e1b gene  (Genewiz)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 85
      Buy from Supplier

    Structured Review

    Genewiz e1b gene
    Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or <t>E1B</t> mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.
    E1b Gene, supplied by Genewiz, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e1b gene/product/Genewiz
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e1b gene - by Bioz Stars, 2021-01
    85/100 stars

    Related Products / Commonly Used Together

    abi prism 7000 sequence detection system
    genomic dna
    quantitative real-time pcr amplification
    hadv-ds
    mastercycler ep gradient s platform
    qpcr amplification
    tgctctggcctgctagattc
    genbank acct
    qpcr
    ctggctccatttgtcaaccag
    restriction endonuclease site
    restriction endonuclease
    rt2 sybr green mastermix

    Images

    1) Product Images from "The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿"

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02269-08

    Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.
    Figure Legend Snippet: Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.

    Techniques Used: Infection, Expressing

    Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.
    Figure Legend Snippet: Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.

    Techniques Used: Infection

    2) Product Images from "The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication"

    Article Title: The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication

    Journal: Journal of Virology

    doi: 10.1128/JVI.03387-12

    Viral DNA synthesis is inhibited in AdEasyE1Sub19-infected cells treated with IFN. (A) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated or mock infected (M). The proteins listed at the right were examined by immunoblotting of total cell lysates as described in Materials and Methods. (B) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]) or AdEasyE1Sub19 (S19) for 36 h or mock infected (mock), and the E1B 55-kDa protein was visualized by immunofluorescence as described in Materials and Methods. DAPI, 4′,6-diamidino-2-phenylindole. (C) HFFs were treated with IFN or untreated (BSA) and infected with 3 PFU/cell of the virus indicated for 2 or 72 h. Viral DNA concentrations were measured by quantitative PCR, with cellular β-actin DNA used as an internal control, as described in Materials and Methods, and are expressed relative to the input (2 h) concentrations. The values represent the averages of two independent experiments, with cumulative standard deviations indicated by the error bars.
    Figure Legend Snippet: Viral DNA synthesis is inhibited in AdEasyE1Sub19-infected cells treated with IFN. (A) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated or mock infected (M). The proteins listed at the right were examined by immunoblotting of total cell lysates as described in Materials and Methods. (B) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]) or AdEasyE1Sub19 (S19) for 36 h or mock infected (mock), and the E1B 55-kDa protein was visualized by immunofluorescence as described in Materials and Methods. DAPI, 4′,6-diamidino-2-phenylindole. (C) HFFs were treated with IFN or untreated (BSA) and infected with 3 PFU/cell of the virus indicated for 2 or 72 h. Viral DNA concentrations were measured by quantitative PCR, with cellular β-actin DNA used as an internal control, as described in Materials and Methods, and are expressed relative to the input (2 h) concentrations. The values represent the averages of two independent experiments, with cumulative standard deviations indicated by the error bars.

    Techniques Used: DNA Synthesis, Infection, Immunofluorescence, Real-time Polymerase Chain Reaction

    Effects of the E1B 55-kDa Sub19 alterations on activation of Stat1. Mock-infected HFFs were treated with 250 units/ml IFN or vehicle-only control (BSA) for 24 h. Cells were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated, and the proteins listed at the right were examined by immunoblotting of whole-cell lysates as described in Materials and Methods. Stat1 phosphorylated on Tyr701 is designated Stat1-P.
    Figure Legend Snippet: Effects of the E1B 55-kDa Sub19 alterations on activation of Stat1. Mock-infected HFFs were treated with 250 units/ml IFN or vehicle-only control (BSA) for 24 h. Cells were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated, and the proteins listed at the right were examined by immunoblotting of whole-cell lysates as described in Materials and Methods. Stat1 phosphorylated on Tyr701 is designated Stat1-P.

    Techniques Used: Activation Assay, Infection

    The Sub19 substitutions impair repression of expression of IFN-inducible genes by the E1B 55-kDa protein. HFFs untreated (BSA) or treated with IFN (IFN) were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19), and total cell RNA was isolated 47 h after infection. The concentrations of GBP1 (A) and IFIT2 (B) mRNAs were determined by quantitative PCR, after synthesis of cDNA by reverse transcription from random primers, as described in Materials and Methods. The values shown represent the averages and cumulative standard deviations (bars) of two independent experiments.
    Figure Legend Snippet: The Sub19 substitutions impair repression of expression of IFN-inducible genes by the E1B 55-kDa protein. HFFs untreated (BSA) or treated with IFN (IFN) were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19), and total cell RNA was isolated 47 h after infection. The concentrations of GBP1 (A) and IFIT2 (B) mRNAs were determined by quantitative PCR, after synthesis of cDNA by reverse transcription from random primers, as described in Materials and Methods. The values shown represent the averages and cumulative standard deviations (bars) of two independent experiments.

    Techniques Used: Expressing, Infection, Isolation, Real-time Polymerase Chain Reaction

    3) Product Images from "The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿"

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02269-08

    Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.
    Figure Legend Snippet: Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.

    Techniques Used: Infection, Expressing

    Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.
    Figure Legend Snippet: Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.

    Techniques Used: Infection

    4) Product Images from "The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿"

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02269-08

    Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.
    Figure Legend Snippet: Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.

    Techniques Used: Infection, Expressing

    Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.
    Figure Legend Snippet: Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.

    Techniques Used: Infection

    Related Articles

    Sequencing:

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿
    Article Snippet: .. Plasmids carrying the desired mutations were identified by the presence of a new restriction endonuclease site, and the presence of the mutations was confirmed by sequencing the E1B gene (Genewiz Inc.). .. The mutations were recovered into the viral genome by homologous recombination with pAdEasy ( ) in Escherichia coli BJ5183 cells, and the presence of the mutations was confirmed by sequencing.

    Article Title: The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication
    Article Snippet: .. Following initial screening by cleavage of the products of mutagenesis with the appropriate restriction endonuclease, the presence of the desired mutation(s) and the absence of other changes in the E1B gene were confirmed by sequencing (Genewiz). .. The altered E1 regions were recovered into the viral genome by homologous recombination between the shuttle plasmids and pAdEasy ( ) in Escherichia coli , and mutant viruses were isolated from these genomes and validated as described previously ( , ).

    Mutagenesis:

    Article Title: The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication
    Article Snippet: .. Following initial screening by cleavage of the products of mutagenesis with the appropriate restriction endonuclease, the presence of the desired mutation(s) and the absence of other changes in the E1B gene were confirmed by sequencing (Genewiz). .. The altered E1 regions were recovered into the viral genome by homologous recombination between the shuttle plasmids and pAdEasy ( ) in Escherichia coli , and mutant viruses were isolated from these genomes and validated as described previously ( , ).

    Infection:

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿
    Article Snippet: .. Nevertheless, we would expect the changes induced upon infection with Adhz60, which cannot express any E1B gene products , to include those observed in the absence of only the E1B 55-kDa protein in Hr6-infected cells. .. Furthermore, the substantial increases in expression of cellular genes associated with immune responses to viral infection seen in Hr6-infected cells (Fig. ) were not evident in Adhz60-infected WI38 cells.

    Expressing:

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿
    Article Snippet: .. Recent reports have implicated E1B gene products in the regulation of expression of cell cycle-related genes. .. Rao et al. identified 345 genes that varied in expression by twofold or greater when normal lung fibroblasts (WI38 cells) were infected with an Ad5 mutant virus (Adhz60) defective for production of all E1B proteins compared to infection with the wild-type virus ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • e1b gene  (Genewiz)
    85
    Genewiz e1b gene
    Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or <t>E1B</t> mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.
    E1b Gene, supplied by Genewiz, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e1b gene/product/Genewiz
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e1b gene - by Bioz Stars, 2021-01
    85/100 stars
    		  Buy from Supplier

    Image Search Results


    Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.

    Journal: Journal of Virology

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿

    doi: 10.1128/JVI.02269-08

    Figure Lengend Snippet: Clusters of coregulated cellular RNAs 30 h after infection with Ad5 or E1B mutants. The expression profiles of significantly regulated genes were clustered into eight distinct groups with similar expression response profiles across the different Ad5 genotypes as described in Materials and Methods. Each cluster was searched for statistically significant enrichment of genes that code for proteins with common functions ( P values are Bonferroni corrected for multiple hypothesis testing). GO terms enriched in clusters 2, 3, and 4 are shown at right, with the corresponding P values. Genes that increased and decreased in expression are shown in yellow and blue, respectively, as indicated on the scale bar. hpi, hours postinfection.

    Article Snippet: Plasmids carrying the desired mutations were identified by the presence of a new restriction endonuclease site, and the presence of the mutations was confirmed by sequencing the E1B gene (Genewiz Inc.).

    Techniques: Infection, Expressing

    Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.

    Journal: Journal of Virology

    Article Title: The Adenoviral E1B 55-Kilodalton Protein Controls Expression of Immune Response Genes but Not p53-Dependent Transcription ▿

    doi: 10.1128/JVI.02269-08

    Figure Lengend Snippet: Effects of the sub17 mutations on accumulation of the E1B 55-kDa protein and protein V. (A) The coding sequences of the E1B proteins are shown to scale below the arrow representing the major E1B mRNA species, with different reading frames in white, gray, and black. As summarized above the mRNA, deletion of bp 2437 in the Hr6 genomes results in a shift of reading frame and termination of translation a short distance downstream. The C-terminal sequences of the wild-type and sub17 E1B 55-kDa proteins are shown between the expansion lines below, with the substitutions indicated in bold. (B) The E1B 55-kDa protein was examined 36 h after infection with Ad5 or Ad5E1B-sub17 (S17) or in mock-infected cells (M) by immunoblotting as described in Materials and Methods. Numbers at left are molecular masses in kilodaltons.

    Article Snippet: Plasmids carrying the desired mutations were identified by the presence of a new restriction endonuclease site, and the presence of the mutations was confirmed by sequencing the E1B gene (Genewiz Inc.).

    Techniques: Infection

    Viral DNA synthesis is inhibited in AdEasyE1Sub19-infected cells treated with IFN. (A) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated or mock infected (M). The proteins listed at the right were examined by immunoblotting of total cell lysates as described in Materials and Methods. (B) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]) or AdEasyE1Sub19 (S19) for 36 h or mock infected (mock), and the E1B 55-kDa protein was visualized by immunofluorescence as described in Materials and Methods. DAPI, 4′,6-diamidino-2-phenylindole. (C) HFFs were treated with IFN or untreated (BSA) and infected with 3 PFU/cell of the virus indicated for 2 or 72 h. Viral DNA concentrations were measured by quantitative PCR, with cellular β-actin DNA used as an internal control, as described in Materials and Methods, and are expressed relative to the input (2 h) concentrations. The values represent the averages of two independent experiments, with cumulative standard deviations indicated by the error bars.

    Journal: Journal of Virology

    Article Title: The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication

    doi: 10.1128/JVI.03387-12

    Figure Lengend Snippet: Viral DNA synthesis is inhibited in AdEasyE1Sub19-infected cells treated with IFN. (A) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated or mock infected (M). The proteins listed at the right were examined by immunoblotting of total cell lysates as described in Materials and Methods. (B) HFFs were infected with 30 PFU/cell AdEasyE1 (wild type [WT]) or AdEasyE1Sub19 (S19) for 36 h or mock infected (mock), and the E1B 55-kDa protein was visualized by immunofluorescence as described in Materials and Methods. DAPI, 4′,6-diamidino-2-phenylindole. (C) HFFs were treated with IFN or untreated (BSA) and infected with 3 PFU/cell of the virus indicated for 2 or 72 h. Viral DNA concentrations were measured by quantitative PCR, with cellular β-actin DNA used as an internal control, as described in Materials and Methods, and are expressed relative to the input (2 h) concentrations. The values represent the averages of two independent experiments, with cumulative standard deviations indicated by the error bars.

    Article Snippet: Following initial screening by cleavage of the products of mutagenesis with the appropriate restriction endonuclease, the presence of the desired mutation(s) and the absence of other changes in the E1B gene were confirmed by sequencing (Genewiz).

    Techniques: DNA Synthesis, Infection, Immunofluorescence, Real-time Polymerase Chain Reaction

    Effects of the E1B 55-kDa Sub19 alterations on activation of Stat1. Mock-infected HFFs were treated with 250 units/ml IFN or vehicle-only control (BSA) for 24 h. Cells were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated, and the proteins listed at the right were examined by immunoblotting of whole-cell lysates as described in Materials and Methods. Stat1 phosphorylated on Tyr701 is designated Stat1-P.

    Journal: Journal of Virology

    Article Title: The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication

    doi: 10.1128/JVI.03387-12

    Figure Lengend Snippet: Effects of the E1B 55-kDa Sub19 alterations on activation of Stat1. Mock-infected HFFs were treated with 250 units/ml IFN or vehicle-only control (BSA) for 24 h. Cells were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19) for the periods indicated, and the proteins listed at the right were examined by immunoblotting of whole-cell lysates as described in Materials and Methods. Stat1 phosphorylated on Tyr701 is designated Stat1-P.

    Article Snippet: Following initial screening by cleavage of the products of mutagenesis with the appropriate restriction endonuclease, the presence of the desired mutation(s) and the absence of other changes in the E1B gene were confirmed by sequencing (Genewiz).

    Techniques: Activation Assay, Infection

    The Sub19 substitutions impair repression of expression of IFN-inducible genes by the E1B 55-kDa protein. HFFs untreated (BSA) or treated with IFN (IFN) were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19), and total cell RNA was isolated 47 h after infection. The concentrations of GBP1 (A) and IFIT2 (B) mRNAs were determined by quantitative PCR, after synthesis of cDNA by reverse transcription from random primers, as described in Materials and Methods. The values shown represent the averages and cumulative standard deviations (bars) of two independent experiments.

    Journal: Journal of Virology

    Article Title: The Repression Domain of the E1B 55-Kilodalton Protein Participates in Countering Interferon-Induced Inhibition of Adenovirus Replication

    doi: 10.1128/JVI.03387-12

    Figure Lengend Snippet: The Sub19 substitutions impair repression of expression of IFN-inducible genes by the E1B 55-kDa protein. HFFs untreated (BSA) or treated with IFN (IFN) were infected with 200 PFU/cell AdEasyE1 (wild type [WT]), AdEasyE1Δ2347 (ΔE1B), or AdEasyE1Sub19 (S19), and total cell RNA was isolated 47 h after infection. The concentrations of GBP1 (A) and IFIT2 (B) mRNAs were determined by quantitative PCR, after synthesis of cDNA by reverse transcription from random primers, as described in Materials and Methods. The values shown represent the averages and cumulative standard deviations (bars) of two independent experiments.

    Article Snippet: Following initial screening by cleavage of the products of mutagenesis with the appropriate restriction endonuclease, the presence of the desired mutation(s) and the absence of other changes in the E1B gene were confirmed by sequencing (Genewiz).

    Techniques: Expressing, Infection, Isolation, Real-time Polymerase Chain Reaction