eco ri  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BsmAI
    Description:
    BsmAI 5 000 units
    Catalog Number:
    R0529L
    Price:
    277
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs eco ri
    BsmAI
    BsmAI 5 000 units
    https://www.bioz.com/result/eco ri/product/New England Biolabs
    Average 99 stars, based on 212 article reviews
    Price from $9.99 to $1999.99
    eco ri - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: Paragraph title: Candidate Gene Cloning and Development of CAPS and InDel Markers ... For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel.

    Amplification:

    Article Title: The lss Supernodulation Mutant of Medicago truncatula Reduces Expression of the SUNN Gene
    Article Snippet: These were used as templates to amplify a 414-bp fragment using primers 5′-AGAATCTGAAGGTTCTAAGCATTTTT-3′ and 5′-GACACTCCACTACTTCCTCTGCT-3′ for sunn-2 and 5′-CATGTTGCTGATTTTGGACTTG-3′ and 5′-CCTGGTACCCTAGAGATTAATCAAGTTGTGACT-3′ for sunn-1 . .. Following amplification, the PCR products were digested with Bsm AI (New England Biolabs) at 55°C for 4 h, which cuts only the sunn-2 allele, or Hae III (New England Biolabs) at 37°C for 4 h, which cuts only the sunn-1 allele. .. Following digestion, the samples were run on a 1% agarose gel and stained with ethidium bromide.

    Article Title: Recognition of Two Novel Phenons of the Genus Acinetobacter among Non-Glucose-Acidifying Isolates from Human Specimens
    Article Snippet: Fractions of the amplimers were digested with the respective restriction enzymes Hin 6I (a Cfo I isoschizomer), Alu I, Mbo I, Rsa I, Msp I (Fermentas, Vilnius, Lithuania), Bfa I, or Bsm AI (New England Biolabs, Beverly, Mass.). .. Fractions of the amplimers were digested with the respective restriction enzymes Hin 6I (a Cfo I isoschizomer), Alu I, Mbo I, Rsa I, Msp I (Fermentas, Vilnius, Lithuania), Bfa I, or Bsm AI (New England Biolabs, Beverly, Mass.).

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: The PCR conditions were 95°C for 5 min, followed by 36 cycles of 95°C for 45 s, annealing (55–62 °C) for 50 s, and extension at 72°C for 1 min, with a final extension at 72°C for 12 min. Amplified PCR fragments were separated on a 6% denaturing polyacrylamide gel or a 1.5% agarose gel. .. For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel.

    Article Title: Unbalance between Excitation and Inhibition in Phenylketonuria, a Genetic Metabolic Disease Associated with Autism
    Article Snippet: Genetic characterization was performed on DNA prepared from tail tissue using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA). .. The ethylnitrosourea (ENU2) mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as previously described [ ]. .. At PND28, animals (sex matched) were housed 2–4 per standard breeding cage with food and water ad libitum on a 12:12 h dark: light cycle (light on 07.00 a.m.–07.00 p.m. h).

    Article Title: Epidemiology and Infection Control Implications of Acinetobacter spp. in Hong Kong
    Article Snippet: The transformation assay of Juni was used to confirm the genus ( ). .. Genomic identification was carried out by amplified ribosomal DNA restriction analysis (ARDRA) as previously described , using two primers (5′-TGG CTC AGA TTG AAC GCT and 5′-TAC CTG TTA CGA CTT CA) and restriction endonucleases ( Cfo I, Alu I, Mbo I, and Msp I Rsa I [Pharmacia, Uppsala, Sweden] and Bfa I and Bsma I [New England Biolabs, Beverly, Mass.]). .. Restriction patterns were obtained by agarose (2%) gel electrophoresis and compared after ethidium bromide staining.

    Article Title: High frequency of the IVS2-2A > G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss
    Article Snippet: DNA samples were amplified by PCR using primers derived from MITOMAP and PCR conditions as previously described [ , ]. .. The presence of the 1555A > G mutation was evaluated in some subjects by DNA sequencing as previously described [ ] and in other subjects by restriction digestion using BsmAI (New England BioLabs, Beverly, MA, USA) according to manufacturer's specifications and as described [ ].

    Article Title: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design
    Article Snippet: PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel. .. PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel.

    Article Title: Common SNP rs6564851 in the BCO1 Gene Affects the Circulating Levels of β-Carotene and the Daily Intake of Carotenoids in Healthy Japanese Women
    Article Snippet: Thermal cycler conditions were as follows: initial melting at 94°C for 3 min, then 40 cycles of amplification at 95°C for 30 s, 56°C for 30 s (50°C for rs2278986), and 72°C for 90 s. This was followed by a final extension step of 72°C for 10 min. .. The product was then digested using BsrI or BsmAI (New England Biolabs, Boston, MA) (rs6564851 or rs2278986, respectively).

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142. .. The PCR product for rs12845494 was added to a master mix of Pst I enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of Bsm AI with SmartCutter® and incubated for an hour at 55 °C.

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142. .. The PCR product for rs12845494 was added to a master mix of Pst I enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of Bsm AI with SmartCutter® and incubated for an hour at 55 °C.

    Article Title: Behavioral and Neurochemical Characterization of New Mouse Model of Hyperphenylalaninemia
    Article Snippet: Genetic characterization was performed on DNA prepared from tail tissue using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA). .. The enu2 mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as described [ ]. .. Further studies have shown that the ENU2 mouse is characterized by a radical mutation located on exon 7, a gene region where serious mutations are common in humans, and by a phenotypic profile strikingly similar to severe human PKU [ , , , , ].

    Article Title: Mutations at codons 178, 200-129, and 232 contributed to the inherited prion diseases in Korean patients
    Article Snippet: The samples were analyzed on an ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, CA, USA), and the data were analyzed with GeneScan software (Applied Biosystems, CA, USA). .. Each PCR products amplified using the same condition as for the DNA sequencing for Cases 1 and 2, were digested with the restriction enzymes Tth111 I, Nsp I, and BsmA I (New England Biolabs). .. The PCR conditions for Case 3 were as follows: 30 cycles of 94°C for 30 sec, 60°C for 1 min, and 72°C for 1 min with the K-7 (5'-GTCACCACAACCACCAAGGG-3') and K-8 (5'-CAGGAAGACCTTCCTCATCC-3') primers.

    Article Title: Early-onset behavioral and neurochemical deficits in the genetic mouse model of phenylketonuria
    Article Snippet: Before the beginning of the tests (pnd 3) mice were marked through distal phalanx removal, in order to be recognizable during the whole testing period. .. For genotyping, tail biopsy was performed; DNA was prepared using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA), and the PAH mutation on exon 7 was detected by PCR amplification and digestion thought restriction enzyme BsmAI (NewEnglandBiolabs, Inc., U.S.). .. Behavioral assessment begun on pnd 4 and finished on pnd 18; animals were then weaned on pnd 28.

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: The PCR mixture was subjected to PCR with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. PCR-amplified products were purified with the Qiaquick DNA Purification Kit (Qiagen, Valencia, Calif.). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel. .. Molecular beacons specific for the ITS2 region of C. albicans and C. dubliniensis were designed on the basis of published probe sequences ( ) that were independently confirmed by DNA sequence analysis at the New York University DNA sequencing facility.

    Mass Spectrometry:

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: Detection of primer extension products was performed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142.

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: Detection of primer extension products was performed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142.

    Positive Control:

    Article Title: c-erbB-2 is not a major factor in the development of colorectal cancer
    Article Snippet: PCR was carried out in a Hybaid Omnigene thermocycler (Hybaid, Middlesex, UK), and consisted of an initial heating at 95°C for 12 min to activate the enzyme, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s and extension at 72°C for 30 s, with a final extension at 72°C for 7 min. Genomic DNA known to be homozygous for the Val allele was included as a positive control, while DNA was omitted from negative control samples. .. PCR product (10 μl) was digested with 5 U Bsm AI (New England BioLabs, Hertfordshire, UK) at 55°C for 2 h, and visualized by electrophoresis on 2.5% agarose containing 0.5 μg ml−1 ethidium bromide.

    Electrophoresis:

    Article Title: c-erbB-2 is not a major factor in the development of colorectal cancer
    Article Snippet: PCR was carried out in a Hybaid Omnigene thermocycler (Hybaid, Middlesex, UK), and consisted of an initial heating at 95°C for 12 min to activate the enzyme, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s and extension at 72°C for 30 s, with a final extension at 72°C for 7 min. Genomic DNA known to be homozygous for the Val allele was included as a positive control, while DNA was omitted from negative control samples. .. PCR product (10 μl) was digested with 5 U Bsm AI (New England BioLabs, Hertfordshire, UK) at 55°C for 2 h, and visualized by electrophoresis on 2.5% agarose containing 0.5 μg ml−1 ethidium bromide. .. The 148 bp PCR product generated was cut by Bsm AI into fragments of 122 and 26 bp if the Ile allele was present, whereas the product from the Val allele was cut to produce fragments of 90, 32 and 26 bp ( ).

    Article Title: Mutations at codons 178, 200-129, and 232 contributed to the inherited prion diseases in Korean patients
    Article Snippet: Each PCR products amplified using the same condition as for the DNA sequencing for Cases 1 and 2, were digested with the restriction enzymes Tth111 I, Nsp I, and BsmA I (New England Biolabs). .. The PCR products for Case 3 were then digested with Nla III (New England Biolabs, Hitchin, UK).

    Expressing:

    Article Title: The lss Supernodulation Mutant of Medicago truncatula Reduces Expression of the SUNN Gene
    Article Snippet: Paragraph title: Expression in lss/sunn Heterozygotes ... Following amplification, the PCR products were digested with Bsm AI (New England Biolabs) at 55°C for 4 h, which cuts only the sunn-2 allele, or Hae III (New England Biolabs) at 37°C for 4 h, which cuts only the sunn-1 allele.

    Touchdown PCR:

    Article Title: Glutathione-S-transferase M1, T1 and P1 polymorphisms, and breast cancer risk, in BRCA1/2 mutation carriers
    Article Snippet: For all PCR reactions, 25 ng of genomic DNA was used in a 15-μl reaction mixture containing 1.5 mM MgCl2 , 6 pM of each primer, 0.5 U of Amplitaq Gold polymerase (The Perkin Elmer Corp. Norwalk, CT, USA) and were run in a Hybaid Touchdown PCR machine. .. Assignment of the GSTP1 Ile (ACA TCT) and Val (ACG TCT) genotype was made by digestion of the PCR products on the basis of the RFLP with Bsm AI (New England Biolabs, Hertfordshire, UK).

    Western Blot:

    Article Title: Aminoglycoside-associated nonsyndromic deafness and speech disorder in mitochondrial A1555G mutation in a family
    Article Snippet: The PCR products were digested with the restriction enzyme BsmAI (NEB) which can specifically recognize and cut the site. .. The PCR products were digested with the restriction enzyme BsmAI (NEB) which can specifically recognize and cut the site.

    Magnetic Resonance Imaging:

    Article Title: Aminoglycoside-associated nonsyndromic deafness and speech disorder in mitochondrial A1555G mutation in a family
    Article Snippet: Further investigation included MRI of the brain and EEG with no significant findings in both tests. .. The PCR products were digested with the restriction enzyme BsmAI (NEB) which can specifically recognize and cut the site.

    Derivative Assay:

    Article Title: High frequency of the IVS2-2A > G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss
    Article Snippet: DNA samples were amplified by PCR using primers derived from MITOMAP and PCR conditions as previously described [ , ]. .. The presence of the 1555A > G mutation was evaluated in some subjects by DNA sequencing as previously described [ ] and in other subjects by restriction digestion using BsmAI (New England BioLabs, Beverly, MA, USA) according to manufacturer's specifications and as described [ ].

    Countercurrent Chromatography:

    Article Title: Common SNP rs6564851 in the BCO1 Gene Affects the Circulating Levels of β-Carotene and the Daily Intake of Carotenoids in Healthy Japanese Women
    Article Snippet: The oligonucleotides used were: rs6564851, 5´-TTA TAT TGG CCT TGG CCG TTT C-3´ (forward primer) and 5´-AGG GAC CAT TCA AGG TTG TG-3´ (reverse primer); rs2278986, 5´-TAC ATC GTC ATG CCC AAC AT-3´ (forward primer) and 5´-CCA GGA CTT CCA AAC CAA GA-3´ (reverse primer). .. The product was then digested using BsrI or BsmAI (New England Biolabs, Boston, MA) (rs6564851 or rs2278986, respectively).

    Generated:

    Article Title: Genetic polymorphisms in the PTPN13 gene and risk of squamous cell carcinoma of head and neck
    Article Snippet: The PCRs were performed by 35 cycles with an annealing temperature of 53°C (c.4068 T > G F1356L), 48°C (c.4566 A > G I1522M) and 62°C (c.6241 T > G Y2081D), respectively. .. For c.4068 T > G F1356L, the 113 bp PCR products were digested with Bsma I (New England Biolabs, Beverly, MA) at 55°C overnight, the G allele generated 91 and 22 bp bands, whereas T allele remained uncut; for c.4566 A > G I1522M, the 123 bp PCR products were digested with Rsa I (New England Biolabs) at 37°C overnight, the G allele was uncut and the A allele was cut into 101 and 22 bp bands; for c.6241 T > G Y2081D, the 121 bp PCR products were digested with Bsma I at 55°C overnight (New England Biolabs), the T allele produced 78 and 33 bp bands and G allele was cut into 51, 33 and 27 bp bands. .. For all three SNPs, ∼10% of the samples were random selected and repeated with RFLP, and the error rate was < 1%.

    DNA Sequencing:

    Article Title: High frequency of the IVS2-2A > G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss
    Article Snippet: DNA samples were amplified by PCR using primers derived from MITOMAP and PCR conditions as previously described [ , ]. .. The presence of the 1555A > G mutation was evaluated in some subjects by DNA sequencing as previously described [ ] and in other subjects by restriction digestion using BsmAI (New England BioLabs, Beverly, MA, USA) according to manufacturer's specifications and as described [ ]. .. Electropherograms were evaluated by visual inspection and pairwise alignment to reference sequences using the BCM Search Launcher BLAST2 Pairwise Sequence Alignment Tool from the Human Genome Sequencing Center of Baylor College of Medicine , and/or by interpretation using Mutation Surveyor software Version 2.41 (Softgenetics, Inc, State College, Pennsylvania, USA).

    Article Title: Mutations at codons 178, 200-129, and 232 contributed to the inherited prion diseases in Korean patients
    Article Snippet: The samples were analyzed on an ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, CA, USA), and the data were analyzed with GeneScan software (Applied Biosystems, CA, USA). .. Each PCR products amplified using the same condition as for the DNA sequencing for Cases 1 and 2, were digested with the restriction enzymes Tth111 I, Nsp I, and BsmA I (New England Biolabs). .. The PCR conditions for Case 3 were as follows: 30 cycles of 94°C for 30 sec, 60°C for 1 min, and 72°C for 1 min with the K-7 (5'-GTCACCACAACCACCAAGGG-3') and K-8 (5'-CAGGAAGACCTTCCTCATCC-3') primers.

    Sequencing:

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: Eight sets of primer pairs were designed using Primer Premier 5 software based on the sequence of 7AS_4248784 and its transcript Traes_7AS_378A12AA9.1 on 7AS, which were obtained by BLAST and functional annotation and gene/transcript set/pathway enrichment analyses of SLAF65386 at a hot region on chromosome 7A. .. For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel.

    Article Title: Frequency of mitochondrial m.1555A  >  G mutation in Syrian patients with non-syndromic hearing impairment
    Article Snippet: Mitochondrial DNA m.1555A > G mutation was detected using PCR-RFLP strategy (m.1555A > G, F: AGAAATGGGCTACATTTTCTACCC; m.1555A > G, R: GTTCGTCCAAGTGCACCTTCCA) as mentioned in [ ] followed by BsmAI-digest (site: GTC TCN/) (New England Bio Labs®). .. Products with m.1555A > G mutation showed one band with 248 bp and wild individual displayed two bands (192 bp and 56 bp) after polyacrylamide gel electrophoresis (6%)(Fig. ).

    Article Title: High frequency of the IVS2-2A > G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss
    Article Snippet: Paragraph title: Mitochondrial 12S rRNA gene sequencing and restriction analysis for the 1555A > G mutation ... The presence of the 1555A > G mutation was evaluated in some subjects by DNA sequencing as previously described [ ] and in other subjects by restriction digestion using BsmAI (New England BioLabs, Beverly, MA, USA) according to manufacturer's specifications and as described [ ].

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: Full DNA sequence analysis of the PCR products obtained with universal fungal primers ITS3 and ITS4 specific for rDNA genes was used to confirm the species identification, as described previously ( ). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel.

    Binding Assay:

    Article Title: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design
    Article Snippet: The GSTP1 polymorphism screened was a guanine to adenine transition at nucleotide 313 (A313 G) that results in an isoleucine to valine substitution at codon 105 (I105 V), which is located in the substrate binding site of GSTP1. .. PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel.

    Cellular Antioxidant Activity Assay:

    Article Title: Common SNP rs6564851 in the BCO1 Gene Affects the Circulating Levels of β-Carotene and the Daily Intake of Carotenoids in Healthy Japanese Women
    Article Snippet: The oligonucleotides used were: rs6564851, 5´-TTA TAT TGG CCT TGG CCG TTT C-3´ (forward primer) and 5´-AGG GAC CAT TCA AGG TTG TG-3´ (reverse primer); rs2278986, 5´-TAC ATC GTC ATG CCC AAC AT-3´ (forward primer) and 5´-CCA GGA CTT CCA AAC CAA GA-3´ (reverse primer). .. The product was then digested using BsrI or BsmAI (New England Biolabs, Boston, MA) (rs6564851 or rs2278986, respectively).

    DNA Extraction:

    Article Title: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design
    Article Snippet: Paragraph title: 2.4. DNA isolation and GSTP1 PCR-restriction fragment length polymorphism genotyping ... PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel.

    Nucleic Acid Electrophoresis:

    Article Title: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design
    Article Snippet: Amplification was achieved by 5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 62°C, and 30 s at 72°C, followed by a final extension step for 7 min at 72°C. .. PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel. .. The presence of the polymorphic BsmAI restriction site yields 148- and 41-bp fragments, indicating the presence of at least one G allele and GSTP1105Val genotypes.

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: The PCR mixture was subjected to PCR with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. PCR-amplified products were purified with the Qiaquick DNA Purification Kit (Qiagen, Valencia, Calif.). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel. .. Molecular beacons specific for the ITS2 region of C. albicans and C. dubliniensis were designed on the basis of published probe sequences ( ) that were independently confirmed by DNA sequence analysis at the New York University DNA sequencing facility.

    Mutagenesis:

    Article Title: Frequency of mitochondrial m.1555A  >  G mutation in Syrian patients with non-syndromic hearing impairment
    Article Snippet: Genomic DNA was extracted using Qiagen FlexiGene kits in accordance with the manufacturer’s instructions. .. Mitochondrial DNA m.1555A > G mutation was detected using PCR-RFLP strategy (m.1555A > G, F: AGAAATGGGCTACATTTTCTACCC; m.1555A > G, R: GTTCGTCCAAGTGCACCTTCCA) as mentioned in [ ] followed by BsmAI-digest (site: GTC TCN/) (New England Bio Labs®). .. Products with m.1555A > G mutation showed one band with 248 bp and wild individual displayed two bands (192 bp and 56 bp) after polyacrylamide gel electrophoresis (6%)(Fig. ).

    Article Title: Unbalance between Excitation and Inhibition in Phenylketonuria, a Genetic Metabolic Disease Associated with Autism
    Article Snippet: Genetic characterization was performed on DNA prepared from tail tissue using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA). .. The ethylnitrosourea (ENU2) mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as previously described [ ]. .. At PND28, animals (sex matched) were housed 2–4 per standard breeding cage with food and water ad libitum on a 12:12 h dark: light cycle (light on 07.00 a.m.–07.00 p.m. h).

    Article Title: High frequency of the IVS2-2A > G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss
    Article Snippet: DNA samples were amplified by PCR using primers derived from MITOMAP and PCR conditions as previously described [ , ]. .. The presence of the 1555A > G mutation was evaluated in some subjects by DNA sequencing as previously described [ ] and in other subjects by restriction digestion using BsmAI (New England BioLabs, Beverly, MA, USA) according to manufacturer's specifications and as described [ ]. .. Electropherograms were evaluated by visual inspection and pairwise alignment to reference sequences using the BCM Search Launcher BLAST2 Pairwise Sequence Alignment Tool from the Human Genome Sequencing Center of Baylor College of Medicine , and/or by interpretation using Mutation Surveyor software Version 2.41 (Softgenetics, Inc, State College, Pennsylvania, USA).

    Article Title: Aminoglycoside-associated nonsyndromic deafness and speech disorder in mitochondrial A1555G mutation in a family
    Article Snippet: To search for mtDNA mutation A1555G, patient's deoxyribonucleic acid (DNA) was extracted and ran polymerase chain reaction (PCR) by MJ Research Thermal Cycler. .. The PCR products were digested with the restriction enzyme BsmAI (NEB) which can specifically recognize and cut the site.

    Article Title: Behavioral and Neurochemical Characterization of New Mouse Model of Hyperphenylalaninemia
    Article Snippet: Genetic characterization was performed on DNA prepared from tail tissue using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA). .. The enu2 mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as described [ ]. .. Further studies have shown that the ENU2 mouse is characterized by a radical mutation located on exon 7, a gene region where serious mutations are common in humans, and by a phenotypic profile strikingly similar to severe human PKU [ , , , , ].

    Article Title: Early-onset behavioral and neurochemical deficits in the genetic mouse model of phenylketonuria
    Article Snippet: Before the beginning of the tests (pnd 3) mice were marked through distal phalanx removal, in order to be recognizable during the whole testing period. .. For genotyping, tail biopsy was performed; DNA was prepared using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA), and the PAH mutation on exon 7 was detected by PCR amplification and digestion thought restriction enzyme BsmAI (NewEnglandBiolabs, Inc., U.S.). .. Behavioral assessment begun on pnd 4 and finished on pnd 18; animals were then weaned on pnd 28.

    CTG Assay:

    Article Title: Epidemiology and Infection Control Implications of Acinetobacter spp. in Hong Kong
    Article Snippet: The transformation assay of Juni was used to confirm the genus ( ). .. Genomic identification was carried out by amplified ribosomal DNA restriction analysis (ARDRA) as previously described , using two primers (5′-TGG CTC AGA TTG AAC GCT and 5′-TAC CTG TTA CGA CTT CA) and restriction endonucleases ( Cfo I, Alu I, Mbo I, and Msp I Rsa I [Pharmacia, Uppsala, Sweden] and Bfa I and Bsma I [New England Biolabs, Beverly, Mass.]). .. Restriction patterns were obtained by agarose (2%) gel electrophoresis and compared after ethidium bromide staining.

    Negative Control:

    Article Title: c-erbB-2 is not a major factor in the development of colorectal cancer
    Article Snippet: PCR was carried out in a Hybaid Omnigene thermocycler (Hybaid, Middlesex, UK), and consisted of an initial heating at 95°C for 12 min to activate the enzyme, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s and extension at 72°C for 30 s, with a final extension at 72°C for 7 min. Genomic DNA known to be homozygous for the Val allele was included as a positive control, while DNA was omitted from negative control samples. .. PCR product (10 μl) was digested with 5 U Bsm AI (New England BioLabs, Hertfordshire, UK) at 55°C for 2 h, and visualized by electrophoresis on 2.5% agarose containing 0.5 μg ml−1 ethidium bromide.

    Mouse Assay:

    Article Title: Unbalance between Excitation and Inhibition in Phenylketonuria, a Genetic Metabolic Disease Associated with Autism
    Article Snippet: Homozygote (−/−) PahEnu2 (ENU2) and Homozygote (+/+) PahEnu2 (WT) BTBR mice were issued from heterozygous mating. .. The ethylnitrosourea (ENU2) mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as previously described [ ].

    Article Title: Behavioral and Neurochemical Characterization of New Mouse Model of Hyperphenylalaninemia
    Article Snippet: Adult homozygous and heterozygous male ENU2 mice and male mice of the background BTBR strain were issued from heterozygous mating. .. The enu2 mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as described [ ].

    Article Title: Early-onset behavioral and neurochemical deficits in the genetic mouse model of phenylketonuria
    Article Snippet: Before the beginning of the tests (pnd 3) mice were marked through distal phalanx removal, in order to be recognizable during the whole testing period. .. For genotyping, tail biopsy was performed; DNA was prepared using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA), and the PAH mutation on exon 7 was detected by PCR amplification and digestion thought restriction enzyme BsmAI (NewEnglandBiolabs, Inc., U.S.).

    Polymerase Chain Reaction:

    Article Title: c-erbB-2 is not a major factor in the development of colorectal cancer
    Article Snippet: PCR was carried out in a Hybaid Omnigene thermocycler (Hybaid, Middlesex, UK), and consisted of an initial heating at 95°C for 12 min to activate the enzyme, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s and extension at 72°C for 30 s, with a final extension at 72°C for 7 min. Genomic DNA known to be homozygous for the Val allele was included as a positive control, while DNA was omitted from negative control samples. .. PCR product (10 μl) was digested with 5 U Bsm AI (New England BioLabs, Hertfordshire, UK) at 55°C for 2 h, and visualized by electrophoresis on 2.5% agarose containing 0.5 μg ml−1 ethidium bromide. .. The 148 bp PCR product generated was cut by Bsm AI into fragments of 122 and 26 bp if the Ile allele was present, whereas the product from the Val allele was cut to produce fragments of 90, 32 and 26 bp ( ).

    Article Title: The lss Supernodulation Mutant of Medicago truncatula Reduces Expression of the SUNN Gene
    Article Snippet: These were used as templates to amplify a 414-bp fragment using primers 5′-AGAATCTGAAGGTTCTAAGCATTTTT-3′ and 5′-GACACTCCACTACTTCCTCTGCT-3′ for sunn-2 and 5′-CATGTTGCTGATTTTGGACTTG-3′ and 5′-CCTGGTACCCTAGAGATTAATCAAGTTGTGACT-3′ for sunn-1 . .. Following amplification, the PCR products were digested with Bsm AI (New England Biolabs) at 55°C for 4 h, which cuts only the sunn-2 allele, or Hae III (New England Biolabs) at 37°C for 4 h, which cuts only the sunn-1 allele. .. Following digestion, the samples were run on a 1% agarose gel and stained with ethidium bromide.

    Article Title: Recognition of Two Novel Phenons of the Genus Acinetobacter among Non-Glucose-Acidifying Isolates from Human Specimens
    Article Snippet: Fractions of the amplimers were digested with the respective restriction enzymes Hin 6I (a Cfo I isoschizomer), Alu I, Mbo I, Rsa I, Msp I (Fermentas, Vilnius, Lithuania), Bfa I, or Bsm AI (New England Biolabs, Beverly, Mass.). .. Fractions of the amplimers were digested with the respective restriction enzymes Hin 6I (a Cfo I isoschizomer), Alu I, Mbo I, Rsa I, Msp I (Fermentas, Vilnius, Lithuania), Bfa I, or Bsm AI (New England Biolabs, Beverly, Mass.).

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: The PCR conditions were 95°C for 5 min, followed by 36 cycles of 95°C for 45 s, annealing (55–62 °C) for 50 s, and extension at 72°C for 1 min, with a final extension at 72°C for 12 min. Amplified PCR fragments were separated on a 6% denaturing polyacrylamide gel or a 1.5% agarose gel. .. For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel. .. For candidate gene cloning, the targeting PCR fragments were recovered and cloned into the pEASY-T5 simple vector and transformed into T1 competent cells (TransGen Biotech, Beijing, China).

    Article Title: Frequency of mitochondrial m.1555A  >  G mutation in Syrian patients with non-syndromic hearing impairment
    Article Snippet: Genomic DNA was extracted using Qiagen FlexiGene kits in accordance with the manufacturer’s instructions. .. Mitochondrial DNA m.1555A > G mutation was detected using PCR-RFLP strategy (m.1555A > G, F: AGAAATGGGCTACATTTTCTACCC; m.1555A > G, R: GTTCGTCCAAGTGCACCTTCCA) as mentioned in [ ] followed by BsmAI-digest (site: GTC TCN/) (New England Bio Labs®). .. Products with m.1555A > G mutation showed one band with 248 bp and wild individual displayed two bands (192 bp and 56 bp) after polyacrylamide gel electrophoresis (6%)(Fig. ).

    Article Title: Genetic polymorphisms in the PTPN13 gene and risk of squamous cell carcinoma of head and neck
    Article Snippet: The PCRs were performed by 35 cycles with an annealing temperature of 53°C (c.4068 T > G F1356L), 48°C (c.4566 A > G I1522M) and 62°C (c.6241 T > G Y2081D), respectively. .. For c.4068 T > G F1356L, the 113 bp PCR products were digested with Bsma I (New England Biolabs, Beverly, MA) at 55°C overnight, the G allele generated 91 and 22 bp bands, whereas T allele remained uncut; for c.4566 A > G I1522M, the 123 bp PCR products were digested with Rsa I (New England Biolabs) at 37°C overnight, the G allele was uncut and the A allele was cut into 101 and 22 bp bands; for c.6241 T > G Y2081D, the 121 bp PCR products were digested with Bsma I at 55°C overnight (New England Biolabs), the T allele produced 78 and 33 bp bands and G allele was cut into 51, 33 and 27 bp bands. .. For all three SNPs, ∼10% of the samples were random selected and repeated with RFLP, and the error rate was < 1%.

    Article Title: Glutathione-S-transferase M1, T1 and P1 polymorphisms, and breast cancer risk, in BRCA1/2 mutation carriers
    Article Snippet: Annealing temperature was 55°C for GSTM1 and GSTP1 , and 66°C for GSTT1 . .. Assignment of the GSTP1 Ile (ACA TCT) and Val (ACG TCT) genotype was made by digestion of the PCR products on the basis of the RFLP with Bsm AI (New England Biolabs, Hertfordshire, UK). .. All PCR products were separated on 3% agarose gels with 2 μl/100 ml of ethidium bromide.

    Article Title: Unbalance between Excitation and Inhibition in Phenylketonuria, a Genetic Metabolic Disease Associated with Autism
    Article Snippet: Genetic characterization was performed on DNA prepared from tail tissue using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA). .. The ethylnitrosourea (ENU2) mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as previously described [ ]. .. At PND28, animals (sex matched) were housed 2–4 per standard breeding cage with food and water ad libitum on a 12:12 h dark: light cycle (light on 07.00 a.m.–07.00 p.m. h).

    Article Title: High frequency of the IVS2-2A > G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss
    Article Snippet: DNA samples were amplified by PCR using primers derived from MITOMAP and PCR conditions as previously described [ , ]. .. The presence of the 1555A > G mutation was evaluated in some subjects by DNA sequencing as previously described [ ] and in other subjects by restriction digestion using BsmAI (New England BioLabs, Beverly, MA, USA) according to manufacturer's specifications and as described [ ].

    Article Title: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design
    Article Snippet: Amplification was achieved by 5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 62°C, and 30 s at 72°C, followed by a final extension step for 7 min at 72°C. .. PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel. .. The presence of the polymorphic BsmAI restriction site yields 148- and 41-bp fragments, indicating the presence of at least one G allele and GSTP1105Val genotypes.

    Article Title: Common SNP rs6564851 in the BCO1 Gene Affects the Circulating Levels of β-Carotene and the Daily Intake of Carotenoids in Healthy Japanese Women
    Article Snippet: Paragraph title: PCR-Restriction Fragment Length Polymorphism (RFLP) ... The product was then digested using BsrI or BsmAI (New England Biolabs, Boston, MA) (rs6564851 or rs2278986, respectively).

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142. .. The PCR product for rs12845494 was added to a master mix of Pst I enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of Bsm AI with SmartCutter® and incubated for an hour at 55 °C.

    Article Title: Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children
    Article Snippet: The PCR conditions were 95°C for 10 min followed by 30 cycles of 95°C for 50 s, 62°C for 50 s, and 72°C for 50 s followed by one cycle of 72°C for 5 min. For IL-4 −590, the reaction conditions were the same as for IL-4 intron 3. .. To detect IL-4 −590 and IL-4 +33 polymorphisms, PCR products were digested further with the restriction enzymes BsmFI and BsmAI (New England Biolabs Inc., USA), respectively, under conditions described by Walley et al . .. For IL4 –590 this resulted in two fragments of 192 bp and 60 bp for the −590C allele and an intact (252 bp) product for the −590T allele.

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142. .. The PCR product for rs12845494 was added to a master mix of Pst I enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of Bsm AI with SmartCutter® and incubated for an hour at 55 °C.

    Article Title: Aminoglycoside-associated nonsyndromic deafness and speech disorder in mitochondrial A1555G mutation in a family
    Article Snippet: To search for mtDNA mutation A1555G, patient's deoxyribonucleic acid (DNA) was extracted and ran polymerase chain reaction (PCR) by MJ Research Thermal Cycler. .. The PCR products were digested with the restriction enzyme BsmAI (NEB) which can specifically recognize and cut the site. .. 10 μl were loaded onto 4% agarose gels and run through gel electrophoresis for 50 minutes at 100 V. The gels were stained with EtBr for 10 minutes after electrophoresis and viewed using ultraviolet light.

    Article Title: Behavioral and Neurochemical Characterization of New Mouse Model of Hyperphenylalaninemia
    Article Snippet: Genetic characterization was performed on DNA prepared from tail tissue using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA). .. The enu2 mutation was detected after PCR amplification of exon 7 of the Pah gene and digestion with BsmAI restriction enzyme (NEB, USA) as described [ ]. .. Further studies have shown that the ENU2 mouse is characterized by a radical mutation located on exon 7, a gene region where serious mutations are common in humans, and by a phenotypic profile strikingly similar to severe human PKU [ , , , , ].

    Article Title: Mutations at codons 178, 200-129, and 232 contributed to the inherited prion diseases in Korean patients
    Article Snippet: The samples were analyzed on an ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, CA, USA), and the data were analyzed with GeneScan software (Applied Biosystems, CA, USA). .. Each PCR products amplified using the same condition as for the DNA sequencing for Cases 1 and 2, were digested with the restriction enzymes Tth111 I, Nsp I, and BsmA I (New England Biolabs). .. The PCR conditions for Case 3 were as follows: 30 cycles of 94°C for 30 sec, 60°C for 1 min, and 72°C for 1 min with the K-7 (5'-GTCACCACAACCACCAAGGG-3') and K-8 (5'-CAGGAAGACCTTCCTCATCC-3') primers.

    Article Title: Early-onset behavioral and neurochemical deficits in the genetic mouse model of phenylketonuria
    Article Snippet: Before the beginning of the tests (pnd 3) mice were marked through distal phalanx removal, in order to be recognizable during the whole testing period. .. For genotyping, tail biopsy was performed; DNA was prepared using the Easy DNA Kit (Invitrogen, Carlsbad, CA, USA), and the PAH mutation on exon 7 was detected by PCR amplification and digestion thought restriction enzyme BsmAI (NewEnglandBiolabs, Inc., U.S.). .. Behavioral assessment begun on pnd 4 and finished on pnd 18; animals were then weaned on pnd 28.

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: The PCR mixture was subjected to PCR with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. PCR-amplified products were purified with the Qiaquick DNA Purification Kit (Qiagen, Valencia, Calif.). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel. .. Molecular beacons specific for the ITS2 region of C. albicans and C. dubliniensis were designed on the basis of published probe sequences ( ) that were independently confirmed by DNA sequence analysis at the New York University DNA sequencing facility.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Common SNP rs6564851 in the BCO1 Gene Affects the Circulating Levels of β-Carotene and the Daily Intake of Carotenoids in Healthy Japanese Women
    Article Snippet: The oligonucleotides used were: rs6564851, 5´-TTA TAT TGG CCT TGG CCG TTT C-3´ (forward primer) and 5´-AGG GAC CAT TCA AGG TTG TG-3´ (reverse primer); rs2278986, 5´-TAC ATC GTC ATG CCC AAC AT-3´ (forward primer) and 5´-CCA GGA CTT CCA AAC CAA GA-3´ (reverse primer). .. The product was then digested using BsrI or BsmAI (New England Biolabs, Boston, MA) (rs6564851 or rs2278986, respectively).

    Purification:

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: The PCR mixture was subjected to PCR with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. PCR-amplified products were purified with the Qiaquick DNA Purification Kit (Qiagen, Valencia, Calif.). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel.

    Software:

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: Eight sets of primer pairs were designed using Primer Premier 5 software based on the sequence of 7AS_4248784 and its transcript Traes_7AS_378A12AA9.1 on 7AS, which were obtained by BLAST and functional annotation and gene/transcript set/pathway enrichment analyses of SLAF65386 at a hot region on chromosome 7A. .. For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel.

    Article Title: Genetic polymorphisms in the PTPN13 gene and risk of squamous cell carcinoma of head and neck
    Article Snippet: The data generated by SNPlex assays were analyzed in GeneMapper software (Applied Biosystems) to determine the genotypes. .. For c.4068 T > G F1356L, the 113 bp PCR products were digested with Bsma I (New England Biolabs, Beverly, MA) at 55°C overnight, the G allele generated 91 and 22 bp bands, whereas T allele remained uncut; for c.4566 A > G I1522M, the 123 bp PCR products were digested with Rsa I (New England Biolabs) at 37°C overnight, the G allele was uncut and the A allele was cut into 101 and 22 bp bands; for c.6241 T > G Y2081D, the 121 bp PCR products were digested with Bsma I at 55°C overnight (New England Biolabs), the T allele produced 78 and 33 bp bands and G allele was cut into 51, 33 and 27 bp bands.

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: SpectroTYPER software was used to automatically import and analyze the genotyping data with genotypes called based on the calculated mass of the extension products. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142.

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: SpectroTYPER software was used to automatically import and analyze the genotyping data with genotypes called based on the calculated mass of the extension products. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142.

    Functional Assay:

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: Eight sets of primer pairs were designed using Primer Premier 5 software based on the sequence of 7AS_4248784 and its transcript Traes_7AS_378A12AA9.1 on 7AS, which were obtained by BLAST and functional annotation and gene/transcript set/pathway enrichment analyses of SLAF65386 at a hot region on chromosome 7A. .. For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel.

    Agarose Gel Electrophoresis:

    Article Title: Cloning and Characterization of TaTGW-7A Gene Associated with Grain Weight in Wheat via SLAF-seq-BSA
    Article Snippet: The PCR conditions were 95°C for 5 min, followed by 36 cycles of 95°C for 45 s, annealing (55–62 °C) for 50 s, and extension at 72°C for 1 min, with a final extension at 72°C for 12 min. Amplified PCR fragments were separated on a 6% denaturing polyacrylamide gel or a 1.5% agarose gel. .. For CAPS markers, PCR products were digested with BsmAI (NEB), BstNI, MluCI , or AluI according to the manufacturer’s directions, labelled with fluorochrome, and then, detected on a 2.0% agarose gel. .. For candidate gene cloning, the targeting PCR fragments were recovered and cloned into the pEASY-T5 simple vector and transformed into T1 competent cells (TransGen Biotech, Beijing, China).

    Article Title: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design
    Article Snippet: Amplification was achieved by 5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 62°C, and 30 s at 72°C, followed by a final extension step for 7 min at 72°C. .. PCR product was subjected to BsmAI enzyme (New England Biolabs) digestion and analyzed by gel electrophoresis on 3% low-melt agarose gel. .. The presence of the polymorphic BsmAI restriction site yields 148- and 41-bp fragments, indicating the presence of at least one G allele and GSTP1105Val genotypes.

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: The PCR mixture was subjected to PCR with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. PCR-amplified products were purified with the Qiaquick DNA Purification Kit (Qiagen, Valencia, Calif.). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel. .. Molecular beacons specific for the ITS2 region of C. albicans and C. dubliniensis were designed on the basis of published probe sequences ( ) that were independently confirmed by DNA sequence analysis at the New York University DNA sequencing facility.

    Produced:

    Article Title: Genetic polymorphisms in the PTPN13 gene and risk of squamous cell carcinoma of head and neck
    Article Snippet: The PCRs were performed by 35 cycles with an annealing temperature of 53°C (c.4068 T > G F1356L), 48°C (c.4566 A > G I1522M) and 62°C (c.6241 T > G Y2081D), respectively. .. For c.4068 T > G F1356L, the 113 bp PCR products were digested with Bsma I (New England Biolabs, Beverly, MA) at 55°C overnight, the G allele generated 91 and 22 bp bands, whereas T allele remained uncut; for c.4566 A > G I1522M, the 123 bp PCR products were digested with Rsa I (New England Biolabs) at 37°C overnight, the G allele was uncut and the A allele was cut into 101 and 22 bp bands; for c.6241 T > G Y2081D, the 121 bp PCR products were digested with Bsma I at 55°C overnight (New England Biolabs), the T allele produced 78 and 33 bp bands and G allele was cut into 51, 33 and 27 bp bands. .. For all three SNPs, ∼10% of the samples were random selected and repeated with RFLP, and the error rate was < 1%.

    Concentration Assay:

    Article Title: Recognition of Two Novel Phenons of the Genus Acinetobacter among Non-Glucose-Acidifying Isolates from Human Specimens
    Article Snippet: The reaction mixture contained a 0.2 mM concentration of each nucleoside triphosphate a 0.2 μM concentration of each primer, 1.5 mM MgCl2 , 10 mM Tris-HCl, 50 mM KCl, and 0.5 U of Taq polymerase (Takara Shuzo Co., Shiga, Japan). .. Fractions of the amplimers were digested with the respective restriction enzymes Hin 6I (a Cfo I isoschizomer), Alu I, Mbo I, Rsa I, Msp I (Fermentas, Vilnius, Lithuania), Bfa I, or Bsm AI (New England Biolabs, Beverly, Mass.).

    DNA Purification:

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
    Article Snippet: The PCR mixture was subjected to PCR with the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min and a final step of 72°C for 5 min. PCR-amplified products were purified with the Qiaquick DNA Purification Kit (Qiagen, Valencia, Calif.). .. The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel.

    Marker:

    Article Title: The lss Supernodulation Mutant of Medicago truncatula Reduces Expression of the SUNN Gene
    Article Snippet: The cDNA from F1 plants of lss × sunn-2 or lss × sunn-1 was analyzed with the sunn-1 or sunn-2 marker to determine if the heterozygote expressed either the lss SUNN or the sunn-2 allele, the sunn-1 allele, or both. cDNA from heterozygote plants, A17 wild-type plants, and genomic DNA from A17 and sunn-2 plants were extracted as described. .. Following amplification, the PCR products were digested with Bsm AI (New England Biolabs) at 55°C for 4 h, which cuts only the sunn-2 allele, or Hae III (New England Biolabs) at 37°C for 4 h, which cuts only the sunn-1 allele.

    Staining:

    Article Title: Mutations at codons 178, 200-129, and 232 contributed to the inherited prion diseases in Korean patients
    Article Snippet: Each PCR products amplified using the same condition as for the DNA sequencing for Cases 1 and 2, were digested with the restriction enzymes Tth111 I, Nsp I, and BsmA I (New England Biolabs). .. The PCR products for Case 3 were then digested with Nla III (New England Biolabs, Hitchin, UK).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs eco ri
    Eco Ri, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 212 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eco ri/product/New England Biolabs
    Average 99 stars, based on 212 article reviews
    Price from $9.99 to $1999.99
    eco ri - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    77
    New England Biolabs mse i eco ri
    Visualized differentially expressed TDFs between Sea Island cotton fibers and Upland cotton fibers in cDNA-AFLP analyses. Lane 1 to 3 show Upland cotton ( G. hirsutum cv. CRI 8) fibers and Lane 4 to 6 show Sea Island cotton ( G . barbadense cv. Pima90-53) fibers. Eco RI/ <t>Mse</t> I and Apo I/ Taq I are the restriction enzyme combinations used in cDNA-AFLP analyses. Arrowheads show the differentially expressed FLA TDFs.
    Mse I Eco Ri, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mse i eco ri/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mse i eco ri - by Bioz Stars, 2019-10
    77/100 stars
      Buy from Supplier

    Image Search Results


    Visualized differentially expressed TDFs between Sea Island cotton fibers and Upland cotton fibers in cDNA-AFLP analyses. Lane 1 to 3 show Upland cotton ( G. hirsutum cv. CRI 8) fibers and Lane 4 to 6 show Sea Island cotton ( G . barbadense cv. Pima90-53) fibers. Eco RI/ Mse I and Apo I/ Taq I are the restriction enzyme combinations used in cDNA-AFLP analyses. Arrowheads show the differentially expressed FLA TDFs.

    Journal: PLoS ONE

    Article Title: Characterization and Expression Analysis of a Fiber Differentially Expressed Fasciclin-like Arabinogalactan Protein Gene in Sea Island Cotton Fibers

    doi: 10.1371/journal.pone.0070185

    Figure Lengend Snippet: Visualized differentially expressed TDFs between Sea Island cotton fibers and Upland cotton fibers in cDNA-AFLP analyses. Lane 1 to 3 show Upland cotton ( G. hirsutum cv. CRI 8) fibers and Lane 4 to 6 show Sea Island cotton ( G . barbadense cv. Pima90-53) fibers. Eco RI/ Mse I and Apo I/ Taq I are the restriction enzyme combinations used in cDNA-AFLP analyses. Arrowheads show the differentially expressed FLA TDFs.

    Article Snippet: Two combinations of restriction enzyme of Mse I/Eco RI and Apo I/Taq I (New England Biolabs, USA) were used in cDNA-AFLP analysis.

    Techniques: cDNA-AFLP Assay

    Full length cDNA sequence of GbFLA5 and its deduced amino acid residues. Nucleotides underlined indicate the start codon of “ATG”, the effectively restriction site in cDNA-AFLP analysis (GAATTC for Eco RI and Apo I, TTAA for Mse I and TCGA for Taq I), and the stop codon of “TGA”, respectively; three conserved regions (H1, H2 and [YA] H) of smart00554 motif were ordinal characterized by wavy line; AGP-like domains are shown by the dashed line.

    Journal: PLoS ONE

    Article Title: Characterization and Expression Analysis of a Fiber Differentially Expressed Fasciclin-like Arabinogalactan Protein Gene in Sea Island Cotton Fibers

    doi: 10.1371/journal.pone.0070185

    Figure Lengend Snippet: Full length cDNA sequence of GbFLA5 and its deduced amino acid residues. Nucleotides underlined indicate the start codon of “ATG”, the effectively restriction site in cDNA-AFLP analysis (GAATTC for Eco RI and Apo I, TTAA for Mse I and TCGA for Taq I), and the stop codon of “TGA”, respectively; three conserved regions (H1, H2 and [YA] H) of smart00554 motif were ordinal characterized by wavy line; AGP-like domains are shown by the dashed line.

    Article Snippet: Two combinations of restriction enzyme of Mse I/Eco RI and Apo I/Taq I (New England Biolabs, USA) were used in cDNA-AFLP analysis.

    Techniques: Sequencing, cDNA-AFLP Assay