eco ri  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    EcoRI HF
    Description:
    EcoRI HF 50 000 units
    Catalog Number:
    r3101l
    Price:
    249
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs eco ri
    EcoRI HF
    EcoRI HF 50 000 units
    https://www.bioz.com/result/eco ri/product/New England Biolabs
    Average 95 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    eco ri - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: All the standard parts were domesticated for Aar I and Bsa I when necessary and were cloned into mUAV. .. Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... PAFAH2 (Origene, #RC200355) and ESD (Origene, #RC200533) constructs were digested using EcoR1-HF (New England BioLabs, #R3101S) and Fse1 (New England BioLabs, #R0588S), followed by heat inactivation.

    Amplification:

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: They were then amplified using Q5 DNA polymerase (NEB) with primers bearing EcoRI , AarI , BsaI , and PstI restriction sites and 4 bp overhangs. .. Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel).

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: Restriction digestion An EcoRI restriction cut site was introduced within the 601 positioning sequence by PCR amplification, 10–15 bp from the left edge of the 601 sequence. .. Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C.

    Synthesized:

    Article Title: Regulatory Protein BBD18 of the Lyme Disease Spirochete: Essential Role During Tick Acquisition?
    Article Snippet: Variant bbd18 genes were synthesized by GenScript Corporation (Piscataway, NJ) with EcoRI recognition sites at both ends. .. These synthetic genes were excised from pUC57 with EcoRI-HF (New England Biolabs, Ipswich, MA) and ligated into appropriately digested and dephosphorylated pBSV2*flaBp ( ) in a manner following the construction of pBSV2*flaBp-bbd18, which contains the wild-type bbd18 gene under expression of the constitutive flaB promoter ( ).

    Neutralization:

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae
    Article Snippet: For digestions, 10 µg of total algae genomic DNA or 250 ng of the exogenous chloroplast genome DNA isolated from bacteria were incubated with EcoRI-HF or NdeI (New England Biolabs; Ipswich, MA, USA) for 3 h at 37°C in a total volume of 50 µl. .. Gel-embedded samples were then incubated in depurination buffer (0.25 N HCl) for 8 min, denaturation buffer (0.5 N NaOH and 1.5 M NaCl) for 18 min, neutralization buffer (1M Tris–HCl, 1.5 M NaCl, pH = 7.4) for 20 min and transferred to a Hybond-N+ membrane (GE Healthcare; Piscataway, NJ, USA).

    Construct:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA), and the appropriate bands were manually excised.

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel). .. Ligation was mediated by T7 DNA ligase (NEB) to construct mUAV, Level 1 and Level 2 Acceptor Vectors.

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: .. PAFAH2 (Origene, #RC200355) and ESD (Origene, #RC200533) constructs were digested using EcoR1-HF (New England BioLabs, #R3101S) and Fse1 (New England BioLabs, #R0588S), followed by heat inactivation. .. Blunt ends were created using DNA Polymerase I, large (Klenow) fragment (New England BioLabs, #M0210S).

    Article Title: Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador, et al. Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador
    Article Snippet: 2.3 ddRADseq library generation and sequencing We constructed double‐digested restriction‐site‐associated DNA sequencing (ddRAD) libraries on a subset of 125 samples of O. sylvatica following the protocol in Peterson, Weber, Kay, Fisher, and Hoekstra ( ). .. Genomic DNA of each sample (1 μg) was digested using 1 μl of EcoRI‐HF (20,000 U/ml) and 1 μl of SphI‐HF (20,000 U/ml) (New England Biolabs, Ipswitch, MA, USA) following the manufacturer's protocol.

    Electrophoresis:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA), and the appropriate bands were manually excised.

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: Electrophoresis was performed in 0.5X TBE buffer at 80 V for 3 hr. .. Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ].

    Incubation:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. Ligation reactions were performed with high-concentration T4 DNA ligase (Life Technologies) with a 1:6 vector to insert ratio, followed by overnight incubation at 16°C.

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae
    Article Snippet: .. For digestions, 10 µg of total algae genomic DNA or 250 ng of the exogenous chloroplast genome DNA isolated from bacteria were incubated with EcoRI-HF or NdeI (New England Biolabs; Ipswich, MA, USA) for 3 h at 37°C in a total volume of 50 µl. .. Digestion products were separated on a 0.7% agarose gel run in TAE.

    Activity Assay:

    Article Title: Multiple Pairwise Analysis of Non-homologous Centromere Coupling Reveals Preferential Chromosome Size-Dependent Interactions and a Role for Bouquet Formation in Establishing the Interaction Pattern
    Article Snippet: For the double digestion, EcoRI-HF and MfeI-HF (NEB) generated cohesive ends that were compatible, yet recognizing slightly different sequences (GAATTC and CAATTG respectively). .. They were selected due to their extremely low star activity, extended enzymatic half-life suitable for overnight digestion and stronger activity in samples of lower purity, making them appropriate for digestion of crosslinked chromatin.

    Expressing:

    Article Title: Regulatory Protein BBD18 of the Lyme Disease Spirochete: Essential Role During Tick Acquisition?
    Article Snippet: .. These synthetic genes were excised from pUC57 with EcoRI-HF (New England Biolabs, Ipswich, MA) and ligated into appropriately digested and dephosphorylated pBSV2*flaBp ( ) in a manner following the construction of pBSV2*flaBp-bbd18, which contains the wild-type bbd18 gene under expression of the constitutive flaB promoter ( ). ..

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... PAFAH2 (Origene, #RC200355) and ESD (Origene, #RC200533) constructs were digested using EcoR1-HF (New England BioLabs, #R3101S) and Fse1 (New England BioLabs, #R0588S), followed by heat inactivation.

    Transformation Assay:

    Article Title: Regulatory Protein BBD18 of the Lyme Disease Spirochete: Essential Role During Tick Acquisition?
    Article Snippet: These synthetic genes were excised from pUC57 with EcoRI-HF (New England Biolabs, Ipswich, MA) and ligated into appropriately digested and dephosphorylated pBSV2*flaBp ( ) in a manner following the construction of pBSV2*flaBp-bbd18, which contains the wild-type bbd18 gene under expression of the constitutive flaB promoter ( ). .. These shuttle vectors were transformed into B312 and assessed by immunoblotting for their ability to suppress OspC synthesis.

    Ligation:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA), and the appropriate bands were manually excised.

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel). .. Ligation was mediated by T7 DNA ligase (NEB) to construct mUAV, Level 1 and Level 2 Acceptor Vectors.

    Article Title: Analysis of the Pseudouridimycin Biosynthetic Pathway Provides Insights into the Formation of C-nucleoside Antibiotics
    Article Snippet: .. Genetic procedures such as plasmid DNA isolation (EuroGold Plasmid Miniprep KIT - EuroClone), restriction endonuclease digestion ( EcoRI-HF, BamHI-HF, XbaI, BglII – NewEngland Biolabs Inc), alkaline phosphatase treatment (NewEngland Biolabs Inc), DNA ligations (Quick Ligation Kit – NewEngland Biolabs Inc), blund-ends DNA generation [DNA Polymerase I, Large (Klenow) Fragment] and genomic DNA extraction (GenElute Bacterial Genomic DNA kit, Sigma-Aldrich) were performed according to the manufacturers’ protocols. .. DNA fragments were excised from agarose gels and residual agarose was removed with the GenElute Gel Extraction Kit, Sigma-Aldrich.

    Transferring:

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C. .. Control reactions showed that free DNA was digested within ∼0.5 min. Time points were taken by transferring 1 μl of each 25 μl reaction to 9 μl of quench (SDS-PAGE loading buffer with 40 mM EDTA).

    Digital PCR:

    Article Title: Linked read sequencing resolves complex genomic rearrangements in gastric cancer metastases
    Article Snippet: Paragraph title: Identifying FGFR2 copy number using droplet digital PCR ... Briefly, gDNA was first digested by EcoRI-HF (NEB) and cleaned up by AMPure XP beads (Beckman Coulter).

    Generated:

    Article Title: Multiple Pairwise Analysis of Non-homologous Centromere Coupling Reveals Preferential Chromosome Size-Dependent Interactions and a Role for Bouquet Formation in Establishing the Interaction Pattern
    Article Snippet: .. For the double digestion, EcoRI-HF and MfeI-HF (NEB) generated cohesive ends that were compatible, yet recognizing slightly different sequences (GAATTC and CAATTG respectively). .. They were selected due to their extremely low star activity, extended enzymatic half-life suitable for overnight digestion and stronger activity in samples of lower purity, making them appropriate for digestion of crosslinked chromatin.

    DNA Sequencing:

    Article Title: Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador, et al. Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador
    Article Snippet: 2.3 ddRADseq library generation and sequencing We constructed double‐digested restriction‐site‐associated DNA sequencing (ddRAD) libraries on a subset of 125 samples of O. sylvatica following the protocol in Peterson, Weber, Kay, Fisher, and Hoekstra ( ). .. Genomic DNA of each sample (1 μg) was digested using 1 μl of EcoRI‐HF (20,000 U/ml) and 1 μl of SphI‐HF (20,000 U/ml) (New England Biolabs, Ipswitch, MA, USA) following the manufacturer's protocol.

    DNA Labeling:

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae
    Article Snippet: For digestions, 10 µg of total algae genomic DNA or 250 ng of the exogenous chloroplast genome DNA isolated from bacteria were incubated with EcoRI-HF or NdeI (New England Biolabs; Ipswich, MA, USA) for 3 h at 37°C in a total volume of 50 µl. .. The DIG High Prime DNA Labeling and Detection Starter Kit II (Roche; Indianapolis, IN, USA) was used to probe Southern blots according to the manufacturers protocol.

    Polymerase Chain Reaction:

    Article Title: Multiple Phenotypes Resulting from a Mutagenesis Screen for Pharynx Muscle Mutations in Caenorhabditis elegans
    Article Snippet: For interval mapping, the previous protocol was followed with the following exceptions, ninety-six F2 generation phenotypically mutant worms were placed into one well of 96-well PCR plate containing 10 µL of proteinase K (6 mg/mL) diluted 1∶10 with worm lysis buffer. .. All regions were cut with DraI (NEB) to identify SNPs, except for 2.8 LG.I the DNA was digested EcoRI-HF (NEB).

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: To create a double-stranded product from the single-stranded DNA oligonucleotide, two cycles of PCR were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA) and Nextera adapter-specific primers (Supplementary Table SI2) as per the manufacturer's instructions. .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone.

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: .. Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel). .. Ligation was mediated by T7 DNA ligase (NEB) to construct mUAV, Level 1 and Level 2 Acceptor Vectors.

    Article Title: Analysis of the Pseudouridimycin Biosynthetic Pathway Provides Insights into the Formation of C-nucleoside Antibiotics
    Article Snippet: Genetic procedures such as plasmid DNA isolation (EuroGold Plasmid Miniprep KIT - EuroClone), restriction endonuclease digestion ( EcoRI-HF, BamHI-HF, XbaI, BglII – NewEngland Biolabs Inc), alkaline phosphatase treatment (NewEngland Biolabs Inc), DNA ligations (Quick Ligation Kit – NewEngland Biolabs Inc), blund-ends DNA generation [DNA Polymerase I, Large (Klenow) Fragment] and genomic DNA extraction (GenElute Bacterial Genomic DNA kit, Sigma-Aldrich) were performed according to the manufacturers’ protocols. .. PCR was carried out using DreamTaq Green PCR Master Mix (ThermoScientific) and PCRBIO HiFi Polymerase (PCRBiosystems) according to the manufacturers’ procedures.

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: Restriction digestion An EcoRI restriction cut site was introduced within the 601 positioning sequence by PCR amplification, 10–15 bp from the left edge of the 601 sequence. .. Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C.

    Molecular Weight:

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: Supercoiled DNA ladder (New England Biolabs, UK) was used as a molecular weight standard for the plasmid size estimation. .. Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ].

    DNA Extraction:

    Article Title: Analysis of the Pseudouridimycin Biosynthetic Pathway Provides Insights into the Formation of C-nucleoside Antibiotics
    Article Snippet: .. Genetic procedures such as plasmid DNA isolation (EuroGold Plasmid Miniprep KIT - EuroClone), restriction endonuclease digestion ( EcoRI-HF, BamHI-HF, XbaI, BglII – NewEngland Biolabs Inc), alkaline phosphatase treatment (NewEngland Biolabs Inc), DNA ligations (Quick Ligation Kit – NewEngland Biolabs Inc), blund-ends DNA generation [DNA Polymerase I, Large (Klenow) Fragment] and genomic DNA extraction (GenElute Bacterial Genomic DNA kit, Sigma-Aldrich) were performed according to the manufacturers’ protocols. .. DNA fragments were excised from agarose gels and residual agarose was removed with the GenElute Gel Extraction Kit, Sigma-Aldrich.

    Nucleic Acid Electrophoresis:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The double-stranded nature of the product was verified using a SmaI (New England BioLabs, Ipswich, MA, USA) restriction digest and gel electrophoresis. .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone.

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ]. .. Restriction fragments were separated on a 0.8% agarose gel prestained with 0.5 μg/ml ethidium bromide (Thermo Scientific, US) at 80 V for 3 hrs and visualized following gel electrophoresis.

    Mutagenesis:

    Article Title: Multiple Phenotypes Resulting from a Mutagenesis Screen for Pharynx Muscle Mutations in Caenorhabditis elegans
    Article Snippet: For interval mapping, the previous protocol was followed with the following exceptions, ninety-six F2 generation phenotypically mutant worms were placed into one well of 96-well PCR plate containing 10 µL of proteinase K (6 mg/mL) diluted 1∶10 with worm lysis buffer. .. All regions were cut with DraI (NEB) to identify SNPs, except for 2.8 LG.I the DNA was digested EcoRI-HF (NEB).

    Article Title: Regulatory Protein BBD18 of the Lyme Disease Spirochete: Essential Role During Tick Acquisition?
    Article Snippet: Paragraph title: Site-directed mutagenesis of BBD18. ... These synthetic genes were excised from pUC57 with EcoRI-HF (New England Biolabs, Ipswich, MA) and ligated into appropriately digested and dephosphorylated pBSV2*flaBp ( ) in a manner following the construction of pBSV2*flaBp-bbd18, which contains the wild-type bbd18 gene under expression of the constitutive flaB promoter ( ).

    Isolation:

    Article Title: Multiple Phenotypes Resulting from a Mutagenesis Screen for Pharynx Muscle Mutations in Caenorhabditis elegans
    Article Snippet: After 24 hours, hermaphrodites with copulatory plugs were isolated. .. All regions were cut with DraI (NEB) to identify SNPs, except for 2.8 LG.I the DNA was digested EcoRI-HF (NEB).

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae
    Article Snippet: .. For digestions, 10 µg of total algae genomic DNA or 250 ng of the exogenous chloroplast genome DNA isolated from bacteria were incubated with EcoRI-HF or NdeI (New England Biolabs; Ipswich, MA, USA) for 3 h at 37°C in a total volume of 50 µl. .. Digestion products were separated on a 0.7% agarose gel run in TAE.

    Labeling:

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: .. Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C. .. After pre-incubation of Chd1 (100 nM), nucleosomes (150 nM) and ±LacI (1.2 μM) for 5 min, EcoR1-HF was added for 2 min to digest free DNA, followed by ATP addition to a final concentration of 2.5 mM.

    Purification:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA), and the appropriate bands were manually excised.

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: .. Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel). .. Ligation was mediated by T7 DNA ligase (NEB) to construct mUAV, Level 1 and Level 2 Acceptor Vectors.

    Article Title: Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador, et al. Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador
    Article Snippet: Genomic DNA of each sample (1 μg) was digested using 1 μl of EcoRI‐HF (20,000 U/ml) and 1 μl of SphI‐HF (20,000 U/ml) (New England Biolabs, Ipswitch, MA, USA) following the manufacturer's protocol. .. Purified digested DNA (100 ng) was ligated to double‐stranded adapters (biotin‐labeled on P2 adapter) with a unique inline barcode using T4 DNA ligase (New England Biolabs) and purified with Agencourt Ampure XP beads.

    Sequencing:

    Article Title: Multiple Phenotypes Resulting from a Mutagenesis Screen for Pharynx Muscle Mutations in Caenorhabditis elegans
    Article Snippet: All primers are identical to Davis et al, 2005 except for the addition of 2.8 LG.I, with the forward primer sequence 5′TCAAATTTGGCACGTCATCAG3′ and reverse primer sequence 5′CTCCATTTTGGAACTCCCAG3′ . .. All regions were cut with DraI (NEB) to identify SNPs, except for 2.8 LG.I the DNA was digested EcoRI-HF (NEB).

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel). .. To construct the 50 bp linkers in the Auxiliary Plasmids, a short sequence was PCR amplified from scOrange gene using primers that contained the appropriate overhangs and the Aar I and Bsa I recogni tion sites.

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: Restriction digestion An EcoRI restriction cut site was introduced within the 601 positioning sequence by PCR amplification, 10–15 bp from the left edge of the 601 sequence. .. Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C.

    Article Title: Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador, et al. Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador
    Article Snippet: Paragraph title: ddRADseq library generation and sequencing ... Genomic DNA of each sample (1 μg) was digested using 1 μl of EcoRI‐HF (20,000 U/ml) and 1 μl of SphI‐HF (20,000 U/ml) (New England Biolabs, Ipswitch, MA, USA) following the manufacturer's protocol.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: CypherSeq design and generation of empty library stocks To create the CypherSeq library construct, two 195 base PAGE Ultramer DNA oligonucleotides (Integrated DNA Technologies, Coralville, IA, USA) were designed (Supplementary Table SI1). .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone.

    Gel Extraction:

    Article Title: Analysis of the Pseudouridimycin Biosynthetic Pathway Provides Insights into the Formation of C-nucleoside Antibiotics
    Article Snippet: Genetic procedures such as plasmid DNA isolation (EuroGold Plasmid Miniprep KIT - EuroClone), restriction endonuclease digestion ( EcoRI-HF, BamHI-HF, XbaI, BglII – NewEngland Biolabs Inc), alkaline phosphatase treatment (NewEngland Biolabs Inc), DNA ligations (Quick Ligation Kit – NewEngland Biolabs Inc), blund-ends DNA generation [DNA Polymerase I, Large (Klenow) Fragment] and genomic DNA extraction (GenElute Bacterial Genomic DNA kit, Sigma-Aldrich) were performed according to the manufacturers’ protocols. .. DNA fragments were excised from agarose gels and residual agarose was removed with the GenElute Gel Extraction Kit, Sigma-Aldrich.

    IA:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: CypherSeq design and generation of empty library stocks To create the CypherSeq library construct, two 195 base PAGE Ultramer DNA oligonucleotides (Integrated DNA Technologies, Coralville, IA, USA) were designed (Supplementary Table SI1). .. The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone.

    SDS Page:

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C. .. Control reactions showed that free DNA was digested within ∼0.5 min. Time points were taken by transferring 1 μl of each 25 μl reaction to 9 μl of quench (SDS-PAGE loading buffer with 40 mM EDTA).

    Plasmid Preparation:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA), and the appropriate bands were manually excised.

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly
    Article Snippet: Paragraph title: Part and vector generation ... Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel).

    Article Title: Analysis of the Pseudouridimycin Biosynthetic Pathway Provides Insights into the Formation of C-nucleoside Antibiotics
    Article Snippet: .. Genetic procedures such as plasmid DNA isolation (EuroGold Plasmid Miniprep KIT - EuroClone), restriction endonuclease digestion ( EcoRI-HF, BamHI-HF, XbaI, BglII – NewEngland Biolabs Inc), alkaline phosphatase treatment (NewEngland Biolabs Inc), DNA ligations (Quick Ligation Kit – NewEngland Biolabs Inc), blund-ends DNA generation [DNA Polymerase I, Large (Klenow) Fragment] and genomic DNA extraction (GenElute Bacterial Genomic DNA kit, Sigma-Aldrich) were performed according to the manufacturers’ protocols. .. DNA fragments were excised from agarose gels and residual agarose was removed with the GenElute Gel Extraction Kit, Sigma-Aldrich.

    Article Title: Regulatory Protein BBD18 of the Lyme Disease Spirochete: Essential Role During Tick Acquisition?
    Article Snippet: Based on BLAST alignment of WT BBD18 (B. burgdorferi B31, GenBank accession no. AE000793.2 ) with amino acid residues contacting DNA in SopB ( ) and conserved residues in other Borrelia species (B. recurrentis A1, plasmid plate 6, GenBank accession no. CP001000.1 ; B. hermsii MTW, plasmid contig 0014, GenBank accession no. CP005691.1 ), we designed four bbd18 variants, each with multiple amino acid substitutions ( ). .. These synthetic genes were excised from pUC57 with EcoRI-HF (New England Biolabs, Ipswich, MA) and ligated into appropriately digested and dephosphorylated pBSV2*flaBp ( ) in a manner following the construction of pBSV2*flaBp-bbd18, which contains the wild-type bbd18 gene under expression of the constitutive flaB promoter ( ).

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: Supercoiled DNA ladder (New England Biolabs, UK) was used as a molecular weight standard for the plasmid size estimation. .. Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ].

    Article Title: In silico analysis of the fucosylation-associated genome of the human blood fluke Schistosoma mansoni: cloning and characterization of the enzymes involved in GDP-L-fucose synthesis and Golgi import
    Article Snippet: .. The protocol for single digests of restriction-tagged GMER and the stock pGEX-6P-1 vector excluded EcoRI-HF™. .. In both schemes, reactions were incubated at 37°C for 2 h. To prevent self-ligation, 2 U calf intestinal alkaline phosphatase (CIP, New England BioLabs) in 1× NEBuffer 4 was added to the linearized pGEX-6P-1 vector, and reactions (30 μL total volume) were incubated at 37°C for 1 h. Both CIP-treated pGEX-6P-1 vector and restriction-digested GMD /GMER amplicon were purified by electrophoretic fractionation in 1% agarose gel, and the DNA fragments were isolated by QIAquick gel extraction.

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... PAFAH2 (Origene, #RC200355) and ESD (Origene, #RC200533) constructs were digested using EcoR1-HF (New England BioLabs, #R3101S) and Fse1 (New England BioLabs, #R0588S), followed by heat inactivation.

    Software:

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ]. .. Plasmid restriction profiles were compared using Bionumerics software, version 7.0 (Applied Maths, Kortrijk, Belgium).

    Agarose Gel Electrophoresis:

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae
    Article Snippet: For digestions, 10 µg of total algae genomic DNA or 250 ng of the exogenous chloroplast genome DNA isolated from bacteria were incubated with EcoRI-HF or NdeI (New England Biolabs; Ipswich, MA, USA) for 3 h at 37°C in a total volume of 50 µl. .. Digestion products were separated on a 0.7% agarose gel run in TAE.

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: To determine the plasmid size and number, extracted plasmids from donors and transconjugants were separated on a 0.8% agarose gel prestained with 0.5 μg/ml ethidium bromide (Thermo Scientific, US). .. Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ].

    Article Title: Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador, et al. Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador
    Article Snippet: Genomic DNA of each sample (1 μg) was digested using 1 μl of EcoRI‐HF (20,000 U/ml) and 1 μl of SphI‐HF (20,000 U/ml) (New England Biolabs, Ipswitch, MA, USA) following the manufacturer's protocol. .. Barcoded samples were pooled and size‐selected between 250 and 350 bp (326–426 bp accounting for the 76 bp adapter) using a Pippin Prep 2% agarose gel cassette (Sage Science, Beverly, MA, USA).

    Embryo Culture:

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Paragraph title: Embryo culture and genotyping ... KSOM+AA medium (Potassium-supplemented simplex optimized medium plus amino acids; Zenith Biotech, cat. no. ZEKS-050) Mineral oil (Millipore, cat. no. ES-005C, embryo grade) Potassium chloride (KCl, Fisher, cat. no. P217–3, certified ACS grade) 1M Tris-HCl, pH 8.5 Solution. (Teknova, cat. no. T1085, molecular biology grade) Ethylenediaminetetraacetic acid (EDTA; Sigma, cat. no. EDS-100G, anhydrous) Magnesium chloride (MgCl2; Fisher, cat. no. M33–500 certified ACS grade) Gelatin type B (Fisher, cat. no. G7–500, laboratory grade) Nonidet P-40 substitute (NP-40; Sigma, cat. no. 74385) Tween-20 (Sigma, cat. no. P7949–500, molecular biology grade) Proteinase K (Fisher, cat. no. BP1700–100, molecular biology grade) GoTaq (Promega, cat. no. M712) HinfI (NEB, cat. no. R0155S, 10,000 units/ml) EcoRI (NEB, cat. no. R3101S, 20,000 units/ml) Additional restriction enzymes for RFLP (Optional, NEB) LE agarose (BioExpress, cat. no. E-3120–500, analytical grade) Tris Base (Fisher cat. no. 77–68-1, molecular biology grade) Acetic acid (Fisher cat. no. 64–19-7, Glacial Certified ACS) 1 kb Plus DNA ladder (Thermo, cat. no.10787018) EtBr (Ethidium Bromide 10 mg/ml; Thermo, cat. no. 15585011, Ultrapure) CAUTION EtBr is considered to be a potent mutagen.

    Spectrophotometry:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The double-stranded product was then purified using the Zymo Research DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA, USA) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC19 backbone. .. The DNA in the gel fragments was then purified using a Zymoclean Gel DNA Recovery kit (Zymo Research) and DNA was quantified using a spectrophotometer (Nanophotometer, Implen, Inc., Munich, Germany).

    Sampling:

    Article Title: Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador, et al. Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador
    Article Snippet: Samples include three specimens randomly drawn within each sampling site from the monomorphic populations (with two sampling sites for Durango and San Antonio populations) and all the specimens from the polymorphic region in Otokiki (see Figure ). .. Genomic DNA of each sample (1 μg) was digested using 1 μl of EcoRI‐HF (20,000 U/ml) and 1 μl of SphI‐HF (20,000 U/ml) (New England Biolabs, Ipswitch, MA, USA) following the manufacturer's protocol.

    Concentration Assay:

    Article Title: The Chd1 chromatin remodeler can sense both entry and exit sides of the nucleosome
    Article Snippet: Digestions of 150 nM fluorescently labeled [FAM]0N70[LacO-11R,Cy5] nucleosomes were carried out using 2 U/μl of EcoRI-HF (NEB) in 1×CutSmart buffer at 30°C. .. After pre-incubation of Chd1 (100 nM), nucleosomes (150 nM) and ±LacI (1.2 μM) for 5 min, EcoR1-HF was added for 2 min to digest free DNA, followed by ATP addition to a final concentration of 2.5 mM.

    Marker:

    Article Title: Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae
    Article Snippet: Transconjugants plasmids were digested with the restriction enzyme EcoRI -HF (New England Biolabs, UK) [ ]. .. Lambda DNA/HindIII Marker, Ready-to-Use (Thermo Fisher Scientific, Lithuania) was used as a molecular weight standard.

    Lysis:

    Article Title: Multiple Phenotypes Resulting from a Mutagenesis Screen for Pharynx Muscle Mutations in Caenorhabditis elegans
    Article Snippet: For interval mapping, the previous protocol was followed with the following exceptions, ninety-six F2 generation phenotypically mutant worms were placed into one well of 96-well PCR plate containing 10 µL of proteinase K (6 mg/mL) diluted 1∶10 with worm lysis buffer. .. All regions were cut with DraI (NEB) to identify SNPs, except for 2.8 LG.I the DNA was digested EcoRI-HF (NEB).

    Article Title: An exogenous chloroplast genome for complex sequence manipulation in algae
    Article Snippet: Approximately 107 cells were collected, suspended in lysis buffer (150 mM Tris–HCl, pH = 7.5, 200 mM NaCl, 20 mM EDTA and 1% SDS), incubated for 1 h at 37°C, extracted once with phenol/chloroform (1:1) and twice with chloroform, ethanol precipitated and resuspended in TE buffer (10 mM Tris–HCl, pH = 7.4, 1 mM EDTA, 50 µg/ml RNase). .. For digestions, 10 µg of total algae genomic DNA or 250 ng of the exogenous chloroplast genome DNA isolated from bacteria were incubated with EcoRI-HF or NdeI (New England Biolabs; Ipswich, MA, USA) for 3 h at 37°C in a total volume of 50 µl.

    Variant Assay:

    Article Title: Regulatory Protein BBD18 of the Lyme Disease Spirochete: Essential Role During Tick Acquisition?
    Article Snippet: Variant bbd18 genes were synthesized by GenScript Corporation (Piscataway, NJ) with EcoRI recognition sites at both ends. .. These synthetic genes were excised from pUC57 with EcoRI-HF (New England Biolabs, Ipswich, MA) and ligated into appropriately digested and dephosphorylated pBSV2*flaBp ( ) in a manner following the construction of pBSV2*flaBp-bbd18, which contains the wild-type bbd18 gene under expression of the constitutive flaB promoter ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs eco ri mtase
    Continuous monitoring of methyltransferases. To perform the methyltransferase assay, a 100 μl reaction typically contained the following assay components: 3.5 μg purified recombinant Mtn, 1 μg XOD (10 units/mg), 0.2 μg HRP (300 units/mg), 0.1 mM Amplex Red, 5 mM MgCl 2 , 0.5 mM SAM (32 mM stock), 1 mM salicylic acid or ~14 nM lambda <t>DNA</t> (0.5 mg/ml), 1-3 μg SA <t>MTase</t> or 80 units Eco RI MTase, and 50 mM Tris-HCl (pH 7.5) or 50 mM potassium phosphate buffer (pH 7.5). For SA MTase, the mixture was additionally supplemented with 1 mM KCl to stimulate activity. Reactions were initiated either with addition of the substrate or enzyme. Fluorescence output was monitored in 96-well microplates at 590 nm with excitation set at 530 nm. The reactions were incubated at 30°C without shaking for up to 60 mins. (A) Methyltransferase activity of Eco RI MTase in the presence of lambda DNA and SAM. (B) Confirmation of lambda DNA methylation by agarose gel electrophoresis. (C) Methyltransferase activity of SA MTase in the presence of salicylic acid (SA) and SAM. (D) Confirmation of the synthesis of methyl salicylate by HPLC.
    Eco Ri Mtase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eco ri mtase/product/New England Biolabs
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    eco ri mtase - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    78
    New England Biolabs hin cii eco ri
    Diagrammatic representation of the liver-derived gp70 cDNA and viral env ) is 99% homologous to that of the infectious NZB xenotropic virus env ), except for several base changes clustered near the gp70/p15E cleavage site and in the 3′ flanking region and <t>LTR</t> ( ), which are reflected by the indicated differences in restriction sites. The SFFV env gene ( ) is a product of natural recombination between endogenous polytropic and exogenous Friend ecotropic viruses with a large in-frame deletion (▿) encompassing the 3′ portion of gp70- and the 5′ portion of p15E-encoding regions. Dashed lines represent vector-derived sequences. A, Acc I; B, Bam HI; E, Eco RI; Ha, Hae II; Hc, Hin <t>cII;</t> Hd, Hin dIII; K, Kpn I; S, Sma I; V, Eco RV; X, Bst XI; AAAAA, poly(A) tail.
    Hin Cii Eco Ri, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hin cii eco ri/product/New England Biolabs
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hin cii eco ri - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    New England Biolabs hin diii eco ri linker
    Targeting strategy, Southern blots and PCR analysis of ES cells and mice lacking the β3-integrin gene. ( a ) Structure of β3 targeting construct, wild-type β3 allele and targeted β3 allele. <t>Exons</t> are indicated as black boxes. The 1.7 kb pgk-neomycin-resistance cassette replaces a 1.4 kb Hin <t>dIII</t> fragment of the β3-gene including exons I and II. Pgk-thymidine kinase genes were used for negative selection. ( b ) Southern blot analysis of Eco RI, Bst EII and NcoI -digested genomic DNA from a representative targeted clone (111). Probe A lay 5′ of the targeting construct and probe B lay inside it ( a ). ( c ) PCR analysis of wild-type, heterozygous and β3-null tail DNA used to screen offspring. Primer locations are indicated by half arrows in A and give products of 446 bp with primers 1 and 3 (wild-type) or 538 bp with primers 1 and 2 (mutant).
    Hin Diii Eco Ri Linker, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hin diii eco ri linker/product/New England Biolabs
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hin diii eco ri linker - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results


    Continuous monitoring of methyltransferases. To perform the methyltransferase assay, a 100 μl reaction typically contained the following assay components: 3.5 μg purified recombinant Mtn, 1 μg XOD (10 units/mg), 0.2 μg HRP (300 units/mg), 0.1 mM Amplex Red, 5 mM MgCl 2 , 0.5 mM SAM (32 mM stock), 1 mM salicylic acid or ~14 nM lambda DNA (0.5 mg/ml), 1-3 μg SA MTase or 80 units Eco RI MTase, and 50 mM Tris-HCl (pH 7.5) or 50 mM potassium phosphate buffer (pH 7.5). For SA MTase, the mixture was additionally supplemented with 1 mM KCl to stimulate activity. Reactions were initiated either with addition of the substrate or enzyme. Fluorescence output was monitored in 96-well microplates at 590 nm with excitation set at 530 nm. The reactions were incubated at 30°C without shaking for up to 60 mins. (A) Methyltransferase activity of Eco RI MTase in the presence of lambda DNA and SAM. (B) Confirmation of lambda DNA methylation by agarose gel electrophoresis. (C) Methyltransferase activity of SA MTase in the presence of salicylic acid (SA) and SAM. (D) Confirmation of the synthesis of methyl salicylate by HPLC.

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases

    doi: 10.3389/fbioe.2018.00146

    Figure Lengend Snippet: Continuous monitoring of methyltransferases. To perform the methyltransferase assay, a 100 μl reaction typically contained the following assay components: 3.5 μg purified recombinant Mtn, 1 μg XOD (10 units/mg), 0.2 μg HRP (300 units/mg), 0.1 mM Amplex Red, 5 mM MgCl 2 , 0.5 mM SAM (32 mM stock), 1 mM salicylic acid or ~14 nM lambda DNA (0.5 mg/ml), 1-3 μg SA MTase or 80 units Eco RI MTase, and 50 mM Tris-HCl (pH 7.5) or 50 mM potassium phosphate buffer (pH 7.5). For SA MTase, the mixture was additionally supplemented with 1 mM KCl to stimulate activity. Reactions were initiated either with addition of the substrate or enzyme. Fluorescence output was monitored in 96-well microplates at 590 nm with excitation set at 530 nm. The reactions were incubated at 30°C without shaking for up to 60 mins. (A) Methyltransferase activity of Eco RI MTase in the presence of lambda DNA and SAM. (B) Confirmation of lambda DNA methylation by agarose gel electrophoresis. (C) Methyltransferase activity of SA MTase in the presence of salicylic acid (SA) and SAM. (D) Confirmation of the synthesis of methyl salicylate by HPLC.

    Article Snippet: During the assay, a linear increase in fluorescence intensity was observed upon addition of Eco RI MTAse with lambda DNA as substrate at a concentration of 96 nM (Figure ).

    Techniques: Purification, Recombinant, Lambda DNA Preparation, Activity Assay, Fluorescence, Incubation, Methylation, Agarose Gel Electrophoresis, High Performance Liquid Chromatography

    Continuous monitoring of methyltransferases. To perform the methyltransferase assay, a 100 μl reaction typically contained the following assay components: 3.5 μg purified recombinant Mtn, 1 μg XOD (10 units/mg), 0.2 μg HRP (300 units/mg), 0.1 mM Amplex Red, 5 mM MgCl 2 , 0.5 mM SAM (32 mM stock), 1 mM salicylic acid or ~14 nM lambda DNA (0.5 mg/ml), 1-3 μg SA MTase or 80 units Eco RI MTase, and 50 mM Tris-HCl (pH 7.5) or 50 mM potassium phosphate buffer (pH 7.5). For SA MTase, the mixture was additionally supplemented with 1 mM KCl to stimulate activity. Reactions were initiated either with addition of the substrate or enzyme. Fluorescence output was monitored in 96-well microplates at 590 nm with excitation set at 530 nm. The reactions were incubated at 30°C without shaking for up to 60 mins. (A) Methyltransferase activity of Eco RI MTase in the presence of lambda DNA and SAM. (B) Confirmation of lambda DNA methylation by agarose gel electrophoresis. (C) Methyltransferase activity of SA MTase in the presence of salicylic acid (SA) and SAM. (D) Confirmation of the synthesis of methyl salicylate by HPLC.

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases

    doi: 10.3389/fbioe.2018.00146

    Figure Lengend Snippet: Continuous monitoring of methyltransferases. To perform the methyltransferase assay, a 100 μl reaction typically contained the following assay components: 3.5 μg purified recombinant Mtn, 1 μg XOD (10 units/mg), 0.2 μg HRP (300 units/mg), 0.1 mM Amplex Red, 5 mM MgCl 2 , 0.5 mM SAM (32 mM stock), 1 mM salicylic acid or ~14 nM lambda DNA (0.5 mg/ml), 1-3 μg SA MTase or 80 units Eco RI MTase, and 50 mM Tris-HCl (pH 7.5) or 50 mM potassium phosphate buffer (pH 7.5). For SA MTase, the mixture was additionally supplemented with 1 mM KCl to stimulate activity. Reactions were initiated either with addition of the substrate or enzyme. Fluorescence output was monitored in 96-well microplates at 590 nm with excitation set at 530 nm. The reactions were incubated at 30°C without shaking for up to 60 mins. (A) Methyltransferase activity of Eco RI MTase in the presence of lambda DNA and SAM. (B) Confirmation of lambda DNA methylation by agarose gel electrophoresis. (C) Methyltransferase activity of SA MTase in the presence of salicylic acid (SA) and SAM. (D) Confirmation of the synthesis of methyl salicylate by HPLC.

    Article Snippet: For this purpose, we employed Eco RI MTase which is known to methylate the DNA sequence, GAATTC, of double-stranded linear DNA (Rubin and Modrich, ).

    Techniques: Purification, Recombinant, Lambda DNA Preparation, Activity Assay, Fluorescence, Incubation, Methylation, Agarose Gel Electrophoresis, High Performance Liquid Chromatography

    Diagrammatic representation of the liver-derived gp70 cDNA and viral env ) is 99% homologous to that of the infectious NZB xenotropic virus env ), except for several base changes clustered near the gp70/p15E cleavage site and in the 3′ flanking region and LTR ( ), which are reflected by the indicated differences in restriction sites. The SFFV env gene ( ) is a product of natural recombination between endogenous polytropic and exogenous Friend ecotropic viruses with a large in-frame deletion (▿) encompassing the 3′ portion of gp70- and the 5′ portion of p15E-encoding regions. Dashed lines represent vector-derived sequences. A, Acc I; B, Bam HI; E, Eco RI; Ha, Hae II; Hc, Hin cII; Hd, Hin dIII; K, Kpn I; S, Sma I; V, Eco RV; X, Bst XI; AAAAA, poly(A) tail.

    Journal: Journal of Virology

    Article Title: Establishment of Monoclonal Anti-Retroviral gp70 Autoantibodies from MRL/lpr Lupus Mice and Induction of Glomerular gp70 Deposition and Pathology by Transfer into Non-Autoimmune Mice

    doi:

    Figure Lengend Snippet: Diagrammatic representation of the liver-derived gp70 cDNA and viral env ) is 99% homologous to that of the infectious NZB xenotropic virus env ), except for several base changes clustered near the gp70/p15E cleavage site and in the 3′ flanking region and LTR ( ), which are reflected by the indicated differences in restriction sites. The SFFV env gene ( ) is a product of natural recombination between endogenous polytropic and exogenous Friend ecotropic viruses with a large in-frame deletion (▿) encompassing the 3′ portion of gp70- and the 5′ portion of p15E-encoding regions. Dashed lines represent vector-derived sequences. A, Acc I; B, Bam HI; E, Eco RI; Ha, Hae II; Hc, Hin cII; Hd, Hin dIII; K, Kpn I; S, Sma I; V, Eco RV; X, Bst XI; AAAAA, poly(A) tail.

    Article Snippet: The Hin cII- Sma I fragment harboring the entire env gene and portions of the pol and LTR from pNZB9-1 was reconstructed in pBluescript-KS(+) vector from purified Hin cII- Eco RI and Eco RI- Sma I fragments (Fig. ), and the unique Acc I site was replaced with a Bam HI linker (New England Biolabs).

    Techniques: Derivative Assay, Plasmid Preparation

    Targeting strategy, Southern blots and PCR analysis of ES cells and mice lacking the β3-integrin gene. ( a ) Structure of β3 targeting construct, wild-type β3 allele and targeted β3 allele. Exons are indicated as black boxes. The 1.7 kb pgk-neomycin-resistance cassette replaces a 1.4 kb Hin dIII fragment of the β3-gene including exons I and II. Pgk-thymidine kinase genes were used for negative selection. ( b ) Southern blot analysis of Eco RI, Bst EII and NcoI -digested genomic DNA from a representative targeted clone (111). Probe A lay 5′ of the targeting construct and probe B lay inside it ( a ). ( c ) PCR analysis of wild-type, heterozygous and β3-null tail DNA used to screen offspring. Primer locations are indicated by half arrows in A and give products of 446 bp with primers 1 and 3 (wild-type) or 538 bp with primers 1 and 2 (mutant).

    Journal: Journal of Clinical Investigation

    Article Title: ?3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival

    doi:

    Figure Lengend Snippet: Targeting strategy, Southern blots and PCR analysis of ES cells and mice lacking the β3-integrin gene. ( a ) Structure of β3 targeting construct, wild-type β3 allele and targeted β3 allele. Exons are indicated as black boxes. The 1.7 kb pgk-neomycin-resistance cassette replaces a 1.4 kb Hin dIII fragment of the β3-gene including exons I and II. Pgk-thymidine kinase genes were used for negative selection. ( b ) Southern blot analysis of Eco RI, Bst EII and NcoI -digested genomic DNA from a representative targeted clone (111). Probe A lay 5′ of the targeting construct and probe B lay inside it ( a ). ( c ) PCR analysis of wild-type, heterozygous and β3-null tail DNA used to screen offspring. Primer locations are indicated by half arrows in A and give products of 446 bp with primers 1 and 3 (wild-type) or 538 bp with primers 1 and 2 (mutant).

    Article Snippet: The 1.7-kb Eco RI- Hin dIII PGK-neo fragment (from pKJ-1) was used to replace a Hin dIII genomic fragment containing exons I and II, with the addition of a Hin dIII/ Eco RI linker (New England Biolabs, Beverly, Massachusetts, USA).

    Techniques: Polymerase Chain Reaction, Mouse Assay, Construct, Selection, Southern Blot, Mutagenesis