Structured Review

GE Healthcare ethylenediaminetetraacetic acid
Ethylenediaminetetraacetic Acid, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 97/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ethylenediaminetetraacetic acid/product/GE Healthcare
Average 97 stars, based on 8 article reviews
Price from $9.99 to $1999.99
ethylenediaminetetraacetic acid - by Bioz Stars, 2020-03
97/100 stars

Images

Related Articles

Clone Assay:

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: Plasmid pKSJ331 was used for mutagenesis, using the QuikChange kit, to create colicin E1 mutant D473N. pKSJ331 was pUC19 with the colicin E1 operon cloned by PCR between the unique KpnI and BamHI sites of pUC19. .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Centrifugation:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: The lysate was clarified by centrifugation, and VP4 was precipitated by addition of AmSO4 to 30% saturation. .. Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: The cell debris was removed by centrifugation at 18000 g for 1 h at 4°C, and the supernatants were assayed to protein purification. .. For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

Amplification:

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC. .. A plasmid containing 32 repeats of the 147 bp Widom 601 sequence ( ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT ) was amplified in E. coli and purified via alkyline lysis methods, largely as outlined in ( ).

Filtration:

Article Title: Tertiary and quaternary allostery in HbII from Scapharca inaequivalvis
Article Snippet: Paragraph title: Gel filtration chromatography ... HbII in 100 mM phosphate, 1 mM EDTA, pH 7.0, was loaded on a G-100 resin packed on a XK 16/70 column (GE Healthcare) connected to an AKTA Prime chromatographic system (GE Healthcare).

Article Title: Stability and Function of the Sec61 Translocation Complex Depends on the Sss1p Tail-Anchor Sequence
Article Snippet: Paragraph title: Gel Filtration Assay ... A total of 300µl of the cleared sample was loaded directly onto a Superdex 200 HR 10/30 column (or Superose 6 HR 10/30 column for WT, CTSa and TMSa samples) (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) pre-equilibrated in 50mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 0.1% digitonin, 1mM EDTA, 5mM β-mercaptoethanol, and 1XCPIC and run at 0.2ml/min on an ÄKTA FPLC System (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) at 4°C.

Article Title: The Arabidopsis Chloroplastic NifU-Like Protein CnfU, Which Can Act as an Iron-Sulfur Cluster Scaffold Protein, Is Required for Biogenesis of Ferredoxin and Photosystem I W⃞
Article Snippet: Paragraph title: Gel Filtration of the Purified AtCnfU-V ... Purified AtCnfU-V (25 μg) dissolved in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM KCl, and 5 mM DTT were further treated either with 10 mM EDTA or 1 mM DTT on ice for 1 h. After treatment, samples were loaded onto Superdex 75 columns (Amersham Biosciences) and eluted with the same buffer.

Suction Filtration:

Article Title: The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity
Article Snippet: The mixture was incubated on ice for 15 to 20 min and then vacuum filtrated through polyvinylidene difluoride membranes (Immobilon P; 0.45-μm pore size; 2.5-cm diameter filters were prepared as specified by the manufacturer [Millipore, Bedford, MA]) using a vacuum filtration manifold (Millipore). .. For this reason also, the storage buffer of the protein was substituted with the same buffer without DTT and EDTA using Sephadex G-25 columns (Amersham Pharmacia Biotech).

Electrophoresis:

Article Title: Oxygen-Linked S-Nitrosation in Fish Myoglobins: A Cysteine-Specific Tertiary Allosteric Effect
Article Snippet: Samples were centrifuged for 25 min at 12,000 g, passed on a PD-10 column (GE Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM dithiothreitol (DTT), pH 8.3 and loaded on a gel-filtration Tricorn Superdex 75 10/300 GL FPLC-column (GE-Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM DTT, 0.15 M NaCl, pH 8.3. .. The purity of salmon and tuna Mb ( > 95%) was assessed spectrophotometrically from the Soret (416 nm) to protein (280 nm) absorbance peak ratio (A416 /A280 > 5) and by isoelectrofocusing and SDS electrophoresis on polyacrylamide gels .

Incubation:

Article Title: The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity
Article Snippet: The mixture was incubated on ice for 15 to 20 min and then vacuum filtrated through polyvinylidene difluoride membranes (Immobilon P; 0.45-μm pore size; 2.5-cm diameter filters were prepared as specified by the manufacturer [Millipore, Bedford, MA]) using a vacuum filtration manifold (Millipore). .. For this reason also, the storage buffer of the protein was substituted with the same buffer without DTT and EDTA using Sephadex G-25 columns (Amersham Pharmacia Biotech).

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)]. .. Magnetic mouse or protein G Dynabeads (30 µl/IP, Invitrogen) were washed and blocked with PBS containing 0.1% BSA for 10 min, then incubated 1 h with 4 µg Ab per IP.

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: After incubation for 30 min at 25°C room temperature, the cells were processed by sonication with Bioruptor (pulse 5 s on and 23 s off; total 10 min) (diagenode, Sparta, NJ) to lyse cells and shear DNA completely. .. The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare).

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: Briefly, hSP-A was purified from the cell-free surfactant pellet of BAL by serial sedimentation and resuspension (five times) in buffer containing 10 mM Tris, 150 mM NaCl, and 1 mM CaCl2 , release by incubation with 10 mM Tris, 150 mM NaCl, and 2 mM EDTA, and adsorption of the recalcified supernatant to mannose-Sepharose affinity columns. .. After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D.

Article Title: A novel mechanism of “metal gel-shift” by histidine-rich Ni2+-binding Hpn protein from Helicobacter pylori strain SS1
Article Snippet: Western blotting analysis The Hpn protein (25 μM) treated with indicated mol equivalent of EDTA or Ni2+ resolved on SDS-PAGE (20%) and then electrophoretically blotted onto polyvinylidene fluoride (PVDF) membrane (Amersham Hybond-P, GE Healthcare, code: RPN303F) in transfer buffer containing no methanol. .. The PVDF membrane was further incubated with C-terminal specific-anti 6×histidine monoclonal antibody (9F2) (Wako Japan, product code: 010–21861 diluted to 1:5000 in PBS-T) for 1 h. After three washes of 15:5:5 min in PBS-T, PVDF membrane was then incubated with horseradish peroxidase-conjugated anti-mouse IgG (GE Healthcare, product code: NA931VS, diluted to 1:5000 in PBS-T) for 1 h. The membrane was further washed again with PBS-T as mentioned earlier and Amersham ECL non-radioactive western blotting detection reagents (GE Healthcare) were used for visualizing protein bands in accordance with the manufacturer's instructions.

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: An additional 10 mM of fresh DTT was added, followed by another 2.5 hr incubation. .. Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC.

Activity Assay:

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare). .. All of the mutant proteins were expressed at wild-type levels and exhibited normal cytotoxic activity, as determined by spot-testing serial dilutions on sensitive indicator lawns.

Expressing:

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: The expression of DSS1-V5-His recombinant protein was induced by adding 1 mmol/L of IPTG for 3 h at 37°C with a vigorous shaking till the cell density reading at OD600 = 0.5–0.6. .. The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare).

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: Paragraph title: Expression and purification of mAOX enzymes ... For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

Article Title: Stability and Function of the Sec61 Translocation Complex Depends on the Sss1p Tail-Anchor Sequence
Article Snippet: Post-nuclear membranes from yeast strains expressing myc-tagged Sss1pWT or Sss1pYG and from strains expressing Sss1pWT, Sss1pTMSa and Sss1pCTSa were first salt extracted at a concentration of 0.050 A280 units /µl in 25mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 10mM EDTA, 1mM iodoacetamide, and 1XCPIC for 30 min on ice and then centrifuged at 60,000 rpm (150,000 g ) for 10 min in a Beckman TLA120.2 rotor. .. A total of 300µl of the cleared sample was loaded directly onto a Superdex 200 HR 10/30 column (or Superose 6 HR 10/30 column for WT, CTSa and TMSa samples) (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) pre-equilibrated in 50mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 0.1% digitonin, 1mM EDTA, 5mM β-mercaptoethanol, and 1XCPIC and run at 0.2ml/min on an ÄKTA FPLC System (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) at 4°C.

Article Title: Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells *
Article Snippet: Paragraph title: Protein Expression and Purification ... RcnR was diluted to 100 mm NaCl, 10 mm EDTA, 10 mm DTT, 10 mm HEPES, pH 7.0, and applied to an equilibrated 5-ml HiTrap SP column (GE Healthcare), washed in the same buffer plus 200 mm NaCl, and eluted in 300 mm NaCl.

Modification:

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: .. After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)]. .. When indicated, TSA was added to the RIPA buffer at a final concentration of 400 ng/ml to detect cortactin acetylation , except in the case of lysates from WT or HDAC6-deficient cells.

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: Human SP-A was isolated from the lung washings of patients with the lung disease alveolar proteinosis by a modification of the method of Suwabe et al. ( ). .. After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D.

Western Blot:

Article Title: A novel mechanism of “metal gel-shift” by histidine-rich Ni2+-binding Hpn protein from Helicobacter pylori strain SS1
Article Snippet: .. Western blotting analysis The Hpn protein (25 μM) treated with indicated mol equivalent of EDTA or Ni2+ resolved on SDS-PAGE (20%) and then electrophoretically blotted onto polyvinylidene fluoride (PVDF) membrane (Amersham Hybond-P, GE Healthcare, code: RPN303F) in transfer buffer containing no methanol. ..

Article Title: Stability and Function of the Sec61 Translocation Complex Depends on the Sss1p Tail-Anchor Sequence
Article Snippet: A total of 300µl of the cleared sample was loaded directly onto a Superdex 200 HR 10/30 column (or Superose 6 HR 10/30 column for WT, CTSa and TMSa samples) (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) pre-equilibrated in 50mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 0.1% digitonin, 1mM EDTA, 5mM β-mercaptoethanol, and 1XCPIC and run at 0.2ml/min on an ÄKTA FPLC System (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) at 4°C. .. Immunoblots were decorated with anti-myc antibodies and bands were quantified as described above.

Flow Cytometry:

Article Title: Oxygen-Linked S-Nitrosation in Fish Myoglobins: A Cysteine-Specific Tertiary Allosteric Effect
Article Snippet: Samples were centrifuged for 25 min at 12,000 g, passed on a PD-10 column (GE Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM dithiothreitol (DTT), pH 8.3 and loaded on a gel-filtration Tricorn Superdex 75 10/300 GL FPLC-column (GE-Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM DTT, 0.15 M NaCl, pH 8.3. .. Finally, the sample was dialysed against 20 mM Tris-HCl pH 9.2, passed through an ion exchange Hitrap Q-FF FPLC-column, and eluted with a 30-min gradient of 0–0.5 M NaCl in 20 mM Tris-HCl pH 9.2 at a flow rate of 1 mL/min.

Reconstitution Assay:

Article Title: The Arabidopsis Chloroplastic NifU-Like Protein CnfU, Which Can Act as an Iron-Sulfur Cluster Scaffold Protein, Is Required for Biogenesis of Ferredoxin and Photosystem I W⃞
Article Snippet: Purified AtCnfU-V (25 μg) dissolved in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM KCl, and 5 mM DTT were further treated either with 10 mM EDTA or 1 mM DTT on ice for 1 h. After treatment, samples were loaded onto Superdex 75 columns (Amersham Biosciences) and eluted with the same buffer. .. To perform the subsequent ferredoxin iron-sulfur cluster reconstitution assay, purified AtCnfU-V (200 μg) dissolved in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM KCl, and 1 mM DTT was further treated with or without 10 mM dithionite on ice briefly and subjected to gel filtration column chromatography as above.

Chromatography:

Article Title: Tertiary and quaternary allostery in HbII from Scapharca inaequivalvis
Article Snippet: Paragraph title: Gel filtration chromatography ... HbII in 100 mM phosphate, 1 mM EDTA, pH 7.0, was loaded on a G-100 resin packed on a XK 16/70 column (GE Healthcare) connected to an AKTA Prime chromatographic system (GE Healthcare).

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: .. After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D. ..

Immunoprecipitation:

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: Paragraph title: Immunoprecipitation (IP) experiments ... After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)].

Protease Inhibitor:

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: .. After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)]. .. When indicated, TSA was added to the RIPA buffer at a final concentration of 400 ng/ml to detect cortactin acetylation , except in the case of lysates from WT or HDAC6-deficient cells.

Infection:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: WT and C-C VP7 were expressed in Sf9 cells infected with a baculovirus vector and purified by successive affinity chromatography with concanavalin A and monoclonal antibody (mAb) 159, which is specific for VP7 trimer (elution by EDTA). .. Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Sedimentation:

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: Briefly, hSP-A was purified from the cell-free surfactant pellet of BAL by serial sedimentation and resuspension (five times) in buffer containing 10 mM Tris, 150 mM NaCl, and 1 mM CaCl2 , release by incubation with 10 mM Tris, 150 mM NaCl, and 2 mM EDTA, and adsorption of the recalcified supernatant to mannose-Sepharose affinity columns. .. After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D.

Sequencing:

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: The forward primer for the colicin operon included residues 5,015–5,035 of the ColE1 plasmid sequence, and the reverse primer included residues 499–479 ( ). .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC. .. A plasmid containing 32 repeats of the 147 bp Widom 601 sequence ( ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT ) was amplified in E. coli and purified via alkyline lysis methods, largely as outlined in ( ).

Sonication:

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: After incubation for 30 min at 25°C room temperature, the cells were processed by sonication with Bioruptor (pulse 5 s on and 23 s off; total 10 min) (diagenode, Sparta, NJ) to lyse cells and shear DNA completely. .. The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare).

Binding Assay:

Article Title: The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity
Article Snippet: Paragraph title: ATP Binding Assays ... For this reason also, the storage buffer of the protein was substituted with the same buffer without DTT and EDTA using Sephadex G-25 columns (Amersham Pharmacia Biotech).

Article Title: Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells *
Article Snippet: FrmR, FrmRE64H, ZntR, and Zur were eluted in a single step using respective binding buffers plus 500 mm NaCl. .. RcnR was diluted to 100 mm NaCl, 10 mm EDTA, 10 mm DTT, 10 mm HEPES, pH 7.0, and applied to an equilibrated 5-ml HiTrap SP column (GE Healthcare), washed in the same buffer plus 200 mm NaCl, and eluted in 300 mm NaCl.

Molecular Weight:

Article Title: Tertiary and quaternary allostery in HbII from Scapharca inaequivalvis
Article Snippet: HbII in 100 mM phosphate, 1 mM EDTA, pH 7.0, was loaded on a G-100 resin packed on a XK 16/70 column (GE Healthcare) connected to an AKTA Prime chromatographic system (GE Healthcare). .. The G-100 column was calibrated using gel filtration molecular weight standard (GE Healthcare): ovalbumin (MW 43,000 Da), conalbumin (MW 75,000 Da) and horse heart myoglobin (MW 17,000 Da).

Nucleic Acid Electrophoresis:

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). .. Elution profiles were recorded by monitoring of the absorbance at 280, 450 and 550 nm and the fractions containing AOX were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE).

Radioactivity:

Article Title: The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity
Article Snippet: Filters were dried, and radioactivity was counted by either liquid scintillation counting or phosphorimaging (Storm; Molecular Dynamics, Sunnyvale, CA). .. For this reason also, the storage buffer of the protein was substituted with the same buffer without DTT and EDTA using Sephadex G-25 columns (Amersham Pharmacia Biotech).

Ion Exchange Chromatography:

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: Histones were extracted from inclusion bodies following ( ) and purified via ion exchange chromatography. .. Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC.

Mutagenesis:

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: Paragraph title: Construction and Purification of Mutant Colicin Proteins ... Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Isolation:

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: Human SP-A was isolated from the lung washings of patients with the lung disease alveolar proteinosis by a modification of the method of Suwabe et al. ( ). .. After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D.

Clarification Assay:

Article Title: Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells *
Article Snippet: BL21(DE3) pETrcnR cells were resuspended in Buffer B (300 mm NaCl, 10 mm EDTA, 10 mm DTT, 10 mm HEPES, pH 7.0) with the addition of 1 mm PMSF and (post-sonication and clarification) applied to an equilibrated 5-ml HiTrap heparin column (GE Healthcare), washed in the same buffer, and eluted in a single step using Buffer B with 800 mm NaCl. .. RcnR was diluted to 100 mm NaCl, 10 mm EDTA, 10 mm DTT, 10 mm HEPES, pH 7.0, and applied to an equilibrated 5-ml HiTrap SP column (GE Healthcare), washed in the same buffer plus 200 mm NaCl, and eluted in 300 mm NaCl.

Transfection:

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: .. After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)]. .. When indicated, TSA was added to the RIPA buffer at a final concentration of 400 ng/ml to detect cortactin acetylation , except in the case of lysates from WT or HDAC6-deficient cells.

Nickel Column:

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: The crude extract was centrifuged at 50,000 g for 20 min at 4°C and then flew through a 2 mL Ni-NTA nickel column (Novagen), which was pre-equilibrated with 20 mmol/L Tris-HCl (pH = 8.0), 150 mmol/L NaCl, 0.1% Triton X-100, and 40 mmol/L imidazole. .. The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare).

Protein Purification:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: Paragraph title: TLP, DLP and recombinant protein purification ... Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: For protein purification, the supernatants after cell lysis were transferred into Ni-NTA (Macherey and Nagel, Düren, Germany) columns and passed through 0.3 ml of resin per liter of culture two times. .. For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

Polymerase Chain Reaction:

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: Plasmid pKSJ331 was used for mutagenesis, using the QuikChange kit, to create colicin E1 mutant D473N. pKSJ331 was pUC19 with the colicin E1 operon cloned by PCR between the unique KpnI and BamHI sites of pUC19. .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Affinity Chromatography:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: WT and C-C VP7 were expressed in Sf9 cells infected with a baculovirus vector and purified by successive affinity chromatography with concanavalin A and monoclonal antibody (mAb) 159, which is specific for VP7 trimer (elution by EDTA). .. Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Article Title: gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes
Article Snippet: Biotinylation, extraction of surface proteins and affinity chromatography of the InlB receptor(s) were performed as described ( ; ). .. Proteins eluted with EDTA were analyzed by SDS–PAGE, transferred to nitrocellulose membrane and detected with streptavidin covalently coupled to HRP and the chemiluminescent ECL detection kit (Amersham).

Fast Protein Liquid Chromatography:

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: .. Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC. .. A plasmid containing 32 repeats of the 147 bp Widom 601 sequence ( ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT ) was amplified in E. coli and purified via alkyline lysis methods, largely as outlined in ( ).

Article Title: Stability and Function of the Sec61 Translocation Complex Depends on the Sss1p Tail-Anchor Sequence
Article Snippet: .. A total of 300µl of the cleared sample was loaded directly onto a Superdex 200 HR 10/30 column (or Superose 6 HR 10/30 column for WT, CTSa and TMSa samples) (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) pre-equilibrated in 50mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 0.1% digitonin, 1mM EDTA, 5mM β-mercaptoethanol, and 1XCPIC and run at 0.2ml/min on an ÄKTA FPLC System (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) at 4°C. .. Fifty 0.5ml fractions were collected, and the proteins were precipitated with trichloroacetic acid, separated by SDS-PAGE, and transferred to nitrocellulose.

Article Title: Oxygen-Linked S-Nitrosation in Fish Myoglobins: A Cysteine-Specific Tertiary Allosteric Effect
Article Snippet: .. Samples were centrifuged for 25 min at 12,000 g, passed on a PD-10 column (GE Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM dithiothreitol (DTT), pH 8.3 and loaded on a gel-filtration Tricorn Superdex 75 10/300 GL FPLC-column (GE-Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM DTT, 0.15 M NaCl, pH 8.3. .. Finally, the sample was dialysed against 20 mM Tris-HCl pH 9.2, passed through an ion exchange Hitrap Q-FF FPLC-column, and eluted with a 30-min gradient of 0–0.5 M NaCl in 20 mM Tris-HCl pH 9.2 at a flow rate of 1 mL/min.

Polyacrylamide Gel Electrophoresis:

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). .. Elution profiles were recorded by monitoring of the absorbance at 280, 450 and 550 nm and the fractions containing AOX were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE).

IA:

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: Both colicin Ia and colicin E1 wild-type and mutant proteins were purified essentially as described previously ( ; ), generally from 250- or 500-ml cultures. .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Purification:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: WT and C-C VP7 were expressed in Sf9 cells infected with a baculovirus vector and purified by successive affinity chromatography with concanavalin A and monoclonal antibody (mAb) 159, which is specific for VP7 trimer (elution by EDTA). .. Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare). ..

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: Paragraph title: Purification of human DSS1 recombinant protein ... The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare).

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: Paragraph title: Purification of native SP-A and SP-D. ... After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D.

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: .. For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). .. Final purification was obtained by the use of size exclusion chromatography on Superdex 200 column (GE Healthcare) equilibrated in 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0).

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: .. Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC. .. A plasmid containing 32 repeats of the 147 bp Widom 601 sequence ( ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT ) was amplified in E. coli and purified via alkyline lysis methods, largely as outlined in ( ).

Article Title: The Arabidopsis Chloroplastic NifU-Like Protein CnfU, Which Can Act as an Iron-Sulfur Cluster Scaffold Protein, Is Required for Biogenesis of Ferredoxin and Photosystem I W⃞
Article Snippet: .. Purified AtCnfU-V (25 μg) dissolved in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM KCl, and 5 mM DTT were further treated either with 10 mM EDTA or 1 mM DTT on ice for 1 h. After treatment, samples were loaded onto Superdex 75 columns (Amersham Biosciences) and eluted with the same buffer. ..

Article Title: Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells *
Article Snippet: Paragraph title: Protein Expression and Purification ... RcnR was diluted to 100 mm NaCl, 10 mm EDTA, 10 mm DTT, 10 mm HEPES, pH 7.0, and applied to an equilibrated 5-ml HiTrap SP column (GE Healthcare), washed in the same buffer plus 200 mm NaCl, and eluted in 300 mm NaCl.

Article Title: Oxygen-Linked S-Nitrosation in Fish Myoglobins: A Cysteine-Specific Tertiary Allosteric Effect
Article Snippet: Paragraph title: Purification of Mbs ... Samples were centrifuged for 25 min at 12,000 g, passed on a PD-10 column (GE Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM dithiothreitol (DTT), pH 8.3 and loaded on a gel-filtration Tricorn Superdex 75 10/300 GL FPLC-column (GE-Healthcare) equilibrated with 50 mM Tris-HCl, 0.5 mM EDTA, 3 mM DTT, 0.15 M NaCl, pH 8.3.

Article Title: gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes
Article Snippet: Paragraph title: Purification of the InlB receptor ... Proteins eluted with EDTA were analyzed by SDS–PAGE, transferred to nitrocellulose membrane and detected with streptavidin covalently coupled to HRP and the chemiluminescent ECL detection kit (Amersham).

SDS Page:

Article Title: A novel mechanism of “metal gel-shift” by histidine-rich Ni2+-binding Hpn protein from Helicobacter pylori strain SS1
Article Snippet: .. Western blotting analysis The Hpn protein (25 μM) treated with indicated mol equivalent of EDTA or Ni2+ resolved on SDS-PAGE (20%) and then electrophoretically blotted onto polyvinylidene fluoride (PVDF) membrane (Amersham Hybond-P, GE Healthcare, code: RPN303F) in transfer buffer containing no methanol. ..

Article Title: Stability and Function of the Sec61 Translocation Complex Depends on the Sss1p Tail-Anchor Sequence
Article Snippet: A total of 300µl of the cleared sample was loaded directly onto a Superdex 200 HR 10/30 column (or Superose 6 HR 10/30 column for WT, CTSa and TMSa samples) (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) pre-equilibrated in 50mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 0.1% digitonin, 1mM EDTA, 5mM β-mercaptoethanol, and 1XCPIC and run at 0.2ml/min on an ÄKTA FPLC System (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) at 4°C. .. Fifty 0.5ml fractions were collected, and the proteins were precipitated with trichloroacetic acid, separated by SDS-PAGE, and transferred to nitrocellulose.

Article Title: gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes
Article Snippet: .. Proteins eluted with EDTA were analyzed by SDS–PAGE, transferred to nitrocellulose membrane and detected with streptavidin covalently coupled to HRP and the chemiluminescent ECL detection kit (Amersham). ..

Plasmid Preparation:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: WT and C-C VP7 were expressed in Sf9 cells infected with a baculovirus vector and purified by successive affinity chromatography with concanavalin A and monoclonal antibody (mAb) 159, which is specific for VP7 trimer (elution by EDTA). .. Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: The forward primer for the colicin operon included residues 5,015–5,035 of the ColE1 plasmid sequence, and the reverse primer included residues 499–479 ( ). .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC. .. A plasmid containing 32 repeats of the 147 bp Widom 601 sequence ( ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT ) was amplified in E. coli and purified via alkyline lysis methods, largely as outlined in ( ).

Spectrophotometric Assay:

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D. .. The EDTA content of all native and recombinant collectin preparations after dialysis was assessed by a modification of the spectrophotometric assay of Kratochvil and White, using β-phenanthrolene–disulfonic acid as the indicator ( ).

Recombinant:

Article Title: Structural Correlates of Rotavirus Cell Entry
Article Snippet: Paragraph title: TLP, DLP and recombinant protein purification ... Following elution with 25 mM Tris pH 8.0, 10 mM NaCl, 1 mM EDTA, fractions containing VP4 were pooled, dialyzed against the same buffer, loaded onto a HiTrap Q column (GE Healthcare), and eluted in Phenyl HP Start Buffer.

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: .. The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare). ..

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D. .. The EDTA content of all native and recombinant collectin preparations after dialysis was assessed by a modification of the spectrophotometric assay of Kratochvil and White, using β-phenanthrolene–disulfonic acid as the indicator ( ).

Size-exclusion Chromatography:

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). .. Final purification was obtained by the use of size exclusion chromatography on Superdex 200 column (GE Healthcare) equilibrated in 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0).

Article Title: Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells *
Article Snippet: Proteins were further purified by size-exclusion chromatography (HiLoad 26/60 Superdex 75, GE Healthcare) equilibrated in 300 mm NaCl, 10 mm DTT, 10 mm EDTA, 10 mm HEPES pH 7.8 for FrmR and FrmRE64H; 50 mm NaCl, 5 mm DTT, 1 mm EDTA, 10 mm HEPES, pH 7.0, for ZntR; 300 mm NaCl, 5 mm DTT, 1 mm EDTA, 10 mm HEPES pH 7.8 for Zur; and Buffer B for RcnR. .. RcnR was diluted to 100 mm NaCl, 10 mm EDTA, 10 mm DTT, 10 mm HEPES, pH 7.0, and applied to an equilibrated 5-ml HiTrap SP column (GE Healthcare), washed in the same buffer plus 200 mm NaCl, and eluted in 300 mm NaCl.

Column Chromatography:

Article Title: The Arabidopsis Chloroplastic NifU-Like Protein CnfU, Which Can Act as an Iron-Sulfur Cluster Scaffold Protein, Is Required for Biogenesis of Ferredoxin and Photosystem I W⃞
Article Snippet: Purified AtCnfU-V (25 μg) dissolved in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM KCl, and 5 mM DTT were further treated either with 10 mM EDTA or 1 mM DTT on ice for 1 h. After treatment, samples were loaded onto Superdex 75 columns (Amersham Biosciences) and eluted with the same buffer. .. To perform the subsequent ferredoxin iron-sulfur cluster reconstitution assay, purified AtCnfU-V (200 μg) dissolved in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM KCl, and 1 mM DTT was further treated with or without 10 mM dithionite on ice briefly and subjected to gel filtration column chromatography as above.

Concentration Assay:

Article Title: The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity
Article Snippet: Because MnCl2 can be tested only in buffers without DTT, this component was omitted from the reaction mixture in the assays in which the divalent cation concentration was varied. .. For this reason also, the storage buffer of the protein was substituted with the same buffer without DTT and EDTA using Sephadex G-25 columns (Amersham Pharmacia Biotech).

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)]. .. When indicated, TSA was added to the RIPA buffer at a final concentration of 400 ng/ml to detect cortactin acetylation , except in the case of lysates from WT or HDAC6-deficient cells.

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare). .. The pooled fractions containing DSS1 protein were collected and the NaCl salt concentration was adjusted to 2 mol/L.

Article Title: Stability and Function of the Sec61 Translocation Complex Depends on the Sss1p Tail-Anchor Sequence
Article Snippet: Post-nuclear membranes from yeast strains expressing myc-tagged Sss1pWT or Sss1pYG and from strains expressing Sss1pWT, Sss1pTMSa and Sss1pCTSa were first salt extracted at a concentration of 0.050 A280 units /µl in 25mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 10mM EDTA, 1mM iodoacetamide, and 1XCPIC for 30 min on ice and then centrifuged at 60,000 rpm (150,000 g ) for 10 min in a Beckman TLA120.2 rotor. .. A total of 300µl of the cleared sample was loaded directly onto a Superdex 200 HR 10/30 column (or Superose 6 HR 10/30 column for WT, CTSa and TMSa samples) (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) pre-equilibrated in 50mM HEPES-KOH, pH 7.5, 500mM potassium acetate, 0.1% digitonin, 1mM EDTA, 5mM β-mercaptoethanol, and 1XCPIC and run at 0.2ml/min on an ÄKTA FPLC System (Amersham Pharmacia Biotech, GE Healthcare Life Sciences, Canada) at 4°C.

Adsorption:

Article Title: Surfactant proteins A and D inhibit the growth of Gram-negative bacteria by increasing membrane permeability
Article Snippet: Briefly, hSP-A was purified from the cell-free surfactant pellet of BAL by serial sedimentation and resuspension (five times) in buffer containing 10 mM Tris, 150 mM NaCl, and 1 mM CaCl2 , release by incubation with 10 mM Tris, 150 mM NaCl, and 2 mM EDTA, and adsorption of the recalcified supernatant to mannose-Sepharose affinity columns. .. After elution with 2 mM EDTA, gel exclusion chromatography with Superose 6 (Amersham Biosciences, Piscataway, New Jersey, USA) was used to remove contaminating SP-D.

Lysis:

Article Title: Cortactin Tyrosine Phosphorylation Promotes Its Deacetylation and Inhibits Cell Spreading
Article Snippet: After transfection cells were washed once with D-PBS and scraped into 700 µl modified RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 15% glycerol, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM Na3 VO4 , 10 mM NaF, 1 mM PMSF, protease inhibitor cocktail (Amersham), phosphatase inhibitor (PhosSTOP, Roche)]. .. After one wash with PBS-0.1% BSA, the beads were added to 200–300 µl cell lysate and incubated with rotation at 4°C for 4 h. The beads were washed 3 times with the help of a magnet (Invitrogen) and 200 µl lysis buffer diluted 1∶10 in PBS supplemented with TSA, except in the case of lysates from WT or HDAC6-deficient cells, when TSA was omitted.

Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia
Article Snippet: Thus, the kil or lysis gene of the E1 operon was not included, so the mitomycin C–induced cultures did not lyse. .. Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

Article Title: DSSylation, a novel protein modification targets proteins induced by oxidative stress, and facilitates their degradation in cells
Article Snippet: The bacterial cells were harvested by spinning at 4,000 g for 20 min at 4°C and re-suspended in 200 mL lysis buffer [50 mmol/L Tris-HCl (pH = 8.0), and 1 mmol/L PMSF]. .. The DSS1-V5-His recombinant protein was eluted with 1× TBS [20 mmol/L Tris-HCl (pH = 7.4) and 0.9% NaCl] containing 50 mmol/L EDTA followed by loading it onto the 1 mL HiTrap Capto DEAE ion exchange column (GE Healthcare).

Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities
Article Snippet: For protein purification, the supernatants after cell lysis were transferred into Ni-NTA (Macherey and Nagel, Düren, Germany) columns and passed through 0.3 ml of resin per liter of culture two times. .. For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

Article Title: The conformation of the histone H3 tail inhibits association of the BPTF PHD finger with the nucleosome
Article Snippet: Briefly, equimolar ratios of histones were mixed in 20 mM Tris pH 7.5, 6M Guanidine HCl, 10 mM DTT, dialyzed into 20 mM Tris pH 7.5, 2M KCl, 1 mM EDTA, 5 mM β-ME, and purified over a sephacryl S-200 column (GE Healthcare Life Sciences) via FPLC. .. A plasmid containing 32 repeats of the 147 bp Widom 601 sequence ( ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT ) was amplified in E. coli and purified via alkyline lysis methods, largely as outlined in ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    GE Healthcare edta plasma supernatant
    Separation of C3dg from the larger C3 fragments. Measurements of C3 molecules encompassing the determinants of the segment C3dg, i.e., C3 and all degradation molecules containing this part of C3. (A) The figure illustrates C3dg measurement on gel permeation chromatography (GPC) fractions of serum before activation (red line) and supernatant of polyethylene glycol <t>(PEG)-precipitated</t> activated serum (blue line). (B) Test for the optimal concentration of PEG for precipitation. Increasing concentrations of PEG were added to <t>EDTA</t> plasma and C3dg was estimated in the supernatants. (C) GPC of supernatant after precipitation of EDTA plasma with 11% (red) and 16% (blue) PEG. C3dg in the fractions was measured. The 11% supernatant shows two major peaks, the first corresponding to C3 and larger C3 components, and the second corresponding to free C3dg. After precipitation with 16% PEG the first was significantly reduced. Panel (D) shows the results of western blotting of supernatants of EDTA-plasma precipitated with 16% (lane 1) or 11% (lane 2) PEG. The samples (corresponding to 0.1 µl plasma) were run non-reduced on the SDS-PAGE. The blot was developed with anti-C3d antibody. It can be seen that the 11% PEG supernatant still contains appreciable amounts of larger C3dg-encompassing molecules. This was repeated three times with similar results.
    Edta Plasma Supernatant, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/edta plasma supernatant/product/GE Healthcare
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    edta plasma supernatant - by Bioz Stars, 2020-03
    86/100 stars
      Buy from Supplier

    99
    GE Healthcare edta
    Steady-state kinetic parameters for mAOX1-4 with aromatic aldehydes as substrates containing a benzyl-group. Apparent steady-state kinetic parameters were recorded in 50 mM <t>Tris-HCl,</t> 200 mM NaCl, and 1 mM <t>EDTA</t> (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.
    Edta, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/edta/product/GE Healthcare
    Average 99 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    edta - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    89
    GE Healthcare glutathione sepharose binding buffer
    Crystal structure of CaM in complex with its AKAP79 binding site. a Cartoon representation showing one of the two copies (chains B and D) of AKAP79 peptide (orange) bound to CaM ( blue ) in the asymmetric unit. The C-lobe (lighter blue ) is in the open conformation with each of its two EF hands coordinating Ca 2+ (yellow). b Rotation of the complex through 90° highlighting the position of the four hydrophobic amino acids comprising the 1-4-7-8 motif. c Reduction in alphascreen signal between biotin-CaM and GST-AKAP79 (1–153) upon addition of 20-mer peptides derived from AKAP79 77–96 ( n = 4). The effects of point mutations within the disruptor peptide were compared. d Binding of purified full-length WT, Δ79–86 or W79A AKAP79 to CaM <t>sepharose.</t> Each AKAP79 variant was purified in complex with the D/D of RIIα. AKAP79 was released from the beads by incubation with EGTA, and detected by anti-AKAP79 IB. The experiment was performed in triplicate with each replicate leading to the same pattern of bands. e Limited Ramachandran plot showing dihedral angles for both copies of AKAP79 positions 80–85 in the asymmetric unit. Black triangles represent amino acids with angles characteristic of 3 10 helices; white diamonds are amino acids with α-helical geometry. f Representation of backbone H-bonds within the AKAP79 helix with distances shown in Å. The two α-helix-type bonds are shown by dotted lines; 3 10 -helical H-bonds as striped lines. The carbonyl group of S81 that does not H-bond to a backbone group is asterisked. g Rotation of the helix through 90°. The triangular backbone geometry of positions 83–86 is such that the side-chains of W79, L83 and T86 extend in the same direction. ** P
    Glutathione Sepharose Binding Buffer, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glutathione sepharose binding buffer/product/GE Healthcare
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    glutathione sepharose binding buffer - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    Image Search Results


    Separation of C3dg from the larger C3 fragments. Measurements of C3 molecules encompassing the determinants of the segment C3dg, i.e., C3 and all degradation molecules containing this part of C3. (A) The figure illustrates C3dg measurement on gel permeation chromatography (GPC) fractions of serum before activation (red line) and supernatant of polyethylene glycol (PEG)-precipitated activated serum (blue line). (B) Test for the optimal concentration of PEG for precipitation. Increasing concentrations of PEG were added to EDTA plasma and C3dg was estimated in the supernatants. (C) GPC of supernatant after precipitation of EDTA plasma with 11% (red) and 16% (blue) PEG. C3dg in the fractions was measured. The 11% supernatant shows two major peaks, the first corresponding to C3 and larger C3 components, and the second corresponding to free C3dg. After precipitation with 16% PEG the first was significantly reduced. Panel (D) shows the results of western blotting of supernatants of EDTA-plasma precipitated with 16% (lane 1) or 11% (lane 2) PEG. The samples (corresponding to 0.1 µl plasma) were run non-reduced on the SDS-PAGE. The blot was developed with anti-C3d antibody. It can be seen that the 11% PEG supernatant still contains appreciable amounts of larger C3dg-encompassing molecules. This was repeated three times with similar results.

    Journal: Frontiers in Immunology

    Article Title: The C3dg Fragment of Complement Is Superior to Conventional C3 as a Diagnostic Biomarker in Systemic Lupus Erythematosus

    doi: 10.3389/fimmu.2018.00581

    Figure Lengend Snippet: Separation of C3dg from the larger C3 fragments. Measurements of C3 molecules encompassing the determinants of the segment C3dg, i.e., C3 and all degradation molecules containing this part of C3. (A) The figure illustrates C3dg measurement on gel permeation chromatography (GPC) fractions of serum before activation (red line) and supernatant of polyethylene glycol (PEG)-precipitated activated serum (blue line). (B) Test for the optimal concentration of PEG for precipitation. Increasing concentrations of PEG were added to EDTA plasma and C3dg was estimated in the supernatants. (C) GPC of supernatant after precipitation of EDTA plasma with 11% (red) and 16% (blue) PEG. C3dg in the fractions was measured. The 11% supernatant shows two major peaks, the first corresponding to C3 and larger C3 components, and the second corresponding to free C3dg. After precipitation with 16% PEG the first was significantly reduced. Panel (D) shows the results of western blotting of supernatants of EDTA-plasma precipitated with 16% (lane 1) or 11% (lane 2) PEG. The samples (corresponding to 0.1 µl plasma) were run non-reduced on the SDS-PAGE. The blot was developed with anti-C3d antibody. It can be seen that the 11% PEG supernatant still contains appreciable amounts of larger C3dg-encompassing molecules. This was repeated three times with similar results.

    Article Snippet: Samples of serum, supernatant of PEG precipitated activated serum and EDTA-plasma supernatant after precipitation with either 11 or 16% PEG (w/v), were subjected to GPC on a Superose 6 10/300 GL column (GE Healthcare).

    Techniques: GPC Assay, Gel Permeation Chromatography, Activation Assay, Concentration Assay, Western Blot, SDS Page

    Steady-state kinetic parameters for mAOX1-4 with aromatic aldehydes as substrates containing a benzyl-group. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Journal: PLoS ONE

    Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities

    doi: 10.1371/journal.pone.0191819

    Figure Lengend Snippet: Steady-state kinetic parameters for mAOX1-4 with aromatic aldehydes as substrates containing a benzyl-group. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

    Techniques: Variant Assay, Activity Assay

    Steady-state kinetic parameters for mAOX1-4 with N-heterocyclic compounds as substrates. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Journal: PLoS ONE

    Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities

    doi: 10.1371/journal.pone.0191819

    Figure Lengend Snippet: Steady-state kinetic parameters for mAOX1-4 with N-heterocyclic compounds as substrates. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

    Techniques: Variant Assay, Activity Assay

    Steady-state kinetic parameters for mAOX1-4 with aliphatic aldehydes as substrates. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Journal: PLoS ONE

    Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities

    doi: 10.1371/journal.pone.0191819

    Figure Lengend Snippet: Steady-state kinetic parameters for mAOX1-4 with aliphatic aldehydes as substrates. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

    Techniques: Variant Assay, Activity Assay

    Steady-state kinetic parameters for mAOX1-4 with cinnamaldehyde-related compounds as substrates aromatic aldehydes as substrates. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Journal: PLoS ONE

    Article Title: Direct comparison of the four aldehyde oxidase enzymes present in mouse gives insight into their substrate specificities

    doi: 10.1371/journal.pone.0191819

    Figure Lengend Snippet: Steady-state kinetic parameters for mAOX1-4 with cinnamaldehyde-related compounds as substrates aromatic aldehydes as substrates. Apparent steady-state kinetic parameters were recorded in 50 mM Tris-HCl, 200 mM NaCl, and 1 mM EDTA (pH 8.0) in the presence of 100 μM DCPIP as electron acceptor. The substrate concentrations were varied around 0.5 and 10 times the K M . The chemical structure of each substrate is shown in the Fig. The values were corrected to a molybdenum saturation of 100% for each mAOX variant for a better comparability. Kinetic Data are mean values from three independent measurements (±S.D.). n.d. = no activity detectable.

    Article Snippet: For further purification, the buffer of partially purified enzymes was changed to 50 mM Tris-HCl, 200 mM NaCl and 1 mM EDTA (pH 8.0) by using PD-10 columns (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).

    Techniques: Variant Assay, Activity Assay

    Effect of trans MTSET on the macroscopic current through colicin Ia mutant N578C channels. The top trace shows the membrane current and the bottom trace shows the voltage, each as a function of time. Before the start of the record, DTT was added to the trans compartment to a final concentration of 5 μM and 1.0 μg N578C (along with 4.5 μg octylglucoside and DTT to 5 μM) was added to the cis compartment. We quickly opened on the order of 1,000 channels by stepping the membrane potential to +70 mV, and then switched it to +50 mV to establish a slower channel-opening rate. At the arrow, 200 μg MTSET was added to the trans compartment. This caused a decrease in current of ∼25%, demonstrating that residue N578C was accessible for reaction. Finally, we confirmed that the channels closed normally when the membrane potential was switched to −50 mV. The solution on both sides of the membrane was 100 mM KCl, 5 mM CaCl 2 , 1 mM EDTA, 20 mM HEPES, pH 7.2. (The membrane broke after colicin addition and was reformed before the start of the record; similar results were obtained with membranes that had not broken.)

    Journal: The Journal of General Physiology

    Article Title: Identification of Channel-lining Amino Acid Residues in the Hydrophobic Segment of Colicin Ia

    doi: 10.1085/jgp.200810042

    Figure Lengend Snippet: Effect of trans MTSET on the macroscopic current through colicin Ia mutant N578C channels. The top trace shows the membrane current and the bottom trace shows the voltage, each as a function of time. Before the start of the record, DTT was added to the trans compartment to a final concentration of 5 μM and 1.0 μg N578C (along with 4.5 μg octylglucoside and DTT to 5 μM) was added to the cis compartment. We quickly opened on the order of 1,000 channels by stepping the membrane potential to +70 mV, and then switched it to +50 mV to establish a slower channel-opening rate. At the arrow, 200 μg MTSET was added to the trans compartment. This caused a decrease in current of ∼25%, demonstrating that residue N578C was accessible for reaction. Finally, we confirmed that the channels closed normally when the membrane potential was switched to −50 mV. The solution on both sides of the membrane was 100 mM KCl, 5 mM CaCl 2 , 1 mM EDTA, 20 mM HEPES, pH 7.2. (The membrane broke after colicin addition and was reformed before the start of the record; similar results were obtained with membranes that had not broken.)

    Article Snippet: Dialyzed streptomycin-sulfate supernatants in 50 mM sodium borate, pH 9.0, 2 mM dithiothreitol (DTT), and 2 mM EDTA were purified on 1- or 5-ml pre-packed HiTrap CM FF columns (GE Healthcare).

    Techniques: IA, Mutagenesis, Concentration Assay

    Crystal structure of CaM in complex with its AKAP79 binding site. a Cartoon representation showing one of the two copies (chains B and D) of AKAP79 peptide (orange) bound to CaM ( blue ) in the asymmetric unit. The C-lobe (lighter blue ) is in the open conformation with each of its two EF hands coordinating Ca 2+ (yellow). b Rotation of the complex through 90° highlighting the position of the four hydrophobic amino acids comprising the 1-4-7-8 motif. c Reduction in alphascreen signal between biotin-CaM and GST-AKAP79 (1–153) upon addition of 20-mer peptides derived from AKAP79 77–96 ( n = 4). The effects of point mutations within the disruptor peptide were compared. d Binding of purified full-length WT, Δ79–86 or W79A AKAP79 to CaM sepharose. Each AKAP79 variant was purified in complex with the D/D of RIIα. AKAP79 was released from the beads by incubation with EGTA, and detected by anti-AKAP79 IB. The experiment was performed in triplicate with each replicate leading to the same pattern of bands. e Limited Ramachandran plot showing dihedral angles for both copies of AKAP79 positions 80–85 in the asymmetric unit. Black triangles represent amino acids with angles characteristic of 3 10 helices; white diamonds are amino acids with α-helical geometry. f Representation of backbone H-bonds within the AKAP79 helix with distances shown in Å. The two α-helix-type bonds are shown by dotted lines; 3 10 -helical H-bonds as striped lines. The carbonyl group of S81 that does not H-bond to a backbone group is asterisked. g Rotation of the helix through 90°. The triangular backbone geometry of positions 83–86 is such that the side-chains of W79, L83 and T86 extend in the same direction. ** P

    Journal: Nature Communications

    Article Title: Molecular basis of AKAP79 regulation by calmodulin

    doi: 10.1038/s41467-017-01715-w

    Figure Lengend Snippet: Crystal structure of CaM in complex with its AKAP79 binding site. a Cartoon representation showing one of the two copies (chains B and D) of AKAP79 peptide (orange) bound to CaM ( blue ) in the asymmetric unit. The C-lobe (lighter blue ) is in the open conformation with each of its two EF hands coordinating Ca 2+ (yellow). b Rotation of the complex through 90° highlighting the position of the four hydrophobic amino acids comprising the 1-4-7-8 motif. c Reduction in alphascreen signal between biotin-CaM and GST-AKAP79 (1–153) upon addition of 20-mer peptides derived from AKAP79 77–96 ( n = 4). The effects of point mutations within the disruptor peptide were compared. d Binding of purified full-length WT, Δ79–86 or W79A AKAP79 to CaM sepharose. Each AKAP79 variant was purified in complex with the D/D of RIIα. AKAP79 was released from the beads by incubation with EGTA, and detected by anti-AKAP79 IB. The experiment was performed in triplicate with each replicate leading to the same pattern of bands. e Limited Ramachandran plot showing dihedral angles for both copies of AKAP79 positions 80–85 in the asymmetric unit. Black triangles represent amino acids with angles characteristic of 3 10 helices; white diamonds are amino acids with α-helical geometry. f Representation of backbone H-bonds within the AKAP79 helix with distances shown in Å. The two α-helix-type bonds are shown by dotted lines; 3 10 -helical H-bonds as striped lines. The carbonyl group of S81 that does not H-bond to a backbone group is asterisked. g Rotation of the helix through 90°. The triangular backbone geometry of positions 83–86 is such that the side-chains of W79, L83 and T86 extend in the same direction. ** P

    Article Snippet: The eluted protein was buffer exchanged into glutathione sepharose binding buffer (25 mM Tris pH 7.4, 500 mM NaCl, 2 mM DTT, 1 mM EDTA, 1 mM Benzamidine) using a Sephadex G-25 column, before 3 h incubation with glutathione sepharose 4B (GE Life Sciences).

    Techniques: Chick Chorioallantoic Membrane Assay, Binding Assay, Amplified Luminescent Proximity Homogenous Assay, Derivative Assay, Purification, Variant Assay, Incubation

    Delineation of key residues in AKAP79 required for CaM binding. a Pull-down of either WT, Δ33–48, Δ79–86, or Δ391–400 FLAG-tagged-AKAP79 (inputs shown in bottom panel) with either CaM sepharose (top panel) or cAMP agarose (middle panel). AKAP79 was detected by anti-FLAG immunoblotting. The experiment was performed in triplicate with each replicate producing the same pattern of bands. b Sequence LOGO for AKAP5 gene products aligned with predicted helical region. The cross-linking cluster between AKAP79 positions 90–99 and K94 in CaM is indicated along with the boundaries of peptides used in the following panels. c – e Determination of inhibitory constants for the peptides outlined in ( b ) in disrupting interaction between biotin-CaM and GST-AKAP79 (1–153) detected using the alphascreen assay ( n = 4 for all data points). K i constants were determined for the 9-mer and 11-mer peptides c , 16-mer and 20-mer peptides d , and for either WT or L101A 26-mer peptides e .***P

    Journal: Nature Communications

    Article Title: Molecular basis of AKAP79 regulation by calmodulin

    doi: 10.1038/s41467-017-01715-w

    Figure Lengend Snippet: Delineation of key residues in AKAP79 required for CaM binding. a Pull-down of either WT, Δ33–48, Δ79–86, or Δ391–400 FLAG-tagged-AKAP79 (inputs shown in bottom panel) with either CaM sepharose (top panel) or cAMP agarose (middle panel). AKAP79 was detected by anti-FLAG immunoblotting. The experiment was performed in triplicate with each replicate producing the same pattern of bands. b Sequence LOGO for AKAP5 gene products aligned with predicted helical region. The cross-linking cluster between AKAP79 positions 90–99 and K94 in CaM is indicated along with the boundaries of peptides used in the following panels. c – e Determination of inhibitory constants for the peptides outlined in ( b ) in disrupting interaction between biotin-CaM and GST-AKAP79 (1–153) detected using the alphascreen assay ( n = 4 for all data points). K i constants were determined for the 9-mer and 11-mer peptides c , 16-mer and 20-mer peptides d , and for either WT or L101A 26-mer peptides e .***P

    Article Snippet: The eluted protein was buffer exchanged into glutathione sepharose binding buffer (25 mM Tris pH 7.4, 500 mM NaCl, 2 mM DTT, 1 mM EDTA, 1 mM Benzamidine) using a Sephadex G-25 column, before 3 h incubation with glutathione sepharose 4B (GE Life Sciences).

    Techniques: Chick Chorioallantoic Membrane Assay, Binding Assay, Sequencing, Amplified Luminescent Proximity Homogenous Assay