Review



nis-elements 7 2022 software ar3  (Nikon)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Nikon nis-elements 7 2022 software ar3
    Nis Elements 7 2022 Software Ar3, supplied by Nikon, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nis-elements 7 2022 software ar3/product/Nikon
    Average 90 stars, based on 1 article reviews
    nis-elements 7 2022 software ar3 - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    nis-elements 7 2022 software ar3  (Nikon)
    90
    Nikon nis-elements 7 2022 software ar3
    Nis Elements 7 2022 Software Ar3, supplied by Nikon, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nis-elements 7 2022 software ar3/product/Nikon
    Average 90 stars, based on 1 article reviews
    nis-elements 7 2022 software ar3 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    v8 7 0 nis elements software version 4 13 04 nikon  (Nikon)
    99
    Nikon v8 7 0 nis elements software version 4 13 04 nikon
    V8 7 0 Nis Elements Software Version 4 13 04 Nikon, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/v8 7 0 nis elements software version 4 13 04 nikon/product/Nikon
    Average 99 stars, based on 1 article reviews
    v8 7 0 nis elements software version 4 13 04 nikon - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    nis-element d z-series 7 software  (Nikon)
    90
    Nikon nis-element d z-series 7 software
    Nis Element D Z Series 7 Software, supplied by Nikon, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nis-element d z-series 7 software/product/Nikon
    Average 90 stars, based on 1 article reviews
    nis-element d z-series 7 software - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    algorithms nis elements ar 4 40 00 nikon n a metamorph software version 7 8 0 0 universal imaging n a e2 cell reports 29  (Nikon)
    99
    Nikon algorithms nis elements ar 4 40 00 nikon n a metamorph software version 7 8 0 0 universal imaging n a e2 cell reports 29
    Algorithms Nis Elements Ar 4 40 00 Nikon N A Metamorph Software Version 7 8 0 0 Universal Imaging N A E2 Cell Reports 29, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/algorithms nis elements ar 4 40 00 nikon n a metamorph software version 7 8 0 0 universal imaging n a e2 cell reports 29/product/Nikon
    Average 99 stars, based on 1 article reviews
    algorithms nis elements ar 4 40 00 nikon n a metamorph software version 7 8 0 0 universal imaging n a e2 cell reports 29 - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other  (Nikon)
    99
    Nikon algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other
    KEY RESOURCES TABLE
    Algorithms Nis Elements Ar Nikon N A Prism 7 Graph Pad Software N A R Rstudio N A Alphaview Proteinsimple N A Other, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other/product/Nikon
    Average 99 stars, based on 1 article reviews
    algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    elements 7 software  (Nikon)
    90
    Nikon elements 7 software
    KEY RESOURCES TABLE
    Elements 7 Software, supplied by Nikon, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/elements 7 software/product/Nikon
    Average 90 stars, based on 1 article reviews
    elements 7 software - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    nikon elements 7 software  (Nikon)
    99
    Nikon nikon elements 7 software
    KEY RESOURCES TABLE
    Nikon Elements 7 Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nikon elements 7 software/product/Nikon
    Average 99 stars, based on 1 article reviews
    nikon elements 7 software - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    finite element software ansys 7  (ANSYS inc)
    90
    ANSYS inc finite element software ansys 7
    KEY RESOURCES TABLE
    Finite Element Software Ansys 7, supplied by ANSYS inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/finite element software ansys 7/product/ANSYS inc
    Average 90 stars, based on 1 article reviews
    finite element software ansys 7 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    nis element d z series 7 software  (Nikon)
    99
    Nikon nis element d z series 7 software
    KEY RESOURCES TABLE
    Nis Element D Z Series 7 Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nis element d z series 7 software/product/Nikon
    Average 99 stars, based on 1 article reviews
    nis element d z series 7 software - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Molecular cell

    Article Title: Targeted and Persistent 8-Oxoguanine Base Damage at Telomeres Promotes Telomere Loss and Crisis

    doi: 10.1016/j.molcel.2019.04.024

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: N/A pLKO1-puro PARP1 shRNA4 (sequence:CCGGCCGAGAAATCTCTTACCTCAACTCGAGTTGAGGTAAGAGATTTCTCGGTTTTT) Sigma MISSION® shRNA SHCLNG- {"type":"entrez-nucleotide","attrs":{"text":"NM_001618","term_id":"1519246470","term_text":"NM_001618"}} NM_001618 TRCN0000007930 Clone ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_001618.2","term_id":"11496989","term_text":"NM_001618.2"}} NM_001618.2 –1176s1c1 pLKO1-puro PARP1 shRNA5 (sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTT) Sigma MISSION® shRNA SHCLNG- {"type":"entrez-nucleotide","attrs":{"text":"NM_001618","term_id":"1519246470","term_text":"NM_001618"}} NM_001618 TRCN0000007929 Clone ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_001618.2","term_id":"11496989","term_text":"NM_001618.2"}} NM_001618.2 –2715s1c1 pCMV-VSV-G Addgene, gift from Dr. Bob Weinberg Cat#8454 psPAX2 Addgene, gift from Dr. Didier Trono Cat#11260 pOGG1-EGFP plasmid Gift from Dr. Anna Campalans (CEA, France) Campalans et al., 2007 pEYFP-XRCC1 plasmid Gift from Dr. Marit Otterlei (NTNU, Normway) Fan et al., 2004 pmCherry-NEIL1 plasmid Gift from Dr. David Wilson (NIA, USA) McNeill et al., 2013 Software and Algorithms NIS Elements AR Nikon N/A Prism 7 Graph Pad software N/A R RStudio N/A AlphaView Proteinsimple N/A Other: Peptide Nucleic Acid Probes TelC-Alexa488 (CCCTAACCCTAACCCTAA) PNA Bio Cat#F1004 CENPB-Cy5 (Pan centromere probe.

    Techniques: Recombinant, Plasmid Preparation, Imaging, Clone Assay, Sequencing, shRNA, Software