Structured Review

Stratagene e coli strain bl21 gold
E Coli Strain Bl21 Gold, supplied by Stratagene, used in various techniques. Bioz Stars score: 87/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli strain bl21 gold/product/Stratagene
Average 87 stars, based on 4 article reviews
Price from $9.99 to $1999.99
e coli strain bl21 gold - by Bioz Stars, 2020-01
87/100 stars

Images

Related Articles

Transduction:

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: .. A derivative of E. coli strain BL21-gold (Stratagene) was constructed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. ..

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: .. Protein Expression Mutant IMDHs were over-expressed from plasmids in a derivative of E. coli strain BL21-gold (Stratagene) formed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. .. Transformed cells were grown overnight at 37°C in 5 mL of LB containing ampicillin (100 µg/ml) and 0.2 mM IPTG.

Clone Assay:

Article Title: Interaction of FUN14 domain containing 1, a mitochondrial outer membrane protein, with kinesin light chain 1 via the tetratricopeptide repeat domain
Article Snippet: cDNA encoding the full-length FUNDC1 was cloned into pET41a. .. The recombinant GST-FUNDC1 fusion protein was expressed in E. coli strain BL21 GOLD (Stratagene, La Jolla, CA, USA) following induction with 0.5 mM isopropyl thio-β-D-galactopyranoside (IPTG) for 3 h. The fusion proteins were purified by attachment to glutathione-agarose beads (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's protocol.

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: The GFP sequence (Clontech) was inserted into pOPINE backbone by using infusion cloning, which resulted in addition of MA(H)6 SSGGS peptide to the N-terminus of GFP. .. Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium.

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: .. This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene). ..

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: The resulting PCR products were inserted into the pPCR-Script Amp SK+ plasmid (Stratagene, La Jolla, CA) by using a PCR Script Amp cloning kit (Stratagene). .. Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene).

Centrifugation:

Article Title: Interaction of FUN14 domain containing 1, a mitochondrial outer membrane protein, with kinesin light chain 1 via the tetratricopeptide repeat domain
Article Snippet: The recombinant GST-FUNDC1 fusion protein was expressed in E. coli strain BL21 GOLD (Stratagene, La Jolla, CA, USA) following induction with 0.5 mM isopropyl thio-β-D-galactopyranoside (IPTG) for 3 h. The fusion proteins were purified by attachment to glutathione-agarose beads (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's protocol. .. The beads were pelleted by centrifugation, washed three times with the extraction buffer [1% Triton X-100 in phosphate-buffered saline (PBS) containing 10 µg/ml each of aprotinin, leupeptin, and pepstatin and 1 µM phenylmethanesulfonyl fluoride], and once with PBS.

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: Protein Expression Mutant IMDHs were over-expressed from plasmids in a derivative of E. coli strain BL21-gold (Stratagene) formed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. .. Following centrifugation, cells were resuspended in 1 mL of BD TALON xTractor Buffer (Becton-Dickenson).

Article Title: The Carboxy-Terminal Region of the Human Immunodeficiency Virus Type 1 Protein Rev Has Multiple Roles in Mediating CRM1-Related Rev Functions
Article Snippet: The expression of recombinant zz-Rev protein was induced by 0.5 mM isopropyl-β- d -thiogalactopyranoside for 15 h at 20°C in the Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene). .. E. coli cells were lysed in buffer A (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM MgCl2 , 2 mM dithiothreitol, and 1 μg each of aprotinin, leupeptin, and pepstatin per ml) with a French press after three freeze-thaw cycles and clarified by centrifugation (100,000 × g , 1 h).

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium. .. Further fermentation was carried out at 20°C for 20 h. Resultant cell mass was harvested by centrifugation, disrupted using a fluidizer (Constant Systems, UK), and subjected to centrifugation to remove cell debris.

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside. .. After centrifugation, supernatants were applied to glutathione–Sepharose 4B (Amersham Pharmacia Biotech).

Amplification:

Article Title: Tay1 Protein, a Novel Telomere Binding Factor from Yarrowia lipolytica *
Article Snippet: Y. lipolytica E129 (MAT A, lys11-23 , leu2-270 , ura3-302 , xpr2-322 ) provided by C. Gaillardin (Institut National de la Recherche Agronomique, Grignon, France) was used as the source of genomic DNA for amplification of the TAY1 coding sequence. .. Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene) was used for production of recombinant Tay1–6HN protein.

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: To produce a protein corresponding to the N-terminal 394 amino acids of CupA, the cupA cDNA in SLA649 was amplified by the PCR ( ) using the sense primer cupA-S, 5′-GCGGCGGC CATATG ATAAATATTGAAGAT-3′ with an Nde I site, and the antisense primer cupA-AS, 5′-CGC GGATCC AAACGGACATTGATTGC-3′ with a Bam HI site. .. This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene).

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: These plasmids were amplified and then digested with the appropriate restriction enzymes, and the inserts were ligated into the matching sites of the pET30 and pQE30 vectors, resulting in inserts with the correct orientation and position of the His tag. .. Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene).

Synthesized:

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: Open Biosystems, Inc. synthesized the oligopeptide HLIPRDALNRMFEM corresponding to the 14 c-terminal amino acids of PRV VP16, which is rich in hydrophilic amino acids and has low sequence homology to HSV VP16. .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Construct:

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: .. A derivative of E. coli strain BL21-gold (Stratagene) was constructed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. ..

Article Title: The Structure of NtdA, a Sugar Aminotransferase Involved in the Kanosamine Biosynthetic Pathway in Bacillus subtilis, Reveals a New Subclass of Aminotransferases *
Article Snippet: .. N-terminally His6 -tagged NtdA was overexpressed in E. coli strain BL21-Gold(DE3) (Stratagene) containing the pET28b- NtdA overexpression construct and purified to homogeneity by Ni2+ affinity chromatography as described previously ( ). .. NtdA was concentrated to 5 mg/ml in 25 m m Tris (pH 8.5) and 0.15 m NaCl for crystallization.

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: .. Protein Expression Mutant IMDHs were over-expressed from plasmids in a derivative of E. coli strain BL21-gold (Stratagene) formed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. .. Transformed cells were grown overnight at 37°C in 5 mL of LB containing ampicillin (100 µg/ml) and 0.2 mM IPTG.

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: To construct pCR3.1-HA–FIH-1(126–349), a PCR product was generated from template pCR3.1-HA–FIH-1 (primers: 5′-CGGACCATGGCTTAC CCATACGATGTTCCAGATTACGCTTACAGTGCCAGCACC CACAA-3′ and 5′-TACTAGCGCTTGGAGTCTCCTGTCC TCATC-3′) and ligated into pCR3.1. .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside.

Incubation:

Article Title: Interaction of FUN14 domain containing 1, a mitochondrial outer membrane protein, with kinesin light chain 1 via the tetratricopeptide repeat domain
Article Snippet: The recombinant GST-FUNDC1 fusion protein was expressed in E. coli strain BL21 GOLD (Stratagene, La Jolla, CA, USA) following induction with 0.5 mM isopropyl thio-β-D-galactopyranoside (IPTG) for 3 h. The fusion proteins were purified by attachment to glutathione-agarose beads (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's protocol. .. Purified His-tagged KLC1 protein was incubated overnight at 4°C with the glutathione beads coupled with GST alone or GST-FUNDC1 protein.

Article Title: Nup50/Npap60 function in nuclear protein import complex disassembly and importin recycling
Article Snippet: GST-mouse Nup50 (residues 1–109) and untagged mouse importin-α (residues 70–529) were expressed in Escherichia coli strain BL21-Gold(DE3) (Stratagene) at 20°C overnight from pGEX-TEV ( ) and pET30a (Novagen), respectively. .. Tween20 was added to 0.1%, and the clarified lysates were incubated with glutathione-Sepharose (Amersham) overnight.

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene). .. Therefore, to prepare the CupA-N antigen, sonicates of E. coli cells expressing the protein were incubated on ice for 2 h with a mixture of detergents and then washed repeatedly in PBS as described earlier ( ).

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ]. .. The resulting supernatants were incubated with Glutathione-Sepharose beads (GE Healthcare), which had been previously washed twice in PBS.

Expressing:

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: .. Protein Expression Mutant IMDHs were over-expressed from plasmids in a derivative of E. coli strain BL21-gold (Stratagene) formed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. .. Transformed cells were grown overnight at 37°C in 5 mL of LB containing ampicillin (100 µg/ml) and 0.2 mM IPTG.

Article Title: The Carboxy-Terminal Region of the Human Immunodeficiency Virus Type 1 Protein Rev Has Multiple Roles in Mediating CRM1-Related Rev Functions
Article Snippet: .. The expression of recombinant zz-Rev protein was induced by 0.5 mM isopropyl-β- d -thiogalactopyranoside for 15 h at 20°C in the Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene). .. E. coli cells were lysed in buffer A (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM MgCl2 , 2 mM dithiothreitol, and 1 μg each of aprotinin, leupeptin, and pepstatin per ml) with a French press after three freeze-thaw cycles and clarified by centrifugation (100,000 × g , 1 h).

Article Title: Characterization of Cg10062 from Corynebacterium glutamicum: Implications for the Evolution of cis-3-Chloroacrylic Acid Dehalogenase Activity in the Tautomerase Superfamily †
Article Snippet: .. Escherichia coli strain BL21-Gold(DE3) (Stratagene, La Jolla, CA) was used in combination with the T7 expression system (pET3b vector) for expression of wild-type Cg10062 and the four mutants (P1A, R70A, R73A, and E114Q). ..

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: .. Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium. .. The cell culture was propagated to OD600 0.5 at 37°C, and then, protein synthesis was induced by 0.5 mM of IPTG.

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: .. This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene). ..

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: Paragraph title: Expression of GTR in Escherichia coli cells. ... Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene).

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside. .. Pelleted cells were lysed by sonication in PBS containing 1% Triton X-100 and Complete protease inhibitor cocktail (Roche).

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ]. .. The resulting supernatants were incubated with Glutathione-Sepharose beads (GE Healthcare), which had been previously washed twice in PBS.

Western Blot:

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: The band was not apparent in uninfected or in HSV-infected samples , nor was it present in Western blots with pre-immune serum (data not shown). .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Crystallization Assay:

Article Title: The Structure of NtdA, a Sugar Aminotransferase Involved in the Kanosamine Biosynthetic Pathway in Bacillus subtilis, Reveals a New Subclass of Aminotransferases *
Article Snippet: N-terminally His6 -tagged NtdA was overexpressed in E. coli strain BL21-Gold(DE3) (Stratagene) containing the pET28b- NtdA overexpression construct and purified to homogeneity by Ni2+ affinity chromatography as described previously ( ). .. NtdA was concentrated to 5 mg/ml in 25 m m Tris (pH 8.5) and 0.15 m NaCl for crystallization.

Article Title: Nup50/Npap60 function in nuclear protein import complex disassembly and importin recycling
Article Snippet: Paragraph title: Preparation of importin- α :Nup50 complex for crystallization ... GST-mouse Nup50 (residues 1–109) and untagged mouse importin-α (residues 70–529) were expressed in Escherichia coli strain BL21-Gold(DE3) (Stratagene) at 20°C overnight from pGEX-TEV ( ) and pET30a (Novagen), respectively.

Over Expression:

Article Title: The Structure of NtdA, a Sugar Aminotransferase Involved in the Kanosamine Biosynthetic Pathway in Bacillus subtilis, Reveals a New Subclass of Aminotransferases *
Article Snippet: .. N-terminally His6 -tagged NtdA was overexpressed in E. coli strain BL21-Gold(DE3) (Stratagene) containing the pET28b- NtdA overexpression construct and purified to homogeneity by Ni2+ affinity chromatography as described previously ( ). .. NtdA was concentrated to 5 mg/ml in 25 m m Tris (pH 8.5) and 0.15 m NaCl for crystallization.

Transformation Assay:

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: Protein Expression Mutant IMDHs were over-expressed from plasmids in a derivative of E. coli strain BL21-gold (Stratagene) formed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. .. Transformed cells were grown overnight at 37°C in 5 mL of LB containing ampicillin (100 µg/ml) and 0.2 mM IPTG.

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: .. This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene). ..

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: .. Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene). .. BL21-Gold was also used for expression of pET30- hemA .

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside. .. Pelleted cells were lysed by sonication in PBS containing 1% Triton X-100 and Complete protease inhibitor cocktail (Roche).

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ]. .. The resulting supernatants were incubated with Glutathione-Sepharose beads (GE Healthcare), which had been previously washed twice in PBS.

Chromatography:

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium. .. The cleared cell lysate was subjected to IMAC chromatography (HisTrap FF column) followed by size-exclusion fractionation (Superdex 75) using an Akta Purifier FPLC system (GE Healthcare).

Protease Inhibitor:

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside. .. Pelleted cells were lysed by sonication in PBS containing 1% Triton X-100 and Complete protease inhibitor cocktail (Roche).

Low Copy Number:

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene). .. This strain contains pREP4, a low-copy-number plasmid which confers kanamycin resistance and expresses the lac repressor protein encoded by the lac1 gene.

Cell Culture:

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium. .. The cell culture was propagated to OD600 0.5 at 37°C, and then, protein synthesis was induced by 0.5 mM of IPTG.

Generated:

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: To construct pCR3.1-HA–FIH-1(126–349), a PCR product was generated from template pCR3.1-HA–FIH-1 (primers: 5′-CGGACCATGGCTTAC CCATACGATGTTCCAGATTACGCTTACAGTGCCAGCACC CACAA-3′ and 5′-TACTAGCGCTTGGAGTCTCCTGTCC TCATC-3′) and ligated into pCR3.1. .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside.

Sequencing:

Article Title: Tay1 Protein, a Novel Telomere Binding Factor from Yarrowia lipolytica *
Article Snippet: Y. lipolytica E129 (MAT A, lys11-23 , leu2-270 , ura3-302 , xpr2-322 ) provided by C. Gaillardin (Institut National de la Recherche Agronomique, Grignon, France) was used as the source of genomic DNA for amplification of the TAY1 coding sequence. .. Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene) was used for production of recombinant Tay1–6HN protein.

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: The GFP sequence (Clontech) was inserted into pOPINE backbone by using infusion cloning, which resulted in addition of MA(H)6 SSGGS peptide to the N-terminus of GFP. .. Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium.

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: The expression plasmid pGEX-5X-1-FIH-1 was constructed by insertion of a Bgl II– Eco RI fragment from pACT II-FIH-1 into Bam HI- and Eco RI-digested pGEX-5X-1. pCR3.1-HA–FIH-1 was constructed by insertion of PCR-amplified HA–FIH-1 DNA sequence into pCR3.1. .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside.

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: Open Biosystems, Inc. synthesized the oligopeptide HLIPRDALNRMFEM corresponding to the 14 c-terminal amino acids of PRV VP16, which is rich in hydrophilic amino acids and has low sequence homology to HSV VP16. .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Sonication:

Article Title: Nup50/Npap60 function in nuclear protein import complex disassembly and importin recycling
Article Snippet: GST-mouse Nup50 (residues 1–109) and untagged mouse importin-α (residues 70–529) were expressed in Escherichia coli strain BL21-Gold(DE3) (Stratagene) at 20°C overnight from pGEX-TEV ( ) and pET30a (Novagen), respectively. .. After harvesting, the two sets of cells were mixed, suspended in PBS, 1 mM EDTA, 2 mM DTT, 1 mM Pefabloc, and lysed by sonication on ice.

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside. .. Pelleted cells were lysed by sonication in PBS containing 1% Triton X-100 and Complete protease inhibitor cocktail (Roche).

Injection:

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: The purified synthetic peptide was injected into rabbits and the resulting serum was evaluated for its specificity to PRV VP16 ( ). .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Recombinant:

Article Title: Interaction of FUN14 domain containing 1, a mitochondrial outer membrane protein, with kinesin light chain 1 via the tetratricopeptide repeat domain
Article Snippet: .. The recombinant GST-FUNDC1 fusion protein was expressed in E. coli strain BL21 GOLD (Stratagene, La Jolla, CA, USA) following induction with 0.5 mM isopropyl thio-β-D-galactopyranoside (IPTG) for 3 h. The fusion proteins were purified by attachment to glutathione-agarose beads (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's protocol. .. Purified His-tagged KLC1 protein was incubated overnight at 4°C with the glutathione beads coupled with GST alone or GST-FUNDC1 protein.

Article Title: Tay1 Protein, a Novel Telomere Binding Factor from Yarrowia lipolytica *
Article Snippet: .. Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene) was used for production of recombinant Tay1–6HN protein. .. ) were synthesized by MWG Operon or Metabion.

Article Title: The Carboxy-Terminal Region of the Human Immunodeficiency Virus Type 1 Protein Rev Has Multiple Roles in Mediating CRM1-Related Rev Functions
Article Snippet: .. The expression of recombinant zz-Rev protein was induced by 0.5 mM isopropyl-β- d -thiogalactopyranoside for 15 h at 20°C in the Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene). .. E. coli cells were lysed in buffer A (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM MgCl2 , 2 mM dithiothreitol, and 1 μg each of aprotinin, leupeptin, and pepstatin per ml) with a French press after three freeze-thaw cycles and clarified by centrifugation (100,000 × g , 1 h).

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: .. Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene). .. BL21-Gold was also used for expression of pET30- hemA .

Molecular Weight:

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: Results indicate that the antibody specifically recognizes an approximately 53kDa protein in the PRV-infected samples, equivalent in size to the predicted molecular weight of PRV VP16. .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Mutagenesis:

Article Title: Pervasive Cryptic Epistasis in Molecular Evolution
Article Snippet: .. Protein Expression Mutant IMDHs were over-expressed from plasmids in a derivative of E. coli strain BL21-gold (Stratagene) formed by P1 transduction of the ΔleuB-leuC::kanr construct from strain JW5807. .. Transformed cells were grown overnight at 37°C in 5 mL of LB containing ampicillin (100 µg/ml) and 0.2 mM IPTG.

Purification:

Article Title: The Structure of NtdA, a Sugar Aminotransferase Involved in the Kanosamine Biosynthetic Pathway in Bacillus subtilis, Reveals a New Subclass of Aminotransferases *
Article Snippet: .. N-terminally His6 -tagged NtdA was overexpressed in E. coli strain BL21-Gold(DE3) (Stratagene) containing the pET28b- NtdA overexpression construct and purified to homogeneity by Ni2+ affinity chromatography as described previously ( ). .. NtdA was concentrated to 5 mg/ml in 25 m m Tris (pH 8.5) and 0.15 m NaCl for crystallization.

Article Title: Interaction of FUN14 domain containing 1, a mitochondrial outer membrane protein, with kinesin light chain 1 via the tetratricopeptide repeat domain
Article Snippet: .. The recombinant GST-FUNDC1 fusion protein was expressed in E. coli strain BL21 GOLD (Stratagene, La Jolla, CA, USA) following induction with 0.5 mM isopropyl thio-β-D-galactopyranoside (IPTG) for 3 h. The fusion proteins were purified by attachment to glutathione-agarose beads (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's protocol. .. Purified His-tagged KLC1 protein was incubated overnight at 4°C with the glutathione beads coupled with GST alone or GST-FUNDC1 protein.

Article Title: The Carboxy-Terminal Region of the Human Immunodeficiency Virus Type 1 Protein Rev Has Multiple Roles in Mediating CRM1-Related Rev Functions
Article Snippet: Paragraph title: Expression and purification of recombinant proteins. ... The expression of recombinant zz-Rev protein was induced by 0.5 mM isopropyl-β- d -thiogalactopyranoside for 15 h at 20°C in the Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene).

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: Paragraph title: Protein expression and purification ... Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium.

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: The purified synthetic peptide was injected into rabbits and the resulting serum was evaluated for its specificity to PRV VP16 ( ). .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Polymerase Chain Reaction:

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: To produce a protein corresponding to the N-terminal 394 amino acids of CupA, the cupA cDNA in SLA649 was amplified by the PCR ( ) using the sense primer cupA-S, 5′-GCGGCGGC CATATG ATAAATATTGAAGAT-3′ with an Nde I site, and the antisense primer cupA-AS, 5′-CGC GGATCC AAACGGACATTGATTGC-3′ with a Bam HI site. .. This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene).

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: The resulting PCR products were inserted into the pPCR-Script Amp SK+ plasmid (Stratagene, La Jolla, CA) by using a PCR Script Amp cloning kit (Stratagene). .. Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene).

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: To construct pCR3.1-HA–FIH-1(126–349), a PCR product was generated from template pCR3.1-HA–FIH-1 (primers: 5′-CGGACCATGGCTTAC CCATACGATGTTCCAGATTACGCTTACAGTGCCAGCACC CACAA-3′ and 5′-TACTAGCGCTTGGAGTCTCCTGTCC TCATC-3′) and ligated into pCR3.1. .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside.

Affinity Chromatography:

Article Title: The Structure of NtdA, a Sugar Aminotransferase Involved in the Kanosamine Biosynthetic Pathway in Bacillus subtilis, Reveals a New Subclass of Aminotransferases *
Article Snippet: .. N-terminally His6 -tagged NtdA was overexpressed in E. coli strain BL21-Gold(DE3) (Stratagene) containing the pET28b- NtdA overexpression construct and purified to homogeneity by Ni2+ affinity chromatography as described previously ( ). .. NtdA was concentrated to 5 mg/ml in 25 m m Tris (pH 8.5) and 0.15 m NaCl for crystallization.

Fast Protein Liquid Chromatography:

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium. .. The cleared cell lysate was subjected to IMAC chromatography (HisTrap FF column) followed by size-exclusion fractionation (Superdex 75) using an Akta Purifier FPLC system (GE Healthcare).

Chromatin Immunoprecipitation:

Article Title: Tay1 Protein, a Novel Telomere Binding Factor from Yarrowia lipolytica *
Article Snippet: Y. lipolytica PO1h ( ura3 ), provided by C. Madzak (Institut National de la Recherche Agronomique, Thiverval-Grignon, France), was used for ChIP experiments. .. Escherichia coli strain BL21-Gold(DE3)pLysS (Stratagene) was used for production of recombinant Tay1–6HN protein.

SDS Page:

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: Cell lysates and cell cytosol from PRV-infected and uninfected RK13 cells as well as cell cytosol from HSV-infected and -uninfected COS cells (prepared as described below) were resolved by 10% SDS-PAGE, and Western blotted with the anti-PRV VP16 antisera. .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ].

Plasmid Preparation:

Article Title: Characterization of Cg10062 from Corynebacterium glutamicum: Implications for the Evolution of cis-3-Chloroacrylic Acid Dehalogenase Activity in the Tautomerase Superfamily †
Article Snippet: .. Escherichia coli strain BL21-Gold(DE3) (Stratagene, La Jolla, CA) was used in combination with the T7 expression system (pET3b vector) for expression of wild-type Cg10062 and the four mutants (P1A, R70A, R73A, and E114Q). ..

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: The amino acid sequence of GFP-nanobody (VH H domain cAbGFP4 ) was reverse translated into genetic code optimized for E. coli -specific codon usage and cloned into pOPINE vector using NcoI/PmeI nucleases, giving the nanobody sequence with a C-terminal his-tag (Epochbiolab, USA). .. Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium.

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: .. This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene). ..

Article Title: Glutamyl-tRNA Reductase of Chlorobium vibrioforme Is a Dissociable Homodimer That Contains One Tightly Bound Heme per Subunit
Article Snippet: The resulting PCR products were inserted into the pPCR-Script Amp SK+ plasmid (Stratagene, La Jolla, CA) by using a PCR Script Amp cloning kit (Stratagene). .. Both recombinant plasmids were transformed into E. coli strain BL21-Gold (Stratagene).

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: .. To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside. .. Pelleted cells were lysed by sonication in PBS containing 1% Triton X-100 and Complete protease inhibitor cocktail (Roche).

Binding Assay:

Article Title: Pseudorabies Virus and Herpes Simplex Virus type 1 utilize different tegument-glycoprotein interactions to mediate the process of envelopment
Article Snippet: .. To perform the binding assay, plasmids expressing either GST alone, or GST fusion proteins with either PRV or HSV gH tails were transformed into the Escherichia coli strain BL21 Gold (Stratagene) and bacterial extracts were prepared as previously described [ ]. .. The resulting supernatants were incubated with Glutathione-Sepharose beads (GE Healthcare), which had been previously washed twice in PBS.

In Vitro:

Article Title: FIH-1: a novel protein that interacts with HIF-1? and VHL to mediate repression of HIF-1 transcriptional activity
Article Snippet: Paragraph title: In vitro interaction (GST pull-down) assays ... To prepare GST fusion proteins, E. coli strain BL21-Gold(DE3)pLysS (Stratagene) was transformed with a pGEX expression vector and treated for 4 h with 0.5 mM isopropyl-D-thiogalactoside.

Fractionation:

Article Title: Structural and thermodynamic analysis of the GFP:GFP-nanobody complex
Article Snippet: Protein expression was conducted in E. coli strain BL21-GOLD (Stratagene) in LB medium. .. The cleared cell lysate was subjected to IMAC chromatography (HisTrap FF column) followed by size-exclusion fractionation (Superdex 75) using an Akta Purifier FPLC system (GE Healthcare).

Staining:

Article Title: The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development
Article Snippet: This cDNA fragment (∼1.2 kb) was cloned into the Nde I/ Bam HI site of the E. coli expression vector pET15b (Novagen), selected by transformation into E. coli strain DH5α, and then introduced into E. coli strain BL21-gold(DE3) (Stratagene). .. About 200 μg of protein was fractionated on a sodium dodecyl sulfate (SDS)-10% polyacrylamide gel and stained with Coomassie blue, and the major band was excised and homogenized in 130 mM NaCl-6 mM Na2 PO4 /KH2 PO4 (pH 6.9) (PBS).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 81
    Stratagene e coli strain bl21 de3 gold
    Expression in whole cell lysates: (A) Growth in an automated plate reader of E. coli <t>BL21</t> (DE3) <t>Gold</t> expressing 48 different pBAD constructs (left panel) and 48 different pET constructs (Right panel). Arrows indicate time of induction. (B) Dot blot analysis
    E Coli Strain Bl21 De3 Gold, supplied by Stratagene, used in various techniques. Bioz Stars score: 81/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain bl21 de3 gold/product/Stratagene
    Average 81 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    e coli strain bl21 de3 gold - by Bioz Stars, 2020-01
    81/100 stars
      Buy from Supplier

    77
    Stratagene e coli strains bl21 de3 gold
    Expression in whole cell lysates: (A) Growth in an automated plate reader of E. coli <t>BL21</t> (DE3) <t>Gold</t> expressing 48 different pBAD constructs (left panel) and 48 different pET constructs (Right panel). Arrows indicate time of induction. (B) Dot blot analysis
    E Coli Strains Bl21 De3 Gold, supplied by Stratagene, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strains bl21 de3 gold/product/Stratagene
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli strains bl21 de3 gold - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    99
    Stratagene bl21 gold
    Optimization of expression conditions and screening background. (A) Colonies of E . coli <t>BL21</t> transformed with TN-XXL cloned into the vector pRSETB (exposure time 4s, gain 2x, binning 1). Scale bar, 10 mm (B) Colonies of E . coli XL1 transformed with TN-XXL cloned into pRSETB and imaged under the same conditions. (C) Mean fluorescence intensities ± SD of colonies transformed with TN-XXL in either BL1 or XL1, imaged under identical conditions (n BL21 = 312, n XL1 = 558). (D) ΔR/R ± SD of E . coli colonies expressing TN-XXL cloned into BL21 or XL1 (n BL21 = 19, n XL1 = 15). (E) Auto-fluorescence of agar plate versus white blotting paper imaged under identical conditions with filters used for FRET imaging. Error bars indicate SD. (F) Basal ratio valuesR 0 ± SD of XL1 colonies transformed with the FRET sensor TN-XXL and imaged on agar plate or on filter paper. (n plate = 149 colonies, n blotting paper = 90 colonies) (G) ΔR/R ± SD of the same colonies following calcium application.
    Bl21 Gold, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 gold/product/Stratagene
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    bl21 gold - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Expression in whole cell lysates: (A) Growth in an automated plate reader of E. coli BL21 (DE3) Gold expressing 48 different pBAD constructs (left panel) and 48 different pET constructs (Right panel). Arrows indicate time of induction. (B) Dot blot analysis

    Journal: Journal of molecular biology

    Article Title: The funnel approach to the pre-crystallization production of membrane proteins

    doi: 10.1016/j.jmb.2007.12.059

    Figure Lengend Snippet: Expression in whole cell lysates: (A) Growth in an automated plate reader of E. coli BL21 (DE3) Gold expressing 48 different pBAD constructs (left panel) and 48 different pET constructs (Right panel). Arrows indicate time of induction. (B) Dot blot analysis

    Article Snippet: The initial expression studies for all clones utilized E. coli strain BL21 (DE3) GOLD™ (Stratagene).

    Techniques: Expressing, Construct, Positron Emission Tomography, Dot Blot

    Expression in whole cell lysates: (A) Growth in an automated plate reader of E. coli BL21 (DE3) Gold expressing 48 different pBAD constructs (left panel) and 48 different pET constructs (Right panel). Arrows indicate time of induction. (B) Dot blot analysis

    Journal: Journal of molecular biology

    Article Title: The funnel approach to the pre-crystallization production of membrane proteins

    doi: 10.1016/j.jmb.2007.12.059

    Figure Lengend Snippet: Expression in whole cell lysates: (A) Growth in an automated plate reader of E. coli BL21 (DE3) Gold expressing 48 different pBAD constructs (left panel) and 48 different pET constructs (Right panel). Arrows indicate time of induction. (B) Dot blot analysis

    Article Snippet: E. coli strains BL21 (DE3) GOLD and BL21(DE3)RIPL were from Stratagene.

    Techniques: Expressing, Construct, Positron Emission Tomography, Dot Blot

    Optimization of expression conditions and screening background. (A) Colonies of E . coli BL21 transformed with TN-XXL cloned into the vector pRSETB (exposure time 4s, gain 2x, binning 1). Scale bar, 10 mm (B) Colonies of E . coli XL1 transformed with TN-XXL cloned into pRSETB and imaged under the same conditions. (C) Mean fluorescence intensities ± SD of colonies transformed with TN-XXL in either BL1 or XL1, imaged under identical conditions (n BL21 = 312, n XL1 = 558). (D) ΔR/R ± SD of E . coli colonies expressing TN-XXL cloned into BL21 or XL1 (n BL21 = 19, n XL1 = 15). (E) Auto-fluorescence of agar plate versus white blotting paper imaged under identical conditions with filters used for FRET imaging. Error bars indicate SD. (F) Basal ratio valuesR 0 ± SD of XL1 colonies transformed with the FRET sensor TN-XXL and imaged on agar plate or on filter paper. (n plate = 149 colonies, n blotting paper = 90 colonies) (G) ΔR/R ± SD of the same colonies following calcium application.

    Journal: PLoS ONE

    Article Title: Large Scale Bacterial Colony Screening of Diversified FRET Biosensors

    doi: 10.1371/journal.pone.0119860

    Figure Lengend Snippet: Optimization of expression conditions and screening background. (A) Colonies of E . coli BL21 transformed with TN-XXL cloned into the vector pRSETB (exposure time 4s, gain 2x, binning 1). Scale bar, 10 mm (B) Colonies of E . coli XL1 transformed with TN-XXL cloned into pRSETB and imaged under the same conditions. (C) Mean fluorescence intensities ± SD of colonies transformed with TN-XXL in either BL1 or XL1, imaged under identical conditions (n BL21 = 312, n XL1 = 558). (D) ΔR/R ± SD of E . coli colonies expressing TN-XXL cloned into BL21 or XL1 (n BL21 = 19, n XL1 = 15). (E) Auto-fluorescence of agar plate versus white blotting paper imaged under identical conditions with filters used for FRET imaging. Error bars indicate SD. (F) Basal ratio valuesR 0 ± SD of XL1 colonies transformed with the FRET sensor TN-XXL and imaged on agar plate or on filter paper. (n plate = 149 colonies, n blotting paper = 90 colonies) (G) ΔR/R ± SD of the same colonies following calcium application.

    Article Snippet: We compared sensor response in a bacterial strain used for protein expression, BL21-Gold (Stratagene), and a strain used for cloning, XL1-Blue (Stratagene) ( ).

    Techniques: Expressing, Transformation Assay, Clone Assay, Plasmid Preparation, Fluorescence, Imaging