then either pulse-labelled with EdU (A; 10 μM, 30 min) or stained for SA-β-gal activity (B). EdU was revealed by Click Chemistry (red). The DNA was stained with DAPI (blue). Cells with enlarged nuclei are indicated by white arrows or circles. Scale bar: 25 μm. ( C ) Human HeLa cells that were either untreated, treated with HS (45.5°C, 30 min), or treated with HS and allowed to recover for the indicated time intervals (6, 24 and 72 h) were subjected to gene expression analysis using qRT-PCR and WB. The expression of p21 CIP1 and p16 INK4a was analysed using EvaGreen-based qRT-PCR. The amplification levels of the cDNA were normalised to the level of GAPDH cDNA. The data are represented as the mean ± SEM. WB was carried out with an antibody against p21; histone H3 was used as the loading control. ( D ) Experimental design for comparison of the effects HS on HeLa cells at different cell cycle phases. ( E ) Cell cycle profiles of the cells treated and allowed to recover as in (D). ( F ) Early and late S-phase HeLa cells obtained using a double-thymidine block were heat treated (45.5°C, 30 min), allowed to recover for 72 h and either pulse-labelled with EdU (10 μM, 30 min) or stained for cyclin B1, p21 or SA-β-gal activity. EdU was revealed by Click Chemistry (red). The DNA was stained with DAPI (blue). The control represents HeLa cells synchronised by a double-thymidine block and released for 72 h. Scale bar: 25 μm.

    Techniques Used: Staining, Activity Assay, Expressing, Quantitative RT-PCR, Western Blot, Amplification, Blocking Assay

    9) Product Images from "One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV"

    Article Title: One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2016.02166

    EvaGreen activity for RT-LAMP. Resultant microchamber devices following the loop-mediated isothermal amplification (LAMP) reaction with EvaGreen (5 and 10X) under UV (On). DNA ladder-like LAMP amplification pattern was confirmed by 2% agarose gel electrophoresis. T: template; P: LAMP-primers. The fluorescence backgrounds were shown as red-squares.
    Figure Legend Snippet: EvaGreen activity for RT-LAMP. Resultant microchamber devices following the loop-mediated isothermal amplification (LAMP) reaction with EvaGreen (5 and 10X) under UV (On). DNA ladder-like LAMP amplification pattern was confirmed by 2% agarose gel electrophoresis. T: template; P: LAMP-primers. The fluorescence backgrounds were shown as red-squares.

    Techniques Used: Activity Assay, Amplification, Agarose Gel Electrophoresis, Fluorescence

    Sensitivity of one-pot RT-LAMP. (A) 10X EvaGreen was initially mixed with RT-LAMP reagents, and the reaction was performed and visualized in microchamber. The purified MERS-CoV RNA was serially diluted in the range 4 × 10 3 –4 × 10 -1 /μL. Relative fluorescent signals were analyzed by using ImageJ software. The relative intensity of fluorescence for positive amplification was normalized to the controls (-Template/-Primer). Red square indicates background fluorescence. (B) Agarose gel electrophoresis confirmation indicated that one-pot RT-LAMP can detect MERS-CoV as few as 0.4 RNA copies. DNA ladder-like pattern was confirmed by 2% agarose gel electrophoresis. T, template; P, primer.
    Figure Legend Snippet: Sensitivity of one-pot RT-LAMP. (A) 10X EvaGreen was initially mixed with RT-LAMP reagents, and the reaction was performed and visualized in microchamber. The purified MERS-CoV RNA was serially diluted in the range 4 × 10 3 –4 × 10 -1 /μL. Relative fluorescent signals were analyzed by using ImageJ software. The relative intensity of fluorescence for positive amplification was normalized to the controls (-Template/-Primer). Red square indicates background fluorescence. (B) Agarose gel electrophoresis confirmation indicated that one-pot RT-LAMP can detect MERS-CoV as few as 0.4 RNA copies. DNA ladder-like pattern was confirmed by 2% agarose gel electrophoresis. T, template; P, primer.

    Techniques Used: Purification, Software, Fluorescence, Amplification, Agarose Gel Electrophoresis

    Specificity of one-pot RT-LAMP for MERS-CoV. RNA samples of MERS-CoV and the other respiratory pathogens were used for specificity evaluation of one-pot RT-LAMP system for MERS-CoV detection; fluorescence was visualized by 10X EvaGreen in microchamber. Each set of lane indicates a specific virus: lane 1, MERS-CoV Korean isolate; lane 2, Human coronavirus (HCoV)-229E; lane 3, Human metapneumovirus (HMPV); lane 4, B/Brisbane/60/2008 (Victoria lineage); lane 5, B/Phuket/3073/2013 (Yamagata lineage); lane 6, Influenza A virus (A/California/04/2009, H1N1); lane 7, influenza A virus (A/Perth/16/2009, H3N2). M, 100 bp DNA ladder.
    Figure Legend Snippet: Specificity of one-pot RT-LAMP for MERS-CoV. RNA samples of MERS-CoV and the other respiratory pathogens were used for specificity evaluation of one-pot RT-LAMP system for MERS-CoV detection; fluorescence was visualized by 10X EvaGreen in microchamber. Each set of lane indicates a specific virus: lane 1, MERS-CoV Korean isolate; lane 2, Human coronavirus (HCoV)-229E; lane 3, Human metapneumovirus (HMPV); lane 4, B/Brisbane/60/2008 (Victoria lineage); lane 5, B/Phuket/3073/2013 (Yamagata lineage); lane 6, Influenza A virus (A/California/04/2009, H1N1); lane 7, influenza A virus (A/Perth/16/2009, H3N2). M, 100 bp DNA ladder.

    Techniques Used: Fluorescence

    10) Product Images from "Simple and robust diagnosis of early, small and AFP-negative primary hepatic carcinomas: an integrative approach of serum fluorescence and conventional blood tests"

    Article Title: Simple and robust diagnosis of early, small and AFP-negative primary hepatic carcinomas: an integrative approach of serum fluorescence and conventional blood tests

    Journal: Oncotarget

    doi: 10.18632/oncotarget.11771

    Diagram of the measurement of serum autofluorescence and cell-free DNA-related fluorescence FS3T8, FS15T8, FS3T37, FS15T37, FS3T8E, FS15T8E, FS3T37E and FS15T37E: the names of 8 original fluorescence indicators. Each indicator name is an abbreviation indicating the fluorescence intensity (F) of serum (S) 3 μL (3) or 15 μL (15) at a given temperature (T) 8°C (8) or 37°C (37) in the presence (E) or absence of EvaGreen.
    Figure Legend Snippet: Diagram of the measurement of serum autofluorescence and cell-free DNA-related fluorescence FS3T8, FS15T8, FS3T37, FS15T37, FS3T8E, FS15T8E, FS3T37E and FS15T37E: the names of 8 original fluorescence indicators. Each indicator name is an abbreviation indicating the fluorescence intensity (F) of serum (S) 3 μL (3) or 15 μL (15) at a given temperature (T) 8°C (8) or 37°C (37) in the presence (E) or absence of EvaGreen.

    Techniques Used: Fluorescence

    Optimum conditions for the fluorescence intensity measurements of pooled serum samples ( A ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to pooled serum volumes at 37°C (T37). ( B ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to detection temperatures for 3 μL (S3) and 15 μL (S15) of pooled serum. ( C , D ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to EvaGreen volumes for 3 μL (S3) and 15 μL (S15) of pooled serum at 8°C (T8) and 37°C (T37). ( E , F ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to the cycle numbers (incubation time) for 3 μL of pooled serum at 8°C (S3T8) and 15 μL of pooled serum at 37°C (S15T37) in the absence of EvaGreen and for 3 μL of pooled serum at 8°C (S3T8E) and 15 μL of pooled serum at 37°C (S15T37E) in the presence of EvaGreen. PHC: primary hepatic carcinoma; LC: liver cirrhosis; CH: chronic hepatitis; NC: normal control.
    Figure Legend Snippet: Optimum conditions for the fluorescence intensity measurements of pooled serum samples ( A ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to pooled serum volumes at 37°C (T37). ( B ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to detection temperatures for 3 μL (S3) and 15 μL (S15) of pooled serum. ( C , D ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to EvaGreen volumes for 3 μL (S3) and 15 μL (S15) of pooled serum at 8°C (T8) and 37°C (T37). ( E , F ) The fluorescence intensity ratios of PHC to LC, CH and NC correspond to the cycle numbers (incubation time) for 3 μL of pooled serum at 8°C (S3T8) and 15 μL of pooled serum at 37°C (S15T37) in the absence of EvaGreen and for 3 μL of pooled serum at 8°C (S3T8E) and 15 μL of pooled serum at 37°C (S15T37E) in the presence of EvaGreen. PHC: primary hepatic carcinoma; LC: liver cirrhosis; CH: chronic hepatitis; NC: normal control.

    Techniques Used: Fluorescence, Liquid Chromatography, Incubation

    11) Product Images from "Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR"

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR

    Journal: Analytical and Bioanalytical Chemistry

    doi: 10.1007/s00216-018-0931-z

    EvaGreen real-time polymerase chain reaction results with different amounts of whole blood in the reactions. Two different assays were applied, targeting either a the invA gene of Salmonella enterica serovar Typhimurium DNA with 0.052 ng DNA added or b the RB1 gene of human DNA with 2 ng DNA added
    Figure Legend Snippet: EvaGreen real-time polymerase chain reaction results with different amounts of whole blood in the reactions. Two different assays were applied, targeting either a the invA gene of Salmonella enterica serovar Typhimurium DNA with 0.052 ng DNA added or b the RB1 gene of human DNA with 2 ng DNA added

    Techniques Used: Real-time Polymerase Chain Reaction

    EvaGreen real-time polymerase chain reaction results with different amounts of immunoglobulin G (IgG). The assay targeting the invA gene of Salmonella enterica serovar Typhimurium was applied, and 52 pg DNA was added to the reactions. a Real-time polymerase chain reaction amplification curves with increasing amounts of IgG and b the generated Cq values, with error bars representing the standard deviation, n = 3. Cq quantification cycle
    Figure Legend Snippet: EvaGreen real-time polymerase chain reaction results with different amounts of immunoglobulin G (IgG). The assay targeting the invA gene of Salmonella enterica serovar Typhimurium was applied, and 52 pg DNA was added to the reactions. a Real-time polymerase chain reaction amplification curves with increasing amounts of IgG and b the generated Cq values, with error bars representing the standard deviation, n = 3. Cq quantification cycle

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Generated, Standard Deviation

    12) Product Images from "iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications"

    Article Title: iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw083

    Microfluidic-assisted screening. ( A ) Experimental workflow. Steps performed on-chip (gray boxes) were distinguished from those performed off-chip (white boxes). ( B ) PCR droplets production. Aqueous phase supplemented with a high concentration of a orange fluorescent dye was injected into droplet generator device and 2.5 pl droplets were generated by focusing aqueous (dark orange) and oil (gray) flows. Emulsions were collected and thermocycled. ( C ) Droplets fusion. Small PCR droplets were reinjected into droplet-fusion device and spaced by a stream of oil. 16 pl droplets containing In Vitro Transcription (IVT, light orange) mixture supplemented with DFHBI were concomitantly produced and synchronized with PCR droplets. Pairs of droplets were then fused when passing in between a ground-connected electrode (gnd, in black) and an electrode to which tension (pos, in red) was applied. ( D ) Droplets sorting. After incubation, emulsions were reinjected into a Fluorescence Activated Droplet Sorting device and the fluorescence of each droplet read at a detection point (blue arrow and blue line on the micrograph). Based on the fluorescence signal, droplets of interest (green) were deflected into sort channel by applying tension to one of the electrode (pos, in red) whereas non-fluorescent droplets (orange) flowed into the waste channel. ( E ) Typical fluorescence profile of screened emulsion. The analysis of DFHBI green fluorescence and Texas-Red orange fluorescence allowed identifying the different populations composing the emulsion. Indeed, using orange fluorescence signal, IVT droplets fused to single PCR droplets (populations 2–5) were easily discriminated from unfused (population 1) and double fused (population 6) IVT droplets. Green fluorescence resulting from EvaGreen intercalation allowed discriminating droplets containing amplified DNA (population 4) from droplet resulting from fusion with an initially empty PCR droplet (population 2). Finally, the stronger DFHBI green fluorescence allowed discriminating droplets containing non-fluorogenic (population 2) and highly fluorogenic aptamers (population 5, red dashed boxed). Population 5 was gated and corresponding droplets sorted. ( F ) Evolution profiles of SpiSel-derived mutants. Gene libraries obtained after mutagenesis (in red) or screening steps (in gray) were transcribed, the RNAs purified and their fluorogenic properties assayed in the presence of the salt used for the selection. Fluorescence values were normalized to that of SpiSel (black circle) in the same conditions. Screenings performed in potassium (triangles) were distinguished from those performed in sodium (squares). Values are the mean of two independent experiments and error bars correspond to ± 1 standard error.
    Figure Legend Snippet: Microfluidic-assisted screening. ( A ) Experimental workflow. Steps performed on-chip (gray boxes) were distinguished from those performed off-chip (white boxes). ( B ) PCR droplets production. Aqueous phase supplemented with a high concentration of a orange fluorescent dye was injected into droplet generator device and 2.5 pl droplets were generated by focusing aqueous (dark orange) and oil (gray) flows. Emulsions were collected and thermocycled. ( C ) Droplets fusion. Small PCR droplets were reinjected into droplet-fusion device and spaced by a stream of oil. 16 pl droplets containing In Vitro Transcription (IVT, light orange) mixture supplemented with DFHBI were concomitantly produced and synchronized with PCR droplets. Pairs of droplets were then fused when passing in between a ground-connected electrode (gnd, in black) and an electrode to which tension (pos, in red) was applied. ( D ) Droplets sorting. After incubation, emulsions were reinjected into a Fluorescence Activated Droplet Sorting device and the fluorescence of each droplet read at a detection point (blue arrow and blue line on the micrograph). Based on the fluorescence signal, droplets of interest (green) were deflected into sort channel by applying tension to one of the electrode (pos, in red) whereas non-fluorescent droplets (orange) flowed into the waste channel. ( E ) Typical fluorescence profile of screened emulsion. The analysis of DFHBI green fluorescence and Texas-Red orange fluorescence allowed identifying the different populations composing the emulsion. Indeed, using orange fluorescence signal, IVT droplets fused to single PCR droplets (populations 2–5) were easily discriminated from unfused (population 1) and double fused (population 6) IVT droplets. Green fluorescence resulting from EvaGreen intercalation allowed discriminating droplets containing amplified DNA (population 4) from droplet resulting from fusion with an initially empty PCR droplet (population 2). Finally, the stronger DFHBI green fluorescence allowed discriminating droplets containing non-fluorogenic (population 2) and highly fluorogenic aptamers (population 5, red dashed boxed). Population 5 was gated and corresponding droplets sorted. ( F ) Evolution profiles of SpiSel-derived mutants. Gene libraries obtained after mutagenesis (in red) or screening steps (in gray) were transcribed, the RNAs purified and their fluorogenic properties assayed in the presence of the salt used for the selection. Fluorescence values were normalized to that of SpiSel (black circle) in the same conditions. Screenings performed in potassium (triangles) were distinguished from those performed in sodium (squares). Values are the mean of two independent experiments and error bars correspond to ± 1 standard error.

    Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Concentration Assay, Injection, Generated, In Vitro, Produced, Incubation, Fluorescence, Amplification, Derivative Assay, Mutagenesis, Purification, Selection

    13) Product Images from "A rapid, low-cost, and microfluidic chip-based system for parallel identification of multiple pathogens related to clinical pneumonia"

    Article Title: A rapid, low-cost, and microfluidic chip-based system for parallel identification of multiple pathogens related to clinical pneumonia

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-06739-2

    Structure of the microfluidic chip and method for the parallel identification of multiple pathogens. ( A ) Basement of the microfluidic chip. ( B ) Cover of the microfluidic chip. ( C ) Six primers embedded together at the bottom of one test cell using low melting point Sepharose CL-4B. ( D ) The mixture of the prepared DNA sample and isothermal nucleic acid amplification reactants is injected into the microfluidic chip via the inlet hole using a pipette. ( E ) The mixtures after being centrifuged at 5000 rpm. ( F ) Six primers released at > 50 °C. ( G ) The fluorescent marker EvaGreen bound to the amplified products as nucleic acid amplification occurred at 65 °C.
    Figure Legend Snippet: Structure of the microfluidic chip and method for the parallel identification of multiple pathogens. ( A ) Basement of the microfluidic chip. ( B ) Cover of the microfluidic chip. ( C ) Six primers embedded together at the bottom of one test cell using low melting point Sepharose CL-4B. ( D ) The mixture of the prepared DNA sample and isothermal nucleic acid amplification reactants is injected into the microfluidic chip via the inlet hole using a pipette. ( E ) The mixtures after being centrifuged at 5000 rpm. ( F ) Six primers released at > 50 °C. ( G ) The fluorescent marker EvaGreen bound to the amplified products as nucleic acid amplification occurred at 65 °C.

    Techniques Used: Chromatin Immunoprecipitation, Amplification, Injection, Transferring, Marker

    14) Product Images from "Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection"

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection

    Journal: Scientific Reports

    doi: 10.1038/srep12543

    Concept of the Tm mapping method. ( A ) The strategy for the primer designs is shown. Nested PCR is performed using seven bacterial universal primer sets, and then the seven Tm values are obtained. ( B ) Mapping the seven Tm values on two dimensions leads to the identification of the unique bacterial species-specific shape. The average of all seven Tm values includes the measurement error among trials; however, the Tm mapping shape is not affected by this type of error. ( C ) Using an analytical instrument with a high degree of thermal accuracy among PCR tubes and Tm value analysis with EvaGreen dye in 36 samples of the same bacterial DNA in the same trial, the tube-to-tube variation is within ±0.1 °C. ( D ) In order to analyze the Tm mapping “shape”, we developed a method to measure the distance of each individual Tm value from the average value. Tm values above the average receive a “+” designation, while those below the average receive a “−” designation. The Tm mapping shape is identified by comparing the seven distances obtained from the unknown bacteria to those in the database. ( E ) In order to identify a bacterial isolate, the identification software program calculates the Difference Values using the indicated formula. The closer the Difference Value is to zero, the more similar the Tm mapping shape is to the shape of a given species of pathogenic bacteria in the database.
    Figure Legend Snippet: Concept of the Tm mapping method. ( A ) The strategy for the primer designs is shown. Nested PCR is performed using seven bacterial universal primer sets, and then the seven Tm values are obtained. ( B ) Mapping the seven Tm values on two dimensions leads to the identification of the unique bacterial species-specific shape. The average of all seven Tm values includes the measurement error among trials; however, the Tm mapping shape is not affected by this type of error. ( C ) Using an analytical instrument with a high degree of thermal accuracy among PCR tubes and Tm value analysis with EvaGreen dye in 36 samples of the same bacterial DNA in the same trial, the tube-to-tube variation is within ±0.1 °C. ( D ) In order to analyze the Tm mapping “shape”, we developed a method to measure the distance of each individual Tm value from the average value. Tm values above the average receive a “+” designation, while those below the average receive a “−” designation. The Tm mapping shape is identified by comparing the seven distances obtained from the unknown bacteria to those in the database. ( E ) In order to identify a bacterial isolate, the identification software program calculates the Difference Values using the indicated formula. The closer the Difference Value is to zero, the more similar the Tm mapping shape is to the shape of a given species of pathogenic bacteria in the database.

    Techniques Used: Nested PCR, Polymerase Chain Reaction, Software

    15) Product Images from "Inducing cellular senescence in vitro by using genetically encoded photosensitizers"

    Article Title: Inducing cellular senescence in vitro by using genetically encoded photosensitizers

    Journal: Aging (Albany NY)

    doi: 10.18632/aging.101065

    Analysis of the expression of p21 and p16 CDK inhibitors in HeLa cells expressing genetically encoded photosensitizers HeLa cells that express H2B-miniSOG or H2B-tKR were synchronized in S phase, illuminated with blue (465-495 nm, 65 mW/cm 2 , 5 min) or green (540-580 nm, 200 mW/cm 2 , 15 min) light, allowed to recover for the indicated time intervals (0, 6, 24 and 48 hr), and subjected to gene expression analysis using qRT-PCR and WB. Control (“C”) represents the non-illuminated cells. The expression of p21 CIP1 and p16 INK4a was analyzed using EvaGreen-based qRT-PCR. The amplification levels of the cDNA were normalized to the level of the GAPDH cDNA. The results of one representative experiment are shown. WB was performed with an antibody against p21; GAPDH was used as the loading control.
    Figure Legend Snippet: Analysis of the expression of p21 and p16 CDK inhibitors in HeLa cells expressing genetically encoded photosensitizers HeLa cells that express H2B-miniSOG or H2B-tKR were synchronized in S phase, illuminated with blue (465-495 nm, 65 mW/cm 2 , 5 min) or green (540-580 nm, 200 mW/cm 2 , 15 min) light, allowed to recover for the indicated time intervals (0, 6, 24 and 48 hr), and subjected to gene expression analysis using qRT-PCR and WB. Control (“C”) represents the non-illuminated cells. The expression of p21 CIP1 and p16 INK4a was analyzed using EvaGreen-based qRT-PCR. The amplification levels of the cDNA were normalized to the level of the GAPDH cDNA. The results of one representative experiment are shown. WB was performed with an antibody against p21; GAPDH was used as the loading control.

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Amplification

    16) Product Images from "Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems"

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems

    Journal: Analytical Chemistry

    doi: 10.1021/ac5022419

    Validation of DNA amplicon detection using a mobile phone camera. (a) Samples containing a range of template molecules were amplified for 30 cycles with EvaGreen, excited by UV transillumination, and imaged with a mobile phone camera and 520 nm filter. (b) Sensitivity and specificity of camera phone detection of amplified DNA in comparison to qPCR end-point detection. The normalized fluorescence for 10 independent experiments is plotted versus the log of the initial template mass.
    Figure Legend Snippet: Validation of DNA amplicon detection using a mobile phone camera. (a) Samples containing a range of template molecules were amplified for 30 cycles with EvaGreen, excited by UV transillumination, and imaged with a mobile phone camera and 520 nm filter. (b) Sensitivity and specificity of camera phone detection of amplified DNA in comparison to qPCR end-point detection. The normalized fluorescence for 10 independent experiments is plotted versus the log of the initial template mass.

    Techniques Used: Amplification, Real-time Polymerase Chain Reaction, Fluorescence

    17) Product Images from "Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes"

    Article Title: Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes

    Journal:

    doi: 10.1128/AEM.02615-17

    Pipeline of the NiCE chip assay. (a) Quantitative PCR is performed by using a 48.48 AccessArray (AA) chip with EvaGreen chemistry. (b) Recovered PCR amplicons are tagged with an Illumina index and adaptors (Illumina) and used for MiSeq 300-bp paired-end sequencing.
    Figure Legend Snippet: Pipeline of the NiCE chip assay. (a) Quantitative PCR is performed by using a 48.48 AccessArray (AA) chip with EvaGreen chemistry. (b) Recovered PCR amplicons are tagged with an Illumina index and adaptors (Illumina) and used for MiSeq 300-bp paired-end sequencing.

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Sequencing

    18) Product Images from "SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR"

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-4-263

    Melt curves for SYBR Green, EvaGreen, and SYTO 16 . All reactions contained 1000 pg shrimp genomic DNA amplified using the 16S primer set. Similar data were obtained for all experiments and amounts of template DNA tested.
    Figure Legend Snippet: Melt curves for SYBR Green, EvaGreen, and SYTO 16 . All reactions contained 1000 pg shrimp genomic DNA amplified using the 16S primer set. Similar data were obtained for all experiments and amounts of template DNA tested.

    Techniques Used: SYBR Green Assay, Amplification

    Related Articles

    Clone Assay:

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye . .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Amplification:

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR
    Article Snippet: For the invA assay, the amplification conditions were 95 °C for 2 min, followed by 50 cycles of 10 s at 95 °C, 20 s at 60 °C, and 30 s at 72 °C. .. Unless otherwise stated, the following reagents were included in all master mixes for the invA assay: 1× ExTaq buffer, 0.2 mM dNTP, 2.0 mM MgCl2 in total, each primer at 0.3 μM (InvA forward primer, InvA reverse primer [ ]), 0.2 μM hydrolysis probe (InvA-minor groove binder [ ]) or 1× EvaGreen (Biotium, Hayward, CA, USA), 1 U ExTaq HS DNA polymerase, and 4 μL DNA (0.013 ng/μL).

    Article Title: Simple and robust diagnosis of early, small and AFP-negative primary hepatic carcinomas: an integrative approach of serum fluorescence and conventional blood tests
    Article Snippet: The excitation and emission wavelengths were 490 nm and 525 nm, respectively. .. These wavelengths are suitable for EvaGreen (Biotium, USA), which is a double-stranded nucleic acid dye used to detect products of real-time PCR amplification. .. During the measurement of serum FI, the reaction mixture was maintained at a certain temperature for 1 minute followed by data collection for 30 seconds.

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: Negative controls were a blank (i.e., without DNA) and another one with 50 ng of carrier normal human blood DNA. .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program. .. To control nested amplification and to determine the number of E6 copies in problem samples, additional mixtures containing 1/50 volume of preamplified positive, negative and problem mixtures were prepared; in these experiments an additional negative control mixture was used which contained preamplified SiHa DNA and the forward (pU1M) but not the reverse (pU1R) primer (Fig. ).

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: For droplet-based MDA reactions, we used a commercially available MDA kit (Genomiphi V2 DNA amplification Kit, GE Healthcare, Waukesha, WI), according to the manufacturer’s protocol, with minor modifications. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA).

    Article Title: A rapid, low-cost, and microfluidic chip-based system for parallel identification of multiple pathogens related to clinical pneumonia
    Article Snippet: The prepared DNA samples were immediately stored at −20 °C until use. .. Each 10-μL isothermal nucleic acid amplification assay for pathogen molecular diagnostics consisted of 0.2 μM each of F3 and B3, 1.6 μM each of FIP and BIP, 0.4 μM each of LF and LB, 8 U of Bst DNA Polymerase (Large Fragment), 0.1 mM dUTP, 0.4 mM dNTPs (New England Biolabs Ltd., Beverly, USA), 0.5 mg/ml BSA (Fluka Sigma-Aldrich Inc., Missouri, USA), 0.6× EvaGreen (Biotium Inc., California, USA), 0.8 M betaine (Fluka Sigma-Aldrich Inc., Missouri, USA), 6 mM MgSO4 (Beijing Chemical Reagents Company, Beijing, China), 0.1 U/mL Uracil-DNA Glycosylase (Fermentas Inc., Burlington, Canada), 10 mM (NH4 )2 SO4 , 20 mM Tris-HCl (pH 8.8 at 25 °C), 10 mM KCl, 0.1% Triton X-100, and 2 μL template DNA. .. The prepared DNA samples were then tested by two real-time PCR assays as control methods: the Sau and mecA genes using Sau and MRSA nucleic acid test kits (PCR fluorescence method) (Triplex International Biosciences Co., Ltd, Fujian, China); and Mpn using a Mycoplasma Pneumonia nucleic acid test kit (PCR fluorescence method) (ACON Biotech Co., Ltd. Hangzhou, China).

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: The primers were as follows: Region 1 primers (forward: 5′-AGAGTTTGATCATGGCTCAG-3′, reverse: 5′-CGTAGGAGTCTGGACCGT-3′, amplicon size: 338 bp), Region 2 primers (forward: 5′-GACTCCTACGGGAGGCA-3′, reverse: 5′-TATTACCGCGGCTGCTG-3′, amplicon size: 199 bp), Region 3 primers (forward: 5′-AGCAGCCGCGGTAATA-3′, reverse: 5′-GGACTACCAGGGTATCTAATCCT-3′, amplicon size: 287 bp), Region 4 primers (forward: 5′-AACAGGATTAGATACCCTGGTAG-3′, reverse: 5′-AATTAAACCACATGCTCCACC-3′, amplicon size: 181 bp), Region 5 primers (forward: 5′-TGGTTTAATTCGATGCAACGC-3′, reverse: 5′-GAGCTGACGACAGCCAT-3′, amplicon size: 120 bp), Region 6 primers (forward: 5′-TTGGGTTAAGTCCCGC-3′, reverse: 5′-CGTCATCCCCACCTTC-3′, amplicon size: 109 bp), Region 7 primers (forward: 5′-GGCTACACACGTGCTACAAT-3′, reverse: 5′-CCGGGAACGTATTCACC-3′, amplicon size: 166 bp). .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. The seven PCR amplicons were then analyzed to obtain the Tm values.

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: PCR reactions for comparison of SYBR Green I (Thermo Fisher Scientific) and EvaGreen (Biotium, USA) detection chemistries were prepared as described above using the P220 phage DNA as template. .. PCR reactions for comparison of SYBR Green I (Thermo Fisher Scientific) and EvaGreen (Biotium, USA) detection chemistries were prepared as described above using the P220 phage DNA as template.

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: For qPCR, amplification data was acquired during the PCR extension step, a thermal melt was performed from 70–95°C. .. For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: Primers targeting the shrimp tropomyosin gene (forward primer: TGCAGCAACTTGAGAACGACCTTG, reverse primer: TGTCCTTCTCCACAAGCTGGATGT, amplicon: TGCAGCAACTTGAGAACGACCTTGACCAGGTGCAGGAATCCTTGCTGAAGGCTA ACATCCAGCTTGTGGAGAAGGACA) were designed from Genbank accession number AY827100 using PrimerQuest (Integrated DNA Technologies, Coralville, IA). .. SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA).

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: For precise quantification of the ratio of relative Sc-j and Sc-i copy numbers and transcript levels in the F1 , the gDNA and cDNA segments that included all the alleles/paralogs in different stage anthers of the F1 plants were amplified using primers P5/P7. .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Whole Genome Amplification:

    Article Title: Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics
    Article Snippet: Paragraph title: Droplet fusion and single-cell whole genome amplification ... Prior to reagent introduction into the device, an MDA mixture (REPLI-g Single Cell Kit, QIAGEN) was prepared containing 1.5 μL of stop buffer, 1.5 μL of H2 O, 14.5 μL of reaction buffer, 1.0 μL of enzyme mix, 2.5 μL of 10% Tween-20 (1% v/v concentration), and 0.5 μL of 20x Evagreen (Biotium, Fremont, CA, USA), for use in a 21.5-μL reaction volume.

    Positive Control:

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: Negative controls were a blank (i.e., without DNA) and another one with 50 ng of carrier normal human blood DNA. .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program. .. To control nested amplification and to determine the number of E6 copies in problem samples, additional mixtures containing 1/50 volume of preamplified positive, negative and problem mixtures were prepared; in these experiments an additional negative control mixture was used which contained preamplified SiHa DNA and the forward (pU1M) but not the reverse (pU1R) primer (Fig. ).

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: In place of 2 μL of DNA template, the PCR reaction mixture contained 2 μL (8.0 ng/μL) of DNA extracted from Escherichia coli (ATCC 25922) as a positive control, or 2 μL of molecular-grade distilled water (water deionized and sterilized for molecular biology, NACALAI TESQUE, INC.) as a negative control for the PCR step. .. For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Synthesized:

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: All oligonucleotide primers were designed using a multiple alignment software program (ClustalX) and were synthesized by Life Technologies Japan, Ltd. (Tokyo, Japan). .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Lambda DNA Preparation:

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: For lambda DNA samples, 0.9 μL of nuclease-free water was added to 1 μL of each denatured DNA solution. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA).

    Quantitative RT-PCR:

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: The SuperScript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Life Technologies, Carlsbad, CA), the qScript™ One-Step SYBR® Green qRT-PCR Kit (Quanta Biosciences, Gaithersburg, MD), the Transcriptor® One-Step RT-PCR Kit (Roche Applied Science, Mannheim, Germany) and Tth DNA polymerase (Epicentre Technologies, Madison, WI) were used according to manufacturer instructions. .. For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: Paragraph title: Quantitative RT-PCR ... Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium).

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: SYBR Green QPCR mix (Bio-Rad) was used for qRT-PCR. .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Real-time Polymerase Chain Reaction:

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR
    Article Snippet: Paragraph title: Real-time PCR and gel electrophoresis ... Unless otherwise stated, the following reagents were included in all master mixes for the invA assay: 1× ExTaq buffer, 0.2 mM dNTP, 2.0 mM MgCl2 in total, each primer at 0.3 μM (InvA forward primer, InvA reverse primer [ ]), 0.2 μM hydrolysis probe (InvA-minor groove binder [ ]) or 1× EvaGreen (Biotium, Hayward, CA, USA), 1 U ExTaq HS DNA polymerase, and 4 μL DNA (0.013 ng/μL).

    Article Title: Simple and robust diagnosis of early, small and AFP-negative primary hepatic carcinomas: an integrative approach of serum fluorescence and conventional blood tests
    Article Snippet: The excitation and emission wavelengths were 490 nm and 525 nm, respectively. .. These wavelengths are suitable for EvaGreen (Biotium, USA), which is a double-stranded nucleic acid dye used to detect products of real-time PCR amplification. .. During the measurement of serum FI, the reaction mixture was maintained at a certain temperature for 1 minute followed by data collection for 30 seconds.

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: Negative controls were a blank (i.e., without DNA) and another one with 50 ng of carrier normal human blood DNA. .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program. .. To control nested amplification and to determine the number of E6 copies in problem samples, additional mixtures containing 1/50 volume of preamplified positive, negative and problem mixtures were prepared; in these experiments an additional negative control mixture was used which contained preamplified SiHa DNA and the forward (pU1M) but not the reverse (pU1R) primer (Fig. ).

    Article Title: Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress
    Article Snippet: The cDNA obtained was analysed by quantitative polymerase chain reaction (PCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). .. The PCRs were performed in 20 μl reaction volumes that included 50 mM Tris-HCl (pH 8.6), 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM of each primer, 0.2 mM of each dNTP, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNA.

    Article Title: Inducing cellular senescence in vitro by using genetically encoded photosensitizers
    Article Snippet: Paragraph title: RNA isolation and reverse transcription quantitative PCR ... Each reaction contained 50 mM Tris-HCl, pH 8.6, 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM each primer, 0.2 mM dNTPs, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNAs.

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: Paragraph title: PCR and qPCR assays ... PCR reactions for comparison of SYBR Green I (Thermo Fisher Scientific) and EvaGreen (Biotium, USA) detection chemistries were prepared as described above using the P220 phage DNA as template.

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: For qPCR, amplification data was acquired during the PCR extension step, a thermal melt was performed from 70–95°C. .. For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes
    Article Snippet: Paragraph title: Microfluidic qPCR. ... The presample master mix (5 μl) contained 1× FastStart HiFi reaction buffer (Roche), 1× AccessArray loading reagent (Fluidigm), 4.5 mM MgCl2 , 5% (vol/vol) DMSO, 0.2 mM each dNTP, 0.05 U FastStart HiFi enzyme blend (Roche), 1× EvaGreen (Biotium), 0.5× 5-carboxyl-X-rhodamine (ROX), and 1 μl template DNA (ca.

    Article Title: Programming an in vitro DNA oscillator using a molecular networking strategy
    Article Snippet: All reactions (except quantitative isothermal amplifications described in Supplementary information S3) were assembled in buffer A containing 45 mM Tris–HCl, 50 mM NaCl, 10 mM KCl, 10 mM (NH4 )SO4 , 7 mM MgCl2 , 6 mM DTT, pH=8.0, 100 μg ml−1 BSA (New England Biolabs), 410 mM Trehalose (included to stabilize RecJf during long experiments), complemented with 1 × EvaGreen (Biotium) and dNTPs (100 μM each) when necessary. .. All reactions (except quantitative isothermal amplifications described in Supplementary information S3) were assembled in buffer A containing 45 mM Tris–HCl, 50 mM NaCl, 10 mM KCl, 10 mM (NH4 )SO4 , 7 mM MgCl2 , 6 mM DTT, pH=8.0, 100 μg ml−1 BSA (New England Biolabs), 410 mM Trehalose (included to stabilize RecJf during long experiments), complemented with 1 × EvaGreen (Biotium) and dNTPs (100 μM each) when necessary.

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA). .. SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA).

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: RNA samples were treated with RQ1 DNase (Promega) prior to reverse transcription with Superscript III (Invitrogen). cDNA reactions were primed with poly dT for measurement of mature transcripts. .. Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium). .. Transcript levels were normalized to Rps17 .

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: The reactions were carried out using the Bio-rad CFX Connect Real-Time PCR System with the following profile: 95 °C for 3 min; 42 cycles of 95 °C for 10 s, 60 °C for 15 s, 72 °C for 20 s. The expression pattern of Sc-j (Os03g0247300 ) in Nip was from the Rice Expression Profile Database ( http://ricexpro.dna.affrc.go.jp/ ) . .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Nested PCR:

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: We used 1.5-mL PCR-clean Eppendorf tubes that were RNase- and DNase-free (Eppendorf, Germany), 0.2-mL PCR tubes (Qiagen) for the first PCR and 0.1-mL Strip Tubes and Caps (Qiagen) for the second (nested) PCR. .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: The PCR product was diluted 500-fold with molecular-grade distilled water (water deionized and sterilized for molecular biology, NACALAI TESQUE, INC.) and then used as a template for the second (nested) PCR procedure. .. For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. The seven samples used to amplify Regions 1 to 7 were incubated for five minutes at 95 °C to activate the Hot Start dNTPs, then denatured for 10 seconds at 94 °C, annealed for 10 seconds at 57 °C, extended for 10 seconds at 72 °C and subjected to fluorescence acquisition for 2 seconds at 82 °C for 30 cycles.

    Random Hexamer Labeling:

    Article Title: Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress
    Article Snippet: RNA (1 μg) was reverse transcribed in a total volume of 20 μl for 1 h at 42°C using 0.4 μg of random hexamer primers and 200 U of reverse transcriptase (Fermentas) in the presence of 20 U of ribonuclease inhibitor (Fermentas). .. The PCRs were performed in 20 μl reaction volumes that included 50 mM Tris-HCl (pH 8.6), 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM of each primer, 0.2 mM of each dNTP, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNA.

    Article Title: Inducing cellular senescence in vitro by using genetically encoded photosensitizers
    Article Snippet: The total RNA was extracted from the cells using TRIzol reagent (Life Technologies), and cDNA synthesis was performed at 42°C for 1 h using 0.5 μg of the total RNA as a template, 0.4 μg of random hexamer primers and 200 U of reverse transcriptase (Fermentas) in the presence of 20 U of ribonuclease inhibitor (Fermentas). .. Each reaction contained 50 mM Tris-HCl, pH 8.6, 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM each primer, 0.2 mM dNTPs, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNAs.

    Stripping Membranes:

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: We used 1.5-mL PCR-clean Eppendorf tubes that were RNase- and DNase-free (Eppendorf, Germany), 0.2-mL PCR tubes (Qiagen) for the first PCR and 0.1-mL Strip Tubes and Caps (Qiagen) for the second (nested) PCR. .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Expressing:

    Article Title: Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress
    Article Snippet: Paragraph title: Gene expression analysis ... The PCRs were performed in 20 μl reaction volumes that included 50 mM Tris-HCl (pH 8.6), 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM of each primer, 0.2 mM of each dNTP, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNA.

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: Paragraph title: Expression analysis ... SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Derivative Assay:

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: Bone marrow derived macrophages are > 95% CD11b/F4-80hi and were used without sorting. .. Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium).

    Flow Cytometry:

    Article Title: iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications
    Article Snippet: 1 μl of this dilution was then introduced in 100 μl of PCR mixture containing 20 pmol of each primer (Fwd and Rev), 0.2 mM of each dNTPs, 0.67 mg/ml Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, 1x EvaGreen (Biotium), 5 U of DreamTaqTM and the corresponding buffer (Fermentas). .. The mixture was loaded in a length of PTFE tubing and infused into droplet generator microfluidic chip where it was dispersed in 2.5 pl droplets (production rate of ≈12 000 droplets/s) carried by HFE 7500 fluorinated oil (3M) supplemented with 3% of a fluorosurfactant ( ).

    Article Title: Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics
    Article Snippet: Prior to reagent introduction into the device, an MDA mixture (REPLI-g Single Cell Kit, QIAGEN) was prepared containing 1.5 μL of stop buffer, 1.5 μL of H2 O, 14.5 μL of reaction buffer, 1.0 μL of enzyme mix, 2.5 μL of 10% Tween-20 (1% v/v concentration), and 0.5 μL of 20x Evagreen (Biotium, Fremont, CA, USA), for use in a 21.5-μL reaction volume. .. The MDA mixture was mixed gently, but completely, by vortexing and loaded into the microfluidic device.

    Sequencing:

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: For quantification and sequence analysis of a single-cell genome, E .coli K12 cells were sorted by FACS into individual reaction tubes containing 1.9 μL of nuclease-free water. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA).

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: PCR validation was performed with a 100-nt single-stranded DNA sequence reported previously as Thr-02, using primers AGCAGCACAGAGGTCAGATG and TTCACGGTAGCACGCATAGG. .. SYBR Green I was obtained from Life Technologies and used at 0.625× concentration, and EvaGreen was obtained from Biotium and used at 1× concentration.

    Mutagenesis:

    Article Title: iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications
    Article Snippet: DNA mutant libraries were diluted in 200 μg/ml yeast total RNA solution (Ambion) down to ≈8 template DNA molecules per picoliter. .. 1 μl of this dilution was then introduced in 100 μl of PCR mixture containing 20 pmol of each primer (Fwd and Rev), 0.2 mM of each dNTPs, 0.67 mg/ml Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, 1x EvaGreen (Biotium), 5 U of DreamTaqTM and the corresponding buffer (Fermentas).

    Generated:

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA). .. Reactions contained 1× PCR buffer, 3 mM MgCl2 , 1.2 mM dNTP mix, 200 nM each primer, 3% DMSO, 4% glycerol, and 1.25 units Taq polymerase in 25 μl total volume.

    Inhibition:

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA). .. Reactions contained 1× PCR buffer, 3 mM MgCl2 , 1.2 mM dNTP mix, 200 nM each primer, 3% DMSO, 4% glycerol, and 1.25 units Taq polymerase in 25 μl total volume.

    Polymerase Chain Reaction:

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: Negative controls were a blank (i.e., without DNA) and another one with 50 ng of carrier normal human blood DNA. .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program. .. To control nested amplification and to determine the number of E6 copies in problem samples, additional mixtures containing 1/50 volume of preamplified positive, negative and problem mixtures were prepared; in these experiments an additional negative control mixture was used which contained preamplified SiHa DNA and the forward (pU1M) but not the reverse (pU1R) primer (Fig. ).

    Article Title: Mechanism of heat stress-induced cellular senescence elucidates the exclusive vulnerability of early S-phase cells to mild genotoxic stress
    Article Snippet: The cDNA obtained was analysed by quantitative polymerase chain reaction (PCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). .. The PCRs were performed in 20 μl reaction volumes that included 50 mM Tris-HCl (pH 8.6), 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM of each primer, 0.2 mM of each dNTP, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNA.

    Article Title: iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications
    Article Snippet: DNA mutant libraries were diluted in 200 μg/ml yeast total RNA solution (Ambion) down to ≈8 template DNA molecules per picoliter. .. 1 μl of this dilution was then introduced in 100 μl of PCR mixture containing 20 pmol of each primer (Fwd and Rev), 0.2 mM of each dNTPs, 0.67 mg/ml Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, 1x EvaGreen (Biotium), 5 U of DreamTaqTM and the corresponding buffer (Fermentas). .. The mixture was loaded in a length of PTFE tubing and infused into droplet generator microfluidic chip where it was dispersed in 2.5 pl droplets (production rate of ≈12 000 droplets/s) carried by HFE 7500 fluorinated oil (3M) supplemented with 3% of a fluorosurfactant ( ).

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: The first PCR primer set was the same as the Region 1 forward primer and the Region 7 reverse primer ( ). .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. The generation of eukaryote-made thermostable DNA polymerase using Saccharomyces cerevisiae has been described previously .

    Article Title: Inducing cellular senescence in vitro by using genetically encoded photosensitizers
    Article Snippet: The obtained cDNAs were analyzed by quantitative polymerase chain reaction (PCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). .. Each reaction contained 50 mM Tris-HCl, pH 8.6, 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM each primer, 0.2 mM dNTPs, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNAs.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: The PCR product was diluted 500-fold with molecular-grade distilled water (water deionized and sterilized for molecular biology, NACALAI TESQUE, INC.) and then used as a template for the second (nested) PCR procedure. .. For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. The seven samples used to amplify Regions 1 to 7 were incubated for five minutes at 95 °C to activate the Hot Start dNTPs, then denatured for 10 seconds at 94 °C, annealed for 10 seconds at 57 °C, extended for 10 seconds at 72 °C and subjected to fluorescence acquisition for 2 seconds at 82 °C for 30 cycles.

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: Subsequent to the amplification, a melting curve analysis was performed in order to distinguish putative nonspecific amplifications. .. PCR reactions for comparison of SYBR Green I (Thermo Fisher Scientific) and EvaGreen (Biotium, USA) detection chemistries were prepared as described above using the P220 phage DNA as template. .. Slopes and efficiencies were analyzed by setting the threshold level at 0.1.

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: For qPCR, amplification data was acquired during the PCR extension step, a thermal melt was performed from 70–95°C. .. For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes
    Article Snippet: The presample master mix (5 μl) contained 1× FastStart HiFi reaction buffer (Roche), 1× AccessArray loading reagent (Fluidigm), 4.5 mM MgCl2 , 5% (vol/vol) DMSO, 0.2 mM each dNTP, 0.05 U FastStart HiFi enzyme blend (Roche), 1× EvaGreen (Biotium), 0.5× 5-carboxyl-X-rhodamine (ROX), and 1 μl template DNA (ca. .. All primers listed in Table S1 in the supplemental material were used in the microfluidic qPCR run, except when RNA (cDNA) samples were used; the 16S rRNA gene assays were not included when RNA samples were used. qPCR was performed under the following thermal conditions: 50°C for 120 s, 70°C for 20 min, and 95°C for 10 min, followed by 10 cycles of condition A (95°C for 15 s, 50°C for 30 s, and 72°C for 1 min), 2 cycles of condition B (95°C for 15 s, 80°C for 30 s, 50°C for 30 s, and 72°C for 1 min), 8 cycles of condition A, 2 cycles of condition B, 8 cycles of condition A, 5 cycles of condition B, and melting curve analysis from 60°C to 95°C.

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: PCR validation was performed with a 100-nt single-stranded DNA sequence reported previously as Thr-02, using primers AGCAGCACAGAGGTCAGATG and TTCACGGTAGCACGCATAGG. .. SYBR Green I was obtained from Life Technologies and used at 0.625× concentration, and EvaGreen was obtained from Biotium and used at 1× concentration.

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA). .. SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA).

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye . .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Injection:

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: CD11b/F4-80hi cells were sorted from total peritoneal cells lavaged from naive or thioglycollate-injected (2 ml injected intraperitoneally four days in advance) mice. .. Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium).

    Molecular Weight:

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: Calculation of the number of E6-HPV16 copies is based on the size of pHV101 (3,645 bp) and the average molecular weight of a deoxynucleotide pair (650 Da). .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program.

    Nucleic Acid Electrophoresis:

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR
    Article Snippet: Paragraph title: Real-time PCR and gel electrophoresis ... Unless otherwise stated, the following reagents were included in all master mixes for the invA assay: 1× ExTaq buffer, 0.2 mM dNTP, 2.0 mM MgCl2 in total, each primer at 0.3 μM (InvA forward primer, InvA reverse primer [ ]), 0.2 μM hydrolysis probe (InvA-minor groove binder [ ]) or 1× EvaGreen (Biotium, Hayward, CA, USA), 1 U ExTaq HS DNA polymerase, and 4 μL DNA (0.013 ng/μL).

    Fluorescence:

    Article Title: Simple and robust diagnosis of early, small and AFP-negative primary hepatic carcinomas: an integrative approach of serum fluorescence and conventional blood tests
    Article Snippet: Paragraph title: Measurement of serum fluorescence intensity ... These wavelengths are suitable for EvaGreen (Biotium, USA), which is a double-stranded nucleic acid dye used to detect products of real-time PCR amplification.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: Each sample was incubated for five minutes at 95 °C to activate the Hot Start dNTPs, then was denatured for 10 seconds at 94 °C, annealed for 10 seconds at 57 °C, extended for 30 seconds at 72 °C and subjected to fluorescence acquisition for 2 seconds at 82 °C for 40 cycles. .. For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes
    Article Snippet: The presample master mix (5 μl) contained 1× FastStart HiFi reaction buffer (Roche), 1× AccessArray loading reagent (Fluidigm), 4.5 mM MgCl2 , 5% (vol/vol) DMSO, 0.2 mM each dNTP, 0.05 U FastStart HiFi enzyme blend (Roche), 1× EvaGreen (Biotium), 0.5× 5-carboxyl-X-rhodamine (ROX), and 1 μl template DNA (ca. .. All primers listed in Table S1 in the supplemental material were used in the microfluidic qPCR run, except when RNA (cDNA) samples were used; the 16S rRNA gene assays were not included when RNA samples were used. qPCR was performed under the following thermal conditions: 50°C for 120 s, 70°C for 20 min, and 95°C for 10 min, followed by 10 cycles of condition A (95°C for 15 s, 50°C for 30 s, and 72°C for 1 min), 2 cycles of condition B (95°C for 15 s, 80°C for 30 s, 50°C for 30 s, and 72°C for 1 min), 8 cycles of condition A, 2 cycles of condition B, 8 cycles of condition A, 5 cycles of condition B, and melting curve analysis from 60°C to 95°C.

    Article Title: Programming an in vitro DNA oscillator using a molecular networking strategy
    Article Snippet: All reactions (except quantitative isothermal amplifications described in Supplementary information S3) were assembled in buffer A containing 45 mM Tris–HCl, 50 mM NaCl, 10 mM KCl, 10 mM (NH4 )SO4 , 7 mM MgCl2 , 6 mM DTT, pH=8.0, 100 μg ml−1 BSA (New England Biolabs), 410 mM Trehalose (included to stabilize RecJf during long experiments), complemented with 1 × EvaGreen (Biotium) and dNTPs (100 μM each) when necessary. .. All reactions (except quantitative isothermal amplifications described in Supplementary information S3) were assembled in buffer A containing 45 mM Tris–HCl, 50 mM NaCl, 10 mM KCl, 10 mM (NH4 )SO4 , 7 mM MgCl2 , 6 mM DTT, pH=8.0, 100 μg ml−1 BSA (New England Biolabs), 410 mM Trehalose (included to stabilize RecJf during long experiments), complemented with 1 × EvaGreen (Biotium) and dNTPs (100 μM each) when necessary.

    Multiple Displacement Amplification:

    Article Title: Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics
    Article Snippet: The cells encapsulated into individual droplets were then incubated at 65 °C in PCR tubes for 10 min. .. Prior to reagent introduction into the device, an MDA mixture (REPLI-g Single Cell Kit, QIAGEN) was prepared containing 1.5 μL of stop buffer, 1.5 μL of H2 O, 14.5 μL of reaction buffer, 1.0 μL of enzyme mix, 2.5 μL of 10% Tween-20 (1% v/v concentration), and 0.5 μL of 20x Evagreen (Biotium, Fremont, CA, USA), for use in a 21.5-μL reaction volume. .. The MDA mixture was mixed gently, but completely, by vortexing and loaded into the microfluidic device.

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: For lambda DNA samples, 0.9 μL of nuclease-free water was added to 1 μL of each denatured DNA solution. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA). .. The MDA mixture was mixed gently but completely by vortexing and loaded into the microfluidic device.

    Isolation:

    Article Title: Inducing cellular senescence in vitro by using genetically encoded photosensitizers
    Article Snippet: Paragraph title: RNA isolation and reverse transcription quantitative PCR ... Each reaction contained 50 mM Tris-HCl, pH 8.6, 50 mM KCl, 1.5 mM MgCl2 , 0.1% Tween-20, 0.5 μM each primer, 0.2 mM dNTPs, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNAs.

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: RNA was isolated with the RNeasy kit (Qiagen) according to the manufacturer’s protocol. .. Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium).

    Size-exclusion Chromatography:

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: The E6-1 positive control mixtures required to generate the family type curves contained the LCRS/E7AS primer pair, 50 ng of "carrier" normal human DNA and serial logarithmic dilutions of pHV101; they were preamplified for 15 cycles (denaturation at 94°C for 15 sec, annealing at 57°C for 1 min and extension at 72°C for 1 min). .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program.

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: To test the optimum concentrations of the primers, identical reactions containing different concentrations of the forward and reverse primers, prepared essentially as described [ ], were run using the following thermocycling conditions: initial stage at 50°C for 2 min, hot start at 95°C for 2 min; followed by 40 cycles of (i) 95°C for 15 sec, (ii) 55°C for 30 sec and (iii) 72°C for 30 sec. .. PCR reactions for comparison of SYBR Green I (Thermo Fisher Scientific) and EvaGreen (Biotium, USA) detection chemistries were prepared as described above using the P220 phage DNA as template.

    Mouse Assay:

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: CD11b/F4-80hi cells were sorted from total peritoneal cells lavaged from naive or thioglycollate-injected (2 ml injected intraperitoneally four days in advance) mice. .. Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: Paragraph title: RT-PCR ... For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: RNA samples were treated with RQ1 DNase (Promega) prior to reverse transcription with Superscript III (Invitrogen). cDNA reactions were primed with poly dT for measurement of mature transcripts. .. Quantitative PCR was performed as described using the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen (Biotium). .. Transcript levels were normalized to Rps17 .

    Lysis:

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: Each cell suspension was heated at 95°C for 3 min for cell lysis and DNA denaturation. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA).

    IA:

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: Primers targeting the shrimp tropomyosin gene (forward primer: TGCAGCAACTTGAGAACGACCTTG, reverse primer: TGTCCTTCTCCACAAGCTGGATGT, amplicon: TGCAGCAACTTGAGAACGACCTTGACCAGGTGCAGGAATCCTTGCTGAAGGCTA ACATCCAGCTTGTGGAGAAGGACA) were designed from Genbank accession number AY827100 using PrimerQuest (Integrated DNA Technologies, Coralville, IA). .. SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA).

    Chromatin Immunoprecipitation:

    Article Title: Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes
    Article Snippet: Microfluidic qPCR was carried out by using a BioMark HD reader (Fluidigm) with a 48.48 AccessArray chip (Fluidigm). .. The presample master mix (5 μl) contained 1× FastStart HiFi reaction buffer (Roche), 1× AccessArray loading reagent (Fluidigm), 4.5 mM MgCl2 , 5% (vol/vol) DMSO, 0.2 mM each dNTP, 0.05 U FastStart HiFi enzyme blend (Roche), 1× EvaGreen (Biotium), 0.5× 5-carboxyl-X-rhodamine (ROX), and 1 μl template DNA (ca.

    Plasmid Preparation:

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye . .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Software:

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR
    Article Snippet: LightCycler Nano Software version 1.1 was used for determination of Cq values. .. Unless otherwise stated, the following reagents were included in all master mixes for the invA assay: 1× ExTaq buffer, 0.2 mM dNTP, 2.0 mM MgCl2 in total, each primer at 0.3 μM (InvA forward primer, InvA reverse primer [ ]), 0.2 μM hydrolysis probe (InvA-minor groove binder [ ]) or 1× EvaGreen (Biotium, Hayward, CA, USA), 1 U ExTaq HS DNA polymerase, and 4 μL DNA (0.013 ng/μL).

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: All oligonucleotide primers were designed using a multiple alignment software program (ClustalX) and were synthesized by Life Technologies Japan, Ltd. (Tokyo, Japan). .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Nitrogen Cycle Evaluation (NiCE) Chip for Simultaneous Analysis of Multiple N Cycle-Associated Genes
    Article Snippet: The presample master mix (5 μl) contained 1× FastStart HiFi reaction buffer (Roche), 1× AccessArray loading reagent (Fluidigm), 4.5 mM MgCl2 , 5% (vol/vol) DMSO, 0.2 mM each dNTP, 0.05 U FastStart HiFi enzyme blend (Roche), 1× EvaGreen (Biotium), 0.5× 5-carboxyl-X-rhodamine (ROX), and 1 μl template DNA (ca. .. The detection of PCR products was achieved by monitoring the fluorescence intensity of EvaGreen dye.

    SYBR Green Assay:

    Article Title: One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV
    Article Snippet: The results of RT-LAMP and RT-PCR were identified using agarose gel electrophoresis. qRT-PCR was performed and identified by using real-time machine, CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). .. In order to utilize EvaGreen in one-pot RT-LAMP experiment, the sensitivity of EvaGreen® (Biotium Inc., USA) were compared with SYBR® Green I (Thermo Fisher Scientific, Waltham, MA, USA) for each concentration (non-contained, 1, 2, 5, 10, 20, 50, 100, 200, 500 and 1000X). .. Polymer based microchamber devices were purchased from Dongwoo Science Co., Ltd (Republic of Korea).

    Article Title: A high-throughput qPCR system for simultaneous quantitative detection of dairy Lactococcus lactis and Leuconostoc bacteriophages
    Article Snippet: Subsequent to the amplification, a melting curve analysis was performed in order to distinguish putative nonspecific amplifications. .. PCR reactions for comparison of SYBR Green I (Thermo Fisher Scientific) and EvaGreen (Biotium, USA) detection chemistries were prepared as described above using the P220 phage DNA as template. .. Slopes and efficiencies were analyzed by setting the threshold level at 0.1.

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: The SuperScript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Life Technologies, Carlsbad, CA), the qScript™ One-Step SYBR® Green qRT-PCR Kit (Quanta Biosciences, Gaithersburg, MD), the Transcriptor® One-Step RT-PCR Kit (Roche Applied Science, Mannheim, Germany) and Tth DNA polymerase (Epicentre Technologies, Madison, WI) were used according to manufacturer instructions. .. For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: DMSO was obtained from the American Type Culture Collection and used at the concentration indicated. .. SYBR Green I was obtained from Life Technologies and used at 0.625× concentration, and EvaGreen was obtained from Biotium and used at 1× concentration. .. Whole blood preserved in EDTA was obtained from Bioreclamation.

    Article Title: SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR
    Article Snippet: SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA). .. SYTO dyes were obtained from Invitrogen/Molecular Probes (Carlsbad, CA) and EvaGreen was obtained from Biotium (Hayward, CA).

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: SYBR Green QPCR mix (Bio-Rad) was used for qRT-PCR. .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    Negative Control:

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: In place of 2 μL of DNA template, the PCR reaction mixture contained 2 μL (8.0 ng/μL) of DNA extracted from Escherichia coli (ATCC 25922) as a positive control, or 2 μL of molecular-grade distilled water (water deionized and sterilized for molecular biology, NACALAI TESQUE, INC.) as a negative control for the PCR step. .. For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Incubation:

    Article Title: Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
    Article Snippet: Negative controls were a blank (i.e., without DNA) and another one with 50 ng of carrier normal human blood DNA. .. Positive control preamplification mixtures were prepared either a) as five "complete" PCR mixtures containing serial logarithmic dilutions of pHV101 to attain 2.5 × 106 -2.5 × 102 pHV101 copies/mixture (Fig. ), or b) as a single "minimum" PCR mixture containing 2.5 × 106 pHV101 copies (Fig. ); 1/50 volumes from both types of mixtures were added to prepare nested qPCR amplification mixtures. qPCR mixtures optimized to amplify E6-2 with the pU1M/pU2R primer pair in the presence of EvaGreen (Biotium, Hayward, CA) were incubated with the same thermocycler program. .. To control nested amplification and to determine the number of E6 copies in problem samples, additional mixtures containing 1/50 volume of preamplified positive, negative and problem mixtures were prepared; in these experiments an additional negative control mixture was used which contained preamplified SiHa DNA and the forward (pU1M) but not the reverse (pU1R) primer (Fig. ).

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution. .. During the first PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Aldrich, USA) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore, Germany), 50 mM KCl, 2.25 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.3 μM of each primer, 1 × EvaGreen (Biotium Inc. CA, USA), and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Article Title: Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection
    Article Snippet: Each sample was incubated for five minutes at 95 °C to activate the Hot Start dNTPs, then was denatured for 10 seconds at 94 °C, annealed for 10 seconds at 57 °C, extended for 30 seconds at 72 °C and subjected to fluorescence acquisition for 2 seconds at 82 °C for 40 cycles. .. For the second (nested) PCR procedure, the PCR reaction mixture (20 μL) contained 2 μL of DNA template of the diluted first PCR product in 200 μM of each dNTP (CleanAmpTM Hot Start dNTP Mix, SIGMA-ALDORICH) filtered using an Amicon Ultra 50 K centrifugal filter (Merck Millipore), 50 mM KCl, 2.5 mM MgCl2 , 10 mM Tris-HCl (pH 8.3), 0.25 μM of each primer, 1 × EvaGreen (Biotium, Inc.) and 1.0 units (0.5 μL) of eukaryote-made thermostable DNA polymerase supplemented with stock buffer solution.

    Produced:

    Article Title: Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics
    Article Snippet: Prior to reagent introduction into the device, an MDA mixture (REPLI-g Single Cell Kit, QIAGEN) was prepared containing 1.5 μL of stop buffer, 1.5 μL of H2 O, 14.5 μL of reaction buffer, 1.0 μL of enzyme mix, 2.5 μL of 10% Tween-20 (1% v/v concentration), and 0.5 μL of 20x Evagreen (Biotium, Fremont, CA, USA), for use in a 21.5-μL reaction volume. .. For cell lysate droplet prepared above, the surrounding carrier oil was replaced by FC-40 containing 2.0% (v/v) Pico-Surf1 (Dolomite).

    Concentration Assay:

    Article Title: One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV
    Article Snippet: The results of RT-LAMP and RT-PCR were identified using agarose gel electrophoresis. qRT-PCR was performed and identified by using real-time machine, CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). .. In order to utilize EvaGreen in one-pot RT-LAMP experiment, the sensitivity of EvaGreen® (Biotium Inc., USA) were compared with SYBR® Green I (Thermo Fisher Scientific, Waltham, MA, USA) for each concentration (non-contained, 1, 2, 5, 10, 20, 50, 100, 200, 500 and 1000X). .. Polymer based microchamber devices were purchased from Dongwoo Science Co., Ltd (Republic of Korea).

    Article Title: Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics
    Article Snippet: The cells encapsulated into individual droplets were then incubated at 65 °C in PCR tubes for 10 min. .. Prior to reagent introduction into the device, an MDA mixture (REPLI-g Single Cell Kit, QIAGEN) was prepared containing 1.5 μL of stop buffer, 1.5 μL of H2 O, 14.5 μL of reaction buffer, 1.0 μL of enzyme mix, 2.5 μL of 10% Tween-20 (1% v/v concentration), and 0.5 μL of 20x Evagreen (Biotium, Fremont, CA, USA), for use in a 21.5-μL reaction volume. .. The MDA mixture was mixed gently, but completely, by vortexing and loaded into the microfluidic device.

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: For lambda DNA samples, 0.9 μL of nuclease-free water was added to 1 μL of each denatured DNA solution. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA). .. The MDA mixture was mixed gently but completely by vortexing and loaded into the microfluidic device.

    Article Title: Thermostable DNA Polymerase from a Viral Metagenome Is a Potent RT-PCR Enzyme
    Article Snippet: The PyroScript® RT-PCR 2X Master Mix (Lucigen) containing 2.5 units of 3173 Pol, was used in reactions at 1X concentration with primers at 200 µM each. .. For the Roche and the Lucigen reagents, a fluorescent DNA-binding dye, EvaGreen (Biotium, Hayward, CA), was added at 0.5×.

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: DMSO was obtained from the American Type Culture Collection and used at the concentration indicated. .. SYBR Green I was obtained from Life Technologies and used at 0.625× concentration, and EvaGreen was obtained from Biotium and used at 1× concentration. .. Whole blood preserved in EDTA was obtained from Bioreclamation.

    Marker:

    Article Title: Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice
    Article Snippet: The insertion/deletion marker 3-N1/3-N2 (Supplementary Table ) was used to differentiate Sc-j from Sc-ia /Sc-ib1/Sc-ib2 , and the SNP marker HRM1F/HRM1R to differentiate Sc-ia from Sc-ib1/Sc-ib2 (Supplementary Fig. ). .. SNP genotype was detected by high-resolution melting analysis (LightScanner, USA) using EvaGreen (Biotium, USA) as a fluorescent dye .

    FACS:

    Article Title: Monodisperse Picoliter Droplets for Low-Bias and Contamination-Free Reactions in Single-Cell Whole Genome Amplification
    Article Snippet: For quantification and sequence analysis of a single-cell genome, E .coli K12 cells were sorted by FACS into individual reaction tubes containing 1.9 μL of nuclease-free water. .. For monitoring of MDA, 0.5 μL of nuclease-free water was replaced with an equivalent amount of Evagreen (0.5× concentration, Biotium Inc., Hayward, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    Biotium evagreen stain
    Visualization of LAMP reaction results. A) After electrophoresis in a 1% agarose gel; B) using <t>EvaGreen</t> stain (Biotium). T.p.— T . palmi , F.o.— F . occidentalis , F.i.— F . intonsa , F.p.— F . pallida , F.t.— F . tenuicornis , T.m.— T . major , T.men.— T . menyanthidis , T.n.— T . nigropilosus , T.o.— T . origani , T.ph.— T . physapus , T.r.— T . roepkei , T.si.— T . simplex , T.sm.— T . sambuci , T.t.— T . tabaci , T.tr.— T . trehernei , NTC—no template control.
    Evagreen Stain, supplied by Biotium, used in various techniques. Bioz Stars score: 80/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/evagreen stain/product/Biotium
    Average 80 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    evagreen stain - by Bioz Stars, 2019-12
    80/100 stars
      Buy from Supplier

    Image Search Results


    Visualization of LAMP reaction results. A) After electrophoresis in a 1% agarose gel; B) using EvaGreen stain (Biotium). T.p.— T . palmi , F.o.— F . occidentalis , F.i.— F . intonsa , F.p.— F . pallida , F.t.— F . tenuicornis , T.m.— T . major , T.men.— T . menyanthidis , T.n.— T . nigropilosus , T.o.— T . origani , T.ph.— T . physapus , T.r.— T . roepkei , T.si.— T . simplex , T.sm.— T . sambuci , T.t.— T . tabaci , T.tr.— T . trehernei , NTC—no template control.

    Journal: PLoS ONE

    Article Title: Detection of the Quarantine Species Thrips palmi by Loop-Mediated Isothermal Amplification

    doi: 10.1371/journal.pone.0122033

    Figure Lengend Snippet: Visualization of LAMP reaction results. A) After electrophoresis in a 1% agarose gel; B) using EvaGreen stain (Biotium). T.p.— T . palmi , F.o.— F . occidentalis , F.i.— F . intonsa , F.p.— F . pallida , F.t.— F . tenuicornis , T.m.— T . major , T.men.— T . menyanthidis , T.n.— T . nigropilosus , T.o.— T . origani , T.ph.— T . physapus , T.r.— T . roepkei , T.si.— T . simplex , T.sm.— T . sambuci , T.t.— T . tabaci , T.tr.— T . trehernei , NTC—no template control.

    Article Snippet: The sensitivity test showed that the reaction performed using the real-time PCR platform could detect 2 x 10-4 of adult specimen ( ) and 2 x 10-3 of larvae specimen , whereas the reaction performed in the heating block and visualized using EvaGreen stain (Biotium) could detect 2 x 10-10 of adult specimen ( ) and 2 x 10-8 of larvae specimen ( ).

    Techniques: Electrophoresis, Agarose Gel Electrophoresis, Staining

    Visualization of LAMP reaction results with different dilutions of DNA template. A) After electrophoresis in a 1% agarose gel; B) using EvaGreen stain (Biotium). a) DNA extracted from one larva; b) DNA extracted from one adult specimen. NTC—no template control.

    Journal: PLoS ONE

    Article Title: Detection of the Quarantine Species Thrips palmi by Loop-Mediated Isothermal Amplification

    doi: 10.1371/journal.pone.0122033

    Figure Lengend Snippet: Visualization of LAMP reaction results with different dilutions of DNA template. A) After electrophoresis in a 1% agarose gel; B) using EvaGreen stain (Biotium). a) DNA extracted from one larva; b) DNA extracted from one adult specimen. NTC—no template control.

    Article Snippet: The sensitivity test showed that the reaction performed using the real-time PCR platform could detect 2 x 10-4 of adult specimen ( ) and 2 x 10-3 of larvae specimen , whereas the reaction performed in the heating block and visualized using EvaGreen stain (Biotium) could detect 2 x 10-10 of adult specimen ( ) and 2 x 10-8 of larvae specimen ( ).

    Techniques: Electrophoresis, Agarose Gel Electrophoresis, Staining

    Visualization of LAMP reaction results without DNA extraction. A) After electrophoresis in a 1% agarose gel; B) using EvaGreen stain (Biotium). T.p.— T . palmi , T.t.— T . tabaci . NTC—no template control.

    Journal: PLoS ONE

    Article Title: Detection of the Quarantine Species Thrips palmi by Loop-Mediated Isothermal Amplification

    doi: 10.1371/journal.pone.0122033

    Figure Lengend Snippet: Visualization of LAMP reaction results without DNA extraction. A) After electrophoresis in a 1% agarose gel; B) using EvaGreen stain (Biotium). T.p.— T . palmi , T.t.— T . tabaci . NTC—no template control.

    Article Snippet: The sensitivity test showed that the reaction performed using the real-time PCR platform could detect 2 x 10-4 of adult specimen ( ) and 2 x 10-3 of larvae specimen , whereas the reaction performed in the heating block and visualized using EvaGreen stain (Biotium) could detect 2 x 10-10 of adult specimen ( ) and 2 x 10-8 of larvae specimen ( ).

    Techniques: DNA Extraction, Electrophoresis, Agarose Gel Electrophoresis, Staining

    EvaGreen activity for RT-LAMP. Resultant microchamber devices following the loop-mediated isothermal amplification (LAMP) reaction with EvaGreen (5 and 10X) under UV (On). DNA ladder-like LAMP amplification pattern was confirmed by 2% agarose gel electrophoresis. T: template; P: LAMP-primers. The fluorescence backgrounds were shown as red-squares.

    Journal: Frontiers in Microbiology

    Article Title: One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV

    doi: 10.3389/fmicb.2016.02166

    Figure Lengend Snippet: EvaGreen activity for RT-LAMP. Resultant microchamber devices following the loop-mediated isothermal amplification (LAMP) reaction with EvaGreen (5 and 10X) under UV (On). DNA ladder-like LAMP amplification pattern was confirmed by 2% agarose gel electrophoresis. T: template; P: LAMP-primers. The fluorescence backgrounds were shown as red-squares.

    Article Snippet: In order to utilize EvaGreen in one-pot RT-LAMP experiment, the sensitivity of EvaGreen® (Biotium Inc., USA) were compared with SYBR® Green I (Thermo Fisher Scientific, Waltham, MA, USA) for each concentration (non-contained, 1, 2, 5, 10, 20, 50, 100, 200, 500 and 1000X).

    Techniques: Activity Assay, Amplification, Agarose Gel Electrophoresis, Fluorescence

    Sensitivity of one-pot RT-LAMP. (A) 10X EvaGreen was initially mixed with RT-LAMP reagents, and the reaction was performed and visualized in microchamber. The purified MERS-CoV RNA was serially diluted in the range 4 × 10 3 –4 × 10 -1 /μL. Relative fluorescent signals were analyzed by using ImageJ software. The relative intensity of fluorescence for positive amplification was normalized to the controls (-Template/-Primer). Red square indicates background fluorescence. (B) Agarose gel electrophoresis confirmation indicated that one-pot RT-LAMP can detect MERS-CoV as few as 0.4 RNA copies. DNA ladder-like pattern was confirmed by 2% agarose gel electrophoresis. T, template; P, primer.

    Journal: Frontiers in Microbiology

    Article Title: One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV

    doi: 10.3389/fmicb.2016.02166

    Figure Lengend Snippet: Sensitivity of one-pot RT-LAMP. (A) 10X EvaGreen was initially mixed with RT-LAMP reagents, and the reaction was performed and visualized in microchamber. The purified MERS-CoV RNA was serially diluted in the range 4 × 10 3 –4 × 10 -1 /μL. Relative fluorescent signals were analyzed by using ImageJ software. The relative intensity of fluorescence for positive amplification was normalized to the controls (-Template/-Primer). Red square indicates background fluorescence. (B) Agarose gel electrophoresis confirmation indicated that one-pot RT-LAMP can detect MERS-CoV as few as 0.4 RNA copies. DNA ladder-like pattern was confirmed by 2% agarose gel electrophoresis. T, template; P, primer.

    Article Snippet: In order to utilize EvaGreen in one-pot RT-LAMP experiment, the sensitivity of EvaGreen® (Biotium Inc., USA) were compared with SYBR® Green I (Thermo Fisher Scientific, Waltham, MA, USA) for each concentration (non-contained, 1, 2, 5, 10, 20, 50, 100, 200, 500 and 1000X).

    Techniques: Purification, Software, Fluorescence, Amplification, Agarose Gel Electrophoresis

    Specificity of one-pot RT-LAMP for MERS-CoV. RNA samples of MERS-CoV and the other respiratory pathogens were used for specificity evaluation of one-pot RT-LAMP system for MERS-CoV detection; fluorescence was visualized by 10X EvaGreen in microchamber. Each set of lane indicates a specific virus: lane 1, MERS-CoV Korean isolate; lane 2, Human coronavirus (HCoV)-229E; lane 3, Human metapneumovirus (HMPV); lane 4, B/Brisbane/60/2008 (Victoria lineage); lane 5, B/Phuket/3073/2013 (Yamagata lineage); lane 6, Influenza A virus (A/California/04/2009, H1N1); lane 7, influenza A virus (A/Perth/16/2009, H3N2). M, 100 bp DNA ladder.

    Journal: Frontiers in Microbiology

    Article Title: One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV

    doi: 10.3389/fmicb.2016.02166

    Figure Lengend Snippet: Specificity of one-pot RT-LAMP for MERS-CoV. RNA samples of MERS-CoV and the other respiratory pathogens were used for specificity evaluation of one-pot RT-LAMP system for MERS-CoV detection; fluorescence was visualized by 10X EvaGreen in microchamber. Each set of lane indicates a specific virus: lane 1, MERS-CoV Korean isolate; lane 2, Human coronavirus (HCoV)-229E; lane 3, Human metapneumovirus (HMPV); lane 4, B/Brisbane/60/2008 (Victoria lineage); lane 5, B/Phuket/3073/2013 (Yamagata lineage); lane 6, Influenza A virus (A/California/04/2009, H1N1); lane 7, influenza A virus (A/Perth/16/2009, H3N2). M, 100 bp DNA ladder.

    Article Snippet: In order to utilize EvaGreen in one-pot RT-LAMP experiment, the sensitivity of EvaGreen® (Biotium Inc., USA) were compared with SYBR® Green I (Thermo Fisher Scientific, Waltham, MA, USA) for each concentration (non-contained, 1, 2, 5, 10, 20, 50, 100, 200, 500 and 1000X).

    Techniques: Fluorescence

    EvaGreen real-time polymerase chain reaction results with different amounts of whole blood in the reactions. Two different assays were applied, targeting either a the invA gene of Salmonella enterica serovar Typhimurium DNA with 0.052 ng DNA added or b the RB1 gene of human DNA with 2 ng DNA added

    Journal: Analytical and Bioanalytical Chemistry

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR

    doi: 10.1007/s00216-018-0931-z

    Figure Lengend Snippet: EvaGreen real-time polymerase chain reaction results with different amounts of whole blood in the reactions. Two different assays were applied, targeting either a the invA gene of Salmonella enterica serovar Typhimurium DNA with 0.052 ng DNA added or b the RB1 gene of human DNA with 2 ng DNA added

    Article Snippet: Unless otherwise stated, the following reagents were included in all master mixes for the invA assay: 1× ExTaq buffer, 0.2 mM dNTP, 2.0 mM MgCl2 in total, each primer at 0.3 μM (InvA forward primer, InvA reverse primer [ ]), 0.2 μM hydrolysis probe (InvA-minor groove binder [ ]) or 1× EvaGreen (Biotium, Hayward, CA, USA), 1 U ExTaq HS DNA polymerase, and 4 μL DNA (0.013 ng/μL).

    Techniques: Real-time Polymerase Chain Reaction

    EvaGreen real-time polymerase chain reaction results with different amounts of immunoglobulin G (IgG). The assay targeting the invA gene of Salmonella enterica serovar Typhimurium was applied, and 52 pg DNA was added to the reactions. a Real-time polymerase chain reaction amplification curves with increasing amounts of IgG and b the generated Cq values, with error bars representing the standard deviation, n = 3. Cq quantification cycle

    Journal: Analytical and Bioanalytical Chemistry

    Article Title: Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR

    doi: 10.1007/s00216-018-0931-z

    Figure Lengend Snippet: EvaGreen real-time polymerase chain reaction results with different amounts of immunoglobulin G (IgG). The assay targeting the invA gene of Salmonella enterica serovar Typhimurium was applied, and 52 pg DNA was added to the reactions. a Real-time polymerase chain reaction amplification curves with increasing amounts of IgG and b the generated Cq values, with error bars representing the standard deviation, n = 3. Cq quantification cycle

    Article Snippet: Unless otherwise stated, the following reagents were included in all master mixes for the invA assay: 1× ExTaq buffer, 0.2 mM dNTP, 2.0 mM MgCl2 in total, each primer at 0.3 μM (InvA forward primer, InvA reverse primer [ ]), 0.2 μM hydrolysis probe (InvA-minor groove binder [ ]) or 1× EvaGreen (Biotium, Hayward, CA, USA), 1 U ExTaq HS DNA polymerase, and 4 μL DNA (0.013 ng/μL).

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Generated, Standard Deviation