endonuclease viii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Endonuclease VIII
    Description:
    Endonuclease VIII 5 000 units
    Catalog Number:
    M0299L
    Price:
    300
    Size:
    5 000 units
    Category:
    Other Endonucleases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs endonuclease viii
    Endonuclease VIII
    Endonuclease VIII 5 000 units
    https://www.bioz.com/result/endonuclease viii/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    endonuclease viii - by Bioz Stars, 2019-12
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Clones were blue-white screened and validated by DNA sequencing. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: To analyze DNA-dC deamination, the 59 bp DNA fragment 5'-AGCT GGCAGGCTAGCAAGTTGGTTGGCAAGCAGGTAAGCAGGCAAGCTGGCTGAATTCC-3' ( ) was cloned into pCR-Blunt II-TOPO® vector. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Centrifugation:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Amplification:

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Targets were initially amplified by PCR containing 1 μg human genomic DNA, 50 nM each of 94 forward PCR primers, 50 nM each of 94 reverse PCR primers, 5 U of AmpliTaq Polyermase Stoffel Fragment (Applied Biosystems), 200 μM each dNTP, 2 mM MgCl2 , 20 mM Tris-HCl (pH 8.4), and 50 mM KCl in a total volume of 10 μL. .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. 2.5 U/μL of Circligase II (Biozym 131406) was used and the ligation reaction carried out overnight.

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: The 5′ and 3′ halves of the DENV genome were amplified using TaKaRa Ex Taq polymerase and inserted into the pSC-A vector between SacI and XbaI sites with the StrataClone PCR cloning kit (Stratagene). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: SAP and Antarctic Phosphatase catalyze the release of 5'-phosphates, yielding non-phosphorylated DNA ends, which cannot be amplified by LM-PCR. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Positive Control:

    Article Title:
    Article Snippet: For the 5-hydroxycytosine (5OHC) positive control substrate, the damage-containing strand was 5′ end-labeled prior to annealing to the cold complementary 34G strand. .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Synthesized:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    SYBR Green Assay:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. A quantitative PCR (qPCR) experiment was carried out using 0.2% of the unamplified library to estimate relative library complexities (Additional file : Table S1), and to determine the optimal number of cycles for subsequent indexing PCR, representing the inflection point of the respective library amplification curves, corrected for reaction volume and template amount. qPCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) with 3 replicates for each library, involving an initial 10 min denaturation at 95 °C, followed by 40 cycles of: 15 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C.

    Incubation:

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB). .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: The linearized DNA substrate (100 fmol) was incubated with 50 ng of purified recombinant GST-mouse AID fusion protein, a gift from Dr. Michael R. Lieber (University of Southern California, Los Angeles, CA), under conditions similar to those used by this investigator , followed by treatment with Shrimp Alkaline Phosphatase (SAP) and Antarctic Phosphatase (New England Biolabs Inc.). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title:
    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Ligation:

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB). .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Generated:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: We interpret this result as indication that no obvious negative influence on extraction efficiency is caused by using this reduced input bone powder amount. .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. The Klenow Fragment of DNA polymerase I (Thermo Fisher Scientific EP0051) was used for the fill-in reaction [ ].

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    DNA Sequencing:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Clones were blue-white screened and validated by DNA sequencing. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Polymerase Chain Reaction:

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Paragraph title: Nested Patch PCR ... Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Plasmids containing the 5′ half of the DENV-2 genome (bases 1–5428) or 3′ half (5429–10723) were used as PCR template in the presence of dUTP prior to random fragmentation with endonuclease-V to ∼100 bp according to Dyson's protocol ( ). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. The fragmented DNA pool was excised from 1.5% agarose gel and then blunted with 2 units of T4 DNA polymerase (New England Biolabs) at 12 °C for 30 min, followed by heat inactivation at 75 °C for 20 min. Ligation of fragments directly into a SmaI-digested and dephosphorylated pIIIA MS2 vector (9.1 kb) was found to be very inefficient.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Recombinant:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: SAP and Antarctic Phosphatase catalyze the release of 5'-phosphates, yielding non-phosphorylated DNA ends, which cannot be amplified by LM-PCR. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.). .. Endo VIII possesses both N-glycosylase and APE activities, thereby cleaving 3′ and 5′ to the abasic site generated by Ung or by itself and leaving a 5′-phosphate and a 3′-phosphate.

    Molecular Weight:

    Article Title:
    Article Snippet: The fractions containing the interstrand crosslinked DNA were pooled and desalted by dialysis in water in a 2,000 molecular weight cutoff cassette (Thermo Scientific, Rockford, IL) at 4 °C overnight and concentrated in a Speed-vac concentrator. .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    DNA Extraction:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: DNA extraction was performed according to Dabney et al. [ ] with reduced bone powder input mass, and reduced centrifugation speed of the binding apparatus at approximately 450×g . .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Molecular Cloning:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Paragraph title: Molecular Cloning ... In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Isolation:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Viral RNA was isolated from DENV-2 strain 16681 and used to generate full-length cDNA according to the SuperScript III procedure (Life Technologies, Inc.). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Electrophoretic Mobility Shift Assay:

    Article Title:
    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Purification:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: The linearized DNA substrate (100 fmol) was incubated with 50 ng of purified recombinant GST-mouse AID fusion protein, a gift from Dr. Michael R. Lieber (University of Southern California, Los Angeles, CA), under conditions similar to those used by this investigator , followed by treatment with Shrimp Alkaline Phosphatase (SAP) and Antarctic Phosphatase (New England Biolabs Inc.). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Sequencing:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: We interpret this result as indication that no obvious negative influence on extraction efficiency is caused by using this reduced input bone powder amount. .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. The Klenow Fragment of DNA polymerase I (Thermo Fisher Scientific EP0051) was used for the fill-in reaction [ ].

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: Putatively positive Y. pestis samples were evaluated by comparing the amount of reads mapping to Y. pestis CO92 (NC_003143.1) to the reads assigned by MALT on the Y. pestis and Y. pseudotuberculosis complex nodes (Supplementary Table ). .. Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. Double-indexing and subsequent library amplification steps were carried out as mentioned in the previous section “Illumina library preparation and sequencing”.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    RNA Expression:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Labeling:

    Article Title:
    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Plasmid Preparation:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. At this stage, the sample RT5 was diluted to 10 nM for deep-shotgun sequencing on a HiSeq 4000 platform using a 1 × 76+8+8 cycles chemistry kit.

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: The 5′ and 3′ halves of the DENV genome were amplified using TaKaRa Ex Taq polymerase and inserted into the pSC-A vector between SacI and XbaI sites with the StrataClone PCR cloning kit (Stratagene). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Real-time Polymerase Chain Reaction:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Binding Assay:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Article Title:
    Article Snippet: Paragraph title: Incision and Binding Assays ... To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Gel Extraction:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs endonuclease v
    Generation of a library of Fli1 fragments. ( A ) Full-length Fli1 gene was PCR amplified in the presence of different dTTP/dUTP ratios, digested with endonuclease V and analysed by agarose gel (1.6%) electrophoresis. Lane M, DNA standard (HyperLadder1;BIOLINE marker); lane 1, 0.2 mM dTTP/0 mM dUTP; lane 2, 0.15 mM dTTP/0.05 mM dUTP; lane 3, 0.1 mM dTTP/0.1 mM dUTP; lane 4, 0.05 mM dTTP/0.15 mM dUTP; lane 5, 0 mM dTTP/0.2 mM dUTP. ( B ) Histogram showing the size distribution frequency ( N ) of 240 randomly picked Fli1 library entry plasmids. ( C ) Coverage plot of a non-redundant set of 173 sequence confirmed Fli1 entry plasmids arrayed against the 1359 bp Fli1 sequence (lower line) with annotated SAM domain (blue, 343–595 bp) and ETS domains (green, 841–1090 bp) sorted from their 5′ end. Red lines are inserts in frame at the 5′ and 3′ junctions and the correct orientation. ( D ) as (C) except the clones are ordered from their 3′ end.
    Endonuclease V, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease v/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    endonuclease v - by Bioz Stars, 2019-12
    95/100 stars
      Buy from Supplier

    97
    New England Biolabs t4 endonuclease v
    Binding of ETS1 protein promotes UV damage formation in vitro.  a  DNA sequences of  RPL13A  and  SDHD  promoter fragments, corresponding to chromosome coordinates chr19:49990710-49990681 and chr11:111957515-111957553, respectively. Putative ETS motifs are shown in gray background and highlighted in bold. Recurrent mutated sites in melanomas are underlined.  b, c  Gel shift assays showing binding of purified ETS1 protein to radiolabeled  RPL13A  ( b ) and  SDHD  ( c ) promoter fragments, respectively.  d  A representative sequencing gel (15%) showing CPD formation in naked  RPL13A  (sample 1, with UV irradiation) and ETS1-bound  RPL13A  DNA (samples 2–5, UV irradiation). The binding products shown in part ( b ) were irradiated with 1KJ m −2  of UV-C light and CPD lesions were converted to single strand breaks by T4 endonuclease V digestion. The resulting DNA breaks were separated on a 15% denaturing sequencing gel to analyze damage abundance at different locations. A negative control (naked DNA without UV irradiation) was also digested with T4 endoV to show the background level of DNA cleavage in the absence of UV-induced DNA lesions. The first lane on the left shows a 10-nt DNA ladder.  e  Same as in part ( d ), except the  SDHD  promoter fragment was analyzed on a 12% gel. Asterisk indicates gel running artifact caused by bromophenol blue in the gel loading buffer. Both  RPL13A  and  SDHD  CPD formation experiments were conducted at least 3 times independently with consistent results
    T4 Endonuclease V, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 endonuclease v/product/New England Biolabs
    Average 97 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    t4 endonuclease v - by Bioz Stars, 2019-12
    97/100 stars
      Buy from Supplier

    79
    New England Biolabs human neil1 protein
    Intracellular localization of <t>NEIL1.</t> A , HeLa cells were transfected with either pAcGFP1-N1 or the pAcGFP-NEIL1 plasmid, fixed and stained with DAPI. Cells were then visualized and imaged for GFP or DAPI. Merge and merge plus brightfield are shown. B ,
    Human Neil1 Protein, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human neil1 protein/product/New England Biolabs
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    human neil1 protein - by Bioz Stars, 2019-12
    79/100 stars
      Buy from Supplier

    Image Search Results


    Generation of a library of Fli1 fragments. ( A ) Full-length Fli1 gene was PCR amplified in the presence of different dTTP/dUTP ratios, digested with endonuclease V and analysed by agarose gel (1.6%) electrophoresis. Lane M, DNA standard (HyperLadder1;BIOLINE marker); lane 1, 0.2 mM dTTP/0 mM dUTP; lane 2, 0.15 mM dTTP/0.05 mM dUTP; lane 3, 0.1 mM dTTP/0.1 mM dUTP; lane 4, 0.05 mM dTTP/0.15 mM dUTP; lane 5, 0 mM dTTP/0.2 mM dUTP. ( B ) Histogram showing the size distribution frequency ( N ) of 240 randomly picked Fli1 library entry plasmids. ( C ) Coverage plot of a non-redundant set of 173 sequence confirmed Fli1 entry plasmids arrayed against the 1359 bp Fli1 sequence (lower line) with annotated SAM domain (blue, 343–595 bp) and ETS domains (green, 841–1090 bp) sorted from their 5′ end. Red lines are inserts in frame at the 5′ and 3′ junctions and the correct orientation. ( D ) as (C) except the clones are ordered from their 3′ end.

    Journal: Nucleic Acids Research

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection

    doi: 10.1093/nar/gkn151

    Figure Lengend Snippet: Generation of a library of Fli1 fragments. ( A ) Full-length Fli1 gene was PCR amplified in the presence of different dTTP/dUTP ratios, digested with endonuclease V and analysed by agarose gel (1.6%) electrophoresis. Lane M, DNA standard (HyperLadder1;BIOLINE marker); lane 1, 0.2 mM dTTP/0 mM dUTP; lane 2, 0.15 mM dTTP/0.05 mM dUTP; lane 3, 0.1 mM dTTP/0.1 mM dUTP; lane 4, 0.05 mM dTTP/0.15 mM dUTP; lane 5, 0 mM dTTP/0.2 mM dUTP. ( B ) Histogram showing the size distribution frequency ( N ) of 240 randomly picked Fli1 library entry plasmids. ( C ) Coverage plot of a non-redundant set of 173 sequence confirmed Fli1 entry plasmids arrayed against the 1359 bp Fli1 sequence (lower line) with annotated SAM domain (blue, 343–595 bp) and ETS domains (green, 841–1090 bp) sorted from their 5′ end. Red lines are inserts in frame at the 5′ and 3′ junctions and the correct orientation. ( D ) as (C) except the clones are ordered from their 3′ end.

    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Marker, Sequencing, Clone Assay

    AID can process blunt DSBs to generate staggered DSBs. A 59 bp DNA fragment containing 13 RGYW repeats was cloned into pCR-Blunt II-TOPO ® vector. A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate and the dU contained control DNA substrate were generated by PCR amplification of the pCR-Blunt IITOPO® vector containing the 59 bp fragment DNA using the forward 5'-phosphorylated primer A or primer A1 (containing a dU instead of a dC at position 3), specific for the 5' region of the 59 bp DNA fragment and the reverse primer B, specific for the vector sequence 116 bp downstream of the inserted 59 bp DNA fragment. The linearized DNA substrate was incubated with nil or recombinant GST-mouse AID fusion protein, then treated with SAP and Antarctic Phosphatase. These catalyze the release of 5'-phosphate groups from DNA yielding non-phosphorylated DNA ends, which cannot been amplified by LM-PCR. Incubation of DNA pretreated with nil or AID with recombinant E. coli Ung, followed by treatment with Endo VIII showed that AID could process blunt DSBs to yield staggered DSB ends. Such staggered DSB ends were amplified by specific LM-PCR after treatment with T4 pol.

    Journal:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID

    doi: 10.1016/j.molimm.2008.07.003

    Figure Lengend Snippet: AID can process blunt DSBs to generate staggered DSBs. A 59 bp DNA fragment containing 13 RGYW repeats was cloned into pCR-Blunt II-TOPO ® vector. A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate and the dU contained control DNA substrate were generated by PCR amplification of the pCR-Blunt IITOPO® vector containing the 59 bp fragment DNA using the forward 5'-phosphorylated primer A or primer A1 (containing a dU instead of a dC at position 3), specific for the 5' region of the 59 bp DNA fragment and the reverse primer B, specific for the vector sequence 116 bp downstream of the inserted 59 bp DNA fragment. The linearized DNA substrate was incubated with nil or recombinant GST-mouse AID fusion protein, then treated with SAP and Antarctic Phosphatase. These catalyze the release of 5'-phosphate groups from DNA yielding non-phosphorylated DNA ends, which cannot been amplified by LM-PCR. Incubation of DNA pretreated with nil or AID with recombinant E. coli Ung, followed by treatment with Endo VIII showed that AID could process blunt DSBs to yield staggered DSB ends. Such staggered DSB ends were amplified by specific LM-PCR after treatment with T4 pol.

    Article Snippet: The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Techniques: Clone Assay, Polymerase Chain Reaction, Plasmid Preparation, Generated, Amplification, Sequencing, Incubation, Recombinant

    Binding of ETS1 protein promotes UV damage formation in vitro.  a  DNA sequences of  RPL13A  and  SDHD  promoter fragments, corresponding to chromosome coordinates chr19:49990710-49990681 and chr11:111957515-111957553, respectively. Putative ETS motifs are shown in gray background and highlighted in bold. Recurrent mutated sites in melanomas are underlined.  b, c  Gel shift assays showing binding of purified ETS1 protein to radiolabeled  RPL13A  ( b ) and  SDHD  ( c ) promoter fragments, respectively.  d  A representative sequencing gel (15%) showing CPD formation in naked  RPL13A  (sample 1, with UV irradiation) and ETS1-bound  RPL13A  DNA (samples 2–5, UV irradiation). The binding products shown in part ( b ) were irradiated with 1KJ m −2  of UV-C light and CPD lesions were converted to single strand breaks by T4 endonuclease V digestion. The resulting DNA breaks were separated on a 15% denaturing sequencing gel to analyze damage abundance at different locations. A negative control (naked DNA without UV irradiation) was also digested with T4 endoV to show the background level of DNA cleavage in the absence of UV-induced DNA lesions. The first lane on the left shows a 10-nt DNA ladder.  e  Same as in part ( d ), except the  SDHD  promoter fragment was analyzed on a 12% gel. Asterisk indicates gel running artifact caused by bromophenol blue in the gel loading buffer. Both  RPL13A  and  SDHD  CPD formation experiments were conducted at least 3 times independently with consistent results

    Journal: Nature Communications

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma

    doi: 10.1038/s41467-018-05064-0

    Figure Lengend Snippet: Binding of ETS1 protein promotes UV damage formation in vitro. a DNA sequences of RPL13A and SDHD promoter fragments, corresponding to chromosome coordinates chr19:49990710-49990681 and chr11:111957515-111957553, respectively. Putative ETS motifs are shown in gray background and highlighted in bold. Recurrent mutated sites in melanomas are underlined. b, c Gel shift assays showing binding of purified ETS1 protein to radiolabeled RPL13A ( b ) and SDHD ( c ) promoter fragments, respectively. d A representative sequencing gel (15%) showing CPD formation in naked RPL13A (sample 1, with UV irradiation) and ETS1-bound RPL13A DNA (samples 2–5, UV irradiation). The binding products shown in part ( b ) were irradiated with 1KJ m −2 of UV-C light and CPD lesions were converted to single strand breaks by T4 endonuclease V digestion. The resulting DNA breaks were separated on a 15% denaturing sequencing gel to analyze damage abundance at different locations. A negative control (naked DNA without UV irradiation) was also digested with T4 endoV to show the background level of DNA cleavage in the absence of UV-induced DNA lesions. The first lane on the left shows a 10-nt DNA ladder. e Same as in part ( d ), except the SDHD promoter fragment was analyzed on a 12% gel. Asterisk indicates gel running artifact caused by bromophenol blue in the gel loading buffer. Both RPL13A and SDHD CPD formation experiments were conducted at least 3 times independently with consistent results

    Article Snippet: The remaining DNA (i.e., 90%) was sequentially incubated with T4 endonuclease V and human apurinic/apyrimidinic (AP) endonuclease (APE1, NEB) to generate new ligatable 3′-OH groups at CPD sites.

    Techniques: Binding Assay, In Vitro, Electrophoretic Mobility Shift Assay, Purification, Sequencing, Irradiation, Negative Control

    Genome-wide map of CPD lesions reveals that CPDs are elevated at active TFBS.  a  Schematic diagram of the CPD-seq method for mapping CPD lesions at single nucleotide resolution. ‘T = C′ indicates a CPD lesion at TC dipyrimidine. Oligonucleotide adapters are indicated in green and purple; ‘NNNNNN′ indicates a random DNA hexamer. A 3′ hydroxyl is indicated with OH, while ‘dd’ indicates a dideoxy 3′ end. The CPD lesion is cleaved with T4 endonuclease V and apurinic/apyrimidinic endonuclease (APE1) to generate a free 3′ hydroxyl immediately upstream of the CPD lesion, which is ligated to an adapter and sequenced.  b  Mutation density surrounding active promoter-proximal TFBS from 184 sequenced melanoma tumors  18 . Observed mutation density (i.e., in melanoma tumors) was analyzed adjacent to known TFBS located in promoter-proximal regions (up to 2500 bp upstream of transcription start site) that were considered active (i.e., overlapping with melanocyte DNase I-hypersensitivity (DHS) regions) for 82 distinct TFs. Expected mutation density was determined from the corresponding DNA sequences surrounding each active promoter-proximal TFBS, based on the trinucleotide mutation signature frequencies for all promoter-proximal regions.  c  Same as part ( b ), except mutations were analyzed adjacent to promoter-proximal TFBS that were considered inactive (i.e., not overlapping with melanocyte DHS regions).  d  Average number of CPD lesions (per TFBS) adjacent to active promoter-proximal TFBS. CPD lesions were mapped using CPD-seq from UV-irradiated NHF1 cells (100 J m −2 ) or isolated NHF1 DNA that was UV-irradiated (80 J m −2 ) in vitro (naked DNA). Cellular DNA was harvested immediately after UV irradiation, so essentially no repair was allowed to occur.  e  Same as in part ( d ), except CPD lesions were analyzed adjacent to inactive promoter-proximal TFBS

    Journal: Nature Communications

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma

    doi: 10.1038/s41467-018-05064-0

    Figure Lengend Snippet: Genome-wide map of CPD lesions reveals that CPDs are elevated at active TFBS. a Schematic diagram of the CPD-seq method for mapping CPD lesions at single nucleotide resolution. ‘T = C′ indicates a CPD lesion at TC dipyrimidine. Oligonucleotide adapters are indicated in green and purple; ‘NNNNNN′ indicates a random DNA hexamer. A 3′ hydroxyl is indicated with OH, while ‘dd’ indicates a dideoxy 3′ end. The CPD lesion is cleaved with T4 endonuclease V and apurinic/apyrimidinic endonuclease (APE1) to generate a free 3′ hydroxyl immediately upstream of the CPD lesion, which is ligated to an adapter and sequenced. b Mutation density surrounding active promoter-proximal TFBS from 184 sequenced melanoma tumors 18 . Observed mutation density (i.e., in melanoma tumors) was analyzed adjacent to known TFBS located in promoter-proximal regions (up to 2500 bp upstream of transcription start site) that were considered active (i.e., overlapping with melanocyte DNase I-hypersensitivity (DHS) regions) for 82 distinct TFs. Expected mutation density was determined from the corresponding DNA sequences surrounding each active promoter-proximal TFBS, based on the trinucleotide mutation signature frequencies for all promoter-proximal regions. c Same as part ( b ), except mutations were analyzed adjacent to promoter-proximal TFBS that were considered inactive (i.e., not overlapping with melanocyte DHS regions). d Average number of CPD lesions (per TFBS) adjacent to active promoter-proximal TFBS. CPD lesions were mapped using CPD-seq from UV-irradiated NHF1 cells (100 J m −2 ) or isolated NHF1 DNA that was UV-irradiated (80 J m −2 ) in vitro (naked DNA). Cellular DNA was harvested immediately after UV irradiation, so essentially no repair was allowed to occur. e Same as in part ( d ), except CPD lesions were analyzed adjacent to inactive promoter-proximal TFBS

    Article Snippet: The remaining DNA (i.e., 90%) was sequentially incubated with T4 endonuclease V and human apurinic/apyrimidinic (AP) endonuclease (APE1, NEB) to generate new ligatable 3′-OH groups at CPD sites.

    Techniques: Genome Wide, Mutagenesis, Irradiation, Isolation, In Vitro

    Intracellular localization of NEIL1. A , HeLa cells were transfected with either pAcGFP1-N1 or the pAcGFP-NEIL1 plasmid, fixed and stained with DAPI. Cells were then visualized and imaged for GFP or DAPI. Merge and merge plus brightfield are shown. B ,

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: Intracellular localization of NEIL1. A , HeLa cells were transfected with either pAcGFP1-N1 or the pAcGFP-NEIL1 plasmid, fixed and stained with DAPI. Cells were then visualized and imaged for GFP or DAPI. Merge and merge plus brightfield are shown. B ,

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Transfection, Plasmid Preparation, Staining

    Western blot analysis and Dig-pso repair in NEIL1 knockdown ( KD ) and control KD ( Cntl ) LN428 cells. A , Western blot analysis of whole cell extracts from Cntl and KD cells, relative to purified recombinant human NEIL1 protein. Designated are the NEIL1

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: Western blot analysis and Dig-pso repair in NEIL1 knockdown ( KD ) and control KD ( Cntl ) LN428 cells. A , Western blot analysis of whole cell extracts from Cntl and KD cells, relative to purified recombinant human NEIL1 protein. Designated are the NEIL1

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Western Blot, Purification, Recombinant

    NEIL1 binding to interstrand crosslink DNA. A , NEIL1 protein titration. NEIL1 protein was incubated at increasing concentrations with the positive control 5OHC-containing duplex substrate, and the binding reactions were resolved on a native gel. Open

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: NEIL1 binding to interstrand crosslink DNA. A , NEIL1 protein titration. NEIL1 protein was incubated at increasing concentrations with the positive control 5OHC-containing duplex substrate, and the binding reactions were resolved on a native gel. Open

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Binding Assay, Titration, Incubation, Positive Control

    Recruitment and retention of NEIL1 at sites of microirradiation in live cells, with or without psoralen or angelicin treatment. HeLa cells were transfected with the pAcGFP-NEIL1 plasmid, and incubated where indicated with psoralen ( Pso ) or angelicin (

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: Recruitment and retention of NEIL1 at sites of microirradiation in live cells, with or without psoralen or angelicin treatment. HeLa cells were transfected with the pAcGFP-NEIL1 plasmid, and incubated where indicated with psoralen ( Pso ) or angelicin (

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Transfection, Plasmid Preparation, Incubation

    Recruitment of NEIL1 variants to regions of targeted microirradiation. HeLa cells were transfected with either WT NEIL1 or one of the NEIL1 variant plasmids: C136R, E181K, or G83D. Recruitment and dispersion of the different GFP-NEIL1 proteins were recorded

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: Recruitment of NEIL1 variants to regions of targeted microirradiation. HeLa cells were transfected with either WT NEIL1 or one of the NEIL1 variant plasmids: C136R, E181K, or G83D. Recruitment and dispersion of the different GFP-NEIL1 proteins were recorded

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Transfection, Variant Assay

    Recruitment of XPC in NEIL1 knockdown ( KD ) and control ( Cntl ) LN428 cells. Following transfection with p2BAC.XPChd, NEIL1 KD (labeled NEIL1 KD-XPC) and Cntl (labeled NEIL1 Cntl-XPC) cells incubated with trioxsalen were laser irradiated at 1.7% (1.7/Pso)

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: Recruitment of XPC in NEIL1 knockdown ( KD ) and control ( Cntl ) LN428 cells. Following transfection with p2BAC.XPChd, NEIL1 KD (labeled NEIL1 KD-XPC) and Cntl (labeled NEIL1 Cntl-XPC) cells incubated with trioxsalen were laser irradiated at 1.7% (1.7/Pso)

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Transfection, Labeling, Incubation, Irradiation

    Effect of NAC or XPC on NEIL1 recruitment. A , NAC. Following transfection of HeLa cells with pAcGFP-NEIL1, cells were incubated with NAC for 30 min prior to targeted microirradiation at either 2.7% or 1.7%/Pso. Recruitment and dispersion of GFP-NEIL1

    Journal:

    Article Title:

    doi: 10.1074/jbc.M113.456087

    Figure Lengend Snippet: Effect of NAC or XPC on NEIL1 recruitment. A , NAC. Following transfection of HeLa cells with pAcGFP-NEIL1, cells were incubated with NAC for 30 min prior to targeted microirradiation at either 2.7% or 1.7%/Pso. Recruitment and dispersion of GFP-NEIL1

    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Techniques: Transfection, Incubation