ecori  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    EcoRI
    Description:
    EcoRI 50 000 units
    Catalog Number:
    R0101L
    Price:
    244
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs ecori
    EcoRI
    EcoRI 50 000 units
    https://www.bioz.com/result/ecori/product/New England Biolabs
    Average 99 stars, based on 497 article reviews
    Price from $9.99 to $1999.99
    ecori - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks"

    Article Title: ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks

    Journal:

    doi: 10.4161/cc.10.3.14713

    EcoRI-induced DSBs stimulate ERK phosphorylation similar to BrdU photolysis. (A) HEK293 cells were electroporated with either electroporation buffer only (lane 1–4) or increasing doses of EcoRI enzyme as indicated. Cells were collected at 2, 10,
    Figure Legend Snippet: EcoRI-induced DSBs stimulate ERK phosphorylation similar to BrdU photolysis. (A) HEK293 cells were electroporated with either electroporation buffer only (lane 1–4) or increasing doses of EcoRI enzyme as indicated. Cells were collected at 2, 10,

    Techniques Used: Electroporation

    EcoRI-induced DSBs increase H2AX, ERK and AKT phosphorylation in an ATM-dependent manner. (A) HEK293 cells were transfected with 5 µg of either pcDNA3 or pcDNA3-NLS-HA-EcoRI and cells collected for western blotting 72 h post transfection. Fold
    Figure Legend Snippet: EcoRI-induced DSBs increase H2AX, ERK and AKT phosphorylation in an ATM-dependent manner. (A) HEK293 cells were transfected with 5 µg of either pcDNA3 or pcDNA3-NLS-HA-EcoRI and cells collected for western blotting 72 h post transfection. Fold

    Techniques Used: Transfection, Hemagglutination Assay, Western Blot

    Dominant-negative AKT reduces ERK phosphorylation in response to IR and EcoRI-induced DSBs. HEK293 cells stably expressing pcDNA3 or DN-AKT-Myc plasmids were: (A) exposed to 0, 5 or 10 Gy and collected after 10 min for western blotting and subsequent
    Figure Legend Snippet: Dominant-negative AKT reduces ERK phosphorylation in response to IR and EcoRI-induced DSBs. HEK293 cells stably expressing pcDNA3 or DN-AKT-Myc plasmids were: (A) exposed to 0, 5 or 10 Gy and collected after 10 min for western blotting and subsequent

    Techniques Used: Dominant Negative Mutation, Stable Transfection, Expressing, Western Blot

    Low levels of DSBs increase cell proliferation. (A) Human U87 cells were electroporated with buffer alone, 2.5 U or 200 U of EcoRI enzyme as described in the legend to . Four days after electroporation cells were collected from triplicate dishes,
    Figure Legend Snippet: Low levels of DSBs increase cell proliferation. (A) Human U87 cells were electroporated with buffer alone, 2.5 U or 200 U of EcoRI enzyme as described in the legend to . Four days after electroporation cells were collected from triplicate dishes,

    Techniques Used: Electroporation

    2) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M116.733154

    CRISPR-EZ generates HDR-mediated genome modifications in mice. A, diagram illustrating the HDR editing scheme targeting Tyr exon 1. A synthesized 92-nt ssDNA donor oligo directs HDR-mediated editing, which replaces the endogenous HinfI restriction site with an EcoRI site, and causes a frameshift mutation to create a premature stop codon in Tyr exon 1. Arrows indicate the positions of primers that amplify a 200-bp DNA fragment for RFLP genotyping analyses. B, RFLP genotyping analyses revealed the successful NHEJ and HDR editing in morula embryos. Nested PCR amplicons ( top row ) were digested with both HinfI ( middle row ) and EcoRI ( bottom row ) to assay for NHEJ editing and HDR editing, respectively. HDR-specific digestion products (∼100 bp, migrate as one band) are marked with black arrowheads. C, representative Tyr -edited mouse litters for a microinjection experiment ( left ), a CRISPR-EZ experiment at 1-ms pulse length ( middle ), and a CRISPR-EZ experiment at 3-ms pulse length ( right ). D, quantification of coat color phenotypes of live Tyr- edited mice generated by microinjection and CRISPR-EZ experiments. E, CRISPR-EZ significantly improves mouse viability after genome editing compared with microinjection-based experiments. The University of California at Berkeley transgenic facility averages were calculated based on data collected across recent five CRISPR experiments that inject cas9 mRNA and sgRNAs for genome editing. F and G, albino mice obtained from CRISPR-EZ experiments were subjected to RFLP genotyping analyses ( F ) to demonstrate NHEJ and/or HDR editing, and select albino mice were sequence-confirmed ( G ). HDR-specific digestion products (∼100 bp, migrating as one band) are marked with black arrowheads ( F ). Red boxes indicate edited sequences, and red letters indicate the HDR-mediated precise modification ( G ). H, diagram illustrating the editing scheme to delete exon 3 of the Mecp2 gene by CRISPR-EZ. Two sgRNAs were designed to direct Cas9 cleavage in Mecp2 intron 2 and intron 3 to generate the ∼720-bp deletion of exon 3. Arrows indicate the positions of primers used for PCR genotyping that amplifies across the deleted region. I and J, representative PCR genotyping analyses ( I ) and sequencing confirmation ( J ) for assessing the editing efficiency of Mecp2 in mouse morula embryos. Red boxes indicate deleted sequences. K, diagram illustrating our HDR editing scheme that inserts a V5 epitope tag (42 bp in length) at the 3′ of the Sox2 open reading frame via a 162-nt ssDNA donor oligo using CRISPR-EZ. Arrows indicate the positions of primers that amplify a 180-bp DNA fragment across the edited genomic region. L and M, PCR genotyping analysis ( L ) and immunofluorescence staining ( M ) for assessing the editing efficiency of the sox2 gene in mouse morula and blastocyst embryos, respectively. Scale bar, 20 μm.
    Figure Legend Snippet: CRISPR-EZ generates HDR-mediated genome modifications in mice. A, diagram illustrating the HDR editing scheme targeting Tyr exon 1. A synthesized 92-nt ssDNA donor oligo directs HDR-mediated editing, which replaces the endogenous HinfI restriction site with an EcoRI site, and causes a frameshift mutation to create a premature stop codon in Tyr exon 1. Arrows indicate the positions of primers that amplify a 200-bp DNA fragment for RFLP genotyping analyses. B, RFLP genotyping analyses revealed the successful NHEJ and HDR editing in morula embryos. Nested PCR amplicons ( top row ) were digested with both HinfI ( middle row ) and EcoRI ( bottom row ) to assay for NHEJ editing and HDR editing, respectively. HDR-specific digestion products (∼100 bp, migrate as one band) are marked with black arrowheads. C, representative Tyr -edited mouse litters for a microinjection experiment ( left ), a CRISPR-EZ experiment at 1-ms pulse length ( middle ), and a CRISPR-EZ experiment at 3-ms pulse length ( right ). D, quantification of coat color phenotypes of live Tyr- edited mice generated by microinjection and CRISPR-EZ experiments. E, CRISPR-EZ significantly improves mouse viability after genome editing compared with microinjection-based experiments. The University of California at Berkeley transgenic facility averages were calculated based on data collected across recent five CRISPR experiments that inject cas9 mRNA and sgRNAs for genome editing. F and G, albino mice obtained from CRISPR-EZ experiments were subjected to RFLP genotyping analyses ( F ) to demonstrate NHEJ and/or HDR editing, and select albino mice were sequence-confirmed ( G ). HDR-specific digestion products (∼100 bp, migrating as one band) are marked with black arrowheads ( F ). Red boxes indicate edited sequences, and red letters indicate the HDR-mediated precise modification ( G ). H, diagram illustrating the editing scheme to delete exon 3 of the Mecp2 gene by CRISPR-EZ. Two sgRNAs were designed to direct Cas9 cleavage in Mecp2 intron 2 and intron 3 to generate the ∼720-bp deletion of exon 3. Arrows indicate the positions of primers used for PCR genotyping that amplifies across the deleted region. I and J, representative PCR genotyping analyses ( I ) and sequencing confirmation ( J ) for assessing the editing efficiency of Mecp2 in mouse morula embryos. Red boxes indicate deleted sequences. K, diagram illustrating our HDR editing scheme that inserts a V5 epitope tag (42 bp in length) at the 3′ of the Sox2 open reading frame via a 162-nt ssDNA donor oligo using CRISPR-EZ. Arrows indicate the positions of primers that amplify a 180-bp DNA fragment across the edited genomic region. L and M, PCR genotyping analysis ( L ) and immunofluorescence staining ( M ) for assessing the editing efficiency of the sox2 gene in mouse morula and blastocyst embryos, respectively. Scale bar, 20 μm.

    Techniques Used: CRISPR, Mouse Assay, Synthesized, Mutagenesis, Non-Homologous End Joining, Nested PCR, Mass Spectrometry, Generated, Transgenic Assay, Sequencing, Modification, Polymerase Chain Reaction, Immunofluorescence, Staining

    3) Product Images from "Detection of Molecular Diversity in Bacillus atrophaeus by Amplified Fragment Length Polymorphism Analysis"

    Article Title: Detection of Molecular Diversity in Bacillus atrophaeus by Amplified Fragment Length Polymorphism Analysis

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.70.5.2786-2790.2004

    Digitized AFLP patterns of Bacillus taxa generated using primer sets EcoRI plus C/MseI plus CA (A) and EcoRI plus C/MseI plus CC (B). Across the top of each image is the fragment size scale (in bases). The Bacillus species and strain designations for
    Figure Legend Snippet: Digitized AFLP patterns of Bacillus taxa generated using primer sets EcoRI plus C/MseI plus CA (A) and EcoRI plus C/MseI plus CC (B). Across the top of each image is the fragment size scale (in bases). The Bacillus species and strain designations for

    Techniques Used: Generated

    4) Product Images from "Identification of Lactococcus lactis Genes Required for Bacteriophage Adsorption"

    Article Title: Identification of Lactococcus lactis Genes Required for Bacteriophage Adsorption

    Journal:

    doi: 10.1128/AEM.70.10.5825-5832.2004

    Southern analyses of chromosomal DNA from selected integrants of L. lactis IL1403 with reduced binding of phage bIL170. Chromosomal DNA was digested with EcoRI, and pGh9:IS S1 was used as a probe. The two bands in each lane represent chromosomal DNA with a flanking pGh9:IS S1 sequence and a flanking IS S1 sequence . The numbers at the top indicate the integrants used (see Table ).
    Figure Legend Snippet: Southern analyses of chromosomal DNA from selected integrants of L. lactis IL1403 with reduced binding of phage bIL170. Chromosomal DNA was digested with EcoRI, and pGh9:IS S1 was used as a probe. The two bands in each lane represent chromosomal DNA with a flanking pGh9:IS S1 sequence and a flanking IS S1 sequence . The numbers at the top indicate the integrants used (see Table ).

    Techniques Used: Binding Assay, Sequencing

    5) Product Images from "Drug screening with human SMN2 reporter identifies SMN protein stabilizers to correct SMA pathology"

    Article Title: Drug screening with human SMN2 reporter identifies SMN protein stabilizers to correct SMA pathology

    Journal: Life Science Alliance

    doi: 10.26508/lsa.201800268

    Establishment of monoclonal SMN2-GFP reporter line in HEK293. (A) Representative images showing the monoclonal SMN2-GFP reporter line. Scale bar, 50 μm. (B) Southern blot showing expected GFP integration. All clones generate a 4,789-bp size DNA fragment comprising the GFP cassette after EcoRI and BamHI digestion. (C) Genomic DNA PCR analysis identifying correct GFP integration. (D) Western blot showing expression of SMNΔ7-GFP fusion proteins in all reporter lines generated. (E) Sequencing of the DNA sequences flanking the GFP cassette confirmed SMN2 gene rather than SMN1 gene integration. (F) GFP integration in SMN2 exon 8 showed normal splicing patterns as more than 90% SMN-Δ7 were spliced. (G) A small pool library screening identified 14 hits which brightened GFP fluorescence in the SMN2-GFP reporter line. Represented pictures before and after compound #8 (Z-FA-FMK) treatment are shown. Scale bar, 50 μm. (H) Quantification data showing that 14 hits significantly increased GFP intensity in the SMN2-GFP reporter cell line by more than 0.5-fold. Data were presented as mean ± SEM, n = 3. * P
    Figure Legend Snippet: Establishment of monoclonal SMN2-GFP reporter line in HEK293. (A) Representative images showing the monoclonal SMN2-GFP reporter line. Scale bar, 50 μm. (B) Southern blot showing expected GFP integration. All clones generate a 4,789-bp size DNA fragment comprising the GFP cassette after EcoRI and BamHI digestion. (C) Genomic DNA PCR analysis identifying correct GFP integration. (D) Western blot showing expression of SMNΔ7-GFP fusion proteins in all reporter lines generated. (E) Sequencing of the DNA sequences flanking the GFP cassette confirmed SMN2 gene rather than SMN1 gene integration. (F) GFP integration in SMN2 exon 8 showed normal splicing patterns as more than 90% SMN-Δ7 were spliced. (G) A small pool library screening identified 14 hits which brightened GFP fluorescence in the SMN2-GFP reporter line. Represented pictures before and after compound #8 (Z-FA-FMK) treatment are shown. Scale bar, 50 μm. (H) Quantification data showing that 14 hits significantly increased GFP intensity in the SMN2-GFP reporter cell line by more than 0.5-fold. Data were presented as mean ± SEM, n = 3. * P

    Techniques Used: Southern Blot, Clone Assay, Polymerase Chain Reaction, Western Blot, Expressing, Generated, Sequencing, Library Screening, Fluorescence

    6) Product Images from "Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice"

    Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20041074

    DC-PCR analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic DNA was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.
    Figure Legend Snippet: DC-PCR analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic DNA was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.

    Techniques Used: Polymerase Chain Reaction, Isolation, In Vitro

    7) Product Images from "Transduction of human embryonic stem cells by ecotropic retroviral vectors"

    Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl674

    Transduction of hES cells with murine retroviral vectors. ( A ) Transfection efficiencies of undifferentiated hES cells using optimized protocols for lipofection (L), electroporation (E) and nucleofection (N) techniques. ( B ) mCAT1-HA expression (green) in nucleofected hES cells cultured on matrigel. Twenty-four hours after plating, the cells show a flattened morphology typical for colonies propagated on matrigel. Nuclear expression of Oct-4 (red) reflects their undifferentiated state. ( C ) Schematic illustration of the two-step protocol used for transduction of hES cells with ecotropic retroviral vectors. First cells are nucleofected with a construct encoding the murine retrovirus receptor mCAT1. Twenty-four hours later they are transduced with a murine retroviral vector. Transduced cultures are either analyzed for transgene expression after 48 h or subjected to selection of permanently transduced clones. The integrated provirus expresses the EGFP transgene from the viral LTR linked to a neomycin resistance gene (neoR) by an internal ribosome entry site (IRES). ( D ) Forty-eight hours after infection, 16.4 ± 5.9% of the total cell population showed EGFP-expression. Normalized to the proportion of mCAT1-expressing cells determined in (A), this corresponds to a calculated transduction efficiency of ∼30% of the mCAT1-expressing cells (mean values from n = 5 independent experiments). ( E – G ) Transduced EGFP-positive cells continue to express the pluripotency-associated markers Oct-4 (E), Tra-1-60 (F) and Tra-1-81 (G) (all red; counterstain DAPI). ( H ) Five passages after transduction, four clones were subjected to Southern analysis. A single integration of the EGFP transgene could be detected in clones PK2, PK4 and PK7. Clone PK5 displays two bands, which could be the result of a double integration, a mixed clone population or a mutation of the vector provirus. Restriction analysis was performed with EcoRI (for genomic DNA) and ClaI (unique site within the retroviral vector). Scale bars: B,E: 100 μm; F: 30 μm; G: 50 μm.
    Figure Legend Snippet: Transduction of hES cells with murine retroviral vectors. ( A ) Transfection efficiencies of undifferentiated hES cells using optimized protocols for lipofection (L), electroporation (E) and nucleofection (N) techniques. ( B ) mCAT1-HA expression (green) in nucleofected hES cells cultured on matrigel. Twenty-four hours after plating, the cells show a flattened morphology typical for colonies propagated on matrigel. Nuclear expression of Oct-4 (red) reflects their undifferentiated state. ( C ) Schematic illustration of the two-step protocol used for transduction of hES cells with ecotropic retroviral vectors. First cells are nucleofected with a construct encoding the murine retrovirus receptor mCAT1. Twenty-four hours later they are transduced with a murine retroviral vector. Transduced cultures are either analyzed for transgene expression after 48 h or subjected to selection of permanently transduced clones. The integrated provirus expresses the EGFP transgene from the viral LTR linked to a neomycin resistance gene (neoR) by an internal ribosome entry site (IRES). ( D ) Forty-eight hours after infection, 16.4 ± 5.9% of the total cell population showed EGFP-expression. Normalized to the proportion of mCAT1-expressing cells determined in (A), this corresponds to a calculated transduction efficiency of ∼30% of the mCAT1-expressing cells (mean values from n = 5 independent experiments). ( E – G ) Transduced EGFP-positive cells continue to express the pluripotency-associated markers Oct-4 (E), Tra-1-60 (F) and Tra-1-81 (G) (all red; counterstain DAPI). ( H ) Five passages after transduction, four clones were subjected to Southern analysis. A single integration of the EGFP transgene could be detected in clones PK2, PK4 and PK7. Clone PK5 displays two bands, which could be the result of a double integration, a mixed clone population or a mutation of the vector provirus. Restriction analysis was performed with EcoRI (for genomic DNA) and ClaI (unique site within the retroviral vector). Scale bars: B,E: 100 μm; F: 30 μm; G: 50 μm.

    Techniques Used: Transduction, Transfection, Electroporation, Hemagglutination Assay, Expressing, Cell Culture, Construct, Plasmid Preparation, Selection, Clone Assay, Infection, Mutagenesis

    8) Product Images from "Replisome-mediated translesion synthesis by a cellular replicase"

    Article Title: Replisome-mediated translesion synthesis by a cellular replicase

    Journal:

    doi: 10.1074/jbc.M117.800441

    The Pol III HE is capable of TLS. A , map of the plasmid template used in the replication reactions and the position of lesions in each template. Standard replication reactions are incubated in the presence of DNA gyrase for 8 min. Additional replication is inhibited by the addition of AMP-PNP and ddNTPs. The products are digested with EcoRI and PvuI. Products formed with an undamaged template are equal-length leading- and lagging-strand sister duplexes. With a damaged template, several types of products can form. A stalled fork can form. If lesion skipping occurs, the leading-strand sister duplex will contain a gap between the stall in the nascent leading strand and the point of restart, whereas the lagging-strand sister duplex will be complete. If uncoupled unwinding occurs concomitant with lagging-strand synthesis but in the absence of continued leading-strand synthesis, the leading-strand sister duplex will be incomplete, whereas the lagging-strand sister duplex will be complete. If TLS occurs, both the leading- and lagging-strand sister duplexes will be complete with the former carrying a full-length nascent leading strand. Also shown are the sequences at the damage site of the templates used. B , TLS by the replisome. Standard replication reactions using the indicated template DNAs and either in the presence (750 μ m ) or absence of additional dNTPs were analyzed by electrophoresis through denaturing alkaline agarose gels as described under “Experimental procedures.” The extent of replication as a fraction of template utilization (completely replicated templates divided by total template in the reaction), calculated from the extent of incorporation of radioactive precursor into acid-insoluble product, is shown below each lane. C , leading- and lagging-strand synthesis remains equivalent during TLS replication. Standard replication reactions using the indicated templates and either in the presence or absence of elevated ( elev ) concentrations of dNTPs were analyzed by native agarose gel electrophoresis as described under “Experimental procedures.” D , extent of TLS on the damaged templates. Shown are the mean and standard deviations ( error bars ) from five experiments. UN , undamaged template; CPD , CPD-containing template; THF1 , THF2 , and THF3 , THF-containing templates; FL , full length.
    Figure Legend Snippet: The Pol III HE is capable of TLS. A , map of the plasmid template used in the replication reactions and the position of lesions in each template. Standard replication reactions are incubated in the presence of DNA gyrase for 8 min. Additional replication is inhibited by the addition of AMP-PNP and ddNTPs. The products are digested with EcoRI and PvuI. Products formed with an undamaged template are equal-length leading- and lagging-strand sister duplexes. With a damaged template, several types of products can form. A stalled fork can form. If lesion skipping occurs, the leading-strand sister duplex will contain a gap between the stall in the nascent leading strand and the point of restart, whereas the lagging-strand sister duplex will be complete. If uncoupled unwinding occurs concomitant with lagging-strand synthesis but in the absence of continued leading-strand synthesis, the leading-strand sister duplex will be incomplete, whereas the lagging-strand sister duplex will be complete. If TLS occurs, both the leading- and lagging-strand sister duplexes will be complete with the former carrying a full-length nascent leading strand. Also shown are the sequences at the damage site of the templates used. B , TLS by the replisome. Standard replication reactions using the indicated template DNAs and either in the presence (750 μ m ) or absence of additional dNTPs were analyzed by electrophoresis through denaturing alkaline agarose gels as described under “Experimental procedures.” The extent of replication as a fraction of template utilization (completely replicated templates divided by total template in the reaction), calculated from the extent of incorporation of radioactive precursor into acid-insoluble product, is shown below each lane. C , leading- and lagging-strand synthesis remains equivalent during TLS replication. Standard replication reactions using the indicated templates and either in the presence or absence of elevated ( elev ) concentrations of dNTPs were analyzed by native agarose gel electrophoresis as described under “Experimental procedures.” D , extent of TLS on the damaged templates. Shown are the mean and standard deviations ( error bars ) from five experiments. UN , undamaged template; CPD , CPD-containing template; THF1 , THF2 , and THF3 , THF-containing templates; FL , full length.

    Techniques Used: Plasmid Preparation, Incubation, Electrophoresis, Agarose Gel Electrophoresis

    9) Product Images from "Identification of Hedysarum Varieties Using Amplified Fragment Length Polymorphism on a Capillary Electrophoresis System"

    Article Title: Identification of Hedysarum Varieties Using Amplified Fragment Length Polymorphism on a Capillary Electrophoresis System

    Journal:

    doi:

    Final genotypes in a binary format for subset of the samples and alleles from the AFLP run with the primer pair FAM-Ecori-ACA and Msei-CTT as displayed in the Genotypes tab of the GeneMapper software.
    Figure Legend Snippet: Final genotypes in a binary format for subset of the samples and alleles from the AFLP run with the primer pair FAM-Ecori-ACA and Msei-CTT as displayed in the Genotypes tab of the GeneMapper software.

    Techniques Used: Software

    10) Product Images from "Capsule Gene Analysis of Invasive Haemophilus influenzae: Accuracy of Serotyping and Prevalence of IS1016 among Nontypeable Isolates"

    Article Title: Capsule Gene Analysis of Invasive Haemophilus influenzae: Accuracy of Serotyping and Prevalence of IS1016 among Nontypeable Isolates

    Journal:

    doi: 10.1128/JCM.00794-07

    Southern hybridization of EcoRI-digested chromosomal DNA from Hib strain 1007 and Hib-minus strain GA346 probed with DIG-labeled pUO38. GA346 contains the major hybridizing bands corresponding to the Hib cap locus (20, 10.2, 4.4, 2.7, and 2.1 kb) and
    Figure Legend Snippet: Southern hybridization of EcoRI-digested chromosomal DNA from Hib strain 1007 and Hib-minus strain GA346 probed with DIG-labeled pUO38. GA346 contains the major hybridizing bands corresponding to the Hib cap locus (20, 10.2, 4.4, 2.7, and 2.1 kb) and

    Techniques Used: Hybridization, Labeling

    Southern hybridization analysis of representative isolates demonstrating hybridization with IS 1016 . Chromosomal DNA was digested with EcoRI from Hib 1007 (lane 2), Rd (lane 3), GA858 (lane 4), GA1354 (lane 5), GA4891 (lane 6), GA2078 (lane 7), GA3204
    Figure Legend Snippet: Southern hybridization analysis of representative isolates demonstrating hybridization with IS 1016 . Chromosomal DNA was digested with EcoRI from Hib 1007 (lane 2), Rd (lane 3), GA858 (lane 4), GA1354 (lane 5), GA4891 (lane 6), GA2078 (lane 7), GA3204

    Techniques Used: Hybridization

    11) Product Images from "Restriction site detection in repetitive nuclear DNA sequences of Trypanosoma evansi for strain differentiation among different isolates"

    Article Title: Restriction site detection in repetitive nuclear DNA sequences of Trypanosoma evansi for strain differentiation among different isolates

    Journal:

    doi: 10.1007/s12639-014-0582-8

    RE digestion of TE-PCR product with EcoRI, Pst I, Eco91l and HindIII . [ Lane M 100 bp DNA ladder; Lane 1 TE-PCR product with out RE; Lane 2 TE-PCR product with EcoRI ; Lane 3 TE-PCR product with Pst I ; Lane 5 TE-PCR product with out RE; Lane 6
    Figure Legend Snippet: RE digestion of TE-PCR product with EcoRI, Pst I, Eco91l and HindIII . [ Lane M 100 bp DNA ladder; Lane 1 TE-PCR product with out RE; Lane 2 TE-PCR product with EcoRI ; Lane 3 TE-PCR product with Pst I ; Lane 5 TE-PCR product with out RE; Lane 6

    Techniques Used: Polymerase Chain Reaction

    12) Product Images from "TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression"

    Article Title: TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0186568

    pET-BccI untreated and digested. 1 : DNA ladder. 2 : pET-BccI untreated. 3 : pET-BccI digested with BccI. 4 , 5 , 6 : pET-BccI digested with EcoRI, BamHI and HindIII, respectively.
    Figure Legend Snippet: pET-BccI untreated and digested. 1 : DNA ladder. 2 : pET-BccI untreated. 3 : pET-BccI digested with BccI. 4 , 5 , 6 : pET-BccI digested with EcoRI, BamHI and HindIII, respectively.

    Techniques Used: Positron Emission Tomography

    The novel protein-expression vector pET-BccI. The pET-26b (+) derived plasmid has a pBR322 origin of replication, which together with the ROP protein regulates the plasmid copy number per bacterial cell. The kanamycin resistance gene enables positive selection of the transformed E . coli cells in the presence of kanamycin. BamHI, EcoRI and HindIII recognition sites, flanking both sites of the T7 promoter, cloning site and T7 terminator cassette, facilitate the screening of the transformed colonies for the recombinant transformants. The cloning site of pET-BccI, composed of two adjacent reverse BccI recognition sites, provides single 5΄-T and C overhangs after digestion with BccI, which are suitable for the ligation of DNA molecules with complementary edges.
    Figure Legend Snippet: The novel protein-expression vector pET-BccI. The pET-26b (+) derived plasmid has a pBR322 origin of replication, which together with the ROP protein regulates the plasmid copy number per bacterial cell. The kanamycin resistance gene enables positive selection of the transformed E . coli cells in the presence of kanamycin. BamHI, EcoRI and HindIII recognition sites, flanking both sites of the T7 promoter, cloning site and T7 terminator cassette, facilitate the screening of the transformed colonies for the recombinant transformants. The cloning site of pET-BccI, composed of two adjacent reverse BccI recognition sites, provides single 5΄-T and C overhangs after digestion with BccI, which are suitable for the ligation of DNA molecules with complementary edges.

    Techniques Used: Expressing, Plasmid Preparation, Positron Emission Tomography, Derivative Assay, Selection, Transformation Assay, Clone Assay, Recombinant, Ligation

    13) Product Images from "Two Novel Bacterial Biosensors for Detection of Nitrate Availability in the Rhizosphere"

    Article Title: Two Novel Bacterial Biosensors for Detection of Nitrate Availability in the Rhizosphere

    Journal:

    doi: 10.1128/AEM.71.12.8537-8547.2005

    Schematic diagram of the construction of the pNice fusion plasmid containing the L28H- fnr gene. Cm r , Km r , and Ap r , resistance to chloramphenicol, kanamycin, and ampicillin, respectively. narGp indicates a 592-bp HindIII-EcoRI fragment of the narG promoter-regulatory
    Figure Legend Snippet: Schematic diagram of the construction of the pNice fusion plasmid containing the L28H- fnr gene. Cm r , Km r , and Ap r , resistance to chloramphenicol, kanamycin, and ampicillin, respectively. narGp indicates a 592-bp HindIII-EcoRI fragment of the narG promoter-regulatory

    Techniques Used: Plasmid Preparation

    14) Product Images from "Identification of an Important Orphan Histidine Kinase for the Initiation of Sporulation and Enterotoxin Production by Clostridium perfringens Type F Strain SM101"

    Article Title: Identification of an Important Orphan Histidine Kinase for the Initiation of Sporulation and Enterotoxin Production by Clostridium perfringens Type F Strain SM101

    Journal: mBio

    doi: 10.1128/mBio.02674-18

    Characterization of the SM101-CPR1055KO null mutant and analysis of sporulation and CPE production. (A) PCR confirming insertional mutagenesis of th e cpr1055 gene in SM101-CPR1055. Shown is the cpr1055 PCR product amplified using DNA from wild-type SM101 (left lane) or the SM101-CPR1055KO mutant (right lane). Note that DNA from the null mutant strain supported amplification of a larger product due to the insertion of an intron into its cpr1055 gene. (B) Southern blot hybridization with an intron-specific probe with DNA from SM101 or SM101-CPR1055KO. The blot shows results of intron-specific Southern blot hybridization with DNA from wild-type SM101 (left lane) or the cpr1055 null mutant (middle lane). DNA from each strain was digested overnight with EcoRI at 37°C and then electrophoresed on a 1% agarose gel. The size of the hybridizing band in the right lane is shown to the left. Using DNA from wild-type SM101, no intron-specific band was detected. However, a single intron-specific band was detected for the SM101-CPR1055KO mutant. (C) RT-PCR analysis for cpr1055 (top panel) or polC (middle panel) transcription in wild-type SM101 or the SM101-CPR1055KO mutant. SM101 DNA was used as a positive control (gDNA). PCRs lacking template DNA acted as a negative control. To show that the RNA preparations from both strains were free from DNA contamination, the samples were also subjected to PCR without reverse transcription (bottom panel). (D) Growth curves for wild-type SM101 versus the SM101-CPR1055KO mutant cultured at 37°C in MDS medium for up to 8 h. Aliquots of each culture were measured every 2 h for their OD 600 . (E) Comparison of results of sporulation by WT SM101 versus SM101-CPR1055KO. Both strains were grown overnight at 37°C in MDS and then subjected to heat shock treatment and plated on BHI agar. After overnight incubation in an anaerobic jar, the resultant colonies were counted and the counts were converted to numbers of spores per milliliter. (F) Comparison of levels of CPE production by SM101 versus the SM101-CPR1055KO mutant. Supernatants of WT SM101 or SM101-CPR1055KO were grown overnight at 37°C in MDS and then assessed by Western blotting for CPE. The results showed that CPE production remained strong after inactivation of the cpr1055 gene. All experiments were repeated three times, and mean representative values are shown. The markers used in panels A and C were Thermo Fisher 1-kb DNA ladders.
    Figure Legend Snippet: Characterization of the SM101-CPR1055KO null mutant and analysis of sporulation and CPE production. (A) PCR confirming insertional mutagenesis of th e cpr1055 gene in SM101-CPR1055. Shown is the cpr1055 PCR product amplified using DNA from wild-type SM101 (left lane) or the SM101-CPR1055KO mutant (right lane). Note that DNA from the null mutant strain supported amplification of a larger product due to the insertion of an intron into its cpr1055 gene. (B) Southern blot hybridization with an intron-specific probe with DNA from SM101 or SM101-CPR1055KO. The blot shows results of intron-specific Southern blot hybridization with DNA from wild-type SM101 (left lane) or the cpr1055 null mutant (middle lane). DNA from each strain was digested overnight with EcoRI at 37°C and then electrophoresed on a 1% agarose gel. The size of the hybridizing band in the right lane is shown to the left. Using DNA from wild-type SM101, no intron-specific band was detected. However, a single intron-specific band was detected for the SM101-CPR1055KO mutant. (C) RT-PCR analysis for cpr1055 (top panel) or polC (middle panel) transcription in wild-type SM101 or the SM101-CPR1055KO mutant. SM101 DNA was used as a positive control (gDNA). PCRs lacking template DNA acted as a negative control. To show that the RNA preparations from both strains were free from DNA contamination, the samples were also subjected to PCR without reverse transcription (bottom panel). (D) Growth curves for wild-type SM101 versus the SM101-CPR1055KO mutant cultured at 37°C in MDS medium for up to 8 h. Aliquots of each culture were measured every 2 h for their OD 600 . (E) Comparison of results of sporulation by WT SM101 versus SM101-CPR1055KO. Both strains were grown overnight at 37°C in MDS and then subjected to heat shock treatment and plated on BHI agar. After overnight incubation in an anaerobic jar, the resultant colonies were counted and the counts were converted to numbers of spores per milliliter. (F) Comparison of levels of CPE production by SM101 versus the SM101-CPR1055KO mutant. Supernatants of WT SM101 or SM101-CPR1055KO were grown overnight at 37°C in MDS and then assessed by Western blotting for CPE. The results showed that CPE production remained strong after inactivation of the cpr1055 gene. All experiments were repeated three times, and mean representative values are shown. The markers used in panels A and C were Thermo Fisher 1-kb DNA ladders.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Southern Blot, Hybridization, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Positive Control, Negative Control, Cell Culture, Incubation, Western Blot

    Characterization of the SM101-CPR0195KO null mutant and SM101-CPR0195comp complementing strain. (A) PCR confirming insertional mutagenesis of the cpr0195 gene in SM101-0195KO. Shown is the cpr0195 PCR product amplified using DNA from wild-type SM101 (lane 2), the SM101-CPR0195KO mutant (lane 3), or the SM101-CPR0195comp complementing strain (lane 4). Note that, compared to the ∼300-bp product amplified using DNA containing a wild-type cpr0195 gene, DNA from the null mutant strain supported amplification of a larger (∼1,200-bp) product due to the insertion of an intron into its cpr0195 gene. (B) Southern blot hybridization of an intron-specific probe with DNA from SM101 (left), SM101-CPR0195KO (middle), or SM101-CPR0195comp (right). DNA from each strain was digested overnight with EcoRI at 37°C and then electrophoresed on a 1% agarose gel. The size of the hybridizing band in the middle and right lanes is shown to the left. Using DNA from wild-type SM101, no intron-specific band was detected, while a single intron-specific band was detected for the SM101-CPR0195KO mutant and complementing strain. (C) RT-PCR analysis for cpr019 5 (top panel) or polC (middle panel) transcription in wild-type SM101, the SM101-CPR0195KO mutant, or the complementing strain. SM101 DNA was used as a positive control (gDNA [genomic DNA]). PCRs lacking template DNA acted as a negative control. To show that the RNA preparations from the three strains were free from DNA contamination, these samples were also subjected to PCR without reverse transcription (bottom panel). (D) Growth curves for wild-type SM101, the SM101-CPR0195KO mutant, and the SM101-CPR0195comp strain cultured at 37°C in MDS medium for up to 8 h. Aliquots of each culture were measured every 2 h for their OD 600 . All experiments were repeated three times, and mean representative values are shown. The markers used in panels A and C were Thermo Fisher 1-kb DNA ladders.
    Figure Legend Snippet: Characterization of the SM101-CPR0195KO null mutant and SM101-CPR0195comp complementing strain. (A) PCR confirming insertional mutagenesis of the cpr0195 gene in SM101-0195KO. Shown is the cpr0195 PCR product amplified using DNA from wild-type SM101 (lane 2), the SM101-CPR0195KO mutant (lane 3), or the SM101-CPR0195comp complementing strain (lane 4). Note that, compared to the ∼300-bp product amplified using DNA containing a wild-type cpr0195 gene, DNA from the null mutant strain supported amplification of a larger (∼1,200-bp) product due to the insertion of an intron into its cpr0195 gene. (B) Southern blot hybridization of an intron-specific probe with DNA from SM101 (left), SM101-CPR0195KO (middle), or SM101-CPR0195comp (right). DNA from each strain was digested overnight with EcoRI at 37°C and then electrophoresed on a 1% agarose gel. The size of the hybridizing band in the middle and right lanes is shown to the left. Using DNA from wild-type SM101, no intron-specific band was detected, while a single intron-specific band was detected for the SM101-CPR0195KO mutant and complementing strain. (C) RT-PCR analysis for cpr019 5 (top panel) or polC (middle panel) transcription in wild-type SM101, the SM101-CPR0195KO mutant, or the complementing strain. SM101 DNA was used as a positive control (gDNA [genomic DNA]). PCRs lacking template DNA acted as a negative control. To show that the RNA preparations from the three strains were free from DNA contamination, these samples were also subjected to PCR without reverse transcription (bottom panel). (D) Growth curves for wild-type SM101, the SM101-CPR0195KO mutant, and the SM101-CPR0195comp strain cultured at 37°C in MDS medium for up to 8 h. Aliquots of each culture were measured every 2 h for their OD 600 . All experiments were repeated three times, and mean representative values are shown. The markers used in panels A and C were Thermo Fisher 1-kb DNA ladders.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Southern Blot, Hybridization, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Positive Control, Negative Control, Cell Culture

    15) Product Images from "Polymorphic Integrations of an Endogenous Gammaretrovirus in the Mule Deer Genome"

    Article Title: Polymorphic Integrations of an Endogenous Gammaretrovirus in the Mule Deer Genome

    Journal:

    doi: 10.1128/JVI.06859-11

    Southern blot analysis of CrERVγ integrations in the mule deer genome. Mule deer genomic DNAs digested with EcoRI and transferred to a membrane were hybridized with a CrERVγ gag-pro probe to reveal the 5′ virus-host junction fragments
    Figure Legend Snippet: Southern blot analysis of CrERVγ integrations in the mule deer genome. Mule deer genomic DNAs digested with EcoRI and transferred to a membrane were hybridized with a CrERVγ gag-pro probe to reveal the 5′ virus-host junction fragments

    Techniques Used: Southern Blot

    16) Product Images from "A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation"

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation

    Journal:

    doi: 10.1073/pnas.0603754103

    DNA methylation status of the GFPn transgenes on the Xa and Xi. ( A ) The structure of the transgenes integrated into the Hprt locus. The location of EcoRI (E) and SmaI (S) restriction sites in the transgenes and the sizes of the fragments detected after
    Figure Legend Snippet: DNA methylation status of the GFPn transgenes on the Xa and Xi. ( A ) The structure of the transgenes integrated into the Hprt locus. The location of EcoRI (E) and SmaI (S) restriction sites in the transgenes and the sizes of the fragments detected after

    Techniques Used: DNA Methylation Assay

    17) Product Images from "Design and Characterization of Bioengineered Cancer-Like Stem Cells"

    Article Title: Design and Characterization of Bioengineered Cancer-Like Stem Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0141172

    Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.
    Figure Legend Snippet: Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.

    Techniques Used: Subcloning, Clone Assay, DNA Sequencing

    18) Product Images from "Activation of XerCD-dif recombination by the FtsK DNA translocase"

    Article Title: Activation of XerCD-dif recombination by the FtsK DNA translocase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr078

    ( A ) Recombination in the presence of peptide WRWYCR traps HJs. Recombination was carried out in the presence of the indicated concentration of peptide and subsequently cut with EcoRI so that HJs migrate slowly. ( B) Denaturing alkali gels allow determination of exchanged strands in isolated HJs. Isolated HJs were 5′-end labelled at each EcoRI cut site. Subsequently, some of the DNA was then further digested with ScaI, and samples were then denatured and electrophoresed. The relative positions of each site are shown diagrammatically below the gel. Sizes of the four strands resulting from EcoRI digestion are shown alongside (left). The expected sizes of top strand exchange (XerC-mediated) and bottom strand exchange (XerD-mediated) are shown on the right. Two strand sizes (3038 and 780) are specific for XerD mediated exchange (shown in bold), while XerC mediated exchange produces two different diagnostic product sizes (2212 and 1613, also in bold). The other strand sizes (415 and 1727) are common to both events. Note that there is always a background of XerC-mediated exchange, which can be estimated from the CD alone lane. However, upon stimulation by γ (in any form) the level of XerD-mediated exchange is greatly increased. Note that there was partial digestion by ScaI of the XerCD + γ 3 reaction (far right lane) so that the four bands seen with EcoRI digestion are still present.
    Figure Legend Snippet: ( A ) Recombination in the presence of peptide WRWYCR traps HJs. Recombination was carried out in the presence of the indicated concentration of peptide and subsequently cut with EcoRI so that HJs migrate slowly. ( B) Denaturing alkali gels allow determination of exchanged strands in isolated HJs. Isolated HJs were 5′-end labelled at each EcoRI cut site. Subsequently, some of the DNA was then further digested with ScaI, and samples were then denatured and electrophoresed. The relative positions of each site are shown diagrammatically below the gel. Sizes of the four strands resulting from EcoRI digestion are shown alongside (left). The expected sizes of top strand exchange (XerC-mediated) and bottom strand exchange (XerD-mediated) are shown on the right. Two strand sizes (3038 and 780) are specific for XerD mediated exchange (shown in bold), while XerC mediated exchange produces two different diagnostic product sizes (2212 and 1613, also in bold). The other strand sizes (415 and 1727) are common to both events. Note that there is always a background of XerC-mediated exchange, which can be estimated from the CD alone lane. However, upon stimulation by γ (in any form) the level of XerD-mediated exchange is greatly increased. Note that there was partial digestion by ScaI of the XerCD + γ 3 reaction (far right lane) so that the four bands seen with EcoRI digestion are still present.

    Techniques Used: Concentration Assay, Isolation, Diagnostic Assay

    ( A ) Schematic of recombination reactions; FtsK dependent recombination gives exclusively free products (P1 + P2) whereas the XerCγ or XerDγ fusion proteins produce mainly catenated products with a small amount of free P1 + P2. Catenated products up to six crossings (6-cat) are shown but higher forms are apparent in the gels. Second recombination events on the catenanes can produce knotted products, both twist and torus knots depending upon the synaptic complexity. DNA supercoiling is not shown for clarity. ( B ) Recombination reactions (20 min) with the indicated proteins were nicked with DNaseI in the presence of ethidium, to reveal the presence of catenated/knotted recombination products. Both fusion proteins produce catenanes, whereas FtsK (K) with XerCD (CD) does not. Nicking was not complete leaving some supercoiled plasmid substrate (supercoiled S). The smaller product, P2, was present lower down the gel but is not shown here. ( C ) Timecourse of recombination with XerCγD proteins. Reactions were nicked as previously. Catenanes (as labelled; the 10-crossing catenane co-migrates with nicked P1) appear at early time points and become stronger upon incubation, concomitant with the appearance of knotted products (weaker unlabelled bands, interdigitated with the catenanes). ( D ) Recombination reactions with the indicated proteins were either digested with EcoRI to show clearly the amount of recombination (upper panel) or electrophoresed without cutting (lower panel) to show the level of free circle product. Supercoiled catenated products were not resolved from the supercoiled substrate in the lower gel.
    Figure Legend Snippet: ( A ) Schematic of recombination reactions; FtsK dependent recombination gives exclusively free products (P1 + P2) whereas the XerCγ or XerDγ fusion proteins produce mainly catenated products with a small amount of free P1 + P2. Catenated products up to six crossings (6-cat) are shown but higher forms are apparent in the gels. Second recombination events on the catenanes can produce knotted products, both twist and torus knots depending upon the synaptic complexity. DNA supercoiling is not shown for clarity. ( B ) Recombination reactions (20 min) with the indicated proteins were nicked with DNaseI in the presence of ethidium, to reveal the presence of catenated/knotted recombination products. Both fusion proteins produce catenanes, whereas FtsK (K) with XerCD (CD) does not. Nicking was not complete leaving some supercoiled plasmid substrate (supercoiled S). The smaller product, P2, was present lower down the gel but is not shown here. ( C ) Timecourse of recombination with XerCγD proteins. Reactions were nicked as previously. Catenanes (as labelled; the 10-crossing catenane co-migrates with nicked P1) appear at early time points and become stronger upon incubation, concomitant with the appearance of knotted products (weaker unlabelled bands, interdigitated with the catenanes). ( D ) Recombination reactions with the indicated proteins were either digested with EcoRI to show clearly the amount of recombination (upper panel) or electrophoresed without cutting (lower panel) to show the level of free circle product. Supercoiled catenated products were not resolved from the supercoiled substrate in the lower gel.

    Techniques Used: Plasmid Preparation, Incubation

    19) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.
    Figure Legend Snippet: Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.

    Techniques Used: Inhibition

    ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.
    Figure Legend Snippet: ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Techniques Used: Generated, Incubation

    20) Product Images from "Combinatorial Domain Hunting: An effective approach for the identification of soluble protein domains adaptable to high-throughput applications"

    Article Title: Combinatorial Domain Hunting: An effective approach for the identification of soluble protein domains adaptable to high-throughput applications

    Journal:

    doi: 10.1110/ps.062082606

    Fragment library distribution. ( A ) Fragment size distribution is unbiased. SYBR-Safe stained 1% agarose gel of 144 individual clones, generated by shotgun capture of the fragmentation reaction in the ligase-free cloning vector pCR-Blunt-II TOPO (Invitrogen). Clones were pooled in lots of 12 and miniprepped, and captured DNA inserts were released as EcoRI fragments, with 12 vector-derived bases still attached to each end. The distribution of fragment sizes populates the desired range 0.1–1.0 kb. ( B ) The fragment position is random. Coverage plot of 63 randomly selected and sequenced clones (black lines) from the p85α fragment library, ordered according to their 5′-end ( bottom to top ), arrayed against the 2175-bp sequence of human p85α. Apart from clones beginning at the actual 5′-end of the target gene, the start positions of the fragments are evenly distributed across the target gene, which is fully sampled. Although the sample size is far too small for statistical significance, it is fully consistent with random and unbiased fragmentation. ( C ) As B , but with the data sorted by 3′-end position. ( D ) Histogram of fragment size frequency (N). Fragment sizes are binned in intervals of 200 bp. Although the sample size is too small for statistical significance, the distribution is consistent with the expected Poisson distribution for a random fragmentation process.
    Figure Legend Snippet: Fragment library distribution. ( A ) Fragment size distribution is unbiased. SYBR-Safe stained 1% agarose gel of 144 individual clones, generated by shotgun capture of the fragmentation reaction in the ligase-free cloning vector pCR-Blunt-II TOPO (Invitrogen). Clones were pooled in lots of 12 and miniprepped, and captured DNA inserts were released as EcoRI fragments, with 12 vector-derived bases still attached to each end. The distribution of fragment sizes populates the desired range 0.1–1.0 kb. ( B ) The fragment position is random. Coverage plot of 63 randomly selected and sequenced clones (black lines) from the p85α fragment library, ordered according to their 5′-end ( bottom to top ), arrayed against the 2175-bp sequence of human p85α. Apart from clones beginning at the actual 5′-end of the target gene, the start positions of the fragments are evenly distributed across the target gene, which is fully sampled. Although the sample size is far too small for statistical significance, it is fully consistent with random and unbiased fragmentation. ( C ) As B , but with the data sorted by 3′-end position. ( D ) Histogram of fragment size frequency (N). Fragment sizes are binned in intervals of 200 bp. Although the sample size is too small for statistical significance, the distribution is consistent with the expected Poisson distribution for a random fragmentation process.

    Techniques Used: Staining, Agarose Gel Electrophoresis, Clone Assay, Generated, Plasmid Preparation, Polymerase Chain Reaction, Derivative Assay, Sequencing

    Related Articles

    Clone Assay:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB). .. For FLAG-B2AR, the remaining portion of the receptor (383–413) was cloned 3′ to the APEX2 sequence, separated by a linker, with NotI and XbaI (NEB) (see ).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes. .. The protein was expressed in E. coli BL21(DE3) cells and purified using glutathione Sepharose resin (GE Healthcare, Piscataway, NJ) per the manufacturer's recommendations.

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Paragraph title: Promoter Fragments; Cloning and Labeling ... The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene).

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Paragraph title: Cloning, gene disruption, and generation of mutant strains. ... To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Centrifugation:

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA). .. Briefly, HEK293NT cells were co-transfected with control vector or lentiviral plasmid carrying Shh fragments, along with lentiviral packaging mix.

    Amplification:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB).

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Each reaction mixture was subjected to the following PCR amplification conditions: cycle 1, 95°C for 2 min; cycles 2 through 35, 95°C for 30 s, 55°C for 40 s, and 68°C for 80 s; and a final extension for 8 min at 68°C. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The gene encoding prothymosin α was amplified from the plasmid by using the following primers: the forward primer sequence was 5′-CGC GGATCC ATGTCTGATGCAGCTGTAGATACC-3′, and the reverse primer sequence was 5′-CCG GAATTC GTCATCCTCGTCGGTCTTCTG-3′ (the bold nucleotides indicate the restriction endonuclease recognition site). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Each reaction mixture was subjected to the following PCR amplification conditions: cycle 1, consisting of 95°C for 2 min; cycles 2 through 35, consisting of 95°C for 30 s, 55°C for 40 s, and 68°C for 80 s; and a final extension for 5 min at 68°C. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The 384-bp region between the smeRv gene (SMD_1762) and the smeU1 gene (SMD_1763), which contains the smeVWX promoter region, was amplified using the FailSafe PCR system (Epicentre) with primers SmeVWX_F (5′- GAATTC GATCCTGGACGTCG-3′, EcoRI site underlined) and SmeVWX_R (5′- AAGCTT GACATTTCCTCCCAAATC-3′, HindIII site underlined). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes.

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Shh fragments were amplified from rat genomic DNA using the primers as follows: sense, 5'-CGGAATTCGCCACC ATGCTGCTGCTGCTGGCCAG-3'; anti-sense, 5'-CGCGGATCC TCAGCTGGACTTGACTGCCATT-3'. .. Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Article Title: Ochratoxin A Production and Amplified Fragment Length Polymorphism Analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger Strains Isolated from Grapes in Italy
    Article Snippet: Approximately 10 ng of genomic DNA from each isolate was cut with EcoRI and MseI (New England Biolabs, Hitchin, Hertfordshire, United Kingdom), and the DNA fragments were ligated to double-stranded restriction site-specific adaptors from the kit. .. A preselective PCR (72°C for 2 min; 20 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 2 min; and then holding at 4°C) was carried out in a 20-μl (final volume) mixture.

    DNA Ligation:

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Synthesized:

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: Oligonucleotides containing the C2′-oxidized abasic site (C2-AP) were synthesized as described ( ). .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Briefly, a 996-bp fragment including the 3′ ends of WQ49_RS12570 and WQ49_RS12575, the intergenic region, the unique transposon sequence, and KpnI and EcoRI restriction sites was synthesized (IDT). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Oligonucleotide Synthesis:

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs. .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    Cytometry:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Construct:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. We transformed the PyiLMN - lacZ reporter plasmid into DS7817 to generate PDS0838 in the NCIB3610 strain background.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Paragraph title: cDNA constructs ... Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB).

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Lentiviral vector containing Shh was constructed using vector pCDH-CMV-MCS-EF1-copGFP as backbone. .. Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA).

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Incubation:

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA). .. Briefly, HEK293NT cells were co-transfected with control vector or lentiviral plasmid carrying Shh fragments, along with lentiviral packaging mix.

    Expressing:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: Paragraph title: Plasmid expressing prothymosin α. ... The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Paragraph title: 2.3 Design and synthesis of pFastBac1 expression vectors ... Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    RNA Sequencing Assay:

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Additionally, differential RNA sequencing (dRNA-seq) data for the region were examined, which found it to be transcriptionally inactive, at least in B. cenocepacia J2315 grown in biofilms ( ). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Transformation Assay:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB).

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The PCR product was ligated into pGEM-T Easy vector (Promega), according to the manufacturer's instructions, obtaining the pPBT02 plasmid, which was introduced by transformation into E. coli OmniMAX (Invitrogen). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Briefly, a 996-bp fragment including the 3′ ends of WQ49_RS12570 and WQ49_RS12575, the intergenic region, the unique transposon sequence, and KpnI and EcoRI restriction sites was synthesized (IDT). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327. .. Using E. coli SY327/pRK2013 as a helper strain, pAH3 was introduced into K56-2 via triparental mating.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Sampling:

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: Paragraph title: Sampling. ... For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Hybridization:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions. .. The digested DNA samples were then electrophoresed on a conventional 1% agarose gel.

    Electroporation:

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: To obtain a pmtA pcs double mutant, pGemT- pmtA ::Kan was introduced by electroporation into B. abortus pcs , and the double recombination events (Kanr Amps ) were selected and confirmed by genomic PCR. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Transfection:

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Paragraph title: Reconstruction of Shh plasmid and lentivirus transfection ... Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA).

    Southern Blot:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: That probe was then employed for Southern blotting to confirm the presence of a single intron insertion in the SM101:: sigF and SM101:: sigG mutants. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and then visualized by staining with ethidium bromide. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs). .. Each digested DNA was then run on a 1% agarose gel.

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Ligation:

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Ligation products were transformed into One Shot chemically competent E. coli TOP10 cells and then screened accordingly ( ). .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Protease Inhibitor:

    Article Title: Steady-State and Pre-Steady-State Kinetic Analysis of Mycobacterium smegmatis Cysteine Ligase (MshC)
    Article Snippet: T4 DNA ligase and the restriction enzymes NdeI and EcoRI were from New England Biolabs. .. T4 DNA ligase and the restriction enzymes NdeI and EcoRI were from New England Biolabs.

    Footprinting:

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene). .. DNA sequences of the hybrid promoters were verified by sequencing (SeqWright).

    Generated:

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: To examine the plasmid background in the newly generated transformant incompatibility group, PCR typing was performed ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Hybrid nixA-ureA promoter fragments were generated by two sequential rounds of PCR using overlap extension with two oligonucleotides that contained the base mutations and flanking primers designed to amplify ∼200–400 bp of DNA spanning the nixA or ureA promoters and genes ( ). .. The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene).

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    DNA Sequencing:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Sequencing:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB).

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: A digoxigenin (DIG)-labeled, intron sequence-specific probe was prepared, as described previously , using primers IBS and EBS1d and a DIG-labeling kit (Roche). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB). .. For FLAG-B2AR, the remaining portion of the receptor (383–413) was cloned 3′ to the APEX2 sequence, separated by a linker, with NotI and XbaI (NEB) (see ).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Briefly, a 996-bp fragment including the 3′ ends of WQ49_RS12570 and WQ49_RS12575, the intergenic region, the unique transposon sequence, and KpnI and EcoRI restriction sites was synthesized (IDT). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Recombinant:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: Paragraph title: Plasmids and recombinant proteins. ... The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Paragraph title: Expression and purification of recombinant replicase proteins from Escherichia coli . ... The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Gel-purified amplicons were ligated into EcoRI-digested pBHR1 by using a Fast-Link DNA ligation kit (Epicentre) and were chemically transformed into E. coli TOP10.

    Nucleic Acid Electrophoresis:

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs. .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    Gene Knockout:

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Double recombination events (Kanr Amps or Gmr Amps ) were selected, and the corresponding gene knockout was confirmed by genomic PCR. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Mutagenesis:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Briefly, DNA from wild-type SM101, the sigF -null mutant, or the sigG -null mutant was isolated using the MasterPure Gram-positive DNA purification kit (Epicentre, Wisconsin). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Paragraph title: PCR and Southern blot analyses of the SM101 codY -null mutant and complemented strain. ... For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene). .. DNA sequences of the hybrid promoters were verified by sequencing (SeqWright).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: The method of Flannagan et al. was used for mutant construction ( ). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Paragraph title: Cloning of B. mallei QS genes, mutant construction, gene disruption, and mutant confirmation. ... Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Paragraph title: Cloning, gene disruption, and generation of mutant strains. ... To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Isolation:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Briefly, DNA from wild-type SM101, the sigF -null mutant, or the sigG -null mutant was isolated using the MasterPure Gram-positive DNA purification kit (Epicentre, Wisconsin). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions. .. The digested DNA samples were then electrophoresed on a conventional 1% agarose gel.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis. .. Each FGF2 isoform was subcloned in pFastBac1 (Life Technologies) vector using the same restriction sites as above, which ensured directional insertion of the genes for each FGF2 isoform.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: DNA was isolated from wild-type strain SM101, the codY -null mutant SM101:: codY , and the complemented strain SM101 codY comp by using the MasterPure Gram-positive bacterial DNA purification kit. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    AST Assay:

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: Where available, ertapenem MIC results from a VITEK2 AST GN-70 test kit (bioMérieux, Durham, NC) were obtained retrospectively from laboratory records. .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Flow Cytometry:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Labeling:

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Paragraph title: Promoter Fragments; Cloning and Labeling ... The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene).

    Article Title: Ochratoxin A Production and Amplified Fragment Length Polymorphism Analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger Strains Isolated from Grapes in Italy
    Article Snippet: Approximately 10 ng of genomic DNA from each isolate was cut with EcoRI and MseI (New England Biolabs, Hitchin, Hertfordshire, United Kingdom), and the DNA fragments were ligated to double-stranded restriction site-specific adaptors from the kit. .. Four separate primer combinations were utilized for the selective amplification: EcoRI+AC and MseI+CC; EcoRI+AT and MseI+CG; EcoRI+AC and MseI+CA; and EcoRI+G and MseI+CT.

    Purification:

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: Purified oligonucleotides were characterized by ESI-MS using an LCQ-Deca after precipitating them from NH4 OAc ( ). .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Each construct was designed as a 6xHis-tag fusion protein with a tobacco etch virus (TEV) recognition site between the 6xHis-tag and the protein to aid with tag removal after purification if necessary. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: Purified plasmid DNA was electroporated into electrocompetent E. coli Genehog cells (Invitrogen, Carlsbad, CA) as previously described ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: Recombinant protein was expressed in Escherichia coli BL21(DE3) cells (Stratagene, La Jolla, CA), purified using Ni2+ -nitrilotriacetic acid agarose resin (Qiagen, Valencia, CA) per the manufacturer's recommendations, and concentrated to 12 mg/ml. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes.

    Article Title: A Mutational Analysis Defines Vibrio fischeri LuxR Binding Sites
    Article Snippet: For purification of chromosomal DNA, PCR products, and plasmids, we used Qiagen kits (Germantown, MD) according to the manufacturer's procedures. .. We obtained T4 polynucleotide kinase, T4 DNA ligase, and EcoRI from New England Biolabs (Ipswich, MA), and BamHI was obtained from Roche.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Paragraph title: Expression and purification of recombinant replicase proteins from Escherichia coli . ... The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. We ligated the digested products together using T4 DNA ligase (NEB).

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and was then visualized by staining with ethidium bromide. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The cleaved products were ligated using T4 ligase.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Paragraph title: PCR and Southern blot analyses of the SM101 codY -null mutant and complemented strain. ... For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: To examine the plasmid background in the newly generated transformant incompatibility group, PCR typing was performed ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The PCR product was ligated into pGEM-T Easy vector (Promega), according to the manufacturer's instructions, obtaining the pPBT02 plasmid, which was introduced by transformation into E. coli OmniMAX (Invitrogen). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes. .. The protein was expressed in E. coli BL21(DE3) cells and purified using glutathione Sepharose resin (GE Healthcare, Piscataway, NJ) per the manufacturer's recommendations.

    Article Title: A Mutational Analysis Defines Vibrio fischeri LuxR Binding Sites
    Article Snippet: For PCR amplifications, we used an Expand Long Template system (Roche, Indianapolis, IN). .. We obtained T4 polynucleotide kinase, T4 DNA ligase, and EcoRI from New England Biolabs (Ipswich, MA), and BamHI was obtained from Roche.

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Hybrid nixA-ureA promoter fragments were generated by two sequential rounds of PCR using overlap extension with two oligonucleotides that contained the base mutations and flanking primers designed to amplify ∼200–400 bp of DNA spanning the nixA or ureA promoters and genes ( ). .. The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene). .. DNA sequences of the hybrid promoters were verified by sequencing (SeqWright).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327. .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: To obtain a pmtA pcs double mutant, pGemT- pmtA ::Kan was introduced by electroporation into B. abortus pcs , and the double recombination events (Kanr Amps ) were selected and confirmed by genomic PCR. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Article Title: Ochratoxin A Production and Amplified Fragment Length Polymorphism Analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger Strains Isolated from Grapes in Italy
    Article Snippet: Approximately 10 ng of genomic DNA from each isolate was cut with EcoRI and MseI (New England Biolabs, Hitchin, Hertfordshire, United Kingdom), and the DNA fragments were ligated to double-stranded restriction site-specific adaptors from the kit. .. A preselective PCR (72°C for 2 min; 20 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 2 min; and then holding at 4°C) was carried out in a 20-μl (final volume) mixture.

    Mouse Assay:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Plasmid Preparation:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. We ligated the digested products together using T4 DNA ligase (NEB).

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The cleaved products were ligated using T4 ligase.

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: For CAV1016, the bla KPC plasmid background has been previously described ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ). .. Total RNA was extracted from E. coli transformants containing parent plasmid Tn 4401 a, Tn 4401 b, and Tn 4401 h using an RNeasy minikit (Qiagen, GmBH, Hilden, Germany).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The construction was verified by DNA sequencing. .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs). .. The product corresponding to the smeVWX promoter region was purified with the purification kit (GE Healthcare) from a 1% agarose gel and cloned into pSEVA237Y using the same restriction enzymes and the T4 DNA ligase (New England BioLabs).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes. .. The protein was expressed in E. coli BL21(DE3) cells and purified using glutathione Sepharose resin (GE Healthcare, Piscataway, NJ) per the manufacturer's recommendations.

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Shh fragments were amplified from rat genomic DNA using the primers as follows: sense, 5'-CGGAATTCGCCACC ATGCTGCTGCTGCTGGCCAG-3'; anti-sense, 5'-CGCGGATCC TCAGCTGGACTTGACTGCCATT-3'. .. Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA). .. The reconstructed plasmid was verified by Sanger sequencing.

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Both amplicons were ligated into pGemTeasy (Promega Corp.) to generate the intermediate vectors pGemT- pmtA and pGemT- pcs . pGemT- pmtA was subsequently digested with ClaI (NEB, Inc.) and ligated into a kanamycin resistance cassette from pUC4K to generate the plasmid pGemT- pmtA ::Kan. pGemT- pcs was digested with HindIII (NEB, Inc.) and ligated into the accI gene conferring resistance to gentamicin to generate pGemT- pcs ::Gm. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Software:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. Digested DNA was analyzed by Southern blot with the GFPn coding sequence as a probe.

    Agarose Gel Electrophoresis:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and was then visualized by staining with ethidium bromide. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis. .. Each FGF2 isoform was subcloned in pFastBac1 (Life Technologies) vector using the same restriction sites as above, which ensured directional insertion of the genes for each FGF2 isoform.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and then visualized by staining with ethidium bromide. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: For CAV1016, the bla KPC plasmid background has been previously described ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ). .. Total RNA was extracted from E. coli transformants containing parent plasmid Tn 4401 a, Tn 4401 b, and Tn 4401 h using an RNeasy minikit (Qiagen, GmBH, Hilden, Germany).

    Transgenic Assay:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. One-third of the EcoRI-digested DNA was digested with SmaI (NEB), and one-third was digested with XmaI (NEB).

    Knock-Out:

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: These vectors were introduced into B. abortus 2308 by electroporation to obtain the corresponding knockout mutants. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    DNA Methylation Assay:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Paragraph title: DNA Methylation Analysis. ... DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    FLAG-tag:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The cleaved products were ligated using T4 ligase.

    DNA Purification:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Briefly, DNA from wild-type SM101, the sigF -null mutant, or the sigG -null mutant was isolated using the MasterPure Gram-positive DNA purification kit (Epicentre, Wisconsin). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: DNA was isolated from wild-type strain SM101, the codY -null mutant SM101:: codY , and the complemented strain SM101 codY comp by using the MasterPure Gram-positive bacterial DNA purification kit. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Staining:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and was then visualized by staining with ethidium bromide. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and then visualized by staining with ethidium bromide. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ecori
    Estimation of the rate of <t>pUC19</t> unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 <t>DNA</t> (BamHI-digested; 1.14 pmol of DSB ends),
    Ecori, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 498 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori/product/New England Biolabs
    Average 99 stars, based on 498 article reviews
    Price from $9.99 to $1999.99
    ecori - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs ecori hf
    Estimation of the rate of <t>pUC19</t> unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 <t>DNA</t> (BamHI-digested; 1.14 pmol of DSB ends),
    Ecori Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori hf/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ecori hf - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Estimation of the rate of pUC19 unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol of DSB ends),

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: Estimation of the rate of pUC19 unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol of DSB ends),

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    AdnAB nuclease action at 3′-labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 3′ 32 P-labeled pUC19 DNA (EcoRI-digested and 3′-labeled with [ 32

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: AdnAB nuclease action at 3′-labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 3′ 32 P-labeled pUC19 DNA (EcoRI-digested and 3′-labeled with [ 32

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    Estimating the coupling of ATP hydrolysis and duplex unwinding. A, reaction mixtures (80 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m [α- 32 P]ATP, 1.6 μg of pUC19 DNA (BamHI-digested; 1.82 pmol of DSB ends),

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: Estimating the coupling of ATP hydrolysis and duplex unwinding. A, reaction mixtures (80 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m [α- 32 P]ATP, 1.6 μg of pUC19 DNA (BamHI-digested; 1.82 pmol of DSB ends),

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques:

    AdnAB nuclease action at 5′ - labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol DSB ends), and 6 pmol

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: AdnAB nuclease action at 5′ - labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol DSB ends), and 6 pmol

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    Duplex unwinding by AdnAB with a crippled AdnA phosphohydrolase module. A, reaction mixtures (60 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1.2 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.37 pmol

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: Duplex unwinding by AdnAB with a crippled AdnA phosphohydrolase module. A, reaction mixtures (60 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1.2 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.37 pmol

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    SSB captures the strands unwound by the AdnAB motor. A, reaction mixtures (10 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 200 ng of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 230 fmol of DSB ends), 1.06 pmol of

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: SSB captures the strands unwound by the AdnAB motor. A, reaction mixtures (10 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 200 ng of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 230 fmol of DSB ends), 1.06 pmol of

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    EcoRI-induced DSBs stimulate ERK phosphorylation similar to BrdU photolysis. (A) HEK293 cells were electroporated with either electroporation buffer only (lane 1–4) or increasing doses of EcoRI enzyme as indicated. Cells were collected at 2, 10,

    Journal:

    Article Title: ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks

    doi: 10.4161/cc.10.3.14713

    Figure Lengend Snippet: EcoRI-induced DSBs stimulate ERK phosphorylation similar to BrdU photolysis. (A) HEK293 cells were electroporated with either electroporation buffer only (lane 1–4) or increasing doses of EcoRI enzyme as indicated. Cells were collected at 2, 10,

    Article Snippet: 1 × 106 HEK293 cells were electroporated with EcoRI (New England Biolabs, Ipswich, MA) using the Amaxa Nucleofector Kit and the Nucleofector II Device (Lonza, Koln, Germany; ).

    Techniques: Electroporation

    EcoRI-induced DSBs increase H2AX, ERK and AKT phosphorylation in an ATM-dependent manner. (A) HEK293 cells were transfected with 5 µg of either pcDNA3 or pcDNA3-NLS-HA-EcoRI and cells collected for western blotting 72 h post transfection. Fold

    Journal:

    Article Title: ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks

    doi: 10.4161/cc.10.3.14713

    Figure Lengend Snippet: EcoRI-induced DSBs increase H2AX, ERK and AKT phosphorylation in an ATM-dependent manner. (A) HEK293 cells were transfected with 5 µg of either pcDNA3 or pcDNA3-NLS-HA-EcoRI and cells collected for western blotting 72 h post transfection. Fold

    Article Snippet: 1 × 106 HEK293 cells were electroporated with EcoRI (New England Biolabs, Ipswich, MA) using the Amaxa Nucleofector Kit and the Nucleofector II Device (Lonza, Koln, Germany; ).

    Techniques: Transfection, Hemagglutination Assay, Western Blot

    Dominant-negative AKT reduces ERK phosphorylation in response to IR and EcoRI-induced DSBs. HEK293 cells stably expressing pcDNA3 or DN-AKT-Myc plasmids were: (A) exposed to 0, 5 or 10 Gy and collected after 10 min for western blotting and subsequent

    Journal:

    Article Title: ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks

    doi: 10.4161/cc.10.3.14713

    Figure Lengend Snippet: Dominant-negative AKT reduces ERK phosphorylation in response to IR and EcoRI-induced DSBs. HEK293 cells stably expressing pcDNA3 or DN-AKT-Myc plasmids were: (A) exposed to 0, 5 or 10 Gy and collected after 10 min for western blotting and subsequent

    Article Snippet: 1 × 106 HEK293 cells were electroporated with EcoRI (New England Biolabs, Ipswich, MA) using the Amaxa Nucleofector Kit and the Nucleofector II Device (Lonza, Koln, Germany; ).

    Techniques: Dominant Negative Mutation, Stable Transfection, Expressing, Western Blot

    Low levels of DSBs increase cell proliferation. (A) Human U87 cells were electroporated with buffer alone, 2.5 U or 200 U of EcoRI enzyme as described in the legend to . Four days after electroporation cells were collected from triplicate dishes,

    Journal:

    Article Title: ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks

    doi: 10.4161/cc.10.3.14713

    Figure Lengend Snippet: Low levels of DSBs increase cell proliferation. (A) Human U87 cells were electroporated with buffer alone, 2.5 U or 200 U of EcoRI enzyme as described in the legend to . Four days after electroporation cells were collected from triplicate dishes,

    Article Snippet: 1 × 106 HEK293 cells were electroporated with EcoRI (New England Biolabs, Ipswich, MA) using the Amaxa Nucleofector Kit and the Nucleofector II Device (Lonza, Koln, Germany; ).

    Techniques: Electroporation