Structured Review

Thermo Fisher ecori
Ecori, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 895 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ecori/product/Thermo Fisher
Average 99 stars, based on 895 article reviews
Price from $9.99 to $1999.99
ecori - by Bioz Stars, 2020-04
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B. ..

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: To obtain targeting fusion vectors, the appropriate cloning vector and a previously assembled EGFP or mEmerald fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: The PCR product was cloned into pCR-BluntII (Invitrogen), and the resulting plasmid was introduced into TOP10. .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: To express FADD and its variants in the Escherichia coli system for subsequent protein purification, the EcoRI-XhoI fragment from pM-FADD, coding for FADD, was cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-XhoI sites in the multiple cloning site to produce the plasmid pHis-FADD. .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems).

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: The purified PCR product was cloned into pEASY-T1 vector (TransGEN, Beijing, China). .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Amplification:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter. .. To generate deletion mutant (N 220-231) of N protein gene with internal deletion of aa220-231, two PCR fragments were amplified using two pairs of primers.

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: The restriction enzyme sites incorporated into the primer sequences are underlined throughout this section. cDNAs were then amplified by PCR with sense primers 5ЈBCVS2187Eco (5Ј-GCT GAA TTC TCT TTC ACG ACA GCT GCA ACC T-3Ј, corresponding to nt 2187-2209 of the BCV S gene) and 5ЈBCVSEco (5Ј-GCT GAA TTC GAT AAT GGT ACT AGG CTG CAT GAT-3Ј, corresponding to the sequence at the 5Ј-end of the BCV S gene) (see Fig. 1A ). .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B.

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: The mNeonGreen cDNA was amplified with a 5′ primer encoding an AgeI site and a 3′ primer encoding either a BspEI (C1) or NotI (N1) site for generating cloning vectors to create C-terminal and N-terminal fusions (with regards to the FP), respectively. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: To construct the plasmid pcDNA4/HisMaxB-hM116 for expression of M116 protein in mammalian cells, the corresponding DNA fragment was amplified by PCR (He et al., 2004a (He et al., , 2004b Luo et al., 2006b) , but only interaction via the C-terminal of N led to formation of pseudoparticles. .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: The full length coding sequence of MT2-MMP was amplified by LA Taq polymerase (TaKaRa, Dalian, China) according to the manufacturer’s protocol. .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The mouse cathepsin B and L cDNAs were amplified from a mouse liver cDNA library (BD Clontech) using the following primers: cathepsin B (CGGAATTCACCATGTGGTGG TCCTTGATCCT and CCGCTCGAGTTAGAATCTTCCCCAGTACT), and cathepsin L (ACGCCAATTGACCATGAATCTTTTACTCTTTT and CCGCTCGAGTCAATTCACGACAGGATAGC). .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Synthesized:

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA). .. The siRNA oligo was synthesized by Genechem (Shanghai, China).

Construct:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter. .. The pCMV-flag-N 369-376 recombinant plasmid containing N protein gene with internal deletion of (aa369-376) was constructed using pfu DNA polymerase with Quickchange site directed mutagenesis kit (Stratagene) according to manufacturer's instruction and used as the template to obtain N226-422/ 369-376 by using the same primers for N226-422 construct.

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: Fusion Plasmid Construction mNeonGreen fluorescent protein expression vectors were constructed using C1 and N1 (Clontech-style) cloning vectors. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: To construct the plasmid pcDNA4/HisMaxB-hM116 for expression of M116 protein in mammalian cells, the corresponding DNA fragment was amplified by PCR (He et al., 2004a (He et al., , 2004b Luo et al., 2006b) , but only interaction via the C-terminal of N led to formation of pseudoparticles. .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: The following primer pairs were used to create the FADD DED mutant constructs: 5′-GTGTCGTCCAGCCTGTCGAGCGGCCAGACGGTCGAGCTCCTGCGC-3′ and 5′-GCGCAGGAGCTCGACCGTCTGGCCGCTCGACAGGCTGGACGACAC-3′ for the SELT mutations, 5′-CTGCACTCGGTGGCGTCCGGCACGGCGAGCAGCGAGCTGACC-3′ and 5′-GGTCAGCTCGCTGCTCGCCGTGCCGGACGCCACCGAGTGCAG-3′ for the SSLS mutations, 5′-CACTCGGTGTCGTCCGGCCTGGCGAGCGGCGAGGCGGTCGAGCTCCTGCGCGAGCTG-3′ and 5′- CAGCTCGCGCAGGAGCTGGACCGCCTCGCCGCTCGCCAGGCCGGACGACACCGAGTG-3′ for the SLT2 mutations, 5′-TCGGTGTCGTCCAGCCTGTCGAGCACCGAGGTCAGCGAGCTCCTGCGCGAGCTG-3′ and 5′-CAGCTCGCGCAGGAGCTCGCTGACCTCGGTGCTCGACAGGCTGGAC GACACCGA-3′ for the SLT3 mutations, and 5′- TCGGTGTCGTCCAGCCTGACCAGCACCGAGGTCACCGAGCTCCTGCGCGAGCTG-3′ and 5′-CAGCTCGCGCAGGAGCTCGGTGACCTCGGTGCTGGTCAGGCTGGACGA CACCGA-3′ for the SLT4 mutations. .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: In the resulting constructs, the cap genes were fused in-frame with a Gal4 DNA-binding domain. .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: Plasmid R267 was constructed by an insertion of a PCR fragment (nt 1038 to 1238) produced with a forward primer (5′-CCG GAATTC TGTGGTTATCCTGCGTTGA-3′ [the EcoRI site is underlined]), a reverse primer (5′-TTGGTCTGCGCACGCGTTCCATCCTTTCTT-3′), and a wild-type template. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Sequencing:

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: .. To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The thermocycling protocol for this PCR reaction was set as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 45 sec, and extension at 72°C for 1 min; The final extension is at 72°C for 10 min. primers for the PCR sub-cloning of GAS1 CDS are listed in .

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: The restriction enzyme sites incorporated into the primer sequences are underlined throughout this section. cDNAs were then amplified by PCR with sense primers 5ЈBCVS2187Eco (5Ј-GCT GAA TTC TCT TTC ACG ACA GCT GCA ACC T-3Ј, corresponding to nt 2187-2209 of the BCV S gene) and 5ЈBCVSEco (5Ј-GCT GAA TTC GAT AAT GGT ACT AGG CTG CAT GAT-3Ј, corresponding to the sequence at the 5Ј-end of the BCV S gene) (see Fig. 1A ). .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B.

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen). .. Expression and purification of the N and M proteins All recombinant proteins were affinity-purified using the His-tag introduced into the protein, and His-tags in the proteins used for biochemical analyses were removed enzymatically according to the manufacturer's instructions (see Supplement 1 for details).

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems). .. This fragment was subsequently cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-PvuII sites in the multiple cloning site to produce the plasmid pHis-E6AP.

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: The full length coding sequence of MT2-MMP was amplified by LA Taq polymerase (TaKaRa, Dalian, China) according to the manufacturer’s protocol. .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA).

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: The RNA probe used to detect HBV-specific RNAs was generated by the in vitro transcription of plasmid R267, which encodes the sequence from nt 1038 to 1238. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Expressing:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: .. Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter. .. To generate deletion mutant (N 220-231) of N protein gene with internal deletion of aa220-231, two PCR fragments were amplified using two pairs of primers.

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: Fusion Plasmid Construction mNeonGreen fluorescent protein expression vectors were constructed using C1 and N1 (Clontech-style) cloning vectors. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: To construct the plasmid pcDNA4/HisMaxB-hM116 for expression of M116 protein in mammalian cells, the corresponding DNA fragment was amplified by PCR (He et al., 2004a (He et al., , 2004b Luo et al., 2006b) , but only interaction via the C-terminal of N led to formation of pseudoparticles. .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA). .. Inserted sequence was confirmed by sequencing (Sangon Biotech, Shanghai, China).

Recombinase Polymerase Amplification:

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: Paragraph title: RPA. ... The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Gel Purification:

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: To obtain targeting fusion vectors, the appropriate cloning vector and a previously assembled EGFP or mEmerald fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Transfection:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: Paragraph title: Plasmids construction and cell transfection ... Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter.

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The assembled pcDNA3.1(+)-GAS1 (pcDNA-GAS1) was then ready for transfection, and pcDNA3.1(+) (pcDNA-vector) was also used as the negative control.

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461). .. All DNA for transfection was prepared using the Plasmid Maxi kit (QIAGEN).

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: Paragraph title: Plasmid, siRNA and cell transfection ... The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA).

Over Expression:

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: GAS1 plasmid construction pcDNA3.1(+) plasmid (Invitrogen; Thermo Fisher Scientific, Inc.) was used for GAS1 overexpression vector construction. .. To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA.

Ligation:

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The PCR products were digested with BamHI and EcoRI for AAV2, or BglII and EcoRI for AAV5 and AAV8, before ligation into the BamHI-/EcoRI-linearized plasmid pGBK-T7 (BD Clontech, Palo Alto, CA). .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Infection:

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: Briefly, HRT-18 cells were grown to monolayers and were infected with BCV virulent strain LY-138 at a multiplicity of infection (m.o.i.) of 10 in the presence of actinomycin D (10 g/ml). .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B.

Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale
Article Snippet: .. Briefly, genomic DNA from C. roseus infected with FD-C and FD-D reference strains was digested with 30 U EcoRI (Invitrogen, Carlsbad, CA) overnight at 37°C and then electrophoresed through the use of a 1 % (wt/vol) agarose gel, depurinated, and denatured in denaturing solution for 30 min. .. The gel was then neutralized in neutralizing solution for 30 min, and the DNA was transferred to a positively charged nylon membrane (Roche, Basel, Switzerland) by capillary action overnight using 10× SSC solution (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

Generated:

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: The RNA probe used to detect HBV-specific RNAs was generated by the in vitro transcription of plasmid R267, which encodes the sequence from nt 1038 to 1238. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: RT-PCR was performed as described previously (Zhang et al., 1991b) . .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B.

Binding Assay:

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems). .. This fragment was subsequently cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-PvuII sites in the multiple cloning site to produce the plasmid pHis-E6AP.

Mutagenesis:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: The wild type (1269 nt) and deletion mutant fragments of the N gene were made as shown in (Fig. 3B ). .. Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter.

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: Paragraph title: Preparations of mutant N proteins ... After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: The following primer pairs were used to create the FADD DED mutant constructs: 5′-GTGTCGTCCAGCCTGTCGAGCGGCCAGACGGTCGAGCTCCTGCGC-3′ and 5′-GCGCAGGAGCTCGACCGTCTGGCCGCTCGACAGGCTGGACGACAC-3′ for the SELT mutations, 5′-CTGCACTCGGTGGCGTCCGGCACGGCGAGCAGCGAGCTGACC-3′ and 5′-GGTCAGCTCGCTGCTCGCCGTGCCGGACGCCACCGAGTGCAG-3′ for the SSLS mutations, 5′-CACTCGGTGTCGTCCGGCCTGGCGAGCGGCGAGGCGGTCGAGCTCCTGCGCGAGCTG-3′ and 5′- CAGCTCGCGCAGGAGCTGGACCGCCTCGCCGCTCGCCAGGCCGGACGACACCGAGTG-3′ for the SLT2 mutations, 5′-TCGGTGTCGTCCAGCCTGTCGAGCACCGAGGTCAGCGAGCTCCTGCGCGAGCTG-3′ and 5′-CAGCTCGCGCAGGAGCTCGCTGACCTCGGTGCTCGACAGGCTGGAC GACACCGA-3′ for the SLT3 mutations, and 5′- TCGGTGTCGTCCAGCCTGACCAGCACCGAGGTCACCGAGCTCCTGCGCGAGCTG-3′ and 5′-CAGCTCGCGCAGGAGCTCGGTGACCTCGGTGCTGGTCAGGCTGGACGA CACCGA-3′ for the SLT4 mutations. .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems).

Isolation:

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: At 24 h postinfection, cells were lysed and total intracellular RNAs were isolated with the Trizol RNA isolation reagent (GIBCO BRL). .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B.

Subcloning:

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: .. To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The thermocycling protocol for this PCR reaction was set as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 45 sec, and extension at 72°C for 1 min; The final extension is at 72°C for 10 min. primers for the PCR sub-cloning of GAS1 CDS are listed in .

Size-exclusion Chromatography:

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The thermocycling protocol for this PCR reaction was set as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 45 sec, and extension at 72°C for 1 min; The final extension is at 72°C for 10 min. primers for the PCR sub-cloning of GAS1 CDS are listed in .

Labeling:

Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale
Article Snippet: Southern hybridization was performed following standard procedures ( ) using a digoxigenin (DIG) labeling and detection system (Roche, Basel, Switzerland). .. Briefly, genomic DNA from C. roseus infected with FD-C and FD-D reference strains was digested with 30 U EcoRI (Invitrogen, Carlsbad, CA) overnight at 37°C and then electrophoresed through the use of a 1 % (wt/vol) agarose gel, depurinated, and denatured in denaturing solution for 30 min.

Purification:

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: Purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: The purified PCR product was cloned into pEASY-T1 vector (TransGEN, Beijing, China). .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA).

Protein Purification:

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems). .. This fragment was subsequently cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-PvuII sites in the multiple cloning site to produce the plasmid pHis-E6AP.

Polymerase Chain Reaction:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: Plasmids construction and cell transfection The pGEMT-N plasmid was used as the template to amplify coding region of N protein with different deletion mutations by PCR. .. Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter.

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: .. To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The thermocycling protocol for this PCR reaction was set as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 45 sec, and extension at 72°C for 1 min; The final extension is at 72°C for 10 min. primers for the PCR sub-cloning of GAS1 CDS are listed in .

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: .. PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B. ..

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: Purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: The PCR product was cloned into pCR-BluntII (Invitrogen), and the resulting plasmid was introduced into TOP10. .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: The purified PCR product was cloned into pEASY-T1 vector (TransGEN, Beijing, China). .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: Plasmid R267 was constructed by an insertion of a PCR fragment (nt 1038 to 1238) produced with a forward primer (5′-CCG GAATTC TGTGGTTATCCTGCGTTGA-3′ [the EcoRI site is underlined]), a reverse primer (5′-TTGGTCTGCGCACGCGTTCCATCCTTTCTT-3′), and a wild-type template. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Blocking Assay:

Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale
Article Snippet: Briefly, genomic DNA from C. roseus infected with FD-C and FD-D reference strains was digested with 30 U EcoRI (Invitrogen, Carlsbad, CA) overnight at 37°C and then electrophoresed through the use of a 1 % (wt/vol) agarose gel, depurinated, and denatured in denaturing solution for 30 min. .. The membrane was prehybridized in 10 ml hybridization buffer (5× SSC, 0.1 % N-lauroylsarcosine [wt/vol], 0.02 % SDS [wt/vol], 1 % blocking solution [Roche, Basel, Switzerland], 600 μg salmon sperm DNA) for 4 h at 65°C.

cDNA Library Assay:

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The mouse cathepsin B and L cDNAs were amplified from a mouse liver cDNA library (BD Clontech) using the following primers: cathepsin B (CGGAATTCACCATGTGGTGG TCCTTGATCCT and CCGCTCGAGTTAGAATCTTCCCCAGTACT), and cathepsin L (ACGCCAATTGACCATGAATCTTTTACTCTTTT and CCGCTCGAGTCAATTCACGACAGGATAGC). .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Two Hybrid Screening:

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Plasmid Preparation:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: .. Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter. .. To generate deletion mutant (N 220-231) of N protein gene with internal deletion of aa220-231, two PCR fragments were amplified using two pairs of primers.

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: Paragraph title: GAS1 plasmid construction ... To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA.

Article Title: The spike but not the hemagglutinin/esterase protein of bovine coronavirus is necessary and sufficient for viral infection.
Article Snippet: Paragraph title: Plasmid construction ... PCR fragment A, which contains the 5Ј-end 2.2 kb of the S gene, was digested with EcoRI and cloned into the EcoRI site of pUC19 (GIBCO BRL), resulting in pUC/A; fragment B, which contains the 3Ј-end 2.0 kb of the S gene, was digested with EcoRI and BamHI and cloned into the EcoRI-BamHI sites of pUC19, resulting in pUC/B.

Article Title: A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum
Article Snippet: Paragraph title: Fusion Plasmid Construction ... To prepare mNeonGreen N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (cDNA source, Tom Keller, Florida State University (FSU), Tallahassee, FL, U.S.A.; NM_001130005.1); human calnexin, AgeI and NotI (Origene; NM_001746.3); c-src (7), BamHI and EcoRI (chicken c-src cDNA source: Marilyn Resh, Sloan-Kettering, New York; XM_001232484.1); connexin-43 (7), BamHI and NotI (rat C×43 cDNA source: Matthias Falk, Lehigh U; NM_001004099.1); EB3 (7), BglII and BamHI (EB3 cDNA source: Lynne Cassimeris, Lehigh University; NM_012326.2); human keratin 18, EcoRI and NotI (Open Biosystems; NM_199187.1); lamin B1 (10), EcoRI and BamHI (human lamin B1 cDNA source: George Patterson, NIH; NM_005573.2); Lifeact (7), BamHI and NotI (Lifeact cDNA source: IDT); mouse mannosidase 2 (112 N-terminal amino acids, MANNII; 10), NheI and BamHI (cDNA source: Jennifer Lippincott-Schwartz, NIH; NM_008549.2); myosin IIA (14) NheI and BglII (mouse myosin IIA cDNA source: Origene; NM_022410.2); human nucleoporin 50kDa, BamHI and NotI (NUP50 cDNA source: Origene; NM_007172.2); human pyruvate dehydrogenase, AgeI and NotI (human PDHA1 cDNA source: Origene; NM_000284); human peroxisomal membrane protein, NotI and AgeI (PMP cDNA source: Origene; NM_018663.1); human MAP Tau (10), AgeI and NotI (MAP Tau cDNA source: Origene; NM_016841); human TfR (20), BamHI and NotI (transferrin receptor cDNA source: George Patterson, NIH; NM_NM_003234); human TPX2 (10), AgeI and NotI (TPX2 cDNA source: Patricia Wadsworth, University of Massachusetts, Amherst; NM_012112.4); mouse VASP (10), NheI and BamHI (cDNA source: Clare Waterman, NIH; NM_009499); vascular epithelial cadherin (10), AgeI and NotI (human VE cadherin cDNA source: Origene; NM_001795.3), vimentin (7), BamHI and NotI (human vimentin cDNA source: Robert Goldman, Northwestern University; NM_003380.3), zyxin (6), BamHI and NotI (human zyxin cDNA source: Origene; NM_003461).

Article Title: Dissection and identification of regions required to form pseudoparticles by the interaction between the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus.
Article Snippet: The PCR product was cloned into pCR-BluntII (Invitrogen), and the resulting plasmid was introduced into TOP10. .. After confirmation of the sequence, the fragment was excised by digestion with EcoRI and NotI and subcloned into the corresponding sites of pcDNA4/HisMaxB (Invitrogen).

Article Title: The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain ▿
Article Snippet: .. To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems). .. This fragment was subsequently cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-PvuII sites in the multiple cloning site to produce the plasmid pHis-E6AP.

Article Title: Membrane type-2 matrix metalloproteinases improve the progression of renal cell cancer
Article Snippet: .. The fragments of MT2-MMP were inserted into the EcoRI and XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen Life Technologies, Carlsbad, CA, USA). .. Inserted sequence was confirmed by sequencing (Sangon Biotech, Shanghai, China).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: Plasmid R267 was constructed by an insertion of a PCR fragment (nt 1038 to 1238) produced with a forward primer (5′-CCG GAATTC TGTGGTTATCCTGCGTTGA-3′ [the EcoRI site is underlined]), a reverse primer (5′-TTGGTCTGCGCACGCGTTCCATCCTTTCTT-3′), and a wild-type template. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Hybridization:

Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale
Article Snippet: Paragraph title: Southern hybridization. ... Briefly, genomic DNA from C. roseus infected with FD-C and FD-D reference strains was digested with 30 U EcoRI (Invitrogen, Carlsbad, CA) overnight at 37°C and then electrophoresed through the use of a 1 % (wt/vol) agarose gel, depurinated, and denatured in denaturing solution for 30 min.

Irradiation:

Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale
Article Snippet: Briefly, genomic DNA from C. roseus infected with FD-C and FD-D reference strains was digested with 30 U EcoRI (Invitrogen, Carlsbad, CA) overnight at 37°C and then electrophoresed through the use of a 1 % (wt/vol) agarose gel, depurinated, and denatured in denaturing solution for 30 min. .. The transferred DNA was fixed to the membrane by UV irradiation.

Negative Control:

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The assembled pcDNA3.1(+)-GAS1 (pcDNA-GAS1) was then ready for transfection, and pcDNA3.1(+) (pcDNA-vector) was also used as the negative control.

Recombinant:

Article Title: Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus.
Article Snippet: Each fragment was digested with BamHI and EcoRI, and ligated into BamHI and EcoRI digested pcDNA3 (Invitrogen), an eukaryotic expression vector, such that transcripts were under the control of the CMV immediate-early promoter. .. The pCMV-flag-N 369-376 recombinant plasmid containing N protein gene with internal deletion of (aa369-376) was constructed using pfu DNA polymerase with Quickchange site directed mutagenesis kit (Stratagene) according to manufacturer's instruction and used as the template to obtain N226-422/ 369-376 by using the same primers for N226-422 construct.

Agarose Gel Electrophoresis:

Article Title: Genetic Diversity of Flavescence Dorée Phytoplasmas at the Vineyard Scale
Article Snippet: .. Briefly, genomic DNA from C. roseus infected with FD-C and FD-D reference strains was digested with 30 U EcoRI (Invitrogen, Carlsbad, CA) overnight at 37°C and then electrophoresed through the use of a 1 % (wt/vol) agarose gel, depurinated, and denatured in denaturing solution for 30 min. .. The gel was then neutralized in neutralizing solution for 30 min, and the DNA was transferred to a positively charged nylon membrane (Roche, Basel, Switzerland) by capillary action overnight using 10× SSC solution (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

In Vitro:

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: The RNA probe used to detect HBV-specific RNAs was generated by the in vitro transcription of plasmid R267, which encodes the sequence from nt 1038 to 1238. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Produced:

Article Title: microRNA-mediated GAS1 downregulation promotes the proliferation of synovial fibroblasts by PI3K-Akt signaling in osteoarthritis
Article Snippet: .. To obtain a GAS1 coding sequence (CDS) for subcloning, a PCR procedure was performed to generate a 1600-bp DNA product using a pair of primers containing EcoRI and XhoI restricting sites, using Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.) and template cDNA produced by from reverse transcription from non-OASF mRNA. .. The thermocycling protocol for this PCR reaction was set as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 45 sec, and extension at 72°C for 1 min; The final extension is at 72°C for 10 min. primers for the PCR sub-cloning of GAS1 CDS are listed in .

Article Title: A Novel cis-Acting Element Facilitates Minus-Strand DNA Synthesis during Reverse Transcription of the Hepatitis B Virus Genome
Article Snippet: Plasmid R267 was constructed by an insertion of a PCR fragment (nt 1038 to 1238) produced with a forward primer (5′-CCG GAATTC TGTGGTTATCCTGCGTTGA-3′ [the EcoRI site is underlined]), a reverse primer (5′-TTGGTCTGCGCACGCGTTCCATCCTTTCTT-3′), and a wild-type template. .. The resulting 200-bp fragment was digested with EcoRI and SphI and inserted into the EcoRI (nt 3014) and SphI (nt 3056) sites of pcDNA1/amp (Invitrogen).

Concentration Assay:

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. Clones were selected for growth on SD media (0.67% yeast nitrogen base without amino acids, 2% glucose, and supplemented with the appropriate amino acids at a concentration of 0.004%), lacking Shown are the proteins recovered in our screen for which we subsequently confirmed the ability to bind to AAV2 and AAV8 particles.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher ecori
    Sender plasmids expressed in Escherichia coli BL21. (A) The modular Sender vector allows facile cloning of any <t>EcoRI</t> , XbaI -flanked <t>synthase</t> open reading frame (ORF) and co-expression with mCherry (mCh) from a single bicistronic mRNA. The vector is represented as SBOL [ 44 ] glyphs (top) and a scaled circular map (bottom). (B) Optical density (OD) readings for E . coli cultures expressing each of the Sender plasmids. (C) mCherry expression is shown as end-point RFP signal normalized to OD 600 after an 8 hour growth period.
    Ecori, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 895 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori/product/Thermo Fisher
    Average 99 stars, based on 895 article reviews
    Price from $9.99 to $1999.99
    ecori - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher restriction endonucleases ecori
    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are <t>EcoRI,</t> <t>HinDIII</t> and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
    Restriction Endonucleases Ecori, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonucleases ecori/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction endonucleases ecori - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    Image Search Results


    Sender plasmids expressed in Escherichia coli BL21. (A) The modular Sender vector allows facile cloning of any EcoRI , XbaI -flanked synthase open reading frame (ORF) and co-expression with mCherry (mCh) from a single bicistronic mRNA. The vector is represented as SBOL [ 44 ] glyphs (top) and a scaled circular map (bottom). (B) Optical density (OD) readings for E . coli cultures expressing each of the Sender plasmids. (C) mCherry expression is shown as end-point RFP signal normalized to OD 600 after an 8 hour growth period.

    Journal: PLoS ONE

    Article Title: Characterization of diverse homoserine lactone synthases in Escherichia coli

    doi: 10.1371/journal.pone.0202294

    Figure Lengend Snippet: Sender plasmids expressed in Escherichia coli BL21. (A) The modular Sender vector allows facile cloning of any EcoRI , XbaI -flanked synthase open reading frame (ORF) and co-expression with mCherry (mCh) from a single bicistronic mRNA. The vector is represented as SBOL [ 44 ] glyphs (top) and a scaled circular map (bottom). (B) Optical density (OD) readings for E . coli cultures expressing each of the Sender plasmids. (C) mCherry expression is shown as end-point RFP signal normalized to OD 600 after an 8 hour growth period.

    Article Snippet: The Modular Sender Vector and each HSL synthase oligo were cut with EcoRI and XbaI (Thermo Fisher Scientific) and ligated using T4 ligase (New England Biolabs).

    Techniques: Plasmid Preparation, Clone Assay, Expressing

    Detection of AMPAR subunits in the mouse sciatic nerve. A , cDNA for GluA1–GluA4 subunits obtained after the second round of PCR was analyzed with electrophoresis in agarose gel. An example gel is shown. The predicted size of the PCR products was as follows: 632 bp for GluA1, 628 bp for GluA2, 630 bp for GluA3, and 626 bp for GluA4. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the φX174 DNA/HaeIII molecular weight marker. Band size for the marker is indicated on the left. B , Products of GluA1, GluA2, GluA3, and GluA4 obtained after the second round of PCR were digested with restriction enzymes specific for each subunit : PstI (275 and 357 bp) for GluA1 , SduI (270 and 358 bp) for GluA2, Eco47III (229 and 401 bp) for GluA3, and EcoRI (289 and 337 bp) for GluA4. An example gel is shown. cDNA for each subunits was cut into two fragments of the predicted size. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the pUC19 DNA/MspI (Hpall) molecular weight marker. Band size for the marker is indicated on the left. Throughout the figure, for positive controls, total RNA was extracted from HEK293 cells transfected with a plasmid encoding GluA1, GluA2, GluA3, or GluA4; this RNA was used as a template. For a negative control, the template was omitted. During RT-PCR, second-round PCR, and digestion, the samples of positive and negative control were always processed in parallel with the samples of RNA extracted from the sciatic nerves.

    Journal: The Journal of Neuroscience

    Article Title: Glutamate Activates AMPA Receptor Conductance in the Developing Schwann Cells of the Mammalian Peripheral Nerves

    doi: 10.1523/JNEUROSCI.1168-17.2017

    Figure Lengend Snippet: Detection of AMPAR subunits in the mouse sciatic nerve. A , cDNA for GluA1–GluA4 subunits obtained after the second round of PCR was analyzed with electrophoresis in agarose gel. An example gel is shown. The predicted size of the PCR products was as follows: 632 bp for GluA1, 628 bp for GluA2, 630 bp for GluA3, and 626 bp for GluA4. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the φX174 DNA/HaeIII molecular weight marker. Band size for the marker is indicated on the left. B , Products of GluA1, GluA2, GluA3, and GluA4 obtained after the second round of PCR were digested with restriction enzymes specific for each subunit : PstI (275 and 357 bp) for GluA1 , SduI (270 and 358 bp) for GluA2, Eco47III (229 and 401 bp) for GluA3, and EcoRI (289 and 337 bp) for GluA4. An example gel is shown. cDNA for each subunits was cut into two fragments of the predicted size. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the pUC19 DNA/MspI (Hpall) molecular weight marker. Band size for the marker is indicated on the left. Throughout the figure, for positive controls, total RNA was extracted from HEK293 cells transfected with a plasmid encoding GluA1, GluA2, GluA3, or GluA4; this RNA was used as a template. For a negative control, the template was omitted. During RT-PCR, second-round PCR, and digestion, the samples of positive and negative control were always processed in parallel with the samples of RNA extracted from the sciatic nerves.

    Article Snippet: For restriction analysis, the PCR products from GluA1, GluA2, GluA3, and GluA4 were digested with PstI, SduI, Eco47III, and EcoRI (all from Thermo Scientific), respectively.

    Techniques: Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis, Molecular Weight, Marker, Transfection, Plasmid Preparation, Negative Control, Reverse Transcription Polymerase Chain Reaction

    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Journal: 3 Biotech

    Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

    doi: 10.1007/s13205-018-1552-0

    Figure Lengend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

    Techniques: Southern Blot, Molecular Weight, Marker, Hybridization