e coli top10  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    One Shot TOP10 Chemically Competent E coli
    Description:
    One Shot TOP10 Chemically Competent E coli are provided at a transformation efficiency of 1 x 109 cfu µg plasmid DNA and are ideal for high efficiency cloning and plasmid propagation They allow stable replication of high copy number plasmids and are the same competent cells that come with many of our cloning kits Features of One Shot TOP10 cells include • Maximization of cloning efficiency in a single tube format• Enhanced genomic DNA cloning capabilitiesEasy to use One Shot formatThe single tube single use format allows for all steps of the transformation protocol up to plating to take place in the same tube thereby helping to save time and prevent contamination Versatile cloning capabilitiesOne Shot TOP10 E coli cells are similar to the DH10B strain and offer the following features • hsdR for efficient transformation of unmethylated DNA from PCR amplifications• mcrA for efficient transformation of methylated DNA from genomic preparations• lacZΔM15 for blue white color screening of recombinant clones• endA1 for cleaner DNA preparations and better results in downstream applications due to elimination of nonspecific digestion by Endonuclease I• recA1 for reduced occurrence of nonspecific recombination in cloned DNAGenotype F mcrA Δ mrr hsdRMS mcrBC Φ80lacZΔM15 Δ lacX74 recA1 araD139 Δ araleu 7697 galU galK rpsL StrR endA1 nupGFind the strain and format that you needWe also offer many other different strains and formats of chemically competent cells and electrocompetent cells to help meet your specific transformation needs If you require high throughput transformation choose from our collection of MultiShot formatted comp cells
    Catalog Number:
    c404003
    Price:
    None
    Applications:
    Chemically Competent Cells for Cloning|Cloning|Transformation
    Category:
    Competent Cells Strains
    Buy from Supplier


    Structured Review

    Thermo Fisher e coli top10
    Competition assays and G. mellonella killing models in HLCRMs. a Fitness of full-length mcr-1 , calalytically inactivated mcr-1 (E246A), and mcr-1 soluble domain. Fitness of blaTEM-1b as a negative control. b Relative fitness of wild-type mcr-1 -positive strains and their derivatives. c Relative fitness of mcr-1/ pBAD-positive E.coli <t>TOP10</t> strains and their derivatives. In all fitness figures, error bars represent the SD ( n = 6). The differences in fitness were tested using non-parametric Mann–Whitney test, * indicates 0.01
    One Shot TOP10 Chemically Competent E coli are provided at a transformation efficiency of 1 x 109 cfu µg plasmid DNA and are ideal for high efficiency cloning and plasmid propagation They allow stable replication of high copy number plasmids and are the same competent cells that come with many of our cloning kits Features of One Shot TOP10 cells include • Maximization of cloning efficiency in a single tube format• Enhanced genomic DNA cloning capabilitiesEasy to use One Shot formatThe single tube single use format allows for all steps of the transformation protocol up to plating to take place in the same tube thereby helping to save time and prevent contamination Versatile cloning capabilitiesOne Shot TOP10 E coli cells are similar to the DH10B strain and offer the following features • hsdR for efficient transformation of unmethylated DNA from PCR amplifications• mcrA for efficient transformation of methylated DNA from genomic preparations• lacZΔM15 for blue white color screening of recombinant clones• endA1 for cleaner DNA preparations and better results in downstream applications due to elimination of nonspecific digestion by Endonuclease I• recA1 for reduced occurrence of nonspecific recombination in cloned DNAGenotype F mcrA Δ mrr hsdRMS mcrBC Φ80lacZΔM15 Δ lacX74 recA1 araD139 Δ araleu 7697 galU galK rpsL StrR endA1 nupGFind the strain and format that you needWe also offer many other different strains and formats of chemically competent cells and electrocompetent cells to help meet your specific transformation needs If you require high throughput transformation choose from our collection of MultiShot formatted comp cells
    https://www.bioz.com/result/e coli top10/product/Thermo Fisher
    Average 90 stars, based on 81 article reviews
    Price from $9.99 to $1999.99
    e coli top10 - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Balancing mcr-1 expression and bacterial survival is a delicate equilibrium between essential cellular defence mechanisms"

    Article Title: Balancing mcr-1 expression and bacterial survival is a delicate equilibrium between essential cellular defence mechanisms

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02149-0

    Competition assays and G. mellonella killing models in HLCRMs. a Fitness of full-length mcr-1 , calalytically inactivated mcr-1 (E246A), and mcr-1 soluble domain. Fitness of blaTEM-1b as a negative control. b Relative fitness of wild-type mcr-1 -positive strains and their derivatives. c Relative fitness of mcr-1/ pBAD-positive E.coli TOP10 strains and their derivatives. In all fitness figures, error bars represent the SD ( n = 6). The differences in fitness were tested using non-parametric Mann–Whitney test, * indicates 0.01
    Figure Legend Snippet: Competition assays and G. mellonella killing models in HLCRMs. a Fitness of full-length mcr-1 , calalytically inactivated mcr-1 (E246A), and mcr-1 soluble domain. Fitness of blaTEM-1b as a negative control. b Relative fitness of wild-type mcr-1 -positive strains and their derivatives. c Relative fitness of mcr-1/ pBAD-positive E.coli TOP10 strains and their derivatives. In all fitness figures, error bars represent the SD ( n = 6). The differences in fitness were tested using non-parametric Mann–Whitney test, * indicates 0.01

    Techniques Used: Negative Control, MANN-WHITNEY

    TEM micrographs of untreated and treated E.coli . In a and b , TEM micrographs of untreated control cells ( E. coli TOP10 with pBAD minus mcr-1 , and E. coli TOP10 ( mcr-1 /pBAD) without l -arabinose induction, respectively); both cells are intact with a well-defined inner and outer membrane, and showed a highly homogeneous electron density in cytoplasm region ( d and e ). c TEM micrographs of mcr-1 overproducing cells; the damaging outer membrane and some completely lysed cells were observed ( f )
    Figure Legend Snippet: TEM micrographs of untreated and treated E.coli . In a and b , TEM micrographs of untreated control cells ( E. coli TOP10 with pBAD minus mcr-1 , and E. coli TOP10 ( mcr-1 /pBAD) without l -arabinose induction, respectively); both cells are intact with a well-defined inner and outer membrane, and showed a highly homogeneous electron density in cytoplasm region ( d and e ). c TEM micrographs of mcr-1 overproducing cells; the damaging outer membrane and some completely lysed cells were observed ( f )

    Techniques Used: Transmission Electron Microscopy

    Related Articles

    Transduction:

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: To filter induced PCR mutations and distinguish possible allelic variants, at least four independent PCR products, and clones from each L1 transduction family member were capillary sequenced using 12 overlapping primer pairs ( ) distributed at ∼500-bp intervals covering the entire L1 sequence. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Clone Assay:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: .. The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03). .. Kanamycin-resistant colonies were selected and plasmid DNA was prepared using the QIAprep Spin Miniprep Kit (Qiagen, 27104).

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: Paragraph title: L1 genotyping and cloning. ... Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. The amplicon-containing pCR2.1 TOPO vector and the target vector, pcDNA 3.1 myc-His A, were digested at 37°C overnight using BamH1 (Promega, R602, Madison, WI) and Csp45I (Promega, R657, Madison, WI).

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: Paragraph title: Cloning of QPCR fragments and QPCR ... These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Article Title: Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
    Article Snippet: .. 10 cm dish ( e.g. , Corning, catalog number: 430167) T75 flasks (Corning, catalog number: 430641U) 0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020) 6-well tissue culture plates (Corning, catalog number: 3516) 96-well clear bottom tissue culture plates (Corning, catalog number: 3610) 40 μm cell strainer (Corning, Falcon® , catalog number: 352340) Parafilm (Parafilm, catalog number: PM-999) 24-well plate 15 ml conical tube Tips S2R+ cells ( Drosophila Genomics Resource Center, catalog number: 150) sgRNA expression plasmid (pl18 - available from author on request) act-GFP plasmid (available from author on request) Chemically competent E. coli cells ( e.g. , Thermo Fisher Scientific, Invitrogen™ , catalog number: C404003) Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427) PBS (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) with 1% FBS (GE Healthcare, HyClone™ , catalog number: SH30541.03) HRMA reagents ( ) Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen™ , catalog number: 450245) M13F and M13R primers dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [ ] for available libraries). ..

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones. .. To verify that PCR amplification did not introduce unwanted mutations, all constructs were sequenced (by Eurofins Genomics S.r.l., Milan, Italy) using standard primers complementary to the plasmid common regions of the constructs, adjacent to the target open reading frames (ORF).

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Sec22b was amplified and adapted for TOPO cloning using AccuPrime Pfx Polymerase (Invitrogen, 12344024) and 5′-CACCATGGTGCTGCTGACGAT-3′ and 5′-TCACAGCCACCAAAACCGCA-3′ primers. .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010).

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: .. Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003). .. Transfections were performed using Mirus LT1 transfection reagent as per the manufacturer's protocol.

    Amplification:

    Article Title: Salt-responsive gut commensal modulates TH17 axis and disease
    Article Snippet: .. Standard curves for quantification consisted in ten-fold serial dilutions in the range of 108 to 100 copies of E. coli (Invitrogen, C404010) or L. murinus isolate 16S rRNA gene amplified with primers 27F (5’-GTTTGATCCTGGCTCAG-3’) and 1492R (5’-CGGCTA CCTTGTTACGAC-3’) . ..

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: Products of the nested PCR were used as the template for final amplification of the synthetic promoters using external primers that corresponded to the terminal 20 bp of each sequence. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: It was amplified by Phusion HF DNA polymerase (M0530L) and purified by the QIAquick PCR Purification Kit (#28106) and QIA gel Extraction kit (#28706). .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: Transgenic plants The TRG1/XYL1 promoter region and the gene containing upstream and downstream regions were amplified from Ws genomic DNA by high-fidelity PCR with specific primers ( Supplementary Table S2 ) and PrimeSTAR DNA polymerase (Takara Bio Inc.). .. The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03).

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. The amplicon-containing pCR2.1 TOPO vector and the target vector, pcDNA 3.1 myc-His A, were digested at 37°C overnight using BamH1 (Promega, R602, Madison, WI) and Csp45I (Promega, R657, Madison, WI).

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: The settings in Primer3 were: melting temperatures between 58°C and 62°C (ΔTm < 1°C), GC content between 40 and 60% and amplicon length between 90 and 120 base pairs. .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones. .. To verify that PCR amplification did not introduce unwanted mutations, all constructs were sequenced (by Eurofins Genomics S.r.l., Milan, Italy) using standard primers complementary to the plasmid common regions of the constructs, adjacent to the target open reading frames (ORF).

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Sec22b was amplified and adapted for TOPO cloning using AccuPrime Pfx Polymerase (Invitrogen, 12344024) and 5′-CACCATGGTGCTGCTGACGAT-3′ and 5′-TCACAGCCACCAAAACCGCA-3′ primers. .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010).

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: Fragment amplification was performed by PCR using Platinum PCR Supermix (Invitrogen; catalog number 11306-016) and the fragment was ligated into previously digested pcDNA3.1 using Quick ligase (New England BioLabs; catalog number M2200S). .. Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003).

    Stable Transfection:

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: .. Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Synthesized:

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: Construction of Connexin-Venus Transfection Vectors The coding regions of wt homo sapience connexin genes were synthesized (by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) without stop codon and subcloned into a pcDNA3.1(+) mammalian expression vector (Cat. No. V79020, Thermo Fisher Scientific) that had been previously modified for C-terminal fusion of connexin genes with Venus, a circularly permuted mutant of the yellow fluorescent protein (YFP) ( ). .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones.

    TA Cloning:

    Article Title: Human Norovirus Detection and Production, Quantification, and Storage of Virus-Like Particles
    Article Snippet: .. AM8110G) TOPO TA Cloning® Kit Dual Promoter (Life Technologies, cat. no. K460040) including: TOP10 pCR™ II-TOPO® vector 10x PCR Buffer Salt Solution 12.5 mM dNTP Mix 0.1 μg/μl M13 Forward (−20) oligonucleotide primer 0.1 μg/μl M13 Reverse oligonucleotide primer 0.1 μg/μl Control Template 0.1 μg/μl Control PCR oligonucleotide primers Water One Shot® TOP10 Competent Cells (Life Technology, cat. no. C404003) including: S.O.C. .. Medium TOP10 cells pUC19 Control DNA LB agar containing 100 μg/ml ampicillin (see recipe) LB broth containing 100 μg/ml ampicillin (see recipe) 40 μg/ml X-Gal (Promega, cat. no. PR-V3941) DNA suspension buffer (Teknova, cat.no.

    Blocking Assay:

    Article Title: Human Norovirus Detection and Production, Quantification, and Storage of Virus-Like Particles
    Article Snippet: AM8110G) TOPO TA Cloning® Kit Dual Promoter (Life Technologies, cat. no. K460040) including: TOP10 pCR™ II-TOPO® vector 10x PCR Buffer Salt Solution 12.5 mM dNTP Mix 0.1 μg/μl M13 Forward (−20) oligonucleotide primer 0.1 μg/μl M13 Reverse oligonucleotide primer 0.1 μg/μl Control Template 0.1 μg/μl Control PCR oligonucleotide primers Water One Shot® TOP10 Competent Cells (Life Technology, cat. no. C404003) including: S.O.C. .. T0220) Taq DNA Polymerase (Roche, cat. no. 11418432001) including: 10x PCR Buffer w/MgCl2 Taq DNA polymerase 0.2 ml thin-walled PCR/RT-PCR tubes GeneAmp 9700 PCR thermal cycler (Life Technology) or similar instrument Water bath at 42°C Ice bath Rotary shaker Autoclaved toothpicks VWR® Digital Dry Block Heaters (VWR, cat. no. 12621-084) or similar instrument 14 ml conical tubes

    SYBR Green Assay:

    Article Title: Salt-responsive gut commensal modulates TH17 axis and disease
    Article Snippet: Samples were quantified in 10 μl reactions containing 1x SYBR Green Master Mix (AB), 300 nM of each primer and 4 ng of genomic DNA. .. Standard curves for quantification consisted in ten-fold serial dilutions in the range of 108 to 100 copies of E. coli (Invitrogen, C404010) or L. murinus isolate 16S rRNA gene amplified with primers 27F (5’-GTTTGATCCTGGCTCAG-3’) and 1492R (5’-CGGCTA CCTTGTTACGAC-3’) .

    Incubation:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: A total of 50 pmol of forward and reverse primers with 5 units of Taq DNA polymerase were combined and incubated at 72 °C for 65 min, hybridizing the two oligos. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    Infection:

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: .. Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Expressing:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: The PCR product was cut with NEB CutSmart and ligated overnight at 16ºC to p3XFLAG-CMV™ -7.1 expression vector (E7533 SIGMA). .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: The restriction sites for the enzymes BamH1 and Csp451 within the targeted expression vector, pcDNA 3.1 myc-His A, (Invitrogen, V800-20, Grand Island, NY) were encoded within both primers to allow for sticky end ligation. .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA).

    Article Title: Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
    Article Snippet: .. 10 cm dish ( e.g. , Corning, catalog number: 430167) T75 flasks (Corning, catalog number: 430641U) 0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020) 6-well tissue culture plates (Corning, catalog number: 3516) 96-well clear bottom tissue culture plates (Corning, catalog number: 3610) 40 μm cell strainer (Corning, Falcon® , catalog number: 352340) Parafilm (Parafilm, catalog number: PM-999) 24-well plate 15 ml conical tube Tips S2R+ cells ( Drosophila Genomics Resource Center, catalog number: 150) sgRNA expression plasmid (pl18 - available from author on request) act-GFP plasmid (available from author on request) Chemically competent E. coli cells ( e.g. , Thermo Fisher Scientific, Invitrogen™ , catalog number: C404003) Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427) PBS (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) with 1% FBS (GE Healthcare, HyClone™ , catalog number: SH30541.03) HRMA reagents ( ) Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen™ , catalog number: 450245) M13F and M13R primers dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [ ] for available libraries). ..

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: Construction of Connexin-Venus Transfection Vectors The coding regions of wt homo sapience connexin genes were synthesized (by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) without stop codon and subcloned into a pcDNA3.1(+) mammalian expression vector (Cat. No. V79020, Thermo Fisher Scientific) that had been previously modified for C-terminal fusion of connexin genes with Venus, a circularly permuted mutant of the yellow fluorescent protein (YFP) ( ). .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones.

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Gateway™ recombination was used to insert the transgene into expression vector pLenti7.3/V5-DEST™ (Invitrogen, V53406).

    Modification:

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: Construction of Connexin-Venus Transfection Vectors The coding regions of wt homo sapience connexin genes were synthesized (by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) without stop codon and subcloned into a pcDNA3.1(+) mammalian expression vector (Cat. No. V79020, Thermo Fisher Scientific) that had been previously modified for C-terminal fusion of connexin genes with Venus, a circularly permuted mutant of the yellow fluorescent protein (YFP) ( ). .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones.

    Western Blot:

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher). .. The cell was post-transfected for 48 hours at 37°C, then the transfection efficacy was determined by qPCR quantification and western blot analysis.

    Transformation Assay:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher). .. The overexpression gene transient transfection was carried out with Lipofectamine 3000 reagent (Invitrogen, CA, USA), while transient knockdown using Mission® esiRNA (EHU018231 SIGMA) with Lipofectamine 2000 following the manufacturer's protocol.

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: .. Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: .. The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03). .. Kanamycin-resistant colonies were selected and plasmid DNA was prepared using the QIAprep Spin Miniprep Kit (Qiagen, 27104).

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates. .. Clones with the specific insert were picked and grown overnight, at 37°C in 3 ml LB/ampicilin medium in a shaker.

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones. .. To verify that PCR amplification did not introduce unwanted mutations, all constructs were sequenced (by Eurofins Genomics S.r.l., Milan, Italy) using standard primers complementary to the plasmid common regions of the constructs, adjacent to the target open reading frames (ORF).

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Over Expression:

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher). .. The overexpression gene transient transfection was carried out with Lipofectamine 3000 reagent (Invitrogen, CA, USA), while transient knockdown using Mission® esiRNA (EHU018231 SIGMA) with Lipofectamine 2000 following the manufacturer's protocol.

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Paragraph title: Generation of Sec22bΔ transgene overexpression vector ... Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Human Norovirus Detection and Production, Quantification, and Storage of Virus-Like Particles
    Article Snippet: ORF2-ORF3 PCR product (see BASIC PROTOCOL 2) Taq DNA polymerase, recombinant (Life Technologies, cat. no. 10342-020) including: 10x PCR Buffer 50 mM MgCl2 Taq DNA polymerase, recombinant 10 mM ATP (Life Technologies, cat.no. .. AM8110G) TOPO TA Cloning® Kit Dual Promoter (Life Technologies, cat. no. K460040) including: TOP10 pCR™ II-TOPO® vector 10x PCR Buffer Salt Solution 12.5 mM dNTP Mix 0.1 μg/μl M13 Forward (−20) oligonucleotide primer 0.1 μg/μl M13 Reverse oligonucleotide primer 0.1 μg/μl Control Template 0.1 μg/μl Control PCR oligonucleotide primers Water One Shot® TOP10 Competent Cells (Life Technology, cat. no. C404003) including: S.O.C.

    Transfection:

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: Paragraph title: Molecular cloning and gene transient transfection ... Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Next, HEK293T cells (ATCC Cat# CRL-3216, RRID: CVCL_0063 ), maintained in DMEM supplemented with 10% FBS at 37°C with 5% CO2 , were transfected with the appropriate lentiviral and packaging plasmids using Lipofectamine 2000 (Invitrogen Cat# 52887) and Opti-MEM (Invitrogen Cat# 31985–070) as described in the Registered Report.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. The beta-2 constructs were ligated into pcDNA 3.1 myc-His A for 3 hours at room temperature, transfected into TOP 10 E. coli, and sequence confirmed post-ligation.

    Article Title: Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
    Article Snippet: .. 10 cm dish ( e.g. , Corning, catalog number: 430167) T75 flasks (Corning, catalog number: 430641U) 0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020) 6-well tissue culture plates (Corning, catalog number: 3516) 96-well clear bottom tissue culture plates (Corning, catalog number: 3610) 40 μm cell strainer (Corning, Falcon® , catalog number: 352340) Parafilm (Parafilm, catalog number: PM-999) 24-well plate 15 ml conical tube Tips S2R+ cells ( Drosophila Genomics Resource Center, catalog number: 150) sgRNA expression plasmid (pl18 - available from author on request) act-GFP plasmid (available from author on request) Chemically competent E. coli cells ( e.g. , Thermo Fisher Scientific, Invitrogen™ , catalog number: C404003) Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427) PBS (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) with 1% FBS (GE Healthcare, HyClone™ , catalog number: SH30541.03) HRMA reagents ( ) Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen™ , catalog number: 450245) M13F and M13R primers dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [ ] for available libraries). ..

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: Paragraph title: Construction of Connexin-Venus Transfection Vectors ... After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones.

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: Paragraph title: Transfections. ... Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003).

    Transgenic Assay:

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: Paragraph title: Transgenic plants ... The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03).

    esiRNA:

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher). .. The overexpression gene transient transfection was carried out with Lipofectamine 3000 reagent (Invitrogen, CA, USA), while transient knockdown using Mission® esiRNA (EHU018231 SIGMA) with Lipofectamine 2000 following the manufacturer's protocol.

    Ligation:

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions. ..

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: The restriction sites for the enzymes BamH1 and Csp451 within the targeted expression vector, pcDNA 3.1 myc-His A, (Invitrogen, V800-20, Grand Island, NY) were encoded within both primers to allow for sticky end ligation. .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA).

    Cell Culture:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Generated:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: An initial template was generated with two, 111 bp, overlapping synthetic oligos corresponding to the sequence of each desired promoter. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    DNA Sequencing:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Polymerase Chain Reaction:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: The hybridized DNA was column purified using a Qiagen PCR purification kit and the secondary nested PCR was completed. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    Article Title: Human Norovirus Detection and Production, Quantification, and Storage of Virus-Like Particles
    Article Snippet: .. AM8110G) TOPO TA Cloning® Kit Dual Promoter (Life Technologies, cat. no. K460040) including: TOP10 pCR™ II-TOPO® vector 10x PCR Buffer Salt Solution 12.5 mM dNTP Mix 0.1 μg/μl M13 Forward (−20) oligonucleotide primer 0.1 μg/μl M13 Reverse oligonucleotide primer 0.1 μg/μl Control Template 0.1 μg/μl Control PCR oligonucleotide primers Water One Shot® TOP10 Competent Cells (Life Technology, cat. no. C404003) including: S.O.C. .. Medium TOP10 cells pUC19 Control DNA LB agar containing 100 μg/ml ampicillin (see recipe) LB broth containing 100 μg/ml ampicillin (see recipe) 40 μg/ml X-Gal (Promega, cat. no. PR-V3941) DNA suspension buffer (Teknova, cat.no.

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: The PCR product was cut with NEB CutSmart and ligated overnight at 16ºC to p3XFLAG-CMV™ -7.1 expression vector (E7533 SIGMA). .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: Transgenic plants The TRG1/XYL1 promoter region and the gene containing upstream and downstream regions were amplified from Ws genomic DNA by high-fidelity PCR with specific primers ( Supplementary Table S2 ) and PrimeSTAR DNA polymerase (Takara Bio Inc.). .. The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03).

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: To filter induced PCR mutations and distinguish possible allelic variants, at least four independent PCR products, and clones from each L1 transduction family member were capillary sequenced using 12 overlapping primer pairs ( ) distributed at ∼500-bp intervals covering the entire L1 sequence. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: PCR amplicons subsequently were TA-cloned into pCR2.1-TOPO (Invitrogen, KNM4500-0110, Carlsbad, CA) via topoisomerase according to manufacturer's instructions. .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA).

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: PCR products were then cloned into pGEMTeasy plasmid (Promega, Cat. A1360). .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Article Title: Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
    Article Snippet: .. 10 cm dish ( e.g. , Corning, catalog number: 430167) T75 flasks (Corning, catalog number: 430641U) 0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020) 6-well tissue culture plates (Corning, catalog number: 3516) 96-well clear bottom tissue culture plates (Corning, catalog number: 3610) 40 μm cell strainer (Corning, Falcon® , catalog number: 352340) Parafilm (Parafilm, catalog number: PM-999) 24-well plate 15 ml conical tube Tips S2R+ cells ( Drosophila Genomics Resource Center, catalog number: 150) sgRNA expression plasmid (pl18 - available from author on request) act-GFP plasmid (available from author on request) Chemically competent E. coli cells ( e.g. , Thermo Fisher Scientific, Invitrogen™ , catalog number: C404003) Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427) PBS (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) with 1% FBS (GE Healthcare, HyClone™ , catalog number: SH30541.03) HRMA reagents ( ) Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen™ , catalog number: 450245) M13F and M13R primers dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [ ] for available libraries). ..

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones. .. To verify that PCR amplification did not introduce unwanted mutations, all constructs were sequenced (by Eurofins Genomics S.r.l., Milan, Italy) using standard primers complementary to the plasmid common regions of the constructs, adjacent to the target open reading frames (ORF).

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: Fragment amplification was performed by PCR using Platinum PCR Supermix (Invitrogen; catalog number 11306-016) and the fragment was ligated into previously digested pcDNA3.1 using Quick ligase (New England BioLabs; catalog number M2200S). .. Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003).

    Binding Assay:

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    DNA Extraction:

    Article Title: Salt-responsive gut commensal modulates TH17 axis and disease
    Article Snippet: Paragraph title: DNA extraction from feces and qPCR of 16S rRNA genes ... Standard curves for quantification consisted in ten-fold serial dilutions in the range of 108 to 100 copies of E. coli (Invitrogen, C404010) or L. murinus isolate 16S rRNA gene amplified with primers 27F (5’-GTTTGATCCTGGCTCAG-3’) and 1492R (5’-CGGCTA CCTTGTTACGAC-3’) .

    Nucleic Acid Electrophoresis:

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: The size, specificity and annealing temperature was tested in a gradient PCR and checked with gel electrophoresis. .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Fluorescence:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Mutagenesis:

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: For each L1, a consensus sequence was obtained, and a mutation-free construct was reconstructed by performing multiple restriction enzyme digestions. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: Construction of Connexin-Venus Transfection Vectors The coding regions of wt homo sapience connexin genes were synthesized (by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) without stop codon and subcloned into a pcDNA3.1(+) mammalian expression vector (Cat. No. V79020, Thermo Fisher Scientific) that had been previously modified for C-terminal fusion of connexin genes with Venus, a circularly permuted mutant of the yellow fluorescent protein (YFP) ( ). .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones.

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Isolation:

    Article Title: Salt-responsive gut commensal modulates TH17 axis and disease
    Article Snippet: DNA extraction from feces and qPCR of 16S rRNA genes DNA from stool samples was isolated using QIAamp DNA Stool Mini Kit (Qiagen) according to the manufacturer's instructions. .. Standard curves for quantification consisted in ten-fold serial dilutions in the range of 108 to 100 copies of E. coli (Invitrogen, C404010) or L. murinus isolate 16S rRNA gene amplified with primers 27F (5’-GTTTGATCCTGGCTCAG-3’) and 1492R (5’-CGGCTA CCTTGTTACGAC-3’) .

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression. .. Positive clones were cultured in Luria broth (LB) media with 100 μg mL–1 ampicillin (Amp) at 37 °C and 220 rpm, plasmids were isolated and promoter integrity was confirmed by DNA sequencing.

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Purification:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: The final 203 bp amplicons, the desired promoter sequences, were gel purified. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: It was amplified by Phusion HF DNA polymerase (M0530L) and purified by the QIAquick PCR Purification Kit (#28106) and QIA gel Extraction kit (#28706). .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: The desired fragments were resolved in a 2% agarose gel (1× TAE buffer), purified, and ligated into a pCEP4 vector using T4 ligase in a 5:1 (insert/vector) ratio. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. Linearized pcDNA 3.1 myc-His A was phosphatase treated using calf intestinal alkaline phosphatase (CIAP) (Invitrogen, 18009-019, Grand Island, NY), phenol/chloroform extracted, and ethanol precipitated while newly digested beta-2 constructs were gel purified from 0.8% agarose using a PureLink Gel Extraction Kit (Invitrogen, K2100-12) and ethanol precipitated.

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: PCR products were examined in 2% EtBr agarose gels, the specific bands were cut from the gel, and purified using QIAquick Gel Extraction Kit (Qiagen, Cat. 28706). .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Sequencing:

    Article Title: Salt-responsive gut commensal modulates TH17 axis and disease
    Article Snippet: To optimize bacterial community structure representation, a mutanolysin (Sigma) digestion step was included (6 μl of 25kU/ml stock/sample) . qPCR on a 7500 Sequence Detector (Applied Biosystems, AB) was used to enumerate bacterial 16S rRNA gene copies in the genomic DNA extracted from stool samples. .. Standard curves for quantification consisted in ten-fold serial dilutions in the range of 108 to 100 copies of E. coli (Invitrogen, C404010) or L. murinus isolate 16S rRNA gene amplified with primers 27F (5’-GTTTGATCCTGGCTCAG-3’) and 1492R (5’-CGGCTA CCTTGTTACGAC-3’) .

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: Products of the nested PCR were used as the template for final amplification of the synthetic promoters using external primers that corresponded to the terminal 20 bp of each sequence. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Plasmids were sequenced to confirm their integrity (Sequencing files can be found at https://osf.io/dhch3/ ).

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03). .. The insertion of the entry plasmids was confirmed by sequencing with primers listed in Supplementary Table S5 .

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: For each L1, a consensus sequence was obtained, and a mutation-free construct was reconstructed by performing multiple restriction enzyme digestions. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. The amplicon-containing pCR2.1 TOPO vector and the target vector, pcDNA 3.1 myc-His A, were digested at 37°C overnight using BamH1 (Promega, R602, Madison, WI) and Csp45I (Promega, R657, Madison, WI).

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: The reverse primer sequence, AAAAGATATCCTCATGAGCGGATACATATT, contained the EcoRV cloning site and the end of the structural polyprotein ORF. .. Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003).

    shRNA:

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Construct:

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: For each L1, a consensus sequence was obtained, and a mutation-free construct was reconstructed by performing multiple restriction enzyme digestions. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. Linearized pcDNA 3.1 myc-His A was phosphatase treated using calf intestinal alkaline phosphatase (CIAP) (Invitrogen, 18009-019, Grand Island, NY), phenol/chloroform extracted, and ethanol precipitated while newly digested beta-2 constructs were gel purified from 0.8% agarose using a PureLink Gel Extraction Kit (Invitrogen, K2100-12) and ethanol precipitated.

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones. .. To verify that PCR amplification did not introduce unwanted mutations, all constructs were sequenced (by Eurofins Genomics S.r.l., Milan, Italy) using standard primers complementary to the plasmid common regions of the constructs, adjacent to the target open reading frames (ORF).

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: The VEEV capsid-V5 construct was transfected using Mirus LT1 transfection reagent (Mirusbio; number MIR 2300) as per the manufacturer's protocol. .. Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003).

    Nested PCR:

    Article Title: Investigation of Changes in Tetracycline Repressor Binding upon Mutations in the Tetracycline Operator
    Article Snippet: Products of the nested PCR were used as the template for final amplification of the synthetic promoters using external primers that corresponded to the terminal 20 bp of each sequence. .. Each promoter was cloned into pGLOW-TOPO (Invitrogen 12567-020) upstream of the green fluorescence protein reporter gene (gfp ) and transformed into chemically competent Top10 (LacI–, TetR−) E. coli (Invitrogen, C404010) by heat shock at 42 °C for 45 s. Transformants were screened by GFP expression.

    Activated Clotting Time Assay:

    Article Title: Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
    Article Snippet: .. 10 cm dish ( e.g. , Corning, catalog number: 430167) T75 flasks (Corning, catalog number: 430641U) 0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020) 6-well tissue culture plates (Corning, catalog number: 3516) 96-well clear bottom tissue culture plates (Corning, catalog number: 3610) 40 μm cell strainer (Corning, Falcon® , catalog number: 352340) Parafilm (Parafilm, catalog number: PM-999) 24-well plate 15 ml conical tube Tips S2R+ cells ( Drosophila Genomics Resource Center, catalog number: 150) sgRNA expression plasmid (pl18 - available from author on request) act-GFP plasmid (available from author on request) Chemically competent E. coli cells ( e.g. , Thermo Fisher Scientific, Invitrogen™ , catalog number: C404003) Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427) PBS (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) with 1% FBS (GE Healthcare, HyClone™ , catalog number: SH30541.03) HRMA reagents ( ) Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen™ , catalog number: 450245) M13F and M13R primers dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [ ] for available libraries). ..

    Plasmid Preparation:

    Article Title: Human Norovirus Detection and Production, Quantification, and Storage of Virus-Like Particles
    Article Snippet: .. AM8110G) TOPO TA Cloning® Kit Dual Promoter (Life Technologies, cat. no. K460040) including: TOP10 pCR™ II-TOPO® vector 10x PCR Buffer Salt Solution 12.5 mM dNTP Mix 0.1 μg/μl M13 Forward (−20) oligonucleotide primer 0.1 μg/μl M13 Reverse oligonucleotide primer 0.1 μg/μl Control Template 0.1 μg/μl Control PCR oligonucleotide primers Water One Shot® TOP10 Competent Cells (Life Technology, cat. no. C404003) including: S.O.C. .. Medium TOP10 cells pUC19 Control DNA LB agar containing 100 μg/ml ampicillin (see recipe) LB broth containing 100 μg/ml ampicillin (see recipe) 40 μg/ml X-Gal (Promega, cat. no. PR-V3941) DNA suspension buffer (Teknova, cat.no.

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: The PCR product was cut with NEB CutSmart and ligated overnight at 16ºC to p3XFLAG-CMV™ -7.1 expression vector (E7533 SIGMA). .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Article Title: α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana
    Article Snippet: .. The product was cloned into the Gateway entry vector using the pENTR Directional TOPO Cloning Kit (Invitrogen, K2400-20SP) and transformed One Shot Chemically Competent Escherichia coli (Invitrogen, C4040-03). .. Kanamycin-resistant colonies were selected and plasmid DNA was prepared using the QIAprep Spin Miniprep Kit (Qiagen, 27104).

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: Paragraph title: ATRX-containing plasmid propagation and handling ... Top10 (Invitrogen, C404003) and DH5α bacteria were also used and are not recommended for growing ATRX -containing plasmids.

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: The desired fragments were resolved in a 2% agarose gel (1× TAE buffer), purified, and ligated into a pCEP4 vector using T4 ligase in a 5:1 (insert/vector) ratio. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: The restriction sites for the enzymes BamH1 and Csp451 within the targeted expression vector, pcDNA 3.1 myc-His A, (Invitrogen, V800-20, Grand Island, NY) were encoded within both primers to allow for sticky end ligation. .. Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA).

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: PCR products were then cloned into pGEMTeasy plasmid (Promega, Cat. A1360). .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Article Title: Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
    Article Snippet: .. 10 cm dish ( e.g. , Corning, catalog number: 430167) T75 flasks (Corning, catalog number: 430641U) 0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020) 6-well tissue culture plates (Corning, catalog number: 3516) 96-well clear bottom tissue culture plates (Corning, catalog number: 3610) 40 μm cell strainer (Corning, Falcon® , catalog number: 352340) Parafilm (Parafilm, catalog number: PM-999) 24-well plate 15 ml conical tube Tips S2R+ cells ( Drosophila Genomics Resource Center, catalog number: 150) sgRNA expression plasmid (pl18 - available from author on request) act-GFP plasmid (available from author on request) Chemically competent E. coli cells ( e.g. , Thermo Fisher Scientific, Invitrogen™ , catalog number: C404003) Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427) PBS (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) with 1% FBS (GE Healthcare, HyClone™ , catalog number: SH30541.03) HRMA reagents ( ) Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen™ , catalog number: 450245) M13F and M13R primers dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [ ] for available libraries). ..

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: Construction of Connexin-Venus Transfection Vectors The coding regions of wt homo sapience connexin genes were synthesized (by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) without stop codon and subcloned into a pcDNA3.1(+) mammalian expression vector (Cat. No. V79020, Thermo Fisher Scientific) that had been previously modified for C-terminal fusion of connexin genes with Venus, a circularly permuted mutant of the yellow fluorescent protein (YFP) ( ). .. After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones.

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Article Title: Protein Phosphatase 1α Interacts with Venezuelan Equine Encephalitis Virus Capsid Protein and Regulates Viral Replication through Modulation of Capsid Phosphorylation
    Article Snippet: .. Ligated plasmid was cloned into OneShot Top10 chemically competent cells (Invitrogen; C404003). .. Transfections were performed using Mirus LT1 transfection reagent as per the manufacturer's protocol.

    Introduce:

    Article Title: A Human-Derived Monoclonal Antibody Targeting Extracellular Connexin Domain Selectively Modulates Hemichannel Function
    Article Snippet: After transformation into Escherichia coli (TOP10, Cat. No. C404010, Thermo Fisher Scientific), miniplasmid preparation and restriction enzyme analysis were performed to identify positive clones. .. To verify that PCR amplification did not introduce unwanted mutations, all constructs were sequenced (by Eurofins Genomics S.r.l., Milan, Italy) using standard primers complementary to the plasmid common regions of the constructs, adjacent to the target open reading frames (ORF).

    Real-time Polymerase Chain Reaction:

    Article Title: Salt-responsive gut commensal modulates TH17 axis and disease
    Article Snippet: Paragraph title: DNA extraction from feces and qPCR of 16S rRNA genes ... Standard curves for quantification consisted in ten-fold serial dilutions in the range of 108 to 100 copies of E. coli (Invitrogen, C404010) or L. murinus isolate 16S rRNA gene amplified with primers 27F (5’-GTTTGATCCTGGCTCAG-3’) and 1492R (5’-CGGCTA CCTTGTTACGAC-3’) .

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher). .. The cell was post-transfected for 48 hours at 37°C, then the transfection efficacy was determined by qPCR quantification and western blot analysis.

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: Paragraph title: Cloning of QPCR fragments and QPCR ... These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Recombinant:

    Article Title: Human Norovirus Detection and Production, Quantification, and Storage of Virus-Like Particles
    Article Snippet: ORF2-ORF3 PCR product (see BASIC PROTOCOL 2) Taq DNA polymerase, recombinant (Life Technologies, cat. no. 10342-020) including: 10x PCR Buffer 50 mM MgCl2 Taq DNA polymerase, recombinant 10 mM ATP (Life Technologies, cat.no. .. AM8110G) TOPO TA Cloning® Kit Dual Promoter (Life Technologies, cat. no. K460040) including: TOP10 pCR™ II-TOPO® vector 10x PCR Buffer Salt Solution 12.5 mM dNTP Mix 0.1 μg/μl M13 Forward (−20) oligonucleotide primer 0.1 μg/μl M13 Reverse oligonucleotide primer 0.1 μg/μl Control Template 0.1 μg/μl Control PCR oligonucleotide primers Water One Shot® TOP10 Competent Cells (Life Technology, cat. no. C404003) including: S.O.C.

    Agarose Gel Electrophoresis:

    Article Title: Dynamic Methylation of an L1 Transduction Family during Reprogramming and Neurodifferentiation
    Article Snippet: The desired fragments were resolved in a 2% agarose gel (1× TAE buffer), purified, and ligated into a pCEP4 vector using T4 ligase in a 5:1 (insert/vector) ratio. .. Five microliters of the ligation product was used to transform One Shot TOP10 chemically competent bacteria (C404010; Invitrogen) as per the manufacturer’s instructions.

    Electrophoresis:

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Selection:

    Article Title: Replication Study: Melanoma genome sequencing reveals frequent PREX2 mutations
    Article Snippet: .. Stable cell generation: Lentivirus production, cell infection, and selection Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen Cat# C737303) (lentiviral plasmids: GFP, PREX2WT , PREX2G844D , or PREX2Q1430* ; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]) or One Shot TOP10 Chemically Competent E. coli (Invitrogen Cat# C404003) (packaging plasmids: pMD2-Gag/Pol, pMD2 VSVG, or pRSV REV; [Dr. Yonathan Lissanu Deribe, MD Anderson Cancer Center]). .. Clones were selected, grown in larger cultures, and DNA isolated with the GenElute Endotoxin-free Plasmid Maxiprep Kit (Sigma-Aldrich Cat# PLEX15-1KT).

    Article Title: Split intein-mediated selection of cells containing two plasmids using a single antibiotic
    Article Snippet: .. Bacterial selection with hygromycin and puromycin E. coli TOP10 cells (Thermo Fisher Scientific C4040-03) were grown on low-salt LB agar-plates containing 100 μg/mL hygromycin. .. For puromycin, we used low-salt LB agar-plates adjusted to pH 8 using Tris with a final concentration of 50 mM containing 50 μg/mL puromycin.

    Concentration Assay:

    Article Title: Split intein-mediated selection of cells containing two plasmids using a single antibiotic
    Article Snippet: Bacterial selection with hygromycin and puromycin E. coli TOP10 cells (Thermo Fisher Scientific C4040-03) were grown on low-salt LB agar-plates containing 100 μg/mL hygromycin. .. For puromycin, we used low-salt LB agar-plates adjusted to pH 8 using Tris with a final concentration of 50 mM containing 50 μg/mL puromycin.

    Gel Extraction:

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: It was amplified by Phusion HF DNA polymerase (M0530L) and purified by the QIAquick PCR Purification Kit (#28106) and QIA gel Extraction kit (#28706). .. Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Article Title: Identification of Beta-2 as a Key Cell Adhesion Molecule in PCa Cell Neurotropic Behavior: A Novel Ex Vivo and Biophysical Approach
    Article Snippet: Clones were selected via 100 µg/mL Kanamycin in LB Broth, sequence confirmed, and amplified in TOP10 E. coli (Invitrogen, C404010, Carlsbad, CA). .. Linearized pcDNA 3.1 myc-His A was phosphatase treated using calf intestinal alkaline phosphatase (CIAP) (Invitrogen, 18009-019, Grand Island, NY), phenol/chloroform extracted, and ethanol precipitated while newly digested beta-2 constructs were gel purified from 0.8% agarose using a PureLink Gel Extraction Kit (Invitrogen, K2100-12) and ethanol precipitated.

    Article Title: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning
    Article Snippet: PCR products were examined in 2% EtBr agarose gels, the specific bands were cut from the gel, and purified using QIAquick Gel Extraction Kit (Qiagen, Cat. 28706). .. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates.

    Article Title: A critical analysis of the role of SNARE protein SEC22B in antigen cross-presentation
    Article Snippet: .. Reaction products were analyzed by electrophoresis, then were gel purified (Qiagen Gel Extraction Kit, 28104), ligated to TOPO vector (Invitrogen, K2400-200) following manufacturer’s instructions, and transformed into TOP10 chemically competent cells (Invitrogen, C404010). .. Site-directed mutagenesis was performed using AccuPrime Pfx Polymerase and 5′-TACAGTTTTATTGAGTTTGATACCTTCATTCAGAAA-3′ and 5′-TGGACGGCTAACAG TGGGCACCTTCTTC-3′ primers in order to induce silent mutations at the site of shRNA 89 and 90 binding.

    Molecular Cloning:

    Article Title: Clinical and in vitro analysis of Osteopontin as a prognostic indicator and unveil its potential downstream targets in bladder cancer
    Article Snippet: Paragraph title: Molecular cloning and gene transient transfection ... Transformation was performed with competent E. coli cells (One Shot Top10, #C404003, Thermofisher).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher topo ta cloning kit
    Topo Ta Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4523 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/topo ta cloning kit/product/Thermo Fisher
    Average 90 stars, based on 4523 article reviews
    Price from $9.99 to $1999.99
    topo ta cloning kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher one shot top10 chemically competent e coli
    One Shot Top10 Chemically Competent E Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one shot top10 chemically competent e coli/product/Thermo Fisher
    Average 90 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    one shot top10 chemically competent e coli - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    MultiShot StripWell TOP10 chemically competent E coli cells are cloning competent cells that packaged in a rack containing 12 strips of 8 tubes to increase productivity for medium throughput bacterial
      Buy from Supplier

    Image Search Results