etoposide  (Tocris)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Etoposide
    Description:
    Topoisomerase II inhibitor
    Catalog Number:
    1226
    Price:
    None
    Purity:
    ≥99% (HPLC)
    Category:
    DNA Topoisomerase Inhibitors DNA Topoisomerases Isomerases Enzymes Pharmacology
    Formula:
    [5R-[5α,5aβ,8aα,9β(R*)]]-9-[(4,6-Ο-Ethylidene-β-D-glucopyranosyl)oxy]-5,8,8a,9-tetrahydro-5-(4-hydroxy-3,5-dimethoxyphenyl)furo[3',4'
    Buy from Supplier


    Structured Review

    Tocris etoposide
    Etoposide
    Topoisomerase II inhibitor
    https://www.bioz.com/result/etoposide/product/Tocris
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-09
    93/100 stars

    Images

    1) Product Images from "Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression"

    Article Title: Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression

    Journal: Nutrients

    doi: 10.3390/nu9101051

    BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and Etoposide 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.
    Figure Legend Snippet: BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and Etoposide 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.

    Techniques Used: High Content Screening, Western Blot, Positive Control, Activation Assay, Expressing

    2) Product Images from "Molecular chaperones in the acquisition of cancer cell chemoresistance with mutated TP53 and MDM2 up-regulation"

    Article Title: Molecular chaperones in the acquisition of cancer cell chemoresistance with mutated TP53 and MDM2 up-regulation

    Journal: Oncotarget

    doi: 10.18632/oncotarget.18899

    p53 R175H and MDM2 proteins synergistically reduce chemosensitivity of lung and breast cancer cells ( A ) H1299-R175H-MDM2 cell line was treated with Ponasterone A (Pon A) and/or Doxycycline (Dox) for 24 h to induce p53 R175H and/or MDM2, respectively. Immunoblotting with specific antibody revealed tight and efficient expression of both proteins. ( B ) Induced and uninduced cells were grown in triplicate in chambers compatible with the xCELLigence RTCA DP Instrument and Cisplatin (40 μM) was added at the indicated time point. Proliferative index was monitored for 120 h. Mean and standard deviation of three repeats are shown. ( C ) After 48 h treatment with 60 μM Cisplatin (left panel) or Etoposide (right panel), the apoptotic response of induced or uninduced cells stained with Annexin V/Gel Green dye was measured with a flow cytometer. p53 R175H or MDM2 expressed alone reduced apoptosis to same extent, whereas significant decrease was observed after simultaneous induction of both proteins. Bars represent the relative decrease (%) of cells in early apoptosis (Annexin V positive, Gel Green dye negative), estimated as follows = ( Value − Baseline ) Baseline × 100 (Baseline–Apoptotic response of uninduced H1299-R175H-MDM2 cell line). Statistical significance ( P value) was counted for three independent experiments with Anova statistical test. *, **, ***, **** indicate statistical significance p
    Figure Legend Snippet: p53 R175H and MDM2 proteins synergistically reduce chemosensitivity of lung and breast cancer cells ( A ) H1299-R175H-MDM2 cell line was treated with Ponasterone A (Pon A) and/or Doxycycline (Dox) for 24 h to induce p53 R175H and/or MDM2, respectively. Immunoblotting with specific antibody revealed tight and efficient expression of both proteins. ( B ) Induced and uninduced cells were grown in triplicate in chambers compatible with the xCELLigence RTCA DP Instrument and Cisplatin (40 μM) was added at the indicated time point. Proliferative index was monitored for 120 h. Mean and standard deviation of three repeats are shown. ( C ) After 48 h treatment with 60 μM Cisplatin (left panel) or Etoposide (right panel), the apoptotic response of induced or uninduced cells stained with Annexin V/Gel Green dye was measured with a flow cytometer. p53 R175H or MDM2 expressed alone reduced apoptosis to same extent, whereas significant decrease was observed after simultaneous induction of both proteins. Bars represent the relative decrease (%) of cells in early apoptosis (Annexin V positive, Gel Green dye negative), estimated as follows = ( Value − Baseline ) Baseline × 100 (Baseline–Apoptotic response of uninduced H1299-R175H-MDM2 cell line). Statistical significance ( P value) was counted for three independent experiments with Anova statistical test. *, **, ***, **** indicate statistical significance p

    Techniques Used: Expressing, Standard Deviation, Staining, Flow Cytometry, Cytometry

    3) Product Images from "Novel peptide dermaseptin‐ PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling, et al. Novel peptide dermaseptin‐PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling"

    Article Title: Novel peptide dermaseptin‐ PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling, et al. Novel peptide dermaseptin‐PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling

    Journal: Journal of Cellular and Molecular Medicine

    doi: 10.1111/jcmm.14032

    Dermaseptin‐PS1 induced U‐251 MG cell death through intrinsic apoptosis signalling. A, Protein expression of caspase 9/cleaved caspase 9, Apaf‐1, Bcl‐2, Bax, Bak, p‐Bad, Bad, p‐p53 and p53 were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. *or # P
    Figure Legend Snippet: Dermaseptin‐PS1 induced U‐251 MG cell death through intrinsic apoptosis signalling. A, Protein expression of caspase 9/cleaved caspase 9, Apaf‐1, Bcl‐2, Bax, Bak, p‐Bad, Bad, p‐p53 and p53 were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. *or # P

    Techniques Used: Expressing, Western Blot, Software, Negative Control

    Dermaseptin‐PS1 induced U‐251 MG cell death at 10 −6 M via apoptosis. Western blot analysis was performed on U‐251 MG cells to test the expression of cleaved caspase 3 and caspase 3 after the treatment of (A) NC, 20 μmol/L, 15 μmol/L and 10 μmol/L etoposide and 10 −4 to 10 −8 M Dermaseptin‐PS1 for 24 h; (B) 10 −6 M Dermaseptin‐PS1 and 20 μmol/L etoposide for indicated times; (C) 20 μmol/L Z‐VAD‐FMK for 2 h subsequent to 20 μmol/L etoposide and 10 −6 M Dermaseptin‐PS1 treatment for 16 h. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. * P
    Figure Legend Snippet: Dermaseptin‐PS1 induced U‐251 MG cell death at 10 −6 M via apoptosis. Western blot analysis was performed on U‐251 MG cells to test the expression of cleaved caspase 3 and caspase 3 after the treatment of (A) NC, 20 μmol/L, 15 μmol/L and 10 μmol/L etoposide and 10 −4 to 10 −8 M Dermaseptin‐PS1 for 24 h; (B) 10 −6 M Dermaseptin‐PS1 and 20 μmol/L etoposide for indicated times; (C) 20 μmol/L Z‐VAD‐FMK for 2 h subsequent to 20 μmol/L etoposide and 10 −6 M Dermaseptin‐PS1 treatment for 16 h. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. * P

    Techniques Used: Western Blot, Expressing, Software, Negative Control

    The examinations of extrinsic apoptotic cascade mediated by Dermaseptin‐PS1 in U‐251 MG cells. Protein expression of caspase 8/cleaved caspase 8 and FADD were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control
    Figure Legend Snippet: The examinations of extrinsic apoptotic cascade mediated by Dermaseptin‐PS1 in U‐251 MG cells. Protein expression of caspase 8/cleaved caspase 8 and FADD were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control

    Techniques Used: Expressing, Western Blot

    4) Product Images from "Predicting effective pro-apoptotic anti-leukaemic drug combinations using co-operative dynamic BH3 profiling"

    Article Title: Predicting effective pro-apoptotic anti-leukaemic drug combinations using co-operative dynamic BH3 profiling

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0190682

    Co-operative induction of apoptosis by ABT-199 with etoposide and AC220. Cells were incubated with 10 nM ABT-199 (199, turquoise), 10 nM pladienolide B (PLB, red), 1 μM torin1 (green), 1 μM etoposide (orange) and 10 nM AC220 (mauve) or the indicated combinations (bright blue bar, height = effect with both agents in combination–sum of effects with agents individually). (A) After 4 hours cells were fixed and processed for Cytochrome C release. (B) ). Asterisks indicate observed values significantly higher than expected values (P
    Figure Legend Snippet: Co-operative induction of apoptosis by ABT-199 with etoposide and AC220. Cells were incubated with 10 nM ABT-199 (199, turquoise), 10 nM pladienolide B (PLB, red), 1 μM torin1 (green), 1 μM etoposide (orange) and 10 nM AC220 (mauve) or the indicated combinations (bright blue bar, height = effect with both agents in combination–sum of effects with agents individually). (A) After 4 hours cells were fixed and processed for Cytochrome C release. (B) ). Asterisks indicate observed values significantly higher than expected values (P

    Techniques Used: Incubation

    Co-operative induction of apoptosis using A-1210477. A. Cells were co-incubated with 1 μM A-1210477 (477) and with 10 nM ABT-199 (199), 10nM pladienolide B (PLB), 1 μM torin1, 1 μM etoposide or 10 nM AC220 for 4 hours. Alternatively, cells were incubated with JQ1 for 48 hours and A-1210477 was added for the final four hours of the incubation. Cells were then fixed and processed for Cytochrome C release. (Mean+/- SD for n = 3). B. Cells were incubated with 1 μM A-1210477 for four hours and 10 nM ABT-199 was added either before, after or concurrently (final 2 hours). In the two-step conditions, cells were pelleted and rinsed twice in RPMI at 4°C in between agents. R10 = medium without drug.
    Figure Legend Snippet: Co-operative induction of apoptosis using A-1210477. A. Cells were co-incubated with 1 μM A-1210477 (477) and with 10 nM ABT-199 (199), 10nM pladienolide B (PLB), 1 μM torin1, 1 μM etoposide or 10 nM AC220 for 4 hours. Alternatively, cells were incubated with JQ1 for 48 hours and A-1210477 was added for the final four hours of the incubation. Cells were then fixed and processed for Cytochrome C release. (Mean+/- SD for n = 3). B. Cells were incubated with 1 μM A-1210477 for four hours and 10 nM ABT-199 was added either before, after or concurrently (final 2 hours). In the two-step conditions, cells were pelleted and rinsed twice in RPMI at 4°C in between agents. R10 = medium without drug.

    Techniques Used: Incubation

    Co-operative induction of apoptosis by pladienolide, torin1, etoposide or AC220 with JQ1. (A ) Time course of bcl-2 protein downregulation in response to JQ1 measured by flow cytometry. MFI = mean fluorescence intensity, corrected for isotype control. ( B) Time course of delta priming to BAD-BH3 and MS1-BH3 measured by cytochrome C release after drug treatment and additional incubation with the indicated BH3 peptides. Values are corrected for Cytochrome C release with peptide only as described in the methods. (C) ). Asterisks indicate observed values significantly higher than expected values (P
    Figure Legend Snippet: Co-operative induction of apoptosis by pladienolide, torin1, etoposide or AC220 with JQ1. (A ) Time course of bcl-2 protein downregulation in response to JQ1 measured by flow cytometry. MFI = mean fluorescence intensity, corrected for isotype control. ( B) Time course of delta priming to BAD-BH3 and MS1-BH3 measured by cytochrome C release after drug treatment and additional incubation with the indicated BH3 peptides. Values are corrected for Cytochrome C release with peptide only as described in the methods. (C) ). Asterisks indicate observed values significantly higher than expected values (P

    Techniques Used: Flow Cytometry, Cytometry, Fluorescence, Incubation

    5) Product Images from "Selective activation of TNFR1 and NF-κB inhibition by a novel biyouyanagin analogue promotes apoptosis in acute leukemia cells"

    Article Title: Selective activation of TNFR1 and NF-κB inhibition by a novel biyouyanagin analogue promotes apoptosis in acute leukemia cells

    Journal: BMC Cancer

    doi: 10.1186/s12885-016-2310-5

    Effects of KC-53 on Caspases and regulatory molecules of the apoptotic pathways in leukemia cells. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. TNFRs membrane expression levels were analyzed by immunoblotting. EGFR was used as a loading control and the TNFRs levels were quantified and normalized in comparison to the EGFR levels. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. ( ii ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk. Caspase-8 enzymatic activity was determined as described in Methods. Etoposide (Eto) added at 5 μΜ was used as a positive control. c ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points followed by immunoblotting. ( ii ) Cells were incubated with 0 or 5 μΜ KC-53 for 6 h and cytosolic and nuclear protein extracts were prepared. The numbers on top of each band represent intensity values and are expressed as fold change in comparison to the control. The results in panels a , b ( i ) and c are representative of three repetitions. The results in b ( ii ) panels represent the mean ± SEM of two replicates and are representative of three independent experiments. (*** p value
    Figure Legend Snippet: Effects of KC-53 on Caspases and regulatory molecules of the apoptotic pathways in leukemia cells. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. TNFRs membrane expression levels were analyzed by immunoblotting. EGFR was used as a loading control and the TNFRs levels were quantified and normalized in comparison to the EGFR levels. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. ( ii ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk. Caspase-8 enzymatic activity was determined as described in Methods. Etoposide (Eto) added at 5 μΜ was used as a positive control. c ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points followed by immunoblotting. ( ii ) Cells were incubated with 0 or 5 μΜ KC-53 for 6 h and cytosolic and nuclear protein extracts were prepared. The numbers on top of each band represent intensity values and are expressed as fold change in comparison to the control. The results in panels a , b ( i ) and c are representative of three repetitions. The results in b ( ii ) panels represent the mean ± SEM of two replicates and are representative of three independent experiments. (*** p value

    Techniques Used: Expressing, Activity Assay, Positive Control, Incubation

    Effects of KC-53 on cell apoptosis and DNA integrity. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points and apoptosis was assessed with Annexin-V/PI staining. Statistical significance was determined by comparing treated samples with the corresponding population of the vehicle control. For comparison, Doxorubicin (Dox) at 0.5 μΜ was used as positive control. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk for 24 h. The presence of nucleosomes in the cytoplasm was determined with the ELISA cell death detection kit and is expressed as Enrichment Factor. Etoposide (Eto) at 5 μΜ was used as positive control. ( ii ) Cells were treated with vehicle control or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk, as shown, for 24 h. Cell viability was assessed with the MTT assay. The results represent the mean ± SEM of two replicates and are representative of three independent experiments. (* p value
    Figure Legend Snippet: Effects of KC-53 on cell apoptosis and DNA integrity. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points and apoptosis was assessed with Annexin-V/PI staining. Statistical significance was determined by comparing treated samples with the corresponding population of the vehicle control. For comparison, Doxorubicin (Dox) at 0.5 μΜ was used as positive control. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk for 24 h. The presence of nucleosomes in the cytoplasm was determined with the ELISA cell death detection kit and is expressed as Enrichment Factor. Etoposide (Eto) at 5 μΜ was used as positive control. ( ii ) Cells were treated with vehicle control or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk, as shown, for 24 h. Cell viability was assessed with the MTT assay. The results represent the mean ± SEM of two replicates and are representative of three independent experiments. (* p value

    Techniques Used: Staining, Positive Control, Enzyme-linked Immunosorbent Assay, MTT Assay

    6) Product Images from "Early changes in rpS6 phosphorylation and BH3 profiling predict response to chemotherapy in AML cells"

    Article Title: Early changes in rpS6 phosphorylation and BH3 profiling predict response to chemotherapy in AML cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0196805

    RpS6 dephosphorylation at 4 hours predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 100 nM Rapamycin, 1 μM torin1 and 3 μM U0126 to determine p-rpS6 baseline. RpS6 dephosphorylation after 4 hours culture with 500 nM 17-AAG is also shown. Example histograms are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG and 2 μM cytarabine. Values are a percent of untreated cell p-rpS6 as described in the methods. Each point represents a cell line and is the product of three individual experiments.
    Figure Legend Snippet: RpS6 dephosphorylation at 4 hours predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 100 nM Rapamycin, 1 μM torin1 and 3 μM U0126 to determine p-rpS6 baseline. RpS6 dephosphorylation after 4 hours culture with 500 nM 17-AAG is also shown. Example histograms are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG and 2 μM cytarabine. Values are a percent of untreated cell p-rpS6 as described in the methods. Each point represents a cell line and is the product of three individual experiments.

    Techniques Used: De-Phosphorylation Assay, Cell Culture

    ROC curve analysis confirms highly significant overall sensitivity and specificity for the ability of both rpS6 dephosphorylation and PUMA-BH3 induced cytochrome C release after 4 hours drug treatment to predict 48 hour sensitivity to drugs. Summary ROC curves for percent change in rpS6 phosphorylation and PUMA induced cytochrome c release after 4 hours treatment with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine in 11 AML cells lines. Cell lines were classified as sensitive or resistant according to 48 hours drug response (The standardised definition of sensitivity is described in the methods section). Each data point used to generate the analysis is the mean of three individual experiments.
    Figure Legend Snippet: ROC curve analysis confirms highly significant overall sensitivity and specificity for the ability of both rpS6 dephosphorylation and PUMA-BH3 induced cytochrome C release after 4 hours drug treatment to predict 48 hour sensitivity to drugs. Summary ROC curves for percent change in rpS6 phosphorylation and PUMA induced cytochrome c release after 4 hours treatment with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine in 11 AML cells lines. Cell lines were classified as sensitive or resistant according to 48 hours drug response (The standardised definition of sensitivity is described in the methods section). Each data point used to generate the analysis is the mean of three individual experiments.

    Techniques Used: De-Phosphorylation Assay

    Changes in expression of apoptotic modulator proteins after four hours drug exposure. (A) MV4-11 cells were treated for four hours with 1 μM etoposide (E), 10 nM AC220 (A) or 1 μM torin1 (T). Each blot represents one of three independent experiments. (B) Blots were subjected to densitometry analysis using Image Studio Lite software (version 5.2). Values shown are percent change in expression normalised to loading control (*p =
    Figure Legend Snippet: Changes in expression of apoptotic modulator proteins after four hours drug exposure. (A) MV4-11 cells were treated for four hours with 1 μM etoposide (E), 10 nM AC220 (A) or 1 μM torin1 (T). Each blot represents one of three independent experiments. (B) Blots were subjected to densitometry analysis using Image Studio Lite software (version 5.2). Values shown are percent change in expression normalised to loading control (*p =

    Techniques Used: Expressing, Software

    PUMA-BH3 peptide-induced cytochrome c release after 4 hours drug treatment predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 1 μM vosaroxin or 50 nM sorafenib followed by 1 hour treatment with PUMA-BH3 peptide or PUMA2A control. Example dot plots are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined as described in the methods. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine followed by 1 hour incubation with PUMA-BH3 peptide. Values are corrected for cytochrome c release with PUMA2A control peptide as described in the methods. Each point represents a cell line and is the product of three individual experiments.
    Figure Legend Snippet: PUMA-BH3 peptide-induced cytochrome c release after 4 hours drug treatment predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 1 μM vosaroxin or 50 nM sorafenib followed by 1 hour treatment with PUMA-BH3 peptide or PUMA2A control. Example dot plots are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined as described in the methods. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine followed by 1 hour incubation with PUMA-BH3 peptide. Values are corrected for cytochrome c release with PUMA2A control peptide as described in the methods. Each point represents a cell line and is the product of three individual experiments.

    Techniques Used: Cell Culture, Incubation

    7) Product Images from "Predicting effective pro-apoptotic anti-leukaemic drug combinations using co-operative dynamic BH3 profiling"

    Article Title: Predicting effective pro-apoptotic anti-leukaemic drug combinations using co-operative dynamic BH3 profiling

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0190682

    Co-operative induction of apoptosis using A-1210477. A. Cells were co-incubated with 1 μM A-1210477 (477) and with 10 nM ABT-199 (199), 10nM pladienolide B (PLB), 1 μM torin1, 1 μM etoposide or 10 nM AC220 for 4 hours. Alternatively, cells were incubated with JQ1 for 48 hours and A-1210477 was added for the final four hours of the incubation. Cells were then fixed and processed for Cytochrome C release. (Mean+/- SD for n = 3). B. Cells were incubated with 1 μM A-1210477 for four hours and 10 nM ABT-199 was added either before, after or concurrently (final 2 hours). In the two-step conditions, cells were pelleted and rinsed twice in RPMI at 4°C in between agents. R10 = medium without drug.
    Figure Legend Snippet: Co-operative induction of apoptosis using A-1210477. A. Cells were co-incubated with 1 μM A-1210477 (477) and with 10 nM ABT-199 (199), 10nM pladienolide B (PLB), 1 μM torin1, 1 μM etoposide or 10 nM AC220 for 4 hours. Alternatively, cells were incubated with JQ1 for 48 hours and A-1210477 was added for the final four hours of the incubation. Cells were then fixed and processed for Cytochrome C release. (Mean+/- SD for n = 3). B. Cells were incubated with 1 μM A-1210477 for four hours and 10 nM ABT-199 was added either before, after or concurrently (final 2 hours). In the two-step conditions, cells were pelleted and rinsed twice in RPMI at 4°C in between agents. R10 = medium without drug.

    Techniques Used: Incubation

    Co-operative induction of apoptosis by ABT-199 with etoposide and AC220. Cells were incubated with 10 nM ABT-199 (199, turquoise), 10 nM pladienolide B (PLB, red), 1 μM torin1 (green), 1 μM etoposide (orange) and 10 nM AC220 (mauve) or the indicated combinations (bright blue bar, height = effect with both agents in combination–sum of effects with agents individually). (A) After 4 hours cells were fixed and processed for Cytochrome C release. (B) After 4 hours DiOC6 was added for a further 75 minutes and 7-amino actinomycin D for the last 30 minutes. (Mean+/- SD for n = 3). Fold excess additivism (FEA) is shown on the figures and was calculated as a ratio of observed to expected values after corrections according to the Bliss algorithm (see methods ). Asterisks indicate observed values significantly higher than expected values (P
    Figure Legend Snippet: Co-operative induction of apoptosis by ABT-199 with etoposide and AC220. Cells were incubated with 10 nM ABT-199 (199, turquoise), 10 nM pladienolide B (PLB, red), 1 μM torin1 (green), 1 μM etoposide (orange) and 10 nM AC220 (mauve) or the indicated combinations (bright blue bar, height = effect with both agents in combination–sum of effects with agents individually). (A) After 4 hours cells were fixed and processed for Cytochrome C release. (B) After 4 hours DiOC6 was added for a further 75 minutes and 7-amino actinomycin D for the last 30 minutes. (Mean+/- SD for n = 3). Fold excess additivism (FEA) is shown on the figures and was calculated as a ratio of observed to expected values after corrections according to the Bliss algorithm (see methods ). Asterisks indicate observed values significantly higher than expected values (P

    Techniques Used: Incubation

    Co-operative induction of apoptosis by pladienolide, torin1, etoposide or AC220 with JQ1. (A ) Time course of bcl-2 protein downregulation in response to JQ1 measured by flow cytometry. MFI = mean fluorescence intensity, corrected for isotype control. ( B) Time course of delta priming to BAD-BH3 and MS1-BH3 measured by cytochrome C release after drug treatment and additional incubation with the indicated BH3 peptides. Values are corrected for Cytochrome C release with peptide only as described in the methods. (C) Cells were incubated with 250 nM JQ1 for 2 days. 10nM pladienolide B (PLB), 1 μM torin1, 10nM ABT-199 (199), 1 μM etoposide (ETO) or 10 nM AC220 were added for the final 4 hours. Cells were then fixed and processed for Cytochrome C release. Bright blue bar height = cytochrome C release with both agents in combination–sum of cytochrome C release with both agents individually). Fold excess additivism is shown on the figures and was calculated as a ratio of observed to expected values after corrections according to the Bliss algorithm (see methods ). Asterisks indicate observed values significantly higher than expected values (P
    Figure Legend Snippet: Co-operative induction of apoptosis by pladienolide, torin1, etoposide or AC220 with JQ1. (A ) Time course of bcl-2 protein downregulation in response to JQ1 measured by flow cytometry. MFI = mean fluorescence intensity, corrected for isotype control. ( B) Time course of delta priming to BAD-BH3 and MS1-BH3 measured by cytochrome C release after drug treatment and additional incubation with the indicated BH3 peptides. Values are corrected for Cytochrome C release with peptide only as described in the methods. (C) Cells were incubated with 250 nM JQ1 for 2 days. 10nM pladienolide B (PLB), 1 μM torin1, 10nM ABT-199 (199), 1 μM etoposide (ETO) or 10 nM AC220 were added for the final 4 hours. Cells were then fixed and processed for Cytochrome C release. Bright blue bar height = cytochrome C release with both agents in combination–sum of cytochrome C release with both agents individually). Fold excess additivism is shown on the figures and was calculated as a ratio of observed to expected values after corrections according to the Bliss algorithm (see methods ). Asterisks indicate observed values significantly higher than expected values (P

    Techniques Used: Flow Cytometry, Cytometry, Fluorescence, Incubation

    8) Product Images from "Etoposide Incorporated into Camel Milk Phospholipids Liposomes Shows Increased Activity against Fibrosarcoma in a Mouse Model"

    Article Title: Etoposide Incorporated into Camel Milk Phospholipids Liposomes Shows Increased Activity against Fibrosarcoma in a Mouse Model

    Journal: BioMed Research International

    doi: 10.1155/2015/743051

    Effects of various formulations of ETP chemotherapy on the survival of tumor-bearing mice. The fibrosarcoma was induced by exposure to benzo(a)pyrene. The treatment of tumor-bearing animals was started at the time point when tumor size reached a volume of approximately 200 mm 3 . Various formulations of etoposide at the dose of 5 mg/kg were administered intraperitoneally to treat tumor-bearing mice twice weekly for three weeks. The first day of treatment was considered day zero. Free ETP versus untreated control ( P = 0.0077); ETP-DPPC-liposomes versus free ETP ( P = 0.2838); and ETP-Cam-liposomes versus free ETP ( P = 0.0303).
    Figure Legend Snippet: Effects of various formulations of ETP chemotherapy on the survival of tumor-bearing mice. The fibrosarcoma was induced by exposure to benzo(a)pyrene. The treatment of tumor-bearing animals was started at the time point when tumor size reached a volume of approximately 200 mm 3 . Various formulations of etoposide at the dose of 5 mg/kg were administered intraperitoneally to treat tumor-bearing mice twice weekly for three weeks. The first day of treatment was considered day zero. Free ETP versus untreated control ( P = 0.0077); ETP-DPPC-liposomes versus free ETP ( P = 0.2838); and ETP-Cam-liposomes versus free ETP ( P = 0.0303).

    Techniques Used: Mouse Assay, Chick Chorioallantoic Membrane Assay

    Effects of various formulations of etoposide on benzo(a)pyrene- (BAP-) induced tumors in a mouse model. Treatment of tumor-bearing animals was started when the tumor size reached a volume of approximately 200 mm 3 . Mice treated with ETP-DPPC-liposomes or ETP-Cam-liposomes showed delayed tumor growth ( P
    Figure Legend Snippet: Effects of various formulations of etoposide on benzo(a)pyrene- (BAP-) induced tumors in a mouse model. Treatment of tumor-bearing animals was started when the tumor size reached a volume of approximately 200 mm 3 . Mice treated with ETP-DPPC-liposomes or ETP-Cam-liposomes showed delayed tumor growth ( P

    Techniques Used: Mouse Assay, Chick Chorioallantoic Membrane Assay

    9) Product Images from "Early changes in rpS6 phosphorylation and BH3 profiling predict response to chemotherapy in AML cells"

    Article Title: Early changes in rpS6 phosphorylation and BH3 profiling predict response to chemotherapy in AML cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0196805

    RpS6 dephosphorylation at 4 hours predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 100 nM Rapamycin, 1 μM torin1 and 3 μM U0126 to determine p-rpS6 baseline. RpS6 dephosphorylation after 4 hours culture with 500 nM 17-AAG is also shown. Example histograms are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG and 2 μM cytarabine. Values are a percent of untreated cell p-rpS6 as described in the methods. Each point represents a cell line and is the product of three individual experiments.
    Figure Legend Snippet: RpS6 dephosphorylation at 4 hours predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 100 nM Rapamycin, 1 μM torin1 and 3 μM U0126 to determine p-rpS6 baseline. RpS6 dephosphorylation after 4 hours culture with 500 nM 17-AAG is also shown. Example histograms are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG and 2 μM cytarabine. Values are a percent of untreated cell p-rpS6 as described in the methods. Each point represents a cell line and is the product of three individual experiments.

    Techniques Used: De-Phosphorylation Assay, Cell Culture

    ROC curve analysis confirms highly significant overall sensitivity and specificity for the ability of both rpS6 dephosphorylation and PUMA-BH3 induced cytochrome C release after 4 hours drug treatment to predict 48 hour sensitivity to drugs. Summary ROC curves for percent change in rpS6 phosphorylation and PUMA induced cytochrome c release after 4 hours treatment with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine in 11 AML cells lines. Cell lines were classified as sensitive or resistant according to 48 hours drug response (The standardised definition of sensitivity is described in the methods section). Each data point used to generate the analysis is the mean of three individual experiments.
    Figure Legend Snippet: ROC curve analysis confirms highly significant overall sensitivity and specificity for the ability of both rpS6 dephosphorylation and PUMA-BH3 induced cytochrome C release after 4 hours drug treatment to predict 48 hour sensitivity to drugs. Summary ROC curves for percent change in rpS6 phosphorylation and PUMA induced cytochrome c release after 4 hours treatment with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine in 11 AML cells lines. Cell lines were classified as sensitive or resistant according to 48 hours drug response (The standardised definition of sensitivity is described in the methods section). Each data point used to generate the analysis is the mean of three individual experiments.

    Techniques Used: De-Phosphorylation Assay

    Changes in expression of apoptotic modulator proteins after four hours drug exposure. (A) MV4-11 cells were treated for four hours with 1 μM etoposide (E), 10 nM AC220 (A) or 1 μM torin1 (T). Each blot represents one of three independent experiments. (B) Blots were subjected to densitometry analysis using Image Studio Lite software (version 5.2). Values shown are percent change in expression normalised to loading control (*p =
    Figure Legend Snippet: Changes in expression of apoptotic modulator proteins after four hours drug exposure. (A) MV4-11 cells were treated for four hours with 1 μM etoposide (E), 10 nM AC220 (A) or 1 μM torin1 (T). Each blot represents one of three independent experiments. (B) Blots were subjected to densitometry analysis using Image Studio Lite software (version 5.2). Values shown are percent change in expression normalised to loading control (*p =

    Techniques Used: Expressing, Software

    PUMA-BH3 peptide-induced cytochrome c release after 4 hours drug treatment predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 1 μM vosaroxin or 50 nM sorafenib followed by 1 hour treatment with PUMA-BH3 peptide or PUMA2A control. Example dot plots are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined as described in the methods. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine followed by 1 hour incubation with PUMA-BH3 peptide. Values are corrected for cytochrome c release with PUMA2A control peptide as described in the methods. Each point represents a cell line and is the product of three individual experiments.
    Figure Legend Snippet: PUMA-BH3 peptide-induced cytochrome c release after 4 hours drug treatment predicts 48 hour drug sensitivity. (A) MOLM-13 cells were cultured for 4 hours with 1 μM vosaroxin or 50 nM sorafenib followed by 1 hour treatment with PUMA-BH3 peptide or PUMA2A control. Example dot plots are representative of 3 individual experiments. (B) Based on the 48 hour IC 50 values a drug sensitive/resistant cut off for cell lines was determined as described in the methods. Cell lines were cultured for 4 hours with 1 μM etoposide, 50nM sorafenib, 600ng/ml GO, 10nM AC220, 1 μM vosaroxin, 500nM 17-AAG or 2 μM cytarabine followed by 1 hour incubation with PUMA-BH3 peptide. Values are corrected for cytochrome c release with PUMA2A control peptide as described in the methods. Each point represents a cell line and is the product of three individual experiments.

    Techniques Used: Cell Culture, Incubation

    10) Product Images from "Inductions of Caspase-, MAPK- and ROS-dependent Apoptosis and Chemotherapeutic Effects Caused by an Ethanol Extract of Scutellaria barbata D. Don in Human Gastric Adenocarcinom Cells"

    Article Title: Inductions of Caspase-, MAPK- and ROS-dependent Apoptosis and Chemotherapeutic Effects Caused by an Ethanol Extract of Scutellaria barbata D. Don in Human Gastric Adenocarcinom Cells

    Journal: Journal of Pharmacopuncture

    doi: 10.3831/KPI.2016.19.014

    ESB increased the chemosensitivity of MKN-45 cells for 24 hours. Cells were co-treated with ESB (40 μg/mL) and a chemotherapeutic agent, such as paclitaxel, 5-fluorouracil, cisplatin, etoposide, doxorubicin, or docetaxel at the indicated concentrations and then subjected to MTT assays. Values are expressed as percentages (%) of control, and columns represent means ± SDs. * P
    Figure Legend Snippet: ESB increased the chemosensitivity of MKN-45 cells for 24 hours. Cells were co-treated with ESB (40 μg/mL) and a chemotherapeutic agent, such as paclitaxel, 5-fluorouracil, cisplatin, etoposide, doxorubicin, or docetaxel at the indicated concentrations and then subjected to MTT assays. Values are expressed as percentages (%) of control, and columns represent means ± SDs. * P

    Techniques Used: MTT Assay

    Related Articles

    Concentration Assay:

    Article Title: Cell type–dependent bimodal p53 activation engenders a dynamic mechanism of chemoresistance
    Article Snippet: .. Chemicals and reagents Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549. .. This oligo was a gift from M. Huen [School of Biomedical Sciences, University of Hong Kong ( )], and siATM-2 (used at 60 nM in U-2 OS; #sc-29761, Santa Cruz Biotechnology).

    Negative Control:

    Article Title: Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression
    Article Snippet: .. A caspase-3/7 inhibitor and Etoposide (Tocris Bioscience, Bristol, UK), a caspase activator, were used as a positive control for caspase 3 activation and a negative control, respectively. .. Another negative control (media without caspase-3/7 reagent) was set up to make sure cell culture medium did not generate a fluorescence signal.

    other:

    Article Title: Predicting effective pro-apoptotic anti-leukaemic drug combinations using co-operative dynamic BH3 profiling
    Article Snippet: Materials Drugs and suppliers used in the study were as follows: 17-AAG, rapamycin, sorafenib and torin1 from LC labs ( www.lclabs.com ); AC220, JQ1, selinexor, tosedostat, TW-37 and vosaroxin from Selleck (supplied by Stratech UK); ABT-199 from Adooq, www.adooq.com ; ABT-737 from Sequoia, Pangbourne, UK; A-1210477 from Chemie Tek, www.chemietek.com ; etoposide from Tocris, Bristol, UK; Mylotarg from Wyeth, Pearl River USA; Pladienolide B from Santa Cruz, supplied by Insight, Wembley, UK; TG02 was from Tragara, San Diego, USA.

    Article Title: Early changes in rpS6 phosphorylation and BH3 profiling predict response to chemotherapy in AML cells
    Article Snippet: Drugs and suppliers used in the study were as follows: 17-AAG, rapamycin, sorafenib, U0126 and torin 1 from LC labs ( ); AC220 and vosaroxin from Selleck (supplied by Stratech UK); etoposide from Tocris; gemtuzumab ozogamicin (GO) was a gift from Wyeth, Pearl River USA.

    Article Title: Predicting effective pro-apoptotic anti-leukaemic drug combinations using co-operative dynamic BH3 profiling
    Article Snippet: ; etoposide from Tocris, Bristol, UK; Mylotarg from Wyeth, Pearl River USA; Pladienolide B from Santa Cruz, supplied by Insight, Wembley, UK; TG02 was from Tragara, San Diego, USA.

    Positive Control:

    Article Title: Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression
    Article Snippet: .. A caspase-3/7 inhibitor and Etoposide (Tocris Bioscience, Bristol, UK), a caspase activator, were used as a positive control for caspase 3 activation and a negative control, respectively. .. Another negative control (media without caspase-3/7 reagent) was set up to make sure cell culture medium did not generate a fluorescence signal.

    Activation Assay:

    Article Title: Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression
    Article Snippet: .. A caspase-3/7 inhibitor and Etoposide (Tocris Bioscience, Bristol, UK), a caspase activator, were used as a positive control for caspase 3 activation and a negative control, respectively. .. Another negative control (media without caspase-3/7 reagent) was set up to make sure cell culture medium did not generate a fluorescence signal.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Tocris etoposide
    p53 R175H and MDM2 proteins synergistically reduce chemosensitivity of lung and breast cancer cells ( A ) H1299-R175H-MDM2 cell line was treated with Ponasterone A (Pon A) and/or Doxycycline (Dox) for 24 h to induce p53 R175H and/or MDM2, respectively. Immunoblotting with specific antibody revealed tight and efficient expression of both proteins. ( B ) Induced and uninduced cells were grown in triplicate in chambers compatible with the xCELLigence RTCA DP Instrument and Cisplatin (40 μM) was added at the indicated time point. Proliferative index was monitored for 120 h. Mean and standard deviation of three repeats are shown. ( C ) After 48 h treatment with 60 μM Cisplatin (left panel) or <t>Etoposide</t> (right panel), the apoptotic response of induced or uninduced cells stained with Annexin V/Gel Green dye was measured with a flow cytometer. p53 R175H or MDM2 expressed alone reduced apoptosis to same extent, whereas significant decrease was observed after simultaneous induction of both proteins. Bars represent the relative decrease (%) of cells in early apoptosis (Annexin V positive, Gel Green dye negative), estimated as follows = ( Value − Baseline ) Baseline × 100 (Baseline–Apoptotic response of uninduced H1299-R175H-MDM2 cell line). Statistical significance ( P value) was counted for three independent experiments with Anova statistical test. *, **, ***, **** indicate statistical significance p
    Etoposide, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide/product/Tocris
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    p53 R175H and MDM2 proteins synergistically reduce chemosensitivity of lung and breast cancer cells ( A ) H1299-R175H-MDM2 cell line was treated with Ponasterone A (Pon A) and/or Doxycycline (Dox) for 24 h to induce p53 R175H and/or MDM2, respectively. Immunoblotting with specific antibody revealed tight and efficient expression of both proteins. ( B ) Induced and uninduced cells were grown in triplicate in chambers compatible with the xCELLigence RTCA DP Instrument and Cisplatin (40 μM) was added at the indicated time point. Proliferative index was monitored for 120 h. Mean and standard deviation of three repeats are shown. ( C ) After 48 h treatment with 60 μM Cisplatin (left panel) or Etoposide (right panel), the apoptotic response of induced or uninduced cells stained with Annexin V/Gel Green dye was measured with a flow cytometer. p53 R175H or MDM2 expressed alone reduced apoptosis to same extent, whereas significant decrease was observed after simultaneous induction of both proteins. Bars represent the relative decrease (%) of cells in early apoptosis (Annexin V positive, Gel Green dye negative), estimated as follows = ( Value − Baseline ) Baseline × 100 (Baseline–Apoptotic response of uninduced H1299-R175H-MDM2 cell line). Statistical significance ( P value) was counted for three independent experiments with Anova statistical test. *, **, ***, **** indicate statistical significance p

    Journal: Oncotarget

    Article Title: Molecular chaperones in the acquisition of cancer cell chemoresistance with mutated TP53 and MDM2 up-regulation

    doi: 10.18632/oncotarget.18899

    Figure Lengend Snippet: p53 R175H and MDM2 proteins synergistically reduce chemosensitivity of lung and breast cancer cells ( A ) H1299-R175H-MDM2 cell line was treated with Ponasterone A (Pon A) and/or Doxycycline (Dox) for 24 h to induce p53 R175H and/or MDM2, respectively. Immunoblotting with specific antibody revealed tight and efficient expression of both proteins. ( B ) Induced and uninduced cells were grown in triplicate in chambers compatible with the xCELLigence RTCA DP Instrument and Cisplatin (40 μM) was added at the indicated time point. Proliferative index was monitored for 120 h. Mean and standard deviation of three repeats are shown. ( C ) After 48 h treatment with 60 μM Cisplatin (left panel) or Etoposide (right panel), the apoptotic response of induced or uninduced cells stained with Annexin V/Gel Green dye was measured with a flow cytometer. p53 R175H or MDM2 expressed alone reduced apoptosis to same extent, whereas significant decrease was observed after simultaneous induction of both proteins. Bars represent the relative decrease (%) of cells in early apoptosis (Annexin V positive, Gel Green dye negative), estimated as follows = ( Value − Baseline ) Baseline × 100 (Baseline–Apoptotic response of uninduced H1299-R175H-MDM2 cell line). Statistical significance ( P value) was counted for three independent experiments with Anova statistical test. *, **, ***, **** indicate statistical significance p

    Article Snippet: Cells were treated with Ponasterone A (Invitrogen), Doxycycline (Sigma-Aldrich), Cisplatin (Tocris Bioscience), Camptothecin (Selleck Chemicals), Doxorubicin (Tocris Bioscience), Etoposide (Tocris Bioscience), Taxol (Tocris Bioscience), at the following concentrations: 0.5–3 µM, 50 ng/ml, 10–80 µM, 1–5 µM, 0.25–2.5 µM, 40–80 μM, 0.1–0.5 μM, respectively.

    Techniques: Expressing, Standard Deviation, Staining, Flow Cytometry, Cytometry

    BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and Etoposide 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.

    Journal: Nutrients

    Article Title: Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression

    doi: 10.3390/nu9101051

    Figure Lengend Snippet: BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and Etoposide 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.

    Article Snippet: A caspase-3/7 inhibitor and Etoposide (Tocris Bioscience, Bristol, UK), a caspase activator, were used as a positive control for caspase 3 activation and a negative control, respectively.

    Techniques: High Content Screening, Western Blot, Positive Control, Activation Assay, Expressing

    Dermaseptin‐PS1 induced U‐251 MG cell death through intrinsic apoptosis signalling. A, Protein expression of caspase 9/cleaved caspase 9, Apaf‐1, Bcl‐2, Bax, Bak, p‐Bad, Bad, p‐p53 and p53 were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. *or # P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Novel peptide dermaseptin‐ PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling, et al. Novel peptide dermaseptin‐PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling

    doi: 10.1111/jcmm.14032

    Figure Lengend Snippet: Dermaseptin‐PS1 induced U‐251 MG cell death through intrinsic apoptosis signalling. A, Protein expression of caspase 9/cleaved caspase 9, Apaf‐1, Bcl‐2, Bax, Bak, p‐Bad, Bad, p‐p53 and p53 were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. *or # P

    Article Snippet: Etoposide was purchased from Tocris Bioscience, Bristol, UK (Cat: 1226), and Z‐VAD‐FMK was purchased by Dr Mei Chen in WWIEM, Queen's University Belfast from InvivoGen, Toulouse, France (Cat: tlrl‐vad).

    Techniques: Expressing, Western Blot, Software, Negative Control

    Dermaseptin‐PS1 induced U‐251 MG cell death at 10 −6 M via apoptosis. Western blot analysis was performed on U‐251 MG cells to test the expression of cleaved caspase 3 and caspase 3 after the treatment of (A) NC, 20 μmol/L, 15 μmol/L and 10 μmol/L etoposide and 10 −4 to 10 −8 M Dermaseptin‐PS1 for 24 h; (B) 10 −6 M Dermaseptin‐PS1 and 20 μmol/L etoposide for indicated times; (C) 20 μmol/L Z‐VAD‐FMK for 2 h subsequent to 20 μmol/L etoposide and 10 −6 M Dermaseptin‐PS1 treatment for 16 h. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Novel peptide dermaseptin‐ PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling, et al. Novel peptide dermaseptin‐PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling

    doi: 10.1111/jcmm.14032

    Figure Lengend Snippet: Dermaseptin‐PS1 induced U‐251 MG cell death at 10 −6 M via apoptosis. Western blot analysis was performed on U‐251 MG cells to test the expression of cleaved caspase 3 and caspase 3 after the treatment of (A) NC, 20 μmol/L, 15 μmol/L and 10 μmol/L etoposide and 10 −4 to 10 −8 M Dermaseptin‐PS1 for 24 h; (B) 10 −6 M Dermaseptin‐PS1 and 20 μmol/L etoposide for indicated times; (C) 20 μmol/L Z‐VAD‐FMK for 2 h subsequent to 20 μmol/L etoposide and 10 −6 M Dermaseptin‐PS1 treatment for 16 h. The detection of GAPDH protein was used as an internal control. The signal intensity was quantified by Image Lab software and GraphPad Prism 5 software was used for statistical comparison. NC, negative control. * P

    Article Snippet: Etoposide was purchased from Tocris Bioscience, Bristol, UK (Cat: 1226), and Z‐VAD‐FMK was purchased by Dr Mei Chen in WWIEM, Queen's University Belfast from InvivoGen, Toulouse, France (Cat: tlrl‐vad).

    Techniques: Western Blot, Expressing, Software, Negative Control

    The examinations of extrinsic apoptotic cascade mediated by Dermaseptin‐PS1 in U‐251 MG cells. Protein expression of caspase 8/cleaved caspase 8 and FADD were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Novel peptide dermaseptin‐ PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling, et al. Novel peptide dermaseptin‐PS1 exhibits anticancer activity via induction of intrinsic apoptosis signalling

    doi: 10.1111/jcmm.14032

    Figure Lengend Snippet: The examinations of extrinsic apoptotic cascade mediated by Dermaseptin‐PS1 in U‐251 MG cells. Protein expression of caspase 8/cleaved caspase 8 and FADD were analysed by Western blot in U‐251 MG cells treated for 4‐24 h with 10 −6 M Dermaseptin‐PS1 or 16‐24 h with 20 μmol/L etoposide. The detection of GAPDH protein was used as an internal control

    Article Snippet: Etoposide was purchased from Tocris Bioscience, Bristol, UK (Cat: 1226), and Z‐VAD‐FMK was purchased by Dr Mei Chen in WWIEM, Queen's University Belfast from InvivoGen, Toulouse, France (Cat: tlrl‐vad).

    Techniques: Expressing, Western Blot

    Effects of KC-53 on Caspases and regulatory molecules of the apoptotic pathways in leukemia cells. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. TNFRs membrane expression levels were analyzed by immunoblotting. EGFR was used as a loading control and the TNFRs levels were quantified and normalized in comparison to the EGFR levels. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. ( ii ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk. Caspase-8 enzymatic activity was determined as described in Methods. Etoposide (Eto) added at 5 μΜ was used as a positive control. c ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points followed by immunoblotting. ( ii ) Cells were incubated with 0 or 5 μΜ KC-53 for 6 h and cytosolic and nuclear protein extracts were prepared. The numbers on top of each band represent intensity values and are expressed as fold change in comparison to the control. The results in panels a , b ( i ) and c are representative of three repetitions. The results in b ( ii ) panels represent the mean ± SEM of two replicates and are representative of three independent experiments. (*** p value

    Journal: BMC Cancer

    Article Title: Selective activation of TNFR1 and NF-κB inhibition by a novel biyouyanagin analogue promotes apoptosis in acute leukemia cells

    doi: 10.1186/s12885-016-2310-5

    Figure Lengend Snippet: Effects of KC-53 on Caspases and regulatory molecules of the apoptotic pathways in leukemia cells. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. TNFRs membrane expression levels were analyzed by immunoblotting. EGFR was used as a loading control and the TNFRs levels were quantified and normalized in comparison to the EGFR levels. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points. ( ii ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk. Caspase-8 enzymatic activity was determined as described in Methods. Etoposide (Eto) added at 5 μΜ was used as a positive control. c ( i ) Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points followed by immunoblotting. ( ii ) Cells were incubated with 0 or 5 μΜ KC-53 for 6 h and cytosolic and nuclear protein extracts were prepared. The numbers on top of each band represent intensity values and are expressed as fold change in comparison to the control. The results in panels a , b ( i ) and c are representative of three repetitions. The results in b ( ii ) panels represent the mean ± SEM of two replicates and are representative of three independent experiments. (*** p value

    Article Snippet: Etoposide and Doxorubicin were purchased from Tocris (Bristol, UK).

    Techniques: Expressing, Activity Assay, Positive Control, Incubation

    Effects of KC-53 on cell apoptosis and DNA integrity. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points and apoptosis was assessed with Annexin-V/PI staining. Statistical significance was determined by comparing treated samples with the corresponding population of the vehicle control. For comparison, Doxorubicin (Dox) at 0.5 μΜ was used as positive control. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk for 24 h. The presence of nucleosomes in the cytoplasm was determined with the ELISA cell death detection kit and is expressed as Enrichment Factor. Etoposide (Eto) at 5 μΜ was used as positive control. ( ii ) Cells were treated with vehicle control or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk, as shown, for 24 h. Cell viability was assessed with the MTT assay. The results represent the mean ± SEM of two replicates and are representative of three independent experiments. (* p value

    Journal: BMC Cancer

    Article Title: Selective activation of TNFR1 and NF-κB inhibition by a novel biyouyanagin analogue promotes apoptosis in acute leukemia cells

    doi: 10.1186/s12885-016-2310-5

    Figure Lengend Snippet: Effects of KC-53 on cell apoptosis and DNA integrity. a Cells were treated with 0 or 5 μΜ KC-53 for the indicated time points and apoptosis was assessed with Annexin-V/PI staining. Statistical significance was determined by comparing treated samples with the corresponding population of the vehicle control. For comparison, Doxorubicin (Dox) at 0.5 μΜ was used as positive control. b ( i ) Cells were treated with 0 or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk for 24 h. The presence of nucleosomes in the cytoplasm was determined with the ELISA cell death detection kit and is expressed as Enrichment Factor. Etoposide (Eto) at 5 μΜ was used as positive control. ( ii ) Cells were treated with vehicle control or 5 μΜ KC-53 in the presence or absence of 20 μM z.vad.fmk, as shown, for 24 h. Cell viability was assessed with the MTT assay. The results represent the mean ± SEM of two replicates and are representative of three independent experiments. (* p value

    Article Snippet: Etoposide and Doxorubicin were purchased from Tocris (Bristol, UK).

    Techniques: Staining, Positive Control, Enzyme-linked Immunosorbent Assay, MTT Assay