escherichia coli strains  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher escherichia coli strains
    Pulldown analysis of the SNAREs and SEC11 with the KC1 67–91 cytosolic domain. Tagged proteins were expressed and purified from <t>Escherichia</t> coli using His-affinity and size-exclusion chromatography before incubation in vitro overnight at 4°C. Shown is one of three independent pulldown experiments with Coomassie-stained SDS-PAGE analysis following separation with Strep-Tactin resin-immobilized KC1 67–91 -Flag 6 -StrepII. Lane sets are the SDS-PAGE results of (left to right) the pulldown, the resin control, and the loading. Incubations were carried out individually with SYP121 ΔC -Flag-6His, VAMP721 ΔC -Flag-6His, Flag 3 -SNAP33-6His, and SEC11-Flag 6 ).
    Escherichia Coli Strains, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli strains/product/Thermo Fisher
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    escherichia coli strains - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "K+ Channel-SEC11 Binding Exchange Regulates SNARE Assembly for Secretory Traffic"

    Article Title: K+ Channel-SEC11 Binding Exchange Regulates SNARE Assembly for Secretory Traffic

    Journal: Plant Physiology

    doi: 10.1104/pp.19.00919

    Pulldown analysis of the SNAREs and SEC11 with the KC1 67–91 cytosolic domain. Tagged proteins were expressed and purified from Escherichia coli using His-affinity and size-exclusion chromatography before incubation in vitro overnight at 4°C. Shown is one of three independent pulldown experiments with Coomassie-stained SDS-PAGE analysis following separation with Strep-Tactin resin-immobilized KC1 67–91 -Flag 6 -StrepII. Lane sets are the SDS-PAGE results of (left to right) the pulldown, the resin control, and the loading. Incubations were carried out individually with SYP121 ΔC -Flag-6His, VAMP721 ΔC -Flag-6His, Flag 3 -SNAP33-6His, and SEC11-Flag 6 ).
    Figure Legend Snippet: Pulldown analysis of the SNAREs and SEC11 with the KC1 67–91 cytosolic domain. Tagged proteins were expressed and purified from Escherichia coli using His-affinity and size-exclusion chromatography before incubation in vitro overnight at 4°C. Shown is one of three independent pulldown experiments with Coomassie-stained SDS-PAGE analysis following separation with Strep-Tactin resin-immobilized KC1 67–91 -Flag 6 -StrepII. Lane sets are the SDS-PAGE results of (left to right) the pulldown, the resin control, and the loading. Incubations were carried out individually with SYP121 ΔC -Flag-6His, VAMP721 ΔC -Flag-6His, Flag 3 -SNAP33-6His, and SEC11-Flag 6 ).

    Techniques Used: Purification, Size-exclusion Chromatography, Incubation, In Vitro, Staining, SDS Page

    Related Articles

    Clone Assay:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: K+ Channel-SEC11 Binding Exchange Regulates SNARE Assembly for Secretory Traffic
    Article Snippet: .. Escherichia coli strains of BL21(DE3) were used as a host for protein expression (Invitrogen) and constructs were cloned into pETDuet ( ) and pRSFDuet (Addgene) expression vectors. .. We used a classical cloning strategy to generate expression cassettes combining the multiple flag tags (Flag3 and Flag6 ) of the vectors with selections of 6His, 2Protein A (2PA), or Strep-II affinity tags on both upstream and downstream positions.

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.). .. Recombinant clones were constructed in the plasmid vector pBluescript II KS(+) (Stratagene, La Jolla, Calif.).

    Article Title: Ternary Complex Formation on the Adenovirus Packaging Sequence by the IVa2 and L4 22-Kilodalton Proteins ▿
    Article Snippet: .. The Escherichia coli strains, One Shot Chemically Competent TOP10 cells (Invitrogen) and BL21-Codon-Plus RIL (Stratagene), were used for cloning purposes and recombinant protein expression, respectively. .. 293 cells, transformed human embryonic kidney cells expressing the E1A and E1B proteins , were grown and maintained as described previously ( ).

    Article Title: Nitric Oxide Signaling and Transcriptional Control of Denitrification Genes in Pseudomonas stutzeri
    Article Snippet: The Escherichia coli strains used for propagation of plasmids were DH10B (Gibco-BRL) and JM110 ( ). .. Vectors used for cloning and sequencing were pBluescript II SK (Stratagene), pUCP22 , and pBSL15 , with the neomycinphosphotransferase II ( nptII ) gene conferring resistance to kanamycin.

    Centrifugation:

    Article Title: Insertional Inactivation of Genes Responsible for the d-Alanylation of Lipoteichoic Acid in Streptococcus gordonii DL1 (Challis) Affects Intrageneric Coaggregations
    Article Snippet: All Escherichia coli strains were cultured aerobically at 37°C in Luria-Bertani (LB) broth or on LB agar (Gibco-BRL). .. Bacterial cells used for coaggregation assays were pelleted by centrifugation at 10,000 × g for 10 min at 4°C, washed three times in coaggregation buffer (1 mM Tris [pH 8.0], 0.1 mM CaCl2 , 0.1 mM MgCl2 , 150 mM NaCl, and 0.02% NaN3 ), and stored in coaggregation buffer at 4°C.

    Amplification:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.). .. Two oligonucleotides, 5′-CTGCTTAGTTGAGTGTTGTTCC-3′ and 5′-CCTGGGTAACAGATGCAA-3′, containing Hin dIII restriction sites at their ends, were used for PCR amplification and cloning of the vspO gene ( ).

    Construct:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: K+ Channel-SEC11 Binding Exchange Regulates SNARE Assembly for Secretory Traffic
    Article Snippet: .. Escherichia coli strains of BL21(DE3) were used as a host for protein expression (Invitrogen) and constructs were cloned into pETDuet ( ) and pRSFDuet (Addgene) expression vectors. .. We used a classical cloning strategy to generate expression cassettes combining the multiple flag tags (Flag3 and Flag6 ) of the vectors with selections of 6His, 2Protein A (2PA), or Strep-II affinity tags on both upstream and downstream positions.

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.). .. Recombinant clones were constructed in the plasmid vector pBluescript II KS(+) (Stratagene, La Jolla, Calif.).

    Incubation:

    Article Title: Microbial survey of ready-to-eat salad ingredients sold at retail reveals the occurrence and the persistence of Listeria monocytogenes Sequence Types 2 and 87 in pre-packed smoked salmon
    Article Snippet: .. Those samples included seven of the positive smoked salmon samples collected from salad bars (n = 13), and 34 positive pre-packed smoked salmon samples obtained from supermarkets (n = 37). (III) Extended spectrum β-lactamase producing Escherichia coli strains Upon the quantification of E. coli count using a previously described method involving pre-enriched aliquots [ ], the isolates were streaked onto Brilliance ESBL agar (Oxoid, Hants, UK) and incubated at 37 °C for 24 h for the detection of extended spectrum β-lactamase producing strains. .. Microbiological analyses using post-enriched sample aliquots The remaining UPB aliquots were incubated and enriched at 37 °C for 24 h for the detection of E. coli O157: H7, L. monocytogenes and Salmonella spp. using previously described methods [ ] with additional tests performed to detect for the presence of V. cholerae and V. parahaemolyticus outlined below.

    Article Title: The Legionella longbeachae Icm/Dot Substrate SidC Selectively Binds Phosphatidylinositol 4-Phosphate with Nanomolar Affinity and Promotes Pathogen Vacuole-Endoplasmic Reticulum Interactions
    Article Snippet: Overnight cultures were incubated for 18 to 21 h in ACES [ N -(2-acetamido)-2-aminoethanesulfonic acid] yeast extract medium (AYE) ( ) at 37°C on a turning wheel. .. Escherichia coli strains were grown on LB (Luria-Bertani) plates and LB medium (Invitrogen) with the appropriate antibiotics.

    Expressing:

    Article Title: Spa33, a Cell Surface-Associated Subunit of the Mxi-Spa Type III Secretory Pathway of Shigella flexneri, Regulates Ipa Protein Traffic
    Article Snippet: The Escherichia coli strains used were SM10 λ pir ( ) for delivery of pGP704 derivatives to S. flexneri and DH5α (Gibco BRL) for plasmid constructions. .. Induction and repression of PBAD -directed gene expression from pBAD18 was performed using media supplemented with arabinose (0.2%) and glucose (0.2%), respectively.

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: K+ Channel-SEC11 Binding Exchange Regulates SNARE Assembly for Secretory Traffic
    Article Snippet: .. Escherichia coli strains of BL21(DE3) were used as a host for protein expression (Invitrogen) and constructs were cloned into pETDuet ( ) and pRSFDuet (Addgene) expression vectors. .. We used a classical cloning strategy to generate expression cassettes combining the multiple flag tags (Flag3 and Flag6 ) of the vectors with selections of 6His, 2Protein A (2PA), or Strep-II affinity tags on both upstream and downstream positions.

    Article Title: Asymmetry in the function and dynamics of the cytosolic group II chaperonin CCT/TRiC
    Article Snippet: .. Bacterial strains, fungi, proteins, and reagents The Escherichia coli strains used in this study were DH5α and XL10-gold for plasmid propagation and BL21 star (DE3) pRARE (Invitrogen, Carlsbad, CA) for protein expression. ..

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: Clonal isolate 182, expressing a 75-kDa VspC product, was isolate and purified as previously described ( ). .. The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.).

    Article Title: Ternary Complex Formation on the Adenovirus Packaging Sequence by the IVa2 and L4 22-Kilodalton Proteins ▿
    Article Snippet: .. The Escherichia coli strains, One Shot Chemically Competent TOP10 cells (Invitrogen) and BL21-Codon-Plus RIL (Stratagene), were used for cloning purposes and recombinant protein expression, respectively. .. 293 cells, transformed human embryonic kidney cells expressing the E1A and E1B proteins , were grown and maintained as described previously ( ).

    Modification:

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: All clonal isolates were propagated at 37°C in a modified standard mycoplasma broth medium as previously described ( ). .. The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.).

    Transformation Assay:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: Insertional Inactivation of Genes Responsible for the d-Alanylation of Lipoteichoic Acid in Streptococcus gordonii DL1 (Challis) Affects Intrageneric Coaggregations
    Article Snippet: The resultant dlt insertion mutants were tested for competence and transformation frequency by the method of Lunsford ( ). .. All Escherichia coli strains were cultured aerobically at 37°C in Luria-Bertani (LB) broth or on LB agar (Gibco-BRL).

    Article Title: Ternary Complex Formation on the Adenovirus Packaging Sequence by the IVa2 and L4 22-Kilodalton Proteins ▿
    Article Snippet: The Escherichia coli strains, One Shot Chemically Competent TOP10 cells (Invitrogen) and BL21-Codon-Plus RIL (Stratagene), were used for cloning purposes and recombinant protein expression, respectively. .. 293 cells, transformed human embryonic kidney cells expressing the E1A and E1B proteins , were grown and maintained as described previously ( ).

    Derivative Assay:

    Article Title: Flavobacterium johnsoniae GldJ Is a Lipoprotein That Is Required for Gliding Motility
    Article Snippet: F. johnsoniae UW101 (from the F. johnsoniae type strain ATCC 17061) was the wild type used in this study, and all mutants were derived from this strain ( ). .. The Escherichia coli strains used were DH5αMCR (Gibco BRL Life Technologies), S17-1 , and TOP10 (Invitrogen).

    Article Title: Flavobacterium johnsoniae GldH Is a Lipoprotein That Is Required for Gliding Motility and Chitin Utilization
    Article Snippet: F. johnsoniae UW101 (ATCC 17061) was the wild-type strain used in these studies, and all mutants were derived from this strain. gld mutants used in this study which were previously characterized included the gldA mutant CJ101-288 , the gldB mutant CJ569 (Tn 4351 insert Ω569) , the gldD mutant CJ282 , the gldF mutant CJ787 , and the gldG mutant CJ776 ( ). .. The Escherichia coli strains used were DH5αMCR (GibcoBRL Life Technologies), S17-1 , BW19851 , and NovaBlue (Novagen Inc., Madison, Wis.).

    Cell Culture:

    Article Title: Insertional Inactivation of Genes Responsible for the d-Alanylation of Lipoteichoic Acid in Streptococcus gordonii DL1 (Challis) Affects Intrageneric Coaggregations
    Article Snippet: .. All Escherichia coli strains were cultured aerobically at 37°C in Luria-Bertani (LB) broth or on LB agar (Gibco-BRL). ..

    Article Title: The Legionella longbeachae Icm/Dot Substrate SidC Selectively Binds Phosphatidylinositol 4-Phosphate with Nanomolar Affinity and Promotes Pathogen Vacuole-Endoplasmic Reticulum Interactions
    Article Snippet: L. longbeachae NSW150, L. pneumophila JR32, and derivatives of these strains (see Table S1 in the supplemental material) were cultured on charcoal yeast extract agar (CYE) plates for 3 days ( ). .. Escherichia coli strains were grown on LB (Luria-Bertani) plates and LB medium (Invitrogen) with the appropriate antibiotics.

    Article Title: Contribution of RaeB, a Putative RND-Type Transporter to Aminoglycoside and Detergent Resistance in Riemerella anatipestifer
    Article Snippet: R. anatipestifer CH-1 (GenBank accession number: NC_018609 ) was isolated from the brains of diseased ducks from Chengdu, Sichuan, China, identified by our laboratory ( ) and cultured in tryptic soybean broth (TSB, Oxoid) or tryptic soy agar (TSA, Oxoid) medium at 37°C in 5% CO2 . .. Escherichia coli strains were grown in Luria-Bertani (LB, Oxoid) broth or LB agar (1.5% agar powder, Solarbio) at 37°C.

    Inhibition:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: Paragraph title: RNA Inhibition (RNAi) by Feeding. ... To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen).

    Sequencing:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: Nitric Oxide Signaling and Transcriptional Control of Denitrification Genes in Pseudomonas stutzeri
    Article Snippet: The Escherichia coli strains used for propagation of plasmids were DH10B (Gibco-BRL) and JM110 ( ). .. Vectors used for cloning and sequencing were pBluescript II SK (Stratagene), pUCP22 , and pBSL15 , with the neomycinphosphotransferase II ( nptII ) gene conferring resistance to kanamycin.

    Injection:

    Article Title: The Tsetse Fly Displays an Attenuated Immune Response to Its Secondary Symbiont, Sodalis glossinidius
    Article Snippet: After injection, flies received streptozotocin-supplemented or regular blood meals every 48 h. The per os treatment consisted of three or continuous streptozotocin-supplemented blood meals (dose indicated in , ). .. The Escherichia coli strain used in this study was obtained from the OneShot® TOP10 kit (Invitrogen) related to the DH10BTM strain and was grown in liquid Luria-Broth (LB) medium or on 1% bacto-agar LB plates at 37°C.

    Binding Assay:

    Article Title: Spa33, a Cell Surface-Associated Subunit of the Mxi-Spa Type III Secretory Pathway of Shigella flexneri, Regulates Ipa Protein Traffic
    Article Snippet: The Escherichia coli strains used were SM10 λ pir ( ) for delivery of pGP704 derivatives to S. flexneri and DH5α (Gibco BRL) for plasmid constructions. .. Analysis of Congo red binding was performed on TSB plates (1.5% agar) supplemented with 0.025% Congo red (Sigma Chemical Co.).

    Radioactivity:

    Article Title: Flavobacterium johnsoniae GldH Is a Lipoprotein That Is Required for Gliding Motility and Chitin Utilization
    Article Snippet: The Escherichia coli strains used were DH5αMCR (GibcoBRL Life Technologies), S17-1 , BW19851 , and NovaBlue (Novagen Inc., Madison, Wis.). .. For radiolabeling experiments, cells were grown in SDY medium.

    Mutagenesis:

    Article Title: Flavobacterium johnsoniae GldH Is a Lipoprotein That Is Required for Gliding Motility and Chitin Utilization
    Article Snippet: F. johnsoniae UW101 (ATCC 17061) was the wild-type strain used in these studies, and all mutants were derived from this strain. gld mutants used in this study which were previously characterized included the gldA mutant CJ101-288 , the gldB mutant CJ569 (Tn 4351 insert Ω569) , the gldD mutant CJ282 , the gldF mutant CJ787 , and the gldG mutant CJ776 ( ). .. The Escherichia coli strains used were DH5αMCR (GibcoBRL Life Technologies), S17-1 , BW19851 , and NovaBlue (Novagen Inc., Madison, Wis.).

    Article Title: Nitric Oxide Signaling and Transcriptional Control of Denitrification Genes in Pseudomonas stutzeri
    Article Snippet: The generation of strains MK220 ( nirF ::Gmr ) , MK418 ( nosR ::Kmr ) , and MRD235 ( dnrD ::Kmr ) ( ) by insertional mutagenesis was described previously. .. The Escherichia coli strains used for propagation of plasmids were DH10B (Gibco-BRL) and JM110 ( ).

    Isolation:

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The geographic origin and site of isolation of M. bovis PG45 were previously described ( ). .. The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.).

    Article Title: Contribution of RaeB, a Putative RND-Type Transporter to Aminoglycoside and Detergent Resistance in Riemerella anatipestifer
    Article Snippet: R. anatipestifer CH-1 (GenBank accession number: NC_018609 ) was isolated from the brains of diseased ducks from Chengdu, Sichuan, China, identified by our laboratory ( ) and cultured in tryptic soybean broth (TSB, Oxoid) or tryptic soy agar (TSA, Oxoid) medium at 37°C in 5% CO2 . .. Escherichia coli strains were grown in Luria-Bertani (LB, Oxoid) broth or LB agar (1.5% agar powder, Solarbio) at 37°C.

    Purification:

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: Clonal isolate 182, expressing a 75-kDa VspC product, was isolate and purified as previously described ( ). .. The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.).

    Polymerase Chain Reaction:

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.). .. Recombinant plasmid pKO35 , carrying the vspO gene, was constructed by cloning the PCR-amplified vspO gene from M. bovis PG45 clonal isolate 7 into the plasmid vector pBS.

    Plasmid Preparation:

    Article Title: Spa33, a Cell Surface-Associated Subunit of the Mxi-Spa Type III Secretory Pathway of Shigella flexneri, Regulates Ipa Protein Traffic
    Article Snippet: .. The Escherichia coli strains used were SM10 λ pir ( ) for delivery of pGP704 derivatives to S. flexneri and DH5α (Gibco BRL) for plasmid constructions. ..

    Article Title: Interaction of intracellular ? amyloid peptide with chaperone proteins
    Article Snippet: .. To construct Escherichia coli strains expressing specific double-stranded RNAs (dsRNA), genomic sequence encompassing all of a specific C. elegans gene (e.g., R05F9.10) was amplified by using forward and reverse primers containing 5′ extensions encoding a T7 promoter sequence (TGAATTGTAATACGACTCACTATAGGGAGA), and the resulting PCR product was cloned into a TOPO XL vector (Invitrogen). .. The resulting dsRNA-expressing plasmid was subsequently transformed into E. coli strain HT115, and lawns of induced (dsRNA-expressing) bacteria were prepared on nematode growth media + isopropyl β-D-thiogalactoside + kanamycin plates as previously described ( ).

    Article Title: Asymmetry in the function and dynamics of the cytosolic group II chaperonin CCT/TRiC
    Article Snippet: .. Bacterial strains, fungi, proteins, and reagents The Escherichia coli strains used in this study were DH5α and XL10-gold for plasmid propagation and BL21 star (DE3) pRARE (Invitrogen, Carlsbad, CA) for protein expression. ..

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.). .. Recombinant clones were constructed in the plasmid vector pBluescript II KS(+) (Stratagene, La Jolla, Calif.).

    Selection:

    Article Title: Contribution of RaeB, a Putative RND-Type Transporter to Aminoglycoside and Detergent Resistance in Riemerella anatipestifer
    Article Snippet: Escherichia coli strains were grown in Luria-Bertani (LB, Oxoid) broth or LB agar (1.5% agar powder, Solarbio) at 37°C. .. The antimicrobial agents that were added to the media used for strain construction and selection were purchased from Sigma, and they were added to reach the following final concentrations: ampicillin (Amp), 100 μg/ml; cefoxitin (Cfx), 1 μg/ml; chloramphenicol (Cm), 25 μg/ml; kanamycin (Kan), 50 μg/ml; and spectinomycin (Spc), 80 μg/ml.

    Concentration Assay:

    Article Title: The Legionella longbeachae Icm/Dot Substrate SidC Selectively Binds Phosphatidylinositol 4-Phosphate with Nanomolar Affinity and Promotes Pathogen Vacuole-Endoplasmic Reticulum Interactions
    Article Snippet: Escherichia coli strains were grown on LB (Luria-Bertani) plates and LB medium (Invitrogen) with the appropriate antibiotics. .. To induce protein production, isopropyl-β- d -thiogalactopyranoside (IPTG) was added at a concentration of 0.5 mM to liquid cultures.

    Recombinant:

    Article Title: Intrachromosomal Recombination within the vsp Locus of Mycoplasma bovis Generates a Chimeric Variable Surface Lipoprotein Antigen
    Article Snippet: The Escherichia coli strain used was DH5αMCR (Gibco BRL Life Technologies, Inc., Gaithersburg, Md.). .. Recombinant clones were constructed in the plasmid vector pBluescript II KS(+) (Stratagene, La Jolla, Calif.).

    Article Title: Ternary Complex Formation on the Adenovirus Packaging Sequence by the IVa2 and L4 22-Kilodalton Proteins ▿
    Article Snippet: .. The Escherichia coli strains, One Shot Chemically Competent TOP10 cells (Invitrogen) and BL21-Codon-Plus RIL (Stratagene), were used for cloning purposes and recombinant protein expression, respectively. .. 293 cells, transformed human embryonic kidney cells expressing the E1A and E1B proteins , were grown and maintained as described previously ( ).

    Chick Chorioallantoic Membrane Assay:

    Article Title: The Legionella longbeachae Icm/Dot Substrate SidC Selectively Binds Phosphatidylinositol 4-Phosphate with Nanomolar Affinity and Promotes Pathogen Vacuole-Endoplasmic Reticulum Interactions
    Article Snippet: To maintain plasmids, chloramphenicol (Cam) was used at 10 μg ml−1 ( L. longbeachae , solid media), 2.5 µg ml−1 ( L. longbeachae , liquid media), or 5 μg ml−1 ( L. pneumophila ). .. Escherichia coli strains were grown on LB (Luria-Bertani) plates and LB medium (Invitrogen) with the appropriate antibiotics.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    The Echo Cloning System is a two vector system that utilizes the Cre lox site specific recombination system of bacteriophage P1 1 2 for rapid cloning into multiple vectors Your
      Buy from Supplier

    78
    Thermo Fisher e coli strains expressing cfa i
    Titration of <t>anti-CFA/I</t> and anti-CS1, -2, -3, -4/6, -5/6, and -6 IgG antibodies in serum samples of the immunized mice (solid dots) and control mice (circles). Heat-extracted CFA/I and CS1, -2, -3, -4/6, and -5/6 or purified CS6 adhesins were used to
    E Coli Strains Expressing Cfa I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strains expressing cfa i/product/Thermo Fisher
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli strains expressing cfa i - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    96
    Thermo Fisher coli o157 strain
    Uptake and inclusion body formation. a – e Fluorescence-activated cell sorting (FACS) analysis of 40,000 E . coli <t>O157:</t> H7 cells, measuring FITC fluorescence ( x -axis) and propidium iodide (PI) fluorescence ( y -axis) of a untreated and heat-inactivated bacteria mixed at a ratio of 1:1 and b–e bacteria treated for 15 min ( b ), 1 h ( c ), 3 h ( d ), and 6 h ( e ) with FITC-labeled P2 at MIC concentration. f Average population sizes of FITC-positive cells treated with FITC-P2 or FITC-P2Pro from four independent experiments such as those shown in b – e . g Wide-field structured illumination microscopy (SIM) image of E . coli treated with FITC-P2 for 15 min and h for 1 h at MIC concentration. i Time-dependent cell death following P2 treatment (1 x MIC) as % CFU/mL, in E . coli O157:H7. j Average population sizes of PI-positive cells (propidium iodide) from four independent FACS experiments such as those shown in a – e . k FACS analysis of 40,000 E . coli O157:H7 cells, measuring pFTAA fluorescence ( x -axis) and PI fluorescence ( y -axis) after 3 h of treatment with P2 at MIC concentration. l Same as h , but after treatment with 100 μg/mL P2Pro
    Coli O157 Strain, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/coli o157 strain/product/Thermo Fisher
    Average 96 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    coli o157 strain - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    79
    Thermo Fisher mdr upec clinical strains
    PFGE analysis of 82 <t>MDR-UPEC</t> strains associated with virulence genes and their mechanisms of resistance . A diversity analysis was performed using the Sørensen-Dice similarity coefficient in association with the UPGMA algorithm. Additionally, the dendrogram was evaluated using the cophenetic correlation coefficient obtained by the Mantel test, which indicated the dispersion of the data and showed a value of r = 0.8124. The seven clusters identified by PFGE are shown in different colors.
    Mdr Upec Clinical Strains, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mdr upec clinical strains/product/Thermo Fisher
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mdr upec clinical strains - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Image Search Results


    Titration of anti-CFA/I and anti-CS1, -2, -3, -4/6, -5/6, and -6 IgG antibodies in serum samples of the immunized mice (solid dots) and control mice (circles). Heat-extracted CFA/I and CS1, -2, -3, -4/6, and -5/6 or purified CS6 adhesins were used to

    Journal: Clinical and Vaccine Immunology : CVI

    Article Title: Multiepitope Fusion Antigen Induces Broadly Protective Antibodies That Prevent Adherence of Escherichia coli Strains Expressing Colonization Factor Antigen I (CFA/I), CFA/II, and CFA/IV

    doi: 10.1128/CVI.00652-13

    Figure Lengend Snippet: Titration of anti-CFA/I and anti-CS1, -2, -3, -4/6, -5/6, and -6 IgG antibodies in serum samples of the immunized mice (solid dots) and control mice (circles). Heat-extracted CFA/I and CS1, -2, -3, -4/6, and -5/6 or purified CS6 adhesins were used to

    Article Snippet: Caco-2 cells (7 × 105 ), which were reported to be adherent by E. coli strains expressing CFA/I, CFA/II, and CFA/IV ( , ), were seeded in each well of a 12-well tissue culture plate containing Dulbecco's modified Eagle's medium (DMEM)–20% fetal bovine serum (FBS) (Fisher Thermo Scientific, Pittsburg, PA).

    Techniques: Titration, Mouse Assay, Purification

    Antibodies in serum of the immunized mice significantly inhibited adherence of ETEC strains expressing CFA/I, CS3, CS4/6, or CS5/6 and E. coli strains expressing CS1 or -2 to Caco-2 cells.

    Journal: Clinical and Vaccine Immunology : CVI

    Article Title: Multiepitope Fusion Antigen Induces Broadly Protective Antibodies That Prevent Adherence of Escherichia coli Strains Expressing Colonization Factor Antigen I (CFA/I), CFA/II, and CFA/IV

    doi: 10.1128/CVI.00652-13

    Figure Lengend Snippet: Antibodies in serum of the immunized mice significantly inhibited adherence of ETEC strains expressing CFA/I, CS3, CS4/6, or CS5/6 and E. coli strains expressing CS1 or -2 to Caco-2 cells.

    Article Snippet: Caco-2 cells (7 × 105 ), which were reported to be adherent by E. coli strains expressing CFA/I, CFA/II, and CFA/IV ( , ), were seeded in each well of a 12-well tissue culture plate containing Dulbecco's modified Eagle's medium (DMEM)–20% fetal bovine serum (FBS) (Fisher Thermo Scientific, Pittsburg, PA).

    Techniques: Mouse Assay, Expressing

    Construction and detection of the CFA multiepitope fusion antigen (MEFA). (A) Construction of the CFA MEFA. The CFA/I major structure subunit CfaB gene ( cfaB ) was used as the backbone, with nucleotides coding for 6 surface-exposed but less-antigenic epitopes

    Journal: Clinical and Vaccine Immunology : CVI

    Article Title: Multiepitope Fusion Antigen Induces Broadly Protective Antibodies That Prevent Adherence of Escherichia coli Strains Expressing Colonization Factor Antigen I (CFA/I), CFA/II, and CFA/IV

    doi: 10.1128/CVI.00652-13

    Figure Lengend Snippet: Construction and detection of the CFA multiepitope fusion antigen (MEFA). (A) Construction of the CFA MEFA. The CFA/I major structure subunit CfaB gene ( cfaB ) was used as the backbone, with nucleotides coding for 6 surface-exposed but less-antigenic epitopes

    Article Snippet: Caco-2 cells (7 × 105 ), which were reported to be adherent by E. coli strains expressing CFA/I, CFA/II, and CFA/IV ( , ), were seeded in each well of a 12-well tissue culture plate containing Dulbecco's modified Eagle's medium (DMEM)–20% fetal bovine serum (FBS) (Fisher Thermo Scientific, Pittsburg, PA).

    Techniques:

    Uptake and inclusion body formation. a – e Fluorescence-activated cell sorting (FACS) analysis of 40,000 E . coli O157: H7 cells, measuring FITC fluorescence ( x -axis) and propidium iodide (PI) fluorescence ( y -axis) of a untreated and heat-inactivated bacteria mixed at a ratio of 1:1 and b–e bacteria treated for 15 min ( b ), 1 h ( c ), 3 h ( d ), and 6 h ( e ) with FITC-labeled P2 at MIC concentration. f Average population sizes of FITC-positive cells treated with FITC-P2 or FITC-P2Pro from four independent experiments such as those shown in b – e . g Wide-field structured illumination microscopy (SIM) image of E . coli treated with FITC-P2 for 15 min and h for 1 h at MIC concentration. i Time-dependent cell death following P2 treatment (1 x MIC) as % CFU/mL, in E . coli O157:H7. j Average population sizes of PI-positive cells (propidium iodide) from four independent FACS experiments such as those shown in a – e . k FACS analysis of 40,000 E . coli O157:H7 cells, measuring pFTAA fluorescence ( x -axis) and PI fluorescence ( y -axis) after 3 h of treatment with P2 at MIC concentration. l Same as h , but after treatment with 100 μg/mL P2Pro

    Journal: Nature Communications

    Article Title: Aggregating sequences that occur in many proteins constitute weak spots of bacterial proteostasis

    doi: 10.1038/s41467-018-03131-0

    Figure Lengend Snippet: Uptake and inclusion body formation. a – e Fluorescence-activated cell sorting (FACS) analysis of 40,000 E . coli O157: H7 cells, measuring FITC fluorescence ( x -axis) and propidium iodide (PI) fluorescence ( y -axis) of a untreated and heat-inactivated bacteria mixed at a ratio of 1:1 and b–e bacteria treated for 15 min ( b ), 1 h ( c ), 3 h ( d ), and 6 h ( e ) with FITC-labeled P2 at MIC concentration. f Average population sizes of FITC-positive cells treated with FITC-P2 or FITC-P2Pro from four independent experiments such as those shown in b – e . g Wide-field structured illumination microscopy (SIM) image of E . coli treated with FITC-P2 for 15 min and h for 1 h at MIC concentration. i Time-dependent cell death following P2 treatment (1 x MIC) as % CFU/mL, in E . coli O157:H7. j Average population sizes of PI-positive cells (propidium iodide) from four independent FACS experiments such as those shown in a – e . k FACS analysis of 40,000 E . coli O157:H7 cells, measuring pFTAA fluorescence ( x -axis) and PI fluorescence ( y -axis) after 3 h of treatment with P2 at MIC concentration. l Same as h , but after treatment with 100 μg/mL P2Pro

    Article Snippet: Thereupon, cells were infected with 200 μL of an overnight culture of E . coli O157 strain with FITC peptide (3 × MIC) for 24 h. Cells were stained with CellMask Deep Red plasma membrane dye (Thermo Fisher catalog# C10046) and 1 μL of NucBlue reagent for 30 min (Invitrogen), and then the medium was removed and 2 mL paraformaldehyde 4% was added to the plate for fixation.

    Techniques: Fluorescence, FACS, Labeling, Concentration Assay, Microscopy

    Cross-seeding and in vivo activity. a Concentration-dependent hemolysis of human erythrocytes by selected peptides (average and SD of three replicates) shown as percent of hemolysis compared to 1% Triton. b , c Cytoxicity of P2 (black bars) and P2Pro (gray) to human HeLa cells measured using the CellTiter Blue assay ( b ) (average and SD of three replicates) and the lactate dehydrogenase (LDH) release assay (average and SD of three replicates), represented as percentage of cell survival compared to control. d Fluorescence micrography of HeLa cells mixed with E . coli O157:H7, treated with FITC-P2 (green channel). Blue is DAPI (4',6-diamidino-2-phenylindole), red is CellMask Deep Red. e Aggregation kinetics of the Alzheimer β (Aβ) peptide at 50 µM with/without P2, monitored using thioflavin-T fluorescence (average and s.d. of three replicates). f Same as b for human islet amyloid polypeptide (IAPP). g Inhibitory effect of 5, 25, and 50 µg/mL P2 on bacterial growth in the presence of human blood serum (25 or 50%; average and SD of three replicates). h ELISA on immobilized FITC-P2 using blood serum of mice treated for 18 days with 30 mg/kg P2. An anti-FITC antibody was used as a positive control for peptide immobilization (three replicates from three mice). i–l Antibacterial efficacy of P2 in a mouse model of bladder infection. The bacterial load of mice infected with E . coli O157:H7 transurethrally was determined after treatment with P2 (P2 administered urethrally (P2 UT) or intraperitoneally (P2 IP)) and controls (ampicillin administered orally (Amp.oral), buffer (mock), and P2Pro administered urethrally (P2Pro2.UT)) in i kidney, j colon, k bladder, and l ureter. Each treatment group consisted of 15 animals. Bacterial loads are expressed as log 10 (CFU/mL). See text and Methods for more details. Plots i – l show individual measurements, as well as mean and s.d. Significant differences were calculated using ANOVA with Tukey's post hoc test. Statistical significance is indicated as follows: *** P ≤ 0.001

    Journal: Nature Communications

    Article Title: Aggregating sequences that occur in many proteins constitute weak spots of bacterial proteostasis

    doi: 10.1038/s41467-018-03131-0

    Figure Lengend Snippet: Cross-seeding and in vivo activity. a Concentration-dependent hemolysis of human erythrocytes by selected peptides (average and SD of three replicates) shown as percent of hemolysis compared to 1% Triton. b , c Cytoxicity of P2 (black bars) and P2Pro (gray) to human HeLa cells measured using the CellTiter Blue assay ( b ) (average and SD of three replicates) and the lactate dehydrogenase (LDH) release assay (average and SD of three replicates), represented as percentage of cell survival compared to control. d Fluorescence micrography of HeLa cells mixed with E . coli O157:H7, treated with FITC-P2 (green channel). Blue is DAPI (4',6-diamidino-2-phenylindole), red is CellMask Deep Red. e Aggregation kinetics of the Alzheimer β (Aβ) peptide at 50 µM with/without P2, monitored using thioflavin-T fluorescence (average and s.d. of three replicates). f Same as b for human islet amyloid polypeptide (IAPP). g Inhibitory effect of 5, 25, and 50 µg/mL P2 on bacterial growth in the presence of human blood serum (25 or 50%; average and SD of three replicates). h ELISA on immobilized FITC-P2 using blood serum of mice treated for 18 days with 30 mg/kg P2. An anti-FITC antibody was used as a positive control for peptide immobilization (three replicates from three mice). i–l Antibacterial efficacy of P2 in a mouse model of bladder infection. The bacterial load of mice infected with E . coli O157:H7 transurethrally was determined after treatment with P2 (P2 administered urethrally (P2 UT) or intraperitoneally (P2 IP)) and controls (ampicillin administered orally (Amp.oral), buffer (mock), and P2Pro administered urethrally (P2Pro2.UT)) in i kidney, j colon, k bladder, and l ureter. Each treatment group consisted of 15 animals. Bacterial loads are expressed as log 10 (CFU/mL). See text and Methods for more details. Plots i – l show individual measurements, as well as mean and s.d. Significant differences were calculated using ANOVA with Tukey's post hoc test. Statistical significance is indicated as follows: *** P ≤ 0.001

    Article Snippet: Thereupon, cells were infected with 200 μL of an overnight culture of E . coli O157 strain with FITC peptide (3 × MIC) for 24 h. Cells were stained with CellMask Deep Red plasma membrane dye (Thermo Fisher catalog# C10046) and 1 μL of NucBlue reagent for 30 min (Invitrogen), and then the medium was removed and 2 mL paraformaldehyde 4% was added to the plate for fixation.

    Techniques: In Vivo, Activity Assay, Concentration Assay, CtB Assay, Lactate Dehydrogenase Assay, Fluorescence, Enzyme-linked Immunosorbent Assay, Mouse Assay, Positive Control, Infection

    Inclusion body formation and proteostatic collapse. a Growth curve of E . coli BL21-overexpressing p53CD (red) and control in the presence (green) or absence (blue) of P2 (average and SD of three replicates). p53CD bacterial growth in the presence of 0.4 mM IPTG. b Colony formation by E . coli BL21 p53CD-overexpressing bacteria. The bottom and top of the box are the first and third quartiles, and the band inside the box represents the median. The whiskers are drawn using Tukey’s method and show the extreme values that fall within 1.5 times the interquartile range. c Transmission electron microscopy image of an inclusion body from P2-treated E . coli O157:H7 (uranyl acetate). d Representative Coomassie blue SDS-PAGE of inclusion bodies from E . coli BL21-overexpressing p53CD (lane 1), mock (lane 2), and E . coli O157:H7 treated with P2 (lane 4), P2Pro (lane 5), or DMSO (lane 6). Molecular-weight markers are shown in lanes 3 and 7. e Western blot for dnaK, groEL, tig, and dnaJ of the same samples than that in d . f Fluorescence microscopy image of E . coli cells stably expressing a fluorescent fusion of DnaK (mCer) treated with P2 at MIC concentration. g Growth inhibition of cells treated with P2 with/without erythromycin (Erm, 100 μg/mL, average and SD of three replicates). h Percent of colony-forming units after treating bacterial KO strains (KEIO) for 1 h with P2 at its MIC concentration. i Percent of colony-forming units of chaperone-overexpressing E . coli strains treated by P2 peptide at MIC concentration for 1 h. Significant differences from the WT are calculated using ordinary one-way ANOVA and Dunnett’s multiple-comparison test. Statistical significance is indicated as follows: ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001

    Journal: Nature Communications

    Article Title: Aggregating sequences that occur in many proteins constitute weak spots of bacterial proteostasis

    doi: 10.1038/s41467-018-03131-0

    Figure Lengend Snippet: Inclusion body formation and proteostatic collapse. a Growth curve of E . coli BL21-overexpressing p53CD (red) and control in the presence (green) or absence (blue) of P2 (average and SD of three replicates). p53CD bacterial growth in the presence of 0.4 mM IPTG. b Colony formation by E . coli BL21 p53CD-overexpressing bacteria. The bottom and top of the box are the first and third quartiles, and the band inside the box represents the median. The whiskers are drawn using Tukey’s method and show the extreme values that fall within 1.5 times the interquartile range. c Transmission electron microscopy image of an inclusion body from P2-treated E . coli O157:H7 (uranyl acetate). d Representative Coomassie blue SDS-PAGE of inclusion bodies from E . coli BL21-overexpressing p53CD (lane 1), mock (lane 2), and E . coli O157:H7 treated with P2 (lane 4), P2Pro (lane 5), or DMSO (lane 6). Molecular-weight markers are shown in lanes 3 and 7. e Western blot for dnaK, groEL, tig, and dnaJ of the same samples than that in d . f Fluorescence microscopy image of E . coli cells stably expressing a fluorescent fusion of DnaK (mCer) treated with P2 at MIC concentration. g Growth inhibition of cells treated with P2 with/without erythromycin (Erm, 100 μg/mL, average and SD of three replicates). h Percent of colony-forming units after treating bacterial KO strains (KEIO) for 1 h with P2 at its MIC concentration. i Percent of colony-forming units of chaperone-overexpressing E . coli strains treated by P2 peptide at MIC concentration for 1 h. Significant differences from the WT are calculated using ordinary one-way ANOVA and Dunnett’s multiple-comparison test. Statistical significance is indicated as follows: ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001

    Article Snippet: Thereupon, cells were infected with 200 μL of an overnight culture of E . coli O157 strain with FITC peptide (3 × MIC) for 24 h. Cells were stained with CellMask Deep Red plasma membrane dye (Thermo Fisher catalog# C10046) and 1 μL of NucBlue reagent for 30 min (Invitrogen), and then the medium was removed and 2 mL paraformaldehyde 4% was added to the plate for fixation.

    Techniques: Transmission Assay, Electron Microscopy, SDS Page, Molecular Weight, Western Blot, Fluorescence, Microscopy, Stable Transfection, Expressing, Concentration Assay, Inhibition

    Proteome analysis, design, and screening of redundant APRs. a Distribution of the redundancy of APR sequences of length seven in the E . coli proteome: percentage of identical sequences (red), one mismatch (blue), and two mismatches (green). b Same distribution as in a for the 75 most redundant APRs in E . coli . c Design pattern for aggregating peptide screen. Tandem APRs are linked by a linker (a single proline residue) and embedded between gatekeeper residues (GK; arginine residues). d , e APR redundancy for toxic versus nontoxic peptides considering one ( d ) or two ( e ) mismatches. The bottom and top of the boxes are the first and third quartiles, and the band inside the box represents the median. The whiskers encompass the minimum and maximum of the data. Significant differences were computed using Welch’s t test. f Time-killing curve of selected peptides (P14, P2, and P5R) and ampicillin (Amp) against E . coli strain O157:H7 treated at MIC concentration (average and SD of three replicates). g – i Transmission electron microcopy (TEM) of cross-sections of resin-embedded E . coli O157:H7, treated for 2 h with buffer ( g ), P2 peptide ( h ), and P105 peptide ( i ) at MIC concentration. j Wide-field structured illumination microscopy (SIM) image of E . coli O157:H7 treated with P2 and stained with the amyloid-specific dye pFTAA (0.5 µM). k Monitoring of spontaneous buildup of resistance by monitoring the MIC value of E . coli O157: H7 cultures that are maintained on sublethal doses (50% of MIC) of selected peptides (P14, P2, and P105) or ampicillin (Amp) for 36 days

    Journal: Nature Communications

    Article Title: Aggregating sequences that occur in many proteins constitute weak spots of bacterial proteostasis

    doi: 10.1038/s41467-018-03131-0

    Figure Lengend Snippet: Proteome analysis, design, and screening of redundant APRs. a Distribution of the redundancy of APR sequences of length seven in the E . coli proteome: percentage of identical sequences (red), one mismatch (blue), and two mismatches (green). b Same distribution as in a for the 75 most redundant APRs in E . coli . c Design pattern for aggregating peptide screen. Tandem APRs are linked by a linker (a single proline residue) and embedded between gatekeeper residues (GK; arginine residues). d , e APR redundancy for toxic versus nontoxic peptides considering one ( d ) or two ( e ) mismatches. The bottom and top of the boxes are the first and third quartiles, and the band inside the box represents the median. The whiskers encompass the minimum and maximum of the data. Significant differences were computed using Welch’s t test. f Time-killing curve of selected peptides (P14, P2, and P5R) and ampicillin (Amp) against E . coli strain O157:H7 treated at MIC concentration (average and SD of three replicates). g – i Transmission electron microcopy (TEM) of cross-sections of resin-embedded E . coli O157:H7, treated for 2 h with buffer ( g ), P2 peptide ( h ), and P105 peptide ( i ) at MIC concentration. j Wide-field structured illumination microscopy (SIM) image of E . coli O157:H7 treated with P2 and stained with the amyloid-specific dye pFTAA (0.5 µM). k Monitoring of spontaneous buildup of resistance by monitoring the MIC value of E . coli O157: H7 cultures that are maintained on sublethal doses (50% of MIC) of selected peptides (P14, P2, and P105) or ampicillin (Amp) for 36 days

    Article Snippet: Thereupon, cells were infected with 200 μL of an overnight culture of E . coli O157 strain with FITC peptide (3 × MIC) for 24 h. Cells were stained with CellMask Deep Red plasma membrane dye (Thermo Fisher catalog# C10046) and 1 μL of NucBlue reagent for 30 min (Invitrogen), and then the medium was removed and 2 mL paraformaldehyde 4% was added to the plate for fixation.

    Techniques: Concentration Assay, Transmission Assay, Transmission Electron Microscopy, Microscopy, Staining

    PFGE analysis of 82 MDR-UPEC strains associated with virulence genes and their mechanisms of resistance . A diversity analysis was performed using the Sørensen-Dice similarity coefficient in association with the UPGMA algorithm. Additionally, the dendrogram was evaluated using the cophenetic correlation coefficient obtained by the Mantel test, which indicated the dispersion of the data and showed a value of r = 0.8124. The seven clusters identified by PFGE are shown in different colors.

    Journal: Frontiers in Microbiology

    Article Title: Multidrug- and Extensively Drug-Resistant Uropathogenic Escherichia coli Clinical Strains: Phylogenetic Groups Widely Associated with Integrons Maintain High Genetic Diversity

    doi: 10.3389/fmicb.2016.02042

    Figure Lengend Snippet: PFGE analysis of 82 MDR-UPEC strains associated with virulence genes and their mechanisms of resistance . A diversity analysis was performed using the Sørensen-Dice similarity coefficient in association with the UPGMA algorithm. Additionally, the dendrogram was evaluated using the cophenetic correlation coefficient obtained by the Mantel test, which indicated the dispersion of the data and showed a value of r = 0.8124. The seven clusters identified by PFGE are shown in different colors.

    Article Snippet: Sequencing of the amplified integron gene cassettes The variable regions of class 1 and 2 integrons from the MDR-UPEC clinical strains were amplified by PCR using a high-fidelity Pfu polymerase of Thermo-Fisher Scientific (CA, USA) (Table ).

    Techniques: