ecoo109i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    EcoO109I
    Description:
    EcoO109I 2 000 units
    Catalog Number:
    R0503S
    Price:
    65
    Size:
    2 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs ecoo109i
    EcoO109I
    EcoO109I 2 000 units
    https://www.bioz.com/result/ecoo109i/product/New England Biolabs
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    ecoo109i - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs). .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Amplification:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Once cells on the third plate were at least ∼70% confluent, DNAs were extracted using QuickExtract DNA extraction solution and PCR amplified using the following primers: F3 primer, TGGCCCATTTATGAGAAAACTGA; and R2 primer, GGGAACAGACTTCAATTCTCCA. .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Construct:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: Versions of this plasmid constructed with different DEs as exon 2 allowed the isolation of transfectant HEK293 populations carrying minigenes with different DEs. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Electrophoresis:

    Article Title: Deficiencies of Human Complement Component C4a and C4b and Heterozygosity in Length Variants of RP-C4-CYP21-TNX (Rccx) Modules in Caucasians
    Article Snippet: Restriction enzymes used included TaqI (GIBCO BRL), BamHI, PshAI, EcoO109I, and NlaIV (New England Biolabs). .. DNA fragments were resolved by electrophoresis of 0.8% agarose gels except for EcoO109I- and NlaIV-digested DNAs, for which 1.2% gels were used. .. Southern blot analysis was performed as described previously .

    Incubation:

    Article Title: New Lung Cancer Panel for High-Throughput Targeted Resequencing
    Article Snippet: Eight different restriction reactions were used to digest genomic DNAs from each sample, including Sfc I and Hpy188I in NEB buffer 4; Dde I and Alu I in NEB buffer 2; Mse I and Bsu 36I in NEB buffer 3; Msl I and Bfa I in NEB buffer 4; Hpy CH4III and Bsp 1286 in NEB buffer 4; Sfc I and Nla III in NEB buffer 4; Mse I and Hpy CH4III in NEB buffer 4; and Hpy CH4V and Eco O109I in NEB buffer 4 (New England Biolabs, Ipswich, MA, USA). .. The restriction reactions contained 1 unit each of two restriction enzymes and their corresponding compatible NEB buffer in 1× concentration and 0.85 µg/µL bovine serum albumin (BSA) in a total volume of 10 µL.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Targeted resequencing of candidate genes using selector probes
    Article Snippet: Of each sample, 100 ng (200 ng for FFPE samples to compensate for DNA fragmentation) was added to eight different restriction reactions containing 1 unit each of two restriction enzymes and their corresponding compatible NEB buffer in 1× concentration and 0.85 µg/µl BSA in a total volume of 10 µl. .. The eight reactions were SfcI and Hpy188I in NEB buffer 4; DdeI and AluI in NEB buffer 2; MseI and Bsu36I in NEB buffer 3; MslI and BfaI in NEB buffer 4; HpyCH4III and Bsp1286 in NEB buffer 4; SfcI and NlaIII in NEB buffer 4; MseI and HpyCH4III in NEB buffer 4; HpyCH4V and EcoO109I in NEB buffer 4 (New England Biolabs).

    Activity Assay:

    Article Title: Alternating Hemiplegia of Childhood-Related Neural and Behavioural Phenotypes in Na+,K+-ATPase ?3 Missense Mutant Mice
    Article Snippet: The Myshkin mouse line has been previously described and was backcrossed 20 generations to the seizure-resistant C57BL/6NCr strain (NCI-Frederick) , ; Myk /+ mice at N20 C57BL/6NCr were previously reported not to show stress-induced seizure activity during electrocorticography . .. Mice used in the present study were bred from C57BL/6NCrl females (Charles River) and Myk /+ males, and were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using polymerase chain reaction (PCR) primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′ .

    Article Title: Deficits in social behavioral tests in a mouse model of alternating hemiplegia of childhood
    Article Snippet: Myk /+ mice at N20 C57BL/6NCr were previously reported to be free of stress-induced seizure activity during electrocorticography (Kirshenbaum et al. ). .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′.

    Expressing:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: To generate the hERα expression plasmid, full length D . magna EF1α-1 promoter [ ] and full length human esr1 [ ] were joined into a pRC21 backbone with full length EF1α-1 3’UTR via InFusion (TAKARA, Kusatsu, Shiga, Japan); the resulting construct was termed pRC21-hERa. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry.

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: To generate the hERα expression plasmid, full length D . magna EF1α-1 promoter [ ] and full length human esr1 [ ] were joined into a pRC21 backbone with full length EF1α-1 3’UTR via InFusion (TAKARA, Kusatsu, Shiga, Japan); the resulting construct was termed pRC21-hERa. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Modification:

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: A single copy transfectant of HEK293 cells carrying a single integrated copy of this plasmid with the attP sequence as a site-specific target was then isolated. pMA-IC contains an attB site for site-specific recombination, a CMV promoter to drive the puromycin resistance gene after site-specific recombination, and the upstream half of the modified dhfr minigene for reconstitution of the full minigene (Supplemental Fig. S10; see Supplemental Material). .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Transformation Assay:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Transfection:

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: Versions of this plasmid constructed with different DEs as exon 2 allowed the isolation of transfectant HEK293 populations carrying minigenes with different DEs. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: A total of 3.3 μg of a 1:1 (vol/vol) mix of repair template and CRISPR plasmid was transfected by use of FuGENE HD into 75 × 103 cells in a 6-well dish. .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Southern Blot:

    Article Title: Deficiencies of Human Complement Component C4a and C4b and Heterozygosity in Length Variants of RP-C4-CYP21-TNX (Rccx) Modules in Caucasians
    Article Snippet: Paragraph title: Isolation of Genomic DNA and Southern Blot Analysis. ... Restriction enzymes used included TaqI (GIBCO BRL), BamHI, PshAI, EcoO109I, and NlaIV (New England Biolabs).

    Ligation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Cell Culture:

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Starting at 48 h posttransfection, cells were cultured in selection medium with 800 μg/ml of G418 (Sigma-Aldrich) for 7 days, with the selection medium being changed every other day. .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Generated:

    Article Title: Characterization of Cognitive Deficits in Mice With an Alternating Hemiplegia-Linked Mutation
    Article Snippet: Myk/+ mice have an amino acid change (I810N) that was generated through N- nitroso-N -ethylurea (ENU) mutagenesis ( ). .. Myk /+ mice were genotyped by the presence of an EcoO109I (New England BioLabs) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′.

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: These coupled-standard plasmids were generated by incorporating cDNA for DE-skipped mRNA and either γ actin mRNA or mRNA that included a DE in the same plasmid. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    other:

    Article Title: Deficiencies of Human Complement Component C4a and C4b and Heterozygosity in Length Variants of RP-C4-CYP21-TNX (Rccx) Modules in Caucasians
    Article Snippet: EcoO109I (panel II-B) defines the genotype based on association with C4-Rg1 (565-bp fragment) and C4-Ch1 (458-bp fragment).

    Sequencing:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry.

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: QPCR measurements were calibrated using plasmids containing both an exon-included and an exon-skipped sequence. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: DNA Sequence Analysis of SLC26A5, Encoding Prestin, in a Patient-Control Cohort: Identification of Fourteen Novel DNA Sequence Variations
    Article Snippet: When the T > G variant sequence was present, the digestion resulted in two fragments of 250 bp and 100 bp. .. PCR fragments containing position g.53884 were digested with restriction enzyme EcoO109I (New England Biolabs, Ipswich, MA, USA).

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs). .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Cellular Antioxidant Activity Assay:

    Article Title: Transgenic rescue of phenotypic deficits in a mouse model of alternating hemiplegia of childhood
    Article Snippet: The purpose of the present study was to determine whether this increase in brain Na+ ,K+ -ATPase activity, to a level comparable with that of Atp1a3 tm1Ling/+ mice (~80 % of wild-type), would have remedial effects in phenotypic tests in which Myk /+ mice show clear deficiencies. .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using PCR primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Hemizygous Tg-Atp1a3 1Stcl/+ (Tg/+) mice were genotyped using PCR primers F, 5′-TGA CAT TGT AGG ACT ATA TTG C-3′ and R, 5′-GTT AAA GGT GTG AGG CAC AGA-3′ spanning the T7 vector-insert boundary.

    Article Title: Alternating Hemiplegia of Childhood-Related Neural and Behavioural Phenotypes in Na+,K+-ATPase ?3 Missense Mutant Mice
    Article Snippet: The Myshkin mouse line has been previously described and was backcrossed 20 generations to the seizure-resistant C57BL/6NCr strain (NCI-Frederick) , ; Myk /+ mice at N20 C57BL/6NCr were previously reported not to show stress-induced seizure activity during electrocorticography . .. Mice used in the present study were bred from C57BL/6NCrl females (Charles River) and Myk /+ males, and were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using polymerase chain reaction (PCR) primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′ . .. Wild-type littermates were used as controls for all experiments.

    Article Title: Deficits in social behavioral tests in a mouse model of alternating hemiplegia of childhood
    Article Snippet: Myk /+ mice at N20 C57BL/6NCr were previously reported to be free of stress-induced seizure activity during electrocorticography (Kirshenbaum et al. ). .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were weaned at four weeks of age and grouped housed (2–5 mice/cage) with same-sex littermates.

    Article Title: Characterization of Cognitive Deficits in Mice With an Alternating Hemiplegia-Linked Mutation
    Article Snippet: Myk /+ males, backcrossed for 20 generations to the C57BL/6NCr strain (NCI-Frederick), were mated with C57BL/6NCrl (Charles River) females to yield wild-type (+/+) and Myk /+ littermates. .. Myk /+ mice were genotyped by the presence of an EcoO109I (New England BioLabs) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were group housed (2–5 mice/cage) with same-sex littermates.

    DNA Extraction:

    Article Title: Deficiencies of Human Complement Component C4a and C4b and Heterozygosity in Length Variants of RP-C4-CYP21-TNX (Rccx) Modules in Caucasians
    Article Snippet: Genomic DNA was isolated from the blood samples using the Puregene DNA isolation kit (Gentra Systems, Inc.). .. Restriction enzymes used included TaqI (GIBCO BRL), BamHI, PshAI, EcoO109I, and NlaIV (New England Biolabs).

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Once cells on the third plate were at least ∼70% confluent, DNAs were extracted using QuickExtract DNA extraction solution and PCR amplified using the following primers: F3 primer, TGGCCCATTTATGAGAAAACTGA; and R2 primer, GGGAACAGACTTCAATTCTCCA. .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Magnetic Beads:

    Article Title: New Lung Cancer Panel for High-Throughput Targeted Resequencing
    Article Snippet: Eight different restriction reactions were used to digest genomic DNAs from each sample, including Sfc I and Hpy188I in NEB buffer 4; Dde I and Alu I in NEB buffer 2; Mse I and Bsu 36I in NEB buffer 3; Msl I and Bfa I in NEB buffer 4; Hpy CH4III and Bsp 1286 in NEB buffer 4; Sfc I and Nla III in NEB buffer 4; Mse I and Hpy CH4III in NEB buffer 4; and Hpy CH4V and Eco O109I in NEB buffer 4 (New England Biolabs, Ipswich, MA, USA). .. The reactions were incubated at 37℃ for 60 min, followed by enzyme inactivation at 80℃ for 20 min. A total of 80 µL of pooled digested sample was mixed with 10 pM biotinylated selector probes, 1 M NaCl, 10 mM Tris-HCl (pH 7.5), 5 mM EDTA, and 0.1% Tween-20 in a total volume of 160 µL.

    Mutagenesis:

    Article Title: Characterization of Cognitive Deficits in Mice With an Alternating Hemiplegia-Linked Mutation
    Article Snippet: Myk/+ mice have an amino acid change (I810N) that was generated through N- nitroso-N -ethylurea (ENU) mutagenesis ( ). .. Myk /+ mice were genotyped by the presence of an EcoO109I (New England BioLabs) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′.

    Isolation:

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: Versions of this plasmid constructed with different DEs as exon 2 allowed the isolation of transfectant HEK293 populations carrying minigenes with different DEs. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Article Title: Deficiencies of Human Complement Component C4a and C4b and Heterozygosity in Length Variants of RP-C4-CYP21-TNX (Rccx) Modules in Caucasians
    Article Snippet: Paragraph title: Isolation of Genomic DNA and Southern Blot Analysis. ... Restriction enzymes used included TaqI (GIBCO BRL), BamHI, PshAI, EcoO109I, and NlaIV (New England Biolabs).

    Mouse Assay:

    Article Title: Transgenic rescue of phenotypic deficits in a mouse model of alternating hemiplegia of childhood
    Article Snippet: The purpose of the present study was to determine whether this increase in brain Na+ ,K+ -ATPase activity, to a level comparable with that of Atp1a3 tm1Ling/+ mice (~80 % of wild-type), would have remedial effects in phenotypic tests in which Myk /+ mice show clear deficiencies. .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using PCR primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Hemizygous Tg-Atp1a3 1Stcl/+ (Tg/+) mice were genotyped using PCR primers F, 5′-TGA CAT TGT AGG ACT ATA TTG C-3′ and R, 5′-GTT AAA GGT GTG AGG CAC AGA-3′ spanning the T7 vector-insert boundary.

    Article Title: Alternating Hemiplegia of Childhood-Related Neural and Behavioural Phenotypes in Na+,K+-ATPase ?3 Missense Mutant Mice
    Article Snippet: The Myshkin mouse line has been previously described and was backcrossed 20 generations to the seizure-resistant C57BL/6NCr strain (NCI-Frederick) , ; Myk /+ mice at N20 C57BL/6NCr were previously reported not to show stress-induced seizure activity during electrocorticography . .. Mice used in the present study were bred from C57BL/6NCrl females (Charles River) and Myk /+ males, and were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using polymerase chain reaction (PCR) primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′ . .. Wild-type littermates were used as controls for all experiments.

    Article Title: Deficits in social behavioral tests in a mouse model of alternating hemiplegia of childhood
    Article Snippet: Myk /+ mice at N20 C57BL/6NCr were previously reported to be free of stress-induced seizure activity during electrocorticography (Kirshenbaum et al. ). .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were weaned at four weeks of age and grouped housed (2–5 mice/cage) with same-sex littermates.

    Article Title: Characterization of Cognitive Deficits in Mice With an Alternating Hemiplegia-Linked Mutation
    Article Snippet: Myk /+ males, backcrossed for 20 generations to the C57BL/6NCr strain (NCI-Frederick), were mated with C57BL/6NCrl (Charles River) females to yield wild-type (+/+) and Myk /+ littermates. .. Myk /+ mice were genotyped by the presence of an EcoO109I (New England BioLabs) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were group housed (2–5 mice/cage) with same-sex littermates.

    Polymerase Chain Reaction:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Transgenic rescue of phenotypic deficits in a mouse model of alternating hemiplegia of childhood
    Article Snippet: The purpose of the present study was to determine whether this increase in brain Na+ ,K+ -ATPase activity, to a level comparable with that of Atp1a3 tm1Ling/+ mice (~80 % of wild-type), would have remedial effects in phenotypic tests in which Myk /+ mice show clear deficiencies. .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using PCR primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Hemizygous Tg-Atp1a3 1Stcl/+ (Tg/+) mice were genotyped using PCR primers F, 5′-TGA CAT TGT AGG ACT ATA TTG C-3′ and R, 5′-GTT AAA GGT GTG AGG CAC AGA-3′ spanning the T7 vector-insert boundary.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Alternating Hemiplegia of Childhood-Related Neural and Behavioural Phenotypes in Na+,K+-ATPase ?3 Missense Mutant Mice
    Article Snippet: The Myshkin mouse line has been previously described and was backcrossed 20 generations to the seizure-resistant C57BL/6NCr strain (NCI-Frederick) , ; Myk /+ mice at N20 C57BL/6NCr were previously reported not to show stress-induced seizure activity during electrocorticography . .. Mice used in the present study were bred from C57BL/6NCrl females (Charles River) and Myk /+ males, and were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using polymerase chain reaction (PCR) primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′ . .. Wild-type littermates were used as controls for all experiments.

    Article Title: Deficits in social behavioral tests in a mouse model of alternating hemiplegia of childhood
    Article Snippet: Myk /+ mice at N20 C57BL/6NCr were previously reported to be free of stress-induced seizure activity during electrocorticography (Kirshenbaum et al. ). .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were weaned at four weeks of age and grouped housed (2–5 mice/cage) with same-sex littermates.

    Article Title: Characterization of Cognitive Deficits in Mice With an Alternating Hemiplegia-Linked Mutation
    Article Snippet: Myk /+ males, backcrossed for 20 generations to the C57BL/6NCr strain (NCI-Frederick), were mated with C57BL/6NCrl (Charles River) females to yield wild-type (+/+) and Myk /+ littermates. .. Myk /+ mice were genotyped by the presence of an EcoO109I (New England BioLabs) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were group housed (2–5 mice/cage) with same-sex littermates.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: DNA Sequence Analysis of SLC26A5, Encoding Prestin, in a Patient-Control Cohort: Identification of Fourteen Novel DNA Sequence Variations
    Article Snippet: When the T > G variant sequence was present, the digestion resulted in two fragments of 250 bp and 100 bp. .. PCR fragments containing position g.53884 were digested with restriction enzyme EcoO109I (New England Biolabs, Ipswich, MA, USA). .. When the consensus sequence was present, the digestion resulted in two fragments of 420 bp and 180 bp.

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Once cells on the third plate were at least ∼70% confluent, DNAs were extracted using QuickExtract DNA extraction solution and PCR amplified using the following primers: F3 primer, TGGCCCATTTATGAGAAAACTGA; and R2 primer, GGGAACAGACTTCAATTCTCCA. .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs). .. PCR products from successfully integrated clones were expected to be digested into products of 751 and 772 bp.

    Quantitative RT-PCR:

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Cotransfection:

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Paragraph title: Cotransfection of CRISPR plasmid and HDR template into hTERT-RPE1 cells. ... PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    CRISPR:

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Paragraph title: Cotransfection of CRISPR plasmid and HDR template into hTERT-RPE1 cells. ... PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Activated Clotting Time Assay:

    Article Title: Deficits in social behavioral tests in a mouse model of alternating hemiplegia of childhood
    Article Snippet: Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′.

    Purification:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: These coupled-standard plasmids were generated by incorporating cDNA for DE-skipped mRNA and either γ actin mRNA or mRNA that included a DE in the same plasmid. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule. .. This solution provided a standard for relative quantification through QPCR.

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs). .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Plasmid Preparation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs). .. A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: These coupled-standard plasmids were generated by incorporating cDNA for DE-skipped mRNA and either γ actin mRNA or mRNA that included a DE in the same plasmid. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule. .. This solution provided a standard for relative quantification through QPCR.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Paragraph title: Cotransfection of CRISPR plasmid and HDR template into hTERT-RPE1 cells. ... PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Real-time Polymerase Chain Reaction:

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: QPCR measurements were calibrated using plasmids containing both an exon-included and an exon-skipped sequence. .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Selection:

    Article Title: Splicing of designer exons informs a biophysical model for exon definition
    Article Snippet: The plasmid used in the generation of the cell line used for chromosomal incorporations, pMA-FW, contains a kanamycin resistance gene for initial selection, a promoterless puromycin resistance gene for subsequent selection of site-specific recombinations with DE-containing plasmids, a φC31 attP site and only the downstream portion of the modified dhfr minigene (including the last exon only). .. Purified plasmid was digested with EcoO109I (NEB) to generate a solution with equimolar amounts of each type of molecule.

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: Starting at 48 h posttransfection, cells were cultured in selection medium with 800 μg/ml of G418 (Sigma-Aldrich) for 7 days, with the selection medium being changed every other day. .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Agarose Gel Electrophoresis:

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells
    Article Snippet: PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs). .. PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Ethanol Precipitation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Concentration Assay:

    Article Title: Targeted resequencing of candidate genes using selector probes
    Article Snippet: Of each sample, 100 ng (200 ng for FFPE samples to compensate for DNA fragmentation) was added to eight different restriction reactions containing 1 unit each of two restriction enzymes and their corresponding compatible NEB buffer in 1× concentration and 0.85 µg/µl BSA in a total volume of 10 µl. .. The eight reactions were SfcI and Hpy188I in NEB buffer 4; DdeI and AluI in NEB buffer 2; MseI and Bsu36I in NEB buffer 3; MslI and BfaI in NEB buffer 4; HpyCH4III and Bsp1286 in NEB buffer 4; SfcI and NlaIII in NEB buffer 4; MseI and HpyCH4III in NEB buffer 4; HpyCH4V and EcoO109I in NEB buffer 4 (New England Biolabs).

    CTG Assay:

    Article Title: Transgenic rescue of phenotypic deficits in a mouse model of alternating hemiplegia of childhood
    Article Snippet: The purpose of the present study was to determine whether this increase in brain Na+ ,K+ -ATPase activity, to a level comparable with that of Atp1a3 tm1Ling/+ mice (~80 % of wild-type), would have remedial effects in phenotypic tests in which Myk /+ mice show clear deficiencies. .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using PCR primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Hemizygous Tg-Atp1a3 1Stcl/+ (Tg/+) mice were genotyped using PCR primers F, 5′-TGA CAT TGT AGG ACT ATA TTG C-3′ and R, 5′-GTT AAA GGT GTG AGG CAC AGA-3′ spanning the T7 vector-insert boundary.

    Article Title: Alternating Hemiplegia of Childhood-Related Neural and Behavioural Phenotypes in Na+,K+-ATPase ?3 Missense Mutant Mice
    Article Snippet: The Myshkin mouse line has been previously described and was backcrossed 20 generations to the seizure-resistant C57BL/6NCr strain (NCI-Frederick) , ; Myk /+ mice at N20 C57BL/6NCr were previously reported not to show stress-induced seizure activity during electrocorticography . .. Mice used in the present study were bred from C57BL/6NCrl females (Charles River) and Myk /+ males, and were genotyped by the presence of an Eco O109I (New England BioLabs) restriction site using polymerase chain reaction (PCR) primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′ . .. Wild-type littermates were used as controls for all experiments.

    Article Title: Deficits in social behavioral tests in a mouse model of alternating hemiplegia of childhood
    Article Snippet: Myk /+ mice at N20 C57BL/6NCr were previously reported to be free of stress-induced seizure activity during electrocorticography (Kirshenbaum et al. ). .. Myk /+ mice were genotyped by the presence of an Eco O109I (New England BioLabs, Hitchin, UK) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were weaned at four weeks of age and grouped housed (2–5 mice/cage) with same-sex littermates.

    Article Title: Characterization of Cognitive Deficits in Mice With an Alternating Hemiplegia-Linked Mutation
    Article Snippet: Myk /+ males, backcrossed for 20 generations to the C57BL/6NCr strain (NCI-Frederick), were mated with C57BL/6NCrl (Charles River) females to yield wild-type (+/+) and Myk /+ littermates. .. Myk /+ mice were genotyped by the presence of an EcoO109I (New England BioLabs) restriction site using polymerase chain reaction primers F, 5′-CTG CCG GAA ATA CAA TAC TGA-3′ and R, 5′-ATA AAT ACC CCA CCA CTG AGC-3′. .. Mice were group housed (2–5 mice/cage) with same-sex littermates.

    Variant Assay:

    Article Title: DNA Sequence Analysis of SLC26A5, Encoding Prestin, in a Patient-Control Cohort: Identification of Fourteen Novel DNA Sequence Variations
    Article Snippet: When the T > G variant sequence was present, the digestion resulted in two fragments of 250 bp and 100 bp. .. PCR fragments containing position g.53884 were digested with restriction enzyme EcoO109I (New England Biolabs, Ipswich, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ecoo109i restriction enzyme
    Validation of specificity and effectiveness of Ki-67 depletion reagents. (A) CRISPR/Cas9-based strategy for generating siRNA-resistant mutations in the endogenous Ki-67 gene. The si-Ki-67 target (green letters) and sgRNA-directed cleavage site (triangle) are indicated in the upper diagram of the endogenous locus. Altered nucleotides (red) and the novel <t>EcoO109I</t> restriction site are shown in the lower diagram of the repair template. (B) DNA sequence analysis of PCR products from wild-type hTERT-RPE1 cells and si-Ki-67-resistant clone 7. (C) EcoO109I digestion of the same PCR products sequenced for panel B. (D) Immunoblot analysis of clone 7 treated with the indicated reagents. (E) RT-qPCR analysis of clone 7. (F to L) Immunoblot analyses of the indicated cell lines treated with the indicated RNA depletion reagents.
    Ecoo109i Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecoo109i restriction enzyme/product/New England Biolabs
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    ecoo109i restriction enzyme - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Validation of specificity and effectiveness of Ki-67 depletion reagents. (A) CRISPR/Cas9-based strategy for generating siRNA-resistant mutations in the endogenous Ki-67 gene. The si-Ki-67 target (green letters) and sgRNA-directed cleavage site (triangle) are indicated in the upper diagram of the endogenous locus. Altered nucleotides (red) and the novel EcoO109I restriction site are shown in the lower diagram of the repair template. (B) DNA sequence analysis of PCR products from wild-type hTERT-RPE1 cells and si-Ki-67-resistant clone 7. (C) EcoO109I digestion of the same PCR products sequenced for panel B. (D) Immunoblot analysis of clone 7 treated with the indicated reagents. (E) RT-qPCR analysis of clone 7. (F to L) Immunoblot analyses of the indicated cell lines treated with the indicated RNA depletion reagents.

    Journal:

    Article Title: Ki-67 Contributes to Normal Cell Cycle Progression and Inactive X Heterochromatin in p21 Checkpoint-Proficient Human Cells

    doi: 10.1128/MCB.00569-16

    Figure Lengend Snippet: Validation of specificity and effectiveness of Ki-67 depletion reagents. (A) CRISPR/Cas9-based strategy for generating siRNA-resistant mutations in the endogenous Ki-67 gene. The si-Ki-67 target (green letters) and sgRNA-directed cleavage site (triangle) are indicated in the upper diagram of the endogenous locus. Altered nucleotides (red) and the novel EcoO109I restriction site are shown in the lower diagram of the repair template. (B) DNA sequence analysis of PCR products from wild-type hTERT-RPE1 cells and si-Ki-67-resistant clone 7. (C) EcoO109I digestion of the same PCR products sequenced for panel B. (D) Immunoblot analysis of clone 7 treated with the indicated reagents. (E) RT-qPCR analysis of clone 7. (F to L) Immunoblot analyses of the indicated cell lines treated with the indicated RNA depletion reagents.

    Article Snippet: PCR products (1,523 bp) were further digested with the EcoO109I restriction enzyme (New England BioLabs).

    Techniques: CRISPR, Sequencing, Polymerase Chain Reaction, Quantitative RT-PCR