e coli rnase h  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Thermo Fisher e coli rnase h
    E Coli Rnase H, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli rnase h/product/Thermo Fisher
    Average 96 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    e coli rnase h - by Bioz Stars, 2020-04
    96/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: Target preparation and labeling For synthetic model systems, labeled targets were prepared from pairs of cDNA clones, each representing a wild-type form and a splice variant [also called : long form (LF) + short form (SF)]. .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol.

    Article Title: A Pair of Tabersonine 16-Hydroxylases Initiates the Synthesis of Vindoline in an Organ-Dependent Manner in Catharanthus roseus 1 1 [C] 1 [C] [W]
    Article Snippet: For cloning, extraction of total RNA from young leaves was performed using the NucleoSpin RNA Plant kit (Macherey-Nagel). .. Following , complementary RNA was removed by treatment with Escherichia coli RNase H (Invitrogen) for 20 min at 37°C.

    Centrifugation:

    Article Title: Stanniocalcin-1 Controls Ion Regulation Functions of Ion-transporting Epithelium Other than Calcium Balance
    Article Snippet: RNA pellets were precipitated by centrifugation at 4 °C and 12,000 xg for 30 min. Pellets were then washed with 70% alcohol, and stored at -20 °C until use. .. For cDNA synthesis, 5 μg of total RNA was reverse-transcribed in a final volume of 20 μL containing 0.5 mM dNTPs, 2.5 μM oligo(dT)20 , 250 ng of random primers, 5 mM dithiothreitol, 40 units of an RNase inhibitor, and 200 units of PowerScript reverse transcriptase (Invitrogen) for 30 min at 50 °C, followed by incubation at 70 °C for 15 min. Twenty units of Escherichia coli RNase H (Invitrogen) were added to remove the remnant RNA in a 20-min incubation at 37 °C.

    Amplification:

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen). .. After a second cycle of amplification and biotin labeling with a BioArray high-yield RNA transcript labeling kit (Enzo Diagnostics, Farmingdale, NY), 20 μg of labeled cRNA was fragmented.

    Article Title: Premature termination codons do not affect the rate of splicing of neighboring introns
    Article Snippet: .. RT reactions (10 μL) were incubated at 37°C for 15 min, then 55°C for 30 min, then 65°C for 30 min, and finally 85°C for 10 min. Escherichia coli RNase H (0.1 U/μL; Invitrogen) was added and the samples incubated at 37°C for 30 min. PCR was then performed using Platinum Taq polymerase (Invitrogen) in the buffer supplied adding 1.5 mM MgCl2 , 0.4 mM dNTPs, 200 nM unlabeled primers doped with 5′-radiolabeled forward primer (to label only one strand of the amplicon), and 7.5% (by volume) of reverse-transcribed cDNA. .. The PCR primers were complementary to sequences equidistant from and flanking each exon-intron boundary to yield PCR products of ~150 bp.

    Article Title: Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
    Article Snippet: Endogenous RNA and recRNA were co-reverse transcribed and amplified simultaneously. .. The reaction was terminated by rapid chilling on ice and by adding 4 U Escherichia coli RNase H (Invitrogen).

    Article Title: Quantitative analysis of mRNA amplification by in vitro transcription
    Article Snippet: Second-strand synthesis (SSS) was carried out in 150 µl with 40 U DNA polymerase I, 2 U Escherichia coli RNase H, and 10 U E.coli DNA ligase in 1× second-strand buffer (Life Technologies) simply by adding 130 µl of an ice-cold SSS premix to the heat inactivated, ice-cold 20 µl RT reaction and incubating at 15°C for 2 h ( ). .. Amplified antisense RNA (aRNA) was purified on paramagnetic beads (Bangs Laboratories).

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: For breast cell lines, brain and melanoma RNAs, labeling was performed using a standard amplification protocol. .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol.

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen). .. For the amplification of Tim-3 transcripts, primers were designed against the untranslated regions (UTRs): 5′-UTR (5′-GAGAGTTAAAACTGTGCCTAACAG-3′) and 3′-UTR (5′-CTCCAAAACCAGTCAGGTGACACA-3′) as previously described ( ).

    DNA Synthesis:

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol. .. Transcription of dsDNA was prepared in 20 μl at 37°C for 3 h using MEGAscript T7 Transcription kit (Ambion) (7.5 mM ATP, 7.5 mM CTP, 7.5 mM GTP, 3.75 mM UTP and 3.75 mM aaUTP).

    Positive Control:

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen). .. Cycling conditions were as follows: denaturation at 95°C for 60 s, annealing at 55°C for 30 s, extension at 72°C for 3 min for 35 cycles, and a final extension at 72°C for 10 min. Human Tim-3 parent vector containing the full mRNA transcript was used as a positive control for all PCR amplifications.

    Synthesized:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: Complementary deoxyribonucleic acid was synthesized using a SuperScript III First-Strand Synthesis System for reverse transcriptase–polymerase chain reaction (RT-PCR; Invitrogen Life Technologies, Carlsbad, CA). .. Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ).

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: .. Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen). .. From the double-strand cDNA, cRNA was prepared using aMEGAscript T7 kit (Ambion, Austin, TX).

    Article Title: A Pair of Tabersonine 16-Hydroxylases Initiates the Synthesis of Vindoline in an Organ-Dependent Manner in Catharanthus roseus 1 1 [C] 1 [C] [W]
    Article Snippet: First-strand was synthesized from 5 µg of total RNA using oligo(dT)18 primers (0.5 µ m ) and 15 units of Thermoscript reverse transcriptase (Invitrogen). .. Following , complementary RNA was removed by treatment with Escherichia coli RNase H (Invitrogen) for 20 min at 37°C.

    Quantitative RT-PCR:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: .. Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Amplifications of the complementary deoxyribonucleic acid samples were performed in triplicate in 96-well plates in a final volume of 20 μL at 40 PCR cycles consisting of a denaturation step at 95°C for 15 s and an anneal/extension step at 60°C for 1 min. Fluorescence measurements were used to generate a dissociation curve utilizing the system software program v1.4 (Applied Biosystems).

    Article Title: Premature termination codons do not affect the rate of splicing of neighboring introns
    Article Snippet: Paragraph title: Quantitative RT-PCR analyses ... RT reactions (10 μL) were incubated at 37°C for 15 min, then 55°C for 30 min, then 65°C for 30 min, and finally 85°C for 10 min. Escherichia coli RNase H (0.1 U/μL; Invitrogen) was added and the samples incubated at 37°C for 30 min. PCR was then performed using Platinum Taq polymerase (Invitrogen) in the buffer supplied adding 1.5 mM MgCl2 , 0.4 mM dNTPs, 200 nM unlabeled primers doped with 5′-radiolabeled forward primer (to label only one strand of the amplicon), and 7.5% (by volume) of reverse-transcribed cDNA.

    Article Title: Immunomodulatory Impact of Leishmania-Induced Macrophage Exosomes: A Comparative Proteomic and Functional Analysis
    Article Snippet: .. Samples were then treated with Escherichia coli RNase H (Invitrogen) for clearance of RNA-DNA helices. qRT-PCR was performed using Qiagen SABioscience RT2 profiler arrays in a Strategene mx3000 thermocycler according to SABiosciences protocol. .. Results were analyzed by ΔΔCt method using the Qiagen qRT-PCR data analysis web interface.

    Real-time Polymerase Chain Reaction:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: .. Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Amplifications of the complementary deoxyribonucleic acid samples were performed in triplicate in 96-well plates in a final volume of 20 μL at 40 PCR cycles consisting of a denaturation step at 95°C for 15 s and an anneal/extension step at 60°C for 1 min. Fluorescence measurements were used to generate a dissociation curve utilizing the system software program v1.4 (Applied Biosystems).

    Article Title: Immunomodulatory Impact of Leishmania-Induced Macrophage Exosomes: A Comparative Proteomic and Functional Analysis
    Article Snippet: Paragraph title: Quantitative real-time PCR (qRT-PCR) ... Samples were then treated with Escherichia coli RNase H (Invitrogen) for clearance of RNA-DNA helices. qRT-PCR was performed using Qiagen SABioscience RT2 profiler arrays in a Strategene mx3000 thermocycler according to SABiosciences protocol.

    Article Title: A Pair of Tabersonine 16-Hydroxylases Initiates the Synthesis of Vindoline in an Organ-Dependent Manner in Catharanthus roseus 1 1 [C] 1 [C] [W]
    Article Snippet: Following , complementary RNA was removed by treatment with Escherichia coli RNase H (Invitrogen) for 20 min at 37°C. .. For real-time PCR, total RNA was extracted from different C. roseus organs and cells with the RNeasy Plant mini kit (Qiagen) and treated (1.5 µg) with RQ1 RNase-free DNase (Promega) before being used for first-strand synthesis by priming with oligo(dT)18 (0.5 µ m ). was carried out using SuperScript III reverse transcriptase (Invitrogen) at 50°C.

    Microarray:

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: Paragraph title: High-Density Oligonucleotide Microarray Analysis ... Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen).

    Incubation:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: .. Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Amplifications of the complementary deoxyribonucleic acid samples were performed in triplicate in 96-well plates in a final volume of 20 μL at 40 PCR cycles consisting of a denaturation step at 95°C for 15 s and an anneal/extension step at 60°C for 1 min. Fluorescence measurements were used to generate a dissociation curve utilizing the system software program v1.4 (Applied Biosystems).

    Article Title: Premature termination codons do not affect the rate of splicing of neighboring introns
    Article Snippet: .. RT reactions (10 μL) were incubated at 37°C for 15 min, then 55°C for 30 min, then 65°C for 30 min, and finally 85°C for 10 min. Escherichia coli RNase H (0.1 U/μL; Invitrogen) was added and the samples incubated at 37°C for 30 min. PCR was then performed using Platinum Taq polymerase (Invitrogen) in the buffer supplied adding 1.5 mM MgCl2 , 0.4 mM dNTPs, 200 nM unlabeled primers doped with 5′-radiolabeled forward primer (to label only one strand of the amplicon), and 7.5% (by volume) of reverse-transcribed cDNA. .. The PCR primers were complementary to sequences equidistant from and flanking each exon-intron boundary to yield PCR products of ~150 bp.

    Article Title: Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
    Article Snippet: Sample solutions were incubated at 65°C for 10 min, 42°C for 50 min, and 70°C for 15 min. Fifty units of Superscript II reverse transcriptase was then added to each sample, and the samples were incubated at 42°C for 50 min and 70°C for 15 min. .. The reaction was terminated by rapid chilling on ice and by adding 4 U Escherichia coli RNase H (Invitrogen).

    Article Title: Quantitative analysis of mRNA amplification by in vitro transcription
    Article Snippet: The standard protocol for 10 µg amplifications employed a 20 µl reverse transcription (RT) reaction with 200 U SuperScript II (Life Technologies) and 0.5 µg (dT)-T7 primer1 [5′-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(T)24 ] in 1× first-strand buffer (Life Technologies) with a 50°C incubation. .. Second-strand synthesis (SSS) was carried out in 150 µl with 40 U DNA polymerase I, 2 U Escherichia coli RNase H, and 10 U E.coli DNA ligase in 1× second-strand buffer (Life Technologies) simply by adding 130 µl of an ice-cold SSS premix to the heat inactivated, ice-cold 20 µl RT reaction and incubating at 15°C for 2 h ( ).

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol. .. Transcription of dsDNA was prepared in 20 μl at 37°C for 3 h using MEGAscript T7 Transcription kit (Ambion) (7.5 mM ATP, 7.5 mM CTP, 7.5 mM GTP, 3.75 mM UTP and 3.75 mM aaUTP).

    Article Title: Stanniocalcin-1 Controls Ion Regulation Functions of Ion-transporting Epithelium Other than Calcium Balance
    Article Snippet: .. For cDNA synthesis, 5 μg of total RNA was reverse-transcribed in a final volume of 20 μL containing 0.5 mM dNTPs, 2.5 μM oligo(dT)20 , 250 ng of random primers, 5 mM dithiothreitol, 40 units of an RNase inhibitor, and 200 units of PowerScript reverse transcriptase (Invitrogen) for 30 min at 50 °C, followed by incubation at 70 °C for 15 min. Twenty units of Escherichia coli RNase H (Invitrogen) were added to remove the remnant RNA in a 20-min incubation at 37 °C. .. Real-time qRT-PCR was used to analyze expression of 4 transcripts: stc-1, stc-1 like , stc-2 , and stc-2 like . qRT-PCR was carried out using a Roche Lightcycler 480 (Roche, Penzberg, Germany).

    Expressing:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Signal levels were normalized to the expression of a constitutively expressed gene, glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ), and shown as a relative ratio.

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen). .. The RGU34A arrays were hybridized as described in the Gene Chip Expression Analysis Technical Manual (Affymetrix) and stained for use with a GeneArray scanner (Agilent Technologies, Palo Alto, CA).

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Paragraph title: Analysis of gene expression by reverse transcription-PCR. ... Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen).

    Modification:

    Article Title: O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins 1
    Article Snippet: Total RNA was isolated from roots, stems, leaves, and kernels of B73 using a modified cetyl-trimethyl-ammonium bromide procedure ( ). .. Escherichia coli RNase H (Invitrogen) was used to remove RNA complementary to cDNA before PCR.

    Article Title: Premature termination codons do not affect the rate of splicing of neighboring introns
    Article Snippet: The mouse B-cell hybridomas were grown in suspension in Dulbecco’s modified Eagle’s medium (Gibco-BRL) supplemented with 12% newborn calf serum (Gemini BioProducts), 110 mg/L sodium pyruvate (Gibco-BRL), and 10−5 M β-mercaptoethanol (Gibco-BRL). .. RT reactions (10 μL) were incubated at 37°C for 15 min, then 55°C for 30 min, then 65°C for 30 min, and finally 85°C for 10 min. Escherichia coli RNase H (0.1 U/μL; Invitrogen) was added and the samples incubated at 37°C for 30 min. PCR was then performed using Platinum Taq polymerase (Invitrogen) in the buffer supplied adding 1.5 mM MgCl2 , 0.4 mM dNTPs, 200 nM unlabeled primers doped with 5′-radiolabeled forward primer (to label only one strand of the amplicon), and 7.5% (by volume) of reverse-transcribed cDNA.

    Chromatography:

    Article Title: Quantitative analysis of mRNA amplification by in vitro transcription
    Article Snippet: Second-strand synthesis (SSS) was carried out in 150 µl with 40 U DNA polymerase I, 2 U Escherichia coli RNase H, and 10 U E.coli DNA ligase in 1× second-strand buffer (Life Technologies) simply by adding 130 µl of an ice-cold SSS premix to the heat inactivated, ice-cold 20 µl RT reaction and incubating at 15°C for 2 h ( ). .. For all other amplifications, cDNA synthesis volumes were different from those of the standard protocol above but reaction component concentrations, incubation times and temperatures were conserved except where noted. (dT)-T7 primer2 [GCATTAGCGGCCGCGAAATTAATACGACTCACTATAGGGAGA(T)21 V] was used; ds cDNA was polished with T4 DNA polymerase for 15 rather than 5 min and was purified by phenol–chloroform extraction followed by chromatography on a BioGel p-6 column [Bio-Rad; microcon-100s, PCR columns (Qiagen), dialysis and paramagnetic beads gave poor recovery of small amounts of cDNA] and precipitated with 20 µg glycogen; transcription reactions were either 40 µl [42°C, 9 h, 160 U T7 RNA polymerase (Promega), 3.0 mM GTP, 1.5 mM ATP, 1.2 mM UTP, 1.2 mM CTP, 0.4 mM bio-11-UTP, 0.4 mM bio-11-CTP, 1× Ampliscribe buffer (Epicentre)] or 20 µl [42°C, 9 h, 80 U T7 RNA polymerase (Promega), 7.5 mM NTP, 1× Ampliscribe buffer (Epicentre); for the first round of two round experiments]; and aRNA was purified in three washes on a microcon-100 (Millipore) both at the end and between rounds.

    Infection:

    Article Title: Immunomodulatory Impact of Leishmania-Induced Macrophage Exosomes: A Comparative Proteomic and Functional Analysis
    Article Snippet: Quantitative real-time PCR (qRT-PCR) J774 macrophages were left untreated, infected with stationary L. mexicana parasites at 1∶20 ratio, stimulated with 100 ng/ml of LPS or 5 µg/ml of exosomes for 8 h. Following stimulation, cells were washed with PBS, (3 times for infected cells) and were lysed in Tryzol reagent (Invitrogen) according to the manufacturer's instructions for RNA extraction. .. Samples were then treated with Escherichia coli RNase H (Invitrogen) for clearance of RNA-DNA helices. qRT-PCR was performed using Qiagen SABioscience RT2 profiler arrays in a Strategene mx3000 thermocycler according to SABiosciences protocol.

    Generated:

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: About 2 μg of corresponding cRNA was generated using in vitro transcription systems (T7 or SP6 Megascript kit; Ambion). .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol.

    Polymerase Chain Reaction:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Amplifications of the complementary deoxyribonucleic acid samples were performed in triplicate in 96-well plates in a final volume of 20 μL at 40 PCR cycles consisting of a denaturation step at 95°C for 15 s and an anneal/extension step at 60°C for 1 min. Fluorescence measurements were used to generate a dissociation curve utilizing the system software program v1.4 (Applied Biosystems).

    Article Title: O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins 1
    Article Snippet: .. Escherichia coli RNase H (Invitrogen) was used to remove RNA complementary to cDNA before PCR. .. Primers were designed to amplify cisZOG1 (but not cisZOG2 ) and cisZOG2 (but not cisZOG1 ).

    Article Title: Premature termination codons do not affect the rate of splicing of neighboring introns
    Article Snippet: .. RT reactions (10 μL) were incubated at 37°C for 15 min, then 55°C for 30 min, then 65°C for 30 min, and finally 85°C for 10 min. Escherichia coli RNase H (0.1 U/μL; Invitrogen) was added and the samples incubated at 37°C for 30 min. PCR was then performed using Platinum Taq polymerase (Invitrogen) in the buffer supplied adding 1.5 mM MgCl2 , 0.4 mM dNTPs, 200 nM unlabeled primers doped with 5′-radiolabeled forward primer (to label only one strand of the amplicon), and 7.5% (by volume) of reverse-transcribed cDNA. .. The PCR primers were complementary to sequences equidistant from and flanking each exon-intron boundary to yield PCR products of ~150 bp.

    Article Title: Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
    Article Snippet: The reaction was terminated by rapid chilling on ice and by adding 4 U Escherichia coli RNase H (Invitrogen). .. The cDNA samples were amplified with primers CYP2E1F and CYP2E1R in 25 μL PCR buffer (100 ng of each primer, 1 U Taq polymerase, 200 mM Tris-HCl, pH 8.4, 500 mM KCl, 50 mM MgCl2 , and 0.2 mM dNTP mixture), using the following PCR conditions: an initial denaturing step at 95°C for 5 min followed by 37 cycles of amplification that consisted of a denaturing step at 95°C for 30 sec, an annealing step at 56°C for 30 sec, and an extension step at 72°C for 30 sec.

    Article Title: Quantitative analysis of mRNA amplification by in vitro transcription
    Article Snippet: Second-strand synthesis (SSS) was carried out in 150 µl with 40 U DNA polymerase I, 2 U Escherichia coli RNase H, and 10 U E.coli DNA ligase in 1× second-strand buffer (Life Technologies) simply by adding 130 µl of an ice-cold SSS premix to the heat inactivated, ice-cold 20 µl RT reaction and incubating at 15°C for 2 h ( ). .. For all other amplifications, cDNA synthesis volumes were different from those of the standard protocol above but reaction component concentrations, incubation times and temperatures were conserved except where noted. (dT)-T7 primer2 [GCATTAGCGGCCGCGAAATTAATACGACTCACTATAGGGAGA(T)21 V] was used; ds cDNA was polished with T4 DNA polymerase for 15 rather than 5 min and was purified by phenol–chloroform extraction followed by chromatography on a BioGel p-6 column [Bio-Rad; microcon-100s, PCR columns (Qiagen), dialysis and paramagnetic beads gave poor recovery of small amounts of cDNA] and precipitated with 20 µg glycogen; transcription reactions were either 40 µl [42°C, 9 h, 160 U T7 RNA polymerase (Promega), 3.0 mM GTP, 1.5 mM ATP, 1.2 mM UTP, 1.2 mM CTP, 0.4 mM bio-11-UTP, 0.4 mM bio-11-CTP, 1× Ampliscribe buffer (Epicentre)] or 20 µl [42°C, 9 h, 80 U T7 RNA polymerase (Promega), 7.5 mM NTP, 1× Ampliscribe buffer (Epicentre); for the first round of two round experiments]; and aRNA was purified in three washes on a microcon-100 (Millipore) both at the end and between rounds.

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen). .. Cycling conditions were as follows: denaturation at 95°C for 60 s, annealing at 55°C for 30 s, extension at 72°C for 3 min for 35 cycles, and a final extension at 72°C for 10 min. Human Tim-3 parent vector containing the full mRNA transcript was used as a positive control for all PCR amplifications.

    Article Title: Expression pattern of neuronal and skeletal muscle voltage-gated Na+ channels in the developing mouse heart
    Article Snippet: The primary RNA fraction was precipitated twice with 0.8 m LiCl to improve conditions for reverse transcription and PCR ( ). .. Reverse transcription was performed using an equimolar mix of the poly-A-anchored oligonucleotides dTAN, dTCN and dTGN, and Superscript II, according to the suggestions of the supplier (Invitrogen, Groningen, The Netherlands), followed by treatment of the cDNA mixture for 20 min at 37°C with Escherichia coli RNase H (MBI Fermentas, Vilnius, Lithuania).

    Sequencing:

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: Rat genome U34A arrays, which contained 9000 probes for known rat genes or expressed sequence tags, were purchased from Affymetrix (Santa Clara, CA). .. Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen).

    Recombinant:

    Article Title: Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
    Article Snippet: Reverse transcription reactions were performed in a final volume of 21 μL containing 16 mM Tris-HCl (pH 8.4), 40 mM KCl, 0.4 mM dithiothreitol, 4 mM MgCl2 , 0.4 mM of each deoxynucleotide triphosphate, 0.5 μg oligo(dT), 40 U recombinant ribonuclease inhibitor RNaseOUT (Invitrogen, Carlsbad, CA, USA), and variable amounts of cellular RNA and recRNA. .. The reaction was terminated by rapid chilling on ice and by adding 4 U Escherichia coli RNase H (Invitrogen).

    Fluorescence:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Amplifications of the complementary deoxyribonucleic acid samples were performed in triplicate in 96-well plates in a final volume of 20 μL at 40 PCR cycles consisting of a denaturation step at 95°C for 15 s and an anneal/extension step at 60°C for 1 min. Fluorescence measurements were used to generate a dissociation curve utilizing the system software program v1.4 (Applied Biosystems).

    Isolation:

    Article Title: O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins 1
    Article Snippet: Total RNA was isolated from roots, stems, leaves, and kernels of B73 using a modified cetyl-trimethyl-ammonium bromide procedure ( ). .. Escherichia coli RNase H (Invitrogen) was used to remove RNA complementary to cDNA before PCR.

    Article Title: Quantitative analysis of mRNA amplification by in vitro transcription
    Article Snippet: Total RNA was isolated 0 and 48 h after hypochlorite treatment of a mixed-stage population of wild-type C.elegans ( ) by the method of Chomczynski and Sacchi ( ). .. Second-strand synthesis (SSS) was carried out in 150 µl with 40 U DNA polymerase I, 2 U Escherichia coli RNase H, and 10 U E.coli DNA ligase in 1× second-strand buffer (Life Technologies) simply by adding 130 µl of an ice-cold SSS premix to the heat inactivated, ice-cold 20 µl RT reaction and incubating at 15°C for 2 h ( ).

    Article Title: Expression pattern of neuronal and skeletal muscle voltage-gated Na+ channels in the developing mouse heart
    Article Snippet: Paragraph title: RNA isolation and cDNA synthesis ... Reverse transcription was performed using an equimolar mix of the poly-A-anchored oligonucleotides dTAN, dTCN and dTGN, and Superscript II, according to the suggestions of the supplier (Invitrogen, Groningen, The Netherlands), followed by treatment of the cDNA mixture for 20 min at 37°C with Escherichia coli RNase H (MBI Fermentas, Vilnius, Lithuania).

    Size-exclusion Chromatography:

    Article Title: Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
    Article Snippet: The reaction was terminated by rapid chilling on ice and by adding 4 U Escherichia coli RNase H (Invitrogen). .. The cDNA samples were amplified with primers CYP2E1F and CYP2E1R in 25 μL PCR buffer (100 ng of each primer, 1 U Taq polymerase, 200 mM Tris-HCl, pH 8.4, 500 mM KCl, 50 mM MgCl2 , and 0.2 mM dNTP mixture), using the following PCR conditions: an initial denaturing step at 95°C for 5 min followed by 37 cycles of amplification that consisted of a denaturing step at 95°C for 30 sec, an annealing step at 56°C for 30 sec, and an extension step at 72°C for 30 sec.

    Labeling:

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: For microarray probing, reverse transcription, second-strand synthesis, and probe generation were all accomplished following the technical notes of the Small Sample Labeling Protocol version 2 (Affymetrix). .. Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen).

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: Paragraph title: Target preparation and labeling ... Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol.

    Purification:

    Article Title: O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins 1
    Article Snippet: The RNA was treated with RNase-free DNase (Qiagen USA, Valencia, CA) and further purified using an RNeasy Mini Kit (Qiagen USA). .. Escherichia coli RNase H (Invitrogen) was used to remove RNA complementary to cDNA before PCR.

    Article Title: Quantitative analysis of mRNA amplification by in vitro transcription
    Article Snippet: Second-strand synthesis (SSS) was carried out in 150 µl with 40 U DNA polymerase I, 2 U Escherichia coli RNase H, and 10 U E.coli DNA ligase in 1× second-strand buffer (Life Technologies) simply by adding 130 µl of an ice-cold SSS premix to the heat inactivated, ice-cold 20 µl RT reaction and incubating at 15°C for 2 h ( ). .. The double-stranded (ds) cDNA was polished by adding 20 U T4 DNA polymerase and incubating for 5 min at 15°C. cDNA was purified on paramagnetic beads (Perseptives) ( ) and was transcribed in 60 µl [37°C, 16 h, 5000 U T7 RNA polymerase (Epicentre Technologies), 3.0 mM GTP, 1.5 mM ATP, 1.2 mM UTP, 1.2 mM CTP, 0.4 mM bio-11-UTP, 0.4 mM bio-11-CTP (Enzo Laboratories), MegaScript 1× buffer (Ambion)].

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol. .. Transcription of dsDNA was prepared in 20 μl at 37°C for 3 h using MEGAscript T7 Transcription kit (Ambion) (7.5 mM ATP, 7.5 mM CTP, 7.5 mM GTP, 3.75 mM UTP and 3.75 mM aaUTP).

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Frozen PBMCs, CD4+ and CD8+ T cells, or monocytes were thawed and lysed, and the RNA was purified using an RNeasy Plus minikit (Qiagen, Venlo, Limburg, Netherlands). .. Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen).

    Article Title: A Pair of Tabersonine 16-Hydroxylases Initiates the Synthesis of Vindoline in an Organ-Dependent Manner in Catharanthus roseus 1 1 [C] 1 [C] [W]
    Article Snippet: Following , complementary RNA was removed by treatment with Escherichia coli RNase H (Invitrogen) for 20 min at 37°C. .. For 5′ RACE, similar reactions were carried out except that total RNA was subsequently removed by treatment with RNase A (Sigma-Aldrich) and the reaction product was purified using the NucleoSpin Extract II kit.

    Article Title: Stanniocalcin-1 Controls Ion Regulation Functions of Ion-transporting Epithelium Other than Calcium Balance
    Article Snippet: The total RNA samples were purified using an RNeasy Mini Kit (Qiagen, Huntsville, AL), and treated with DNase1 to remove genomic DNA. .. For cDNA synthesis, 5 μg of total RNA was reverse-transcribed in a final volume of 20 μL containing 0.5 mM dNTPs, 2.5 μM oligo(dT)20 , 250 ng of random primers, 5 mM dithiothreitol, 40 units of an RNase inhibitor, and 200 units of PowerScript reverse transcriptase (Invitrogen) for 30 min at 50 °C, followed by incubation at 70 °C for 15 min. Twenty units of Escherichia coli RNase H (Invitrogen) were added to remove the remnant RNA in a 20-min incubation at 37 °C.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: Complementary deoxyribonucleic acid was synthesized using a SuperScript III First-Strand Synthesis System for reverse transcriptase–polymerase chain reaction (RT-PCR; Invitrogen Life Technologies, Carlsbad, CA). .. Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ).

    Article Title: O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins 1
    Article Snippet: Paragraph title: RT-PCR ... Escherichia coli RNase H (Invitrogen) was used to remove RNA complementary to cDNA before PCR.

    Article Title: Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
    Article Snippet: Paragraph title: Quantitative reverse transcriptase (RT)-PCR. ... The reaction was terminated by rapid chilling on ice and by adding 4 U Escherichia coli RNase H (Invitrogen).

    Microscopy:

    Article Title: Expression pattern of neuronal and skeletal muscle voltage-gated Na+ channels in the developing mouse heart
    Article Snippet: Embryonic hearts were isolated under a microscope, and four hearts were pooled for RNA isolation. .. Reverse transcription was performed using an equimolar mix of the poly-A-anchored oligonucleotides dTAN, dTCN and dTGN, and Superscript II, according to the suggestions of the supplier (Invitrogen, Groningen, The Netherlands), followed by treatment of the cDNA mixture for 20 min at 37°C with Escherichia coli RNase H (MBI Fermentas, Vilnius, Lithuania).

    Chromatin Immunoprecipitation:

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen). .. The RGU34A arrays were hybridized as described in the Gene Chip Expression Analysis Technical Manual (Affymetrix) and stained for use with a GeneArray scanner (Agilent Technologies, Palo Alto, CA).

    Plasmid Preparation:

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen). .. Cycling conditions were as follows: denaturation at 95°C for 60 s, annealing at 55°C for 30 s, extension at 72°C for 3 min for 35 cycles, and a final extension at 72°C for 10 min. Human Tim-3 parent vector containing the full mRNA transcript was used as a positive control for all PCR amplifications.

    Software:

    Article Title: The Effect of Hydrostatic Pressure on Three-Dimensional Chondroinduction of Human Adipose-Derived Stem Cells
    Article Snippet: Then, Escherichia coli RNase H (2 U/μL) was added and incubated at 37°C for 20 min. Real-time RT-PCR was performed in an ABI Prism7300 system (Applied Biosystems, Foster City, CA) using The RT SYBR Green/ROX qPCR master mix (SA Biosciences, Frederick, MD) with primers designed for this study ( ). .. Amplifications of the complementary deoxyribonucleic acid samples were performed in triplicate in 96-well plates in a final volume of 20 μL at 40 PCR cycles consisting of a denaturation step at 95°C for 15 s and an anneal/extension step at 60°C for 1 min. Fluorescence measurements were used to generate a dissociation curve utilizing the system software program v1.4 (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Stanniocalcin-1 Controls Ion Regulation Functions of Ion-transporting Epithelium Other than Calcium Balance
    Article Snippet: For cDNA synthesis, 5 μg of total RNA was reverse-transcribed in a final volume of 20 μL containing 0.5 mM dNTPs, 2.5 μM oligo(dT)20 , 250 ng of random primers, 5 mM dithiothreitol, 40 units of an RNase inhibitor, and 200 units of PowerScript reverse transcriptase (Invitrogen) for 30 min at 50 °C, followed by incubation at 70 °C for 15 min. Twenty units of Escherichia coli RNase H (Invitrogen) were added to remove the remnant RNA in a 20-min incubation at 37 °C. .. The final volume in a well was 10 μL, consisting of 5 μL of 2X SYBR green master mix (Roche), 3.2 ng of cDNA, and 50 nM of primer pairs.

    RNA Extraction:

    Article Title: Immunomodulatory Impact of Leishmania-Induced Macrophage Exosomes: A Comparative Proteomic and Functional Analysis
    Article Snippet: Quantitative real-time PCR (qRT-PCR) J774 macrophages were left untreated, infected with stationary L. mexicana parasites at 1∶20 ratio, stimulated with 100 ng/ml of LPS or 5 µg/ml of exosomes for 8 h. Following stimulation, cells were washed with PBS, (3 times for infected cells) and were lysed in Tryzol reagent (Invitrogen) according to the manufacturer's instructions for RNA extraction. .. Samples were then treated with Escherichia coli RNase H (Invitrogen) for clearance of RNA-DNA helices. qRT-PCR was performed using Qiagen SABioscience RT2 profiler arrays in a Strategene mx3000 thermocycler according to SABiosciences protocol.

    Article Title: A Pair of Tabersonine 16-Hydroxylases Initiates the Synthesis of Vindoline in an Organ-Dependent Manner in Catharanthus roseus 1 1 [C] 1 [C] [W]
    Article Snippet: Paragraph title: RNA Extraction and ... Following , complementary RNA was removed by treatment with Escherichia coli RNase H (Invitrogen) for 20 min at 37°C.

    Agarose Gel Electrophoresis:

    Article Title: Soluble T Cell Immunoglobulin Mucin Domain 3 Is Shed from CD8+ T Cells by the Sheddase ADAM10, Is Increased in Plasma during Untreated HIV Infection, and Correlates with HIV Disease Progression
    Article Snippet: Total RNA was reverse transcribed with the SuperScript III first-strand synthesis system (Invitrogen) using oligo(dT)18 primers, and RNA complementary to the cDNA was removed using Escherichia coli RNase H (Invitrogen). .. Products were visualized using ethidium bromide on a 1% agarose gel.

    Article Title: Stanniocalcin-1 Controls Ion Regulation Functions of Ion-transporting Epithelium Other than Calcium Balance
    Article Snippet: The quantity and quality of total RNA were assessed by Nanodrop spectrophotometry (ND-1000, NanoDrop Technology, Wilmington, DE) and agarose gel electrophoresis, respectively. .. For cDNA synthesis, 5 μg of total RNA was reverse-transcribed in a final volume of 20 μL containing 0.5 mM dNTPs, 2.5 μM oligo(dT)20 , 250 ng of random primers, 5 mM dithiothreitol, 40 units of an RNase inhibitor, and 200 units of PowerScript reverse transcriptase (Invitrogen) for 30 min at 50 °C, followed by incubation at 70 °C for 15 min. Twenty units of Escherichia coli RNase H (Invitrogen) were added to remove the remnant RNA in a 20-min incubation at 37 °C.

    In Vitro:

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: About 2 μg of corresponding cRNA was generated using in vitro transcription systems (T7 or SP6 Megascript kit; Ambion). .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol.

    Ethanol Precipitation:

    Article Title: Premature termination codons do not affect the rate of splicing of neighboring introns
    Article Snippet: Contaminating genomic DNA was removed by treating with RQ1 DNase (Promega) in 5 mM MgCl2 and 50 mM Tris pH 8.0 at 37°C for 1 h, followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. .. RT reactions (10 μL) were incubated at 37°C for 15 min, then 55°C for 30 min, then 65°C for 30 min, and finally 85°C for 10 min. Escherichia coli RNase H (0.1 U/μL; Invitrogen) was added and the samples incubated at 37°C for 30 min. PCR was then performed using Platinum Taq polymerase (Invitrogen) in the buffer supplied adding 1.5 mM MgCl2 , 0.4 mM dNTPs, 200 nM unlabeled primers doped with 5′-radiolabeled forward primer (to label only one strand of the amplicon), and 7.5% (by volume) of reverse-transcribed cDNA.

    Spectrophotometry:

    Article Title: Stanniocalcin-1 Controls Ion Regulation Functions of Ion-transporting Epithelium Other than Calcium Balance
    Article Snippet: The quantity and quality of total RNA were assessed by Nanodrop spectrophotometry (ND-1000, NanoDrop Technology, Wilmington, DE) and agarose gel electrophoresis, respectively. .. For cDNA synthesis, 5 μg of total RNA was reverse-transcribed in a final volume of 20 μL containing 0.5 mM dNTPs, 2.5 μM oligo(dT)20 , 250 ng of random primers, 5 mM dithiothreitol, 40 units of an RNase inhibitor, and 200 units of PowerScript reverse transcriptase (Invitrogen) for 30 min at 50 °C, followed by incubation at 70 °C for 15 min. Twenty units of Escherichia coli RNase H (Invitrogen) were added to remove the remnant RNA in a 20-min incubation at 37 °C.

    Staining:

    Article Title: ?2-Macroglobulin: A Novel Cytochemical Marker Characterizing Preneoplastic and Neoplastic Rat Liver Lesions Negative for Hitherto Established Cytochemical Markers
    Article Snippet: Briefly, from 100 ng of total RNA, first-strand cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Groningen, The Netherlands) and a T7-(dT)24 primer (Amersham Bioscience) and then double-strand cDNA was synthesized with Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli DNA ligase (Invitrogen). .. The RGU34A arrays were hybridized as described in the Gene Chip Expression Analysis Technical Manual (Affymetrix) and stained for use with a GeneArray scanner (Agilent Technologies, Palo Alto, CA).

    Variant Assay:

    Article Title: A microarray configuration to quantify expression levels and relative abundance of splice variants
    Article Snippet: Target preparation and labeling For synthetic model systems, labeled targets were prepared from pairs of cDNA clones, each representing a wild-type form and a splice variant [also called : long form (LF) + short form (SF)]. .. Second-strand synthesis (SSS) was carried out in 150 μl final volume containing 40 U DNA polymerase I, 2 U of Escherichia coli RNase H, and 10 U of E.coli DNA ligase in 1× second-strand buffer (Life Technologies) by adding 130 μl of ice-cold SSS premix to the 20 μl RT reaction and incubated at 16°C for 2 h. The double-strand DNA synthesis was terminated by adding 10 U of T4 DNA polymerase and incubating for 10 min at 16°C. cDNA was purified with phenol/chloroform/isoamyl-alcohol 25:24:1 (v/v/v) extraction on Phase lock gels (Eppendorf) and precipitated overnight at −20°C with 7.5 M NH4 Ac and absolute ethanol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher e coli rnase h
    Sequence preferences of Escherichia coli, Homo sapiens and HIV-1 <t>RNase</t> H ( A ) The heatmaps display the changes in nucleotide composition at different positions for the R7 construct (left) and the R4b construct (right) after cleavage with the three different RNase H enzymes. The intensity of the red and blue color indicates the k rel of having given nucleotide at a given position fixed relative to the average hydrolysis rate of the randomized pool. The barplots below the heatmaps show the overall information content at each position and the sequence logos are based on the 1% most downregulated pentamers. Note that only the randomized parts of the probed duplexes is displayed. ( B ) Cleavage of sequences predicted to be preferred (‘P’), avoided (‘A’) and neutral (‘N’) with respect to cleavage with human RNase H1 compared to the cleavage of a reference substrate. With respect to the reference substrate, the k rel of the preferred substrate is 3.7, of the avoided is 0.26 and of the neutral it is 1.4. ( C ) The design of the dumbbell substrate mimics. The gray box indicates the region having either the preferred (‘P’) or avoided (‘A’) sequence. ( D ) The cleavage of a reference substrate in the presence of increasing concentrations of a preferred or avoided dumbbell substrate mimic.
    E Coli Rnase H, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli rnase h/product/Thermo Fisher
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    e coli rnase h - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    96
    Thermo Fisher v5 tagged rnase h1
    Overexpression of rnh1 relieves replication pausing. A–D , 2DNAGE of four restriction fragments of Drosophila S2 cells mtDNA, probed as indicated, in material from control cells and cells overexpressing <t>RNase</t> H1 in the form of epitope-tagged RNase H1-V5 (denoted OE ), both treated with 500 μ m CuSO 4 for 48 h to induce expression. E , schematic map of Drosophila mtDNA, as also shown in Fig. 8 , indicating the location of relevant restriction sites ( open circles ), mTTF-binding sites (bs1 and bs2; filled circles ), the noncoding region ( bold ), and the probes used. The open arrowhead marks the location and direction of replication initiation (see Ref. 40 ). The directions of first- and second-dimension electrophoresis in all gels are as indicated by the arrows . The images show relatively low exposures to reveal fine details of the arcs of RIs.
    V5 Tagged Rnase H1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/v5 tagged rnase h1/product/Thermo Fisher
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    v5 tagged rnase h1 - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    80
    Thermo Fisher rnase hi
    Chromosome fragmentation analysis by <t>RNase</t> HI, RNase <t>HII</t> and RNase A treatment in vitro A. A scheme of various hypothetical R-lesions (R-tract, two types of R-gaps) with positions of cleavage by RNase HI, HII and A (in low salt (LS) and high salt (HS) conditions) shown with arrows of the corresponding color. Small blue “d” letters, dNs; small orange “r” letters, rNs. The strand polarity in a duplex is identified on the left. B. A representative pulsed-field gel detecting chromosomal fragmentation after RNase HII treatment. The lanes are marked either with “b” (buffer treatment control) or “H2” (RNase HII treatment). Strains: WT, AB1157; rnhA , L-413; rnhB , L-415; rnhAB , L-416; uvrA rnhAB , L-417. C. Quantification of the RNase treatment-induced fragmentation. The plotted values are means ± SEM from 3-6 independent measurements from gels like in “B”. For RNase A treatment, both low salt (LS) and high salt (HS) conditions are plotted. Since individual fragmentation values are differences between the enzyme and the buffer treatments, some values are negative.
    Rnase Hi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase hi/product/Thermo Fisher
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rnase hi - by Bioz Stars, 2020-04
    80/100 stars
      Buy from Supplier

    Image Search Results


    Sequence preferences of Escherichia coli, Homo sapiens and HIV-1 RNase H ( A ) The heatmaps display the changes in nucleotide composition at different positions for the R7 construct (left) and the R4b construct (right) after cleavage with the three different RNase H enzymes. The intensity of the red and blue color indicates the k rel of having given nucleotide at a given position fixed relative to the average hydrolysis rate of the randomized pool. The barplots below the heatmaps show the overall information content at each position and the sequence logos are based on the 1% most downregulated pentamers. Note that only the randomized parts of the probed duplexes is displayed. ( B ) Cleavage of sequences predicted to be preferred (‘P’), avoided (‘A’) and neutral (‘N’) with respect to cleavage with human RNase H1 compared to the cleavage of a reference substrate. With respect to the reference substrate, the k rel of the preferred substrate is 3.7, of the avoided is 0.26 and of the neutral it is 1.4. ( C ) The design of the dumbbell substrate mimics. The gray box indicates the region having either the preferred (‘P’) or avoided (‘A’) sequence. ( D ) The cleavage of a reference substrate in the presence of increasing concentrations of a preferred or avoided dumbbell substrate mimic.

    Journal: Nucleic Acids Research

    Article Title: RNase H sequence preferences influence antisense oligonucleotide efficiency

    doi: 10.1093/nar/gkx1073

    Figure Lengend Snippet: Sequence preferences of Escherichia coli, Homo sapiens and HIV-1 RNase H ( A ) The heatmaps display the changes in nucleotide composition at different positions for the R7 construct (left) and the R4b construct (right) after cleavage with the three different RNase H enzymes. The intensity of the red and blue color indicates the k rel of having given nucleotide at a given position fixed relative to the average hydrolysis rate of the randomized pool. The barplots below the heatmaps show the overall information content at each position and the sequence logos are based on the 1% most downregulated pentamers. Note that only the randomized parts of the probed duplexes is displayed. ( B ) Cleavage of sequences predicted to be preferred (‘P’), avoided (‘A’) and neutral (‘N’) with respect to cleavage with human RNase H1 compared to the cleavage of a reference substrate. With respect to the reference substrate, the k rel of the preferred substrate is 3.7, of the avoided is 0.26 and of the neutral it is 1.4. ( C ) The design of the dumbbell substrate mimics. The gray box indicates the region having either the preferred (‘P’) or avoided (‘A’) sequence. ( D ) The cleavage of a reference substrate in the presence of increasing concentrations of a preferred or avoided dumbbell substrate mimic.

    Article Snippet: Nevertheless, only one of the modified nucleotides directly interacts with the RNase H1 enzyme ( ) ( ) and reassuringly, for the human and E. coli RNase H, we obtained similar results with all three constructs having different modification patterns (Figure and ), suggesting that the different modifications in the substrates did not distort the results.

    Techniques: Sequencing, Construct

    Functional significance of predicted HIV-1 RNase H cleavage sites. ( A ) Predicted RNase H cleavage efficiency of the HIV-1 genome, shown as log 2 (fold change) (log 2 FC). ( B ) Schematic of the HIV reverse transcription. White scissors at the black circle indicate specific areas zoomed-in in subsequent panels. ( C ) Comparison of distances (in nucleotides) between well-cleaved sites in the HIV-1 genome and in the randomized HIV-1 genomes. The red rhombi shows the observed count of distances between positions predicted to be efficiently cleaved in HIV-1 genome that fall into the indicated distance intervals. The violin plots show the density of the distributions that resulted from the same analysis, but repeated 10 000× on HIV-1 genome sequences that were randomized with preserving the local dinucleotide content; Predicted cleavage efficiency of ( D ) the sequence surrounding the 3′PPT, ( E ) of the terminal 18 nt of the tRNA-Lys3 primer and ( F ) it is reverse complement (primer binding site). ( G ) Predicted cleavage efficiency of the best-cleaved site in the terminal 18 nt of the different human tRNAs (plus CCA) and of the corresponding reverse complement. The tRNA-Lys3 is indicated in red.

    Journal: Nucleic Acids Research

    Article Title: RNase H sequence preferences influence antisense oligonucleotide efficiency

    doi: 10.1093/nar/gkx1073

    Figure Lengend Snippet: Functional significance of predicted HIV-1 RNase H cleavage sites. ( A ) Predicted RNase H cleavage efficiency of the HIV-1 genome, shown as log 2 (fold change) (log 2 FC). ( B ) Schematic of the HIV reverse transcription. White scissors at the black circle indicate specific areas zoomed-in in subsequent panels. ( C ) Comparison of distances (in nucleotides) between well-cleaved sites in the HIV-1 genome and in the randomized HIV-1 genomes. The red rhombi shows the observed count of distances between positions predicted to be efficiently cleaved in HIV-1 genome that fall into the indicated distance intervals. The violin plots show the density of the distributions that resulted from the same analysis, but repeated 10 000× on HIV-1 genome sequences that were randomized with preserving the local dinucleotide content; Predicted cleavage efficiency of ( D ) the sequence surrounding the 3′PPT, ( E ) of the terminal 18 nt of the tRNA-Lys3 primer and ( F ) it is reverse complement (primer binding site). ( G ) Predicted cleavage efficiency of the best-cleaved site in the terminal 18 nt of the different human tRNAs (plus CCA) and of the corresponding reverse complement. The tRNA-Lys3 is indicated in red.

    Article Snippet: Nevertheless, only one of the modified nucleotides directly interacts with the RNase H1 enzyme ( ) ( ) and reassuringly, for the human and E. coli RNase H, we obtained similar results with all three constructs having different modification patterns (Figure and ), suggesting that the different modifications in the substrates did not distort the results.

    Techniques: Functional Assay, Preserving, Sequencing, Binding Assay

    RNase H Sequence Preferences correlate with gapmer efficiency. ( A ) Correlation between the log 2 fold changes of different hexamers observed for the R4b construct in the experiment and the corresponding log 2 fold changes as predicted by a single nucleotide model prepared from the data obtained in the R4a experiment. ( B ) As in (A), but with prediction with a dinucleotide model. ( C ) Prediction of RNase H1 mediated downregulation of the different 11-mers present in RNA sequence used for the RNase H RNA–DNA heteroduplex crystal structure [PDB: 2QK9]. Each bar corresponds to the cleavage site of a potential binding mode of RNase H1. The filled bar corresponds to the RNase H1 binding mode observed in the crystal structure and is also indicated in the drawing below the plot. ( D ) Correlation between the change of target RNA level for MAPT ( 30 ) after treatment with 1518 different gapmers and the corresponding downregulation predicted by the dinucleotide model for the different binding modes of RNase H1 on each gapmer target duplex. The error bars show the 99% confidence intervals. The drawing below the plot indicates the RNase H1 binding mode associated with the best-observed correlation. ( E ) The same analysis as in (D), but with 1581 different gapmers targeted against ANGPTL3 ( 31 ).

    Journal: Nucleic Acids Research

    Article Title: RNase H sequence preferences influence antisense oligonucleotide efficiency

    doi: 10.1093/nar/gkx1073

    Figure Lengend Snippet: RNase H Sequence Preferences correlate with gapmer efficiency. ( A ) Correlation between the log 2 fold changes of different hexamers observed for the R4b construct in the experiment and the corresponding log 2 fold changes as predicted by a single nucleotide model prepared from the data obtained in the R4a experiment. ( B ) As in (A), but with prediction with a dinucleotide model. ( C ) Prediction of RNase H1 mediated downregulation of the different 11-mers present in RNA sequence used for the RNase H RNA–DNA heteroduplex crystal structure [PDB: 2QK9]. Each bar corresponds to the cleavage site of a potential binding mode of RNase H1. The filled bar corresponds to the RNase H1 binding mode observed in the crystal structure and is also indicated in the drawing below the plot. ( D ) Correlation between the change of target RNA level for MAPT ( 30 ) after treatment with 1518 different gapmers and the corresponding downregulation predicted by the dinucleotide model for the different binding modes of RNase H1 on each gapmer target duplex. The error bars show the 99% confidence intervals. The drawing below the plot indicates the RNase H1 binding mode associated with the best-observed correlation. ( E ) The same analysis as in (D), but with 1581 different gapmers targeted against ANGPTL3 ( 31 ).

    Article Snippet: Nevertheless, only one of the modified nucleotides directly interacts with the RNase H1 enzyme ( ) ( ) and reassuringly, for the human and E. coli RNase H, we obtained similar results with all three constructs having different modification patterns (Figure and ), suggesting that the different modifications in the substrates did not distort the results.

    Techniques: Sequencing, Construct, Binding Assay

    Refining the HIV-1 RNase H sequence preference model. ( A ) Distributions of the observed log 2 fold changes of RNA heptamers in R7 for human RNase H1 (right) and HIV-1 RNase H (left). ( B ) The observed log 2 fold changes after cleavage with HIV-1 RNase H for an efficiently cleaved hexamer (GCGCAA) located at different positions of R7. The position of the arrow indicates the cleavage site as aligned to the picture of scissors in the box and the arrow length represents the efficiency of cleavage. ( C ) Sequence logos of the best cleaved quartile of sets of heptamers predicted to have the same cleavage site. The arrows indicate the predicted cleavage site, with the length proportional to the observed cleavage efficiency.

    Journal: Nucleic Acids Research

    Article Title: RNase H sequence preferences influence antisense oligonucleotide efficiency

    doi: 10.1093/nar/gkx1073

    Figure Lengend Snippet: Refining the HIV-1 RNase H sequence preference model. ( A ) Distributions of the observed log 2 fold changes of RNA heptamers in R7 for human RNase H1 (right) and HIV-1 RNase H (left). ( B ) The observed log 2 fold changes after cleavage with HIV-1 RNase H for an efficiently cleaved hexamer (GCGCAA) located at different positions of R7. The position of the arrow indicates the cleavage site as aligned to the picture of scissors in the box and the arrow length represents the efficiency of cleavage. ( C ) Sequence logos of the best cleaved quartile of sets of heptamers predicted to have the same cleavage site. The arrows indicate the predicted cleavage site, with the length proportional to the observed cleavage efficiency.

    Article Snippet: Nevertheless, only one of the modified nucleotides directly interacts with the RNase H1 enzyme ( ) ( ) and reassuringly, for the human and E. coli RNase H, we obtained similar results with all three constructs having different modification patterns (Figure and ), suggesting that the different modifications in the substrates did not distort the results.

    Techniques: Refining, Sequencing

    Overexpression of rnh1 relieves replication pausing. A–D , 2DNAGE of four restriction fragments of Drosophila S2 cells mtDNA, probed as indicated, in material from control cells and cells overexpressing RNase H1 in the form of epitope-tagged RNase H1-V5 (denoted OE ), both treated with 500 μ m CuSO 4 for 48 h to induce expression. E , schematic map of Drosophila mtDNA, as also shown in Fig. 8 , indicating the location of relevant restriction sites ( open circles ), mTTF-binding sites (bs1 and bs2; filled circles ), the noncoding region ( bold ), and the probes used. The open arrowhead marks the location and direction of replication initiation (see Ref. 40 ). The directions of first- and second-dimension electrophoresis in all gels are as indicated by the arrows . The images show relatively low exposures to reveal fine details of the arcs of RIs.

    Journal: The Journal of Biological Chemistry

    Article Title: RNase H1 promotes replication fork progression through oppositely transcribed regions of Drosophila mitochondrial DNA

    doi: 10.1074/jbc.RA118.007015

    Figure Lengend Snippet: Overexpression of rnh1 relieves replication pausing. A–D , 2DNAGE of four restriction fragments of Drosophila S2 cells mtDNA, probed as indicated, in material from control cells and cells overexpressing RNase H1 in the form of epitope-tagged RNase H1-V5 (denoted OE ), both treated with 500 μ m CuSO 4 for 48 h to induce expression. E , schematic map of Drosophila mtDNA, as also shown in Fig. 8 , indicating the location of relevant restriction sites ( open circles ), mTTF-binding sites (bs1 and bs2; filled circles ), the noncoding region ( bold ), and the probes used. The open arrowhead marks the location and direction of replication initiation (see Ref. 40 ). The directions of first- and second-dimension electrophoresis in all gels are as indicated by the arrows . The images show relatively low exposures to reveal fine details of the arcs of RIs.

    Article Snippet: To establish cell clones stably expressing V5-tagged RNase H1 and variants, pCoBlast (Thermo Fisher Scientific) was included in transfections.

    Techniques: Over Expression, Expressing, Binding Assay, Electrophoresis

    Subcellular localization of epitope-tagged RNase H1. A , immunocytochemistry of cells transiently transfected with RNase H1-V5, probed for the V5 epitope tag ( red ), Cox4 ( green ), and DAPI ( blue ), showing examples of the three types of intracellular distribution of V5-tagged RNase H1: nucleus and mitochondria ( i ), mitochondria only ( ii ), and nucleus only ( iii ). B , subcellular distribution of RNase H1-V5 in 100 transfected cells as indicated (mean of three experiments, error bars denote S.D.). C , Western blots of subcellular fractions from cells transfected with RNase H1-V5, highly enriched for nuclei ( nuc ) or mitochondria ( mt ) as indicated, probed simultaneously for V5 and for the markers indicated. M , molecular mass markers.

    Journal: The Journal of Biological Chemistry

    Article Title: RNase H1 promotes replication fork progression through oppositely transcribed regions of Drosophila mitochondrial DNA

    doi: 10.1074/jbc.RA118.007015

    Figure Lengend Snippet: Subcellular localization of epitope-tagged RNase H1. A , immunocytochemistry of cells transiently transfected with RNase H1-V5, probed for the V5 epitope tag ( red ), Cox4 ( green ), and DAPI ( blue ), showing examples of the three types of intracellular distribution of V5-tagged RNase H1: nucleus and mitochondria ( i ), mitochondria only ( ii ), and nucleus only ( iii ). B , subcellular distribution of RNase H1-V5 in 100 transfected cells as indicated (mean of three experiments, error bars denote S.D.). C , Western blots of subcellular fractions from cells transfected with RNase H1-V5, highly enriched for nuclei ( nuc ) or mitochondria ( mt ) as indicated, probed simultaneously for V5 and for the markers indicated. M , molecular mass markers.

    Article Snippet: To establish cell clones stably expressing V5-tagged RNase H1 and variants, pCoBlast (Thermo Fisher Scientific) was included in transfections.

    Techniques: Immunocytochemistry, Transfection, Western Blot

    Subcellular targeting of RNase H1 variants. A , intracellular localization of RNase H1-V5 variants in cultures of stably transfected cells exemplified in B . M1V and M16V, N-terminal methionine variants (see Fig. S2 A ); ΔNLS, with the putative nuclear localization signal deleted (see Fig. S2 C ). C , intracellular localization of RNase H1-V5 in cells synchronized in G1 and G2 (see FACS profiles in Fig. S2 E ). All plotted values are means of three experiments. Error bars denote S.D. nuc , nuclei; mt , mitochondria.

    Journal: The Journal of Biological Chemistry

    Article Title: RNase H1 promotes replication fork progression through oppositely transcribed regions of Drosophila mitochondrial DNA

    doi: 10.1074/jbc.RA118.007015

    Figure Lengend Snippet: Subcellular targeting of RNase H1 variants. A , intracellular localization of RNase H1-V5 variants in cultures of stably transfected cells exemplified in B . M1V and M16V, N-terminal methionine variants (see Fig. S2 A ); ΔNLS, with the putative nuclear localization signal deleted (see Fig. S2 C ). C , intracellular localization of RNase H1-V5 in cells synchronized in G1 and G2 (see FACS profiles in Fig. S2 E ). All plotted values are means of three experiments. Error bars denote S.D. nuc , nuclei; mt , mitochondria.

    Article Snippet: To establish cell clones stably expressing V5-tagged RNase H1 and variants, pCoBlast (Thermo Fisher Scientific) was included in transfections.

    Techniques: Stable Transfection, Transfection, FACS

    Chromosome fragmentation analysis by RNase HI, RNase HII and RNase A treatment in vitro A. A scheme of various hypothetical R-lesions (R-tract, two types of R-gaps) with positions of cleavage by RNase HI, HII and A (in low salt (LS) and high salt (HS) conditions) shown with arrows of the corresponding color. Small blue “d” letters, dNs; small orange “r” letters, rNs. The strand polarity in a duplex is identified on the left. B. A representative pulsed-field gel detecting chromosomal fragmentation after RNase HII treatment. The lanes are marked either with “b” (buffer treatment control) or “H2” (RNase HII treatment). Strains: WT, AB1157; rnhA , L-413; rnhB , L-415; rnhAB , L-416; uvrA rnhAB , L-417. C. Quantification of the RNase treatment-induced fragmentation. The plotted values are means ± SEM from 3-6 independent measurements from gels like in “B”. For RNase A treatment, both low salt (LS) and high salt (HS) conditions are plotted. Since individual fragmentation values are differences between the enzyme and the buffer treatments, some values are negative.

    Journal: Journal of molecular biology

    Article Title: RNase HII saves rnhA mutant Escherichia coli from R-loop-associated chromosomal fragmentation

    doi: 10.1016/j.jmb.2017.08.004

    Figure Lengend Snippet: Chromosome fragmentation analysis by RNase HI, RNase HII and RNase A treatment in vitro A. A scheme of various hypothetical R-lesions (R-tract, two types of R-gaps) with positions of cleavage by RNase HI, HII and A (in low salt (LS) and high salt (HS) conditions) shown with arrows of the corresponding color. Small blue “d” letters, dNs; small orange “r” letters, rNs. The strand polarity in a duplex is identified on the left. B. A representative pulsed-field gel detecting chromosomal fragmentation after RNase HII treatment. The lanes are marked either with “b” (buffer treatment control) or “H2” (RNase HII treatment). Strains: WT, AB1157; rnhA , L-413; rnhB , L-415; rnhAB , L-416; uvrA rnhAB , L-417. C. Quantification of the RNase treatment-induced fragmentation. The plotted values are means ± SEM from 3-6 independent measurements from gels like in “B”. For RNase A treatment, both low salt (LS) and high salt (HS) conditions are plotted. Since individual fragmentation values are differences between the enzyme and the buffer treatments, some values are negative.

    Article Snippet: To remove potential (RNA-DNA) intermediates formed in plasmids, the DNA samples were treated in 30 μl of 70% formamide at 65°C for 5 minutes, chilled on ice, precipitated with 500 mM NaCl and ethanol, dried on air and dissolved in water and aliquotted into three 20 μl reactions for treatment with RNase HI or RNase HII.

    Techniques: In Vitro, Pulsed-Field Gel

    Growth, morphology and viability of the double rnhAB mutants A. A scheme of in vivo substrates of the two RNase H enzymes. The common substrate, framed in bright green, is the RNA-run with at least four contiguous rNs, which we call “R-tract”. HI and H1, HII and H2 refer to RNase H enzymes of prokaryotes and eukaryotes accordingly. B. Colony size on LB agar, 37°C, 24 hours. Strains: WT, AB1157; Δ rnhA , L-413; Δ rnhB , L-415; Δ rnhAB , L-416. C. Images of rnh and wild type strains stained with DAPI and observed by Hiraga's fluo-phase combined method. Cells were grown at 37°C in LB. The strains are like in “B”. D. Viability of the strains, determined as the ratio of the colony forming units (CFUs) to the microscopic counts in the same volume of the culture. Overnight cultures grown at 30°C were diluted and grown at the temperature (indicated by the first number) to OD 0.2-0.3 (about 2 hours), then cultures were serially diluted and plated on LB plates developed for 16 hours at the temperature indicated by the second number in pairs. Average viability (± SEM) of the eight WT measurements and six measurements for the rnhAB mutant cells is shown (the low titers of the two MG1655 Δ rnhAB cultures at 42°C were not used in the calculation). Strains: AB1157, L-416, MG1655, L-419. E. An enlarged image of the rnhAB mutant cells (processed as in panel C), to show nucleoids of both filamenting and normal-looking cells in some detail. F. Anaerobic growth inhibition of the rnhA and anaerobic lethality of rnhAB strains. Dilution-spotting of strains (like in “B”) was done in an anaerobic chamber on LB plates. Plates were incubated at room temperature in the chamber for 24 hours, then shifted to 28°C aerobic conditions for another 48 hours. G. The uvrA defect further reduces the colony size of the rnhAB double mutant. Strains: rnhAB , L-416; uvrA rnhA , L-414; uvrA rnhAB , L-417.

    Journal: Journal of molecular biology

    Article Title: RNase HII saves rnhA mutant Escherichia coli from R-loop-associated chromosomal fragmentation

    doi: 10.1016/j.jmb.2017.08.004

    Figure Lengend Snippet: Growth, morphology and viability of the double rnhAB mutants A. A scheme of in vivo substrates of the two RNase H enzymes. The common substrate, framed in bright green, is the RNA-run with at least four contiguous rNs, which we call “R-tract”. HI and H1, HII and H2 refer to RNase H enzymes of prokaryotes and eukaryotes accordingly. B. Colony size on LB agar, 37°C, 24 hours. Strains: WT, AB1157; Δ rnhA , L-413; Δ rnhB , L-415; Δ rnhAB , L-416. C. Images of rnh and wild type strains stained with DAPI and observed by Hiraga's fluo-phase combined method. Cells were grown at 37°C in LB. The strains are like in “B”. D. Viability of the strains, determined as the ratio of the colony forming units (CFUs) to the microscopic counts in the same volume of the culture. Overnight cultures grown at 30°C were diluted and grown at the temperature (indicated by the first number) to OD 0.2-0.3 (about 2 hours), then cultures were serially diluted and plated on LB plates developed for 16 hours at the temperature indicated by the second number in pairs. Average viability (± SEM) of the eight WT measurements and six measurements for the rnhAB mutant cells is shown (the low titers of the two MG1655 Δ rnhAB cultures at 42°C were not used in the calculation). Strains: AB1157, L-416, MG1655, L-419. E. An enlarged image of the rnhAB mutant cells (processed as in panel C), to show nucleoids of both filamenting and normal-looking cells in some detail. F. Anaerobic growth inhibition of the rnhA and anaerobic lethality of rnhAB strains. Dilution-spotting of strains (like in “B”) was done in an anaerobic chamber on LB plates. Plates were incubated at room temperature in the chamber for 24 hours, then shifted to 28°C aerobic conditions for another 48 hours. G. The uvrA defect further reduces the colony size of the rnhAB double mutant. Strains: rnhAB , L-416; uvrA rnhA , L-414; uvrA rnhAB , L-417.

    Article Snippet: To remove potential (RNA-DNA) intermediates formed in plasmids, the DNA samples were treated in 30 μl of 70% formamide at 65°C for 5 minutes, chilled on ice, precipitated with 500 mM NaCl and ethanol, dried on air and dissolved in water and aliquotted into three 20 μl reactions for treatment with RNase HI or RNase HII.

    Techniques: In Vivo, Staining, Mutagenesis, Inhibition, Incubation

    Verification of RNase HI and RNase HII rN-DNA substrate specificity in vitro and the rN-density in DNA of the RNase H + cells and rnh mutants A. A scheme of the two double stranded oligo substrates: 38R1 (single rN) and 34R5 (five consecutive rN). The 32 P label at the 5′ end is shown as a red asterisk. DNA nucleotides are shown as blue lower case “d”, ribonucleotides are orange uppercase “R”. B. Products of the rN-DNA substrate hydrolysis by E. coli RNase HI and RNase HII enzymes. The radiolabelled rN-containing dsDNA oligos (shown in A) were incubated with the RNase HI or RNase HII enzymes. “0.1 M NaOH” and “Na Carb. pH 9.3” refer to alkali conditions in which rN hydrolysis produces reference size products. Numbers “1” or “5” refer to 38R1 or 34R5 oligos (A); ss/ds refers to whether the substrate used in the reaction was single-stranded or double-stranded. RNase H1 and RNase H2 were the E. coli enzymes RNase HI and RNase HII. RNase H1-1 and RNase H1-2 were RNase HI enzymes from different producers. The numbers on the side of the gel represent the sizes of the substrate and cleavage products. The reaction products were analyzed in 18% urea-PAGE gel. C. Only 34R5 oligo was used as either ss or ds substrate. All designations are like in “B”. D. Treatment with RNase HII of the plasmid isolated by alkaline lysis protocol. SCM, supercoiled monomer; b, buffer; H2, RNase HII. Plasmid: pEAK86, plasmid isolation was done at 0°C. Strains for results shown in panels D-I were: WT, AB1157; rnhA , L-413; rnhB , L-415; rnhAB , L-416; uvrA rnhAB L-417. Product of the reactions were run in 1.1% agarose gel; autoradiogram of the representative Southern blot with the radiolabelled pEAK86 DNA as a probe is shown here and also in E and G. E. Treatment with either RNase HI or RNase HII enzymes of the plasmid isolated by the total genomic DNA protocol. SC, supercoiled plasmid; relaxed, relaxed plasmid; chrom., chromosomal DNA. Plasmid: pEAK86. Analysis of plasmid species was carried out as in D. F. Summary of quantification of the RNaseHII-revealed density of rNs in plasmid DNA isolated by various methods from the rnhAB double mutant. The density calculations are described in Methods. “Form.”, formamide. G. Alkali treatment analysis of rN-density. The plasmid DNA isolated by alkaline lysis at 0°C, was linearized and treated with NaOH. Treatment: “—”, no treatment; 0°, 0.2 M NaOH, 20 mM EDTA treatment on ice for 20 min; 45°, 0.3 M NaOH, 20 mM EDTA treatment at 45°C for 90 minutes. ds, linearized plasmid DNA, ss -single stranded plasmid. The samples were run in 1.1% agarose in TAE buffer, at 4°C. H. Summary of quantification of the rN-density determined by either RNase HII or by alkali treatments (from gels like in “G”). Various mutant comparison data are shown, pEAK86 was purified by alkaline lysis only, values are means of three independent measurements ± SEM. The star identifies the value already reported in panel “F”. I. R-loop removal by RNase HI or by RNase A. pAM34 isolated from rnhA (strain L-413) by the total genomic DNA protocol.

    Journal: Journal of molecular biology

    Article Title: RNase HII saves rnhA mutant Escherichia coli from R-loop-associated chromosomal fragmentation

    doi: 10.1016/j.jmb.2017.08.004

    Figure Lengend Snippet: Verification of RNase HI and RNase HII rN-DNA substrate specificity in vitro and the rN-density in DNA of the RNase H + cells and rnh mutants A. A scheme of the two double stranded oligo substrates: 38R1 (single rN) and 34R5 (five consecutive rN). The 32 P label at the 5′ end is shown as a red asterisk. DNA nucleotides are shown as blue lower case “d”, ribonucleotides are orange uppercase “R”. B. Products of the rN-DNA substrate hydrolysis by E. coli RNase HI and RNase HII enzymes. The radiolabelled rN-containing dsDNA oligos (shown in A) were incubated with the RNase HI or RNase HII enzymes. “0.1 M NaOH” and “Na Carb. pH 9.3” refer to alkali conditions in which rN hydrolysis produces reference size products. Numbers “1” or “5” refer to 38R1 or 34R5 oligos (A); ss/ds refers to whether the substrate used in the reaction was single-stranded or double-stranded. RNase H1 and RNase H2 were the E. coli enzymes RNase HI and RNase HII. RNase H1-1 and RNase H1-2 were RNase HI enzymes from different producers. The numbers on the side of the gel represent the sizes of the substrate and cleavage products. The reaction products were analyzed in 18% urea-PAGE gel. C. Only 34R5 oligo was used as either ss or ds substrate. All designations are like in “B”. D. Treatment with RNase HII of the plasmid isolated by alkaline lysis protocol. SCM, supercoiled monomer; b, buffer; H2, RNase HII. Plasmid: pEAK86, plasmid isolation was done at 0°C. Strains for results shown in panels D-I were: WT, AB1157; rnhA , L-413; rnhB , L-415; rnhAB , L-416; uvrA rnhAB L-417. Product of the reactions were run in 1.1% agarose gel; autoradiogram of the representative Southern blot with the radiolabelled pEAK86 DNA as a probe is shown here and also in E and G. E. Treatment with either RNase HI or RNase HII enzymes of the plasmid isolated by the total genomic DNA protocol. SC, supercoiled plasmid; relaxed, relaxed plasmid; chrom., chromosomal DNA. Plasmid: pEAK86. Analysis of plasmid species was carried out as in D. F. Summary of quantification of the RNaseHII-revealed density of rNs in plasmid DNA isolated by various methods from the rnhAB double mutant. The density calculations are described in Methods. “Form.”, formamide. G. Alkali treatment analysis of rN-density. The plasmid DNA isolated by alkaline lysis at 0°C, was linearized and treated with NaOH. Treatment: “—”, no treatment; 0°, 0.2 M NaOH, 20 mM EDTA treatment on ice for 20 min; 45°, 0.3 M NaOH, 20 mM EDTA treatment at 45°C for 90 minutes. ds, linearized plasmid DNA, ss -single stranded plasmid. The samples were run in 1.1% agarose in TAE buffer, at 4°C. H. Summary of quantification of the rN-density determined by either RNase HII or by alkali treatments (from gels like in “G”). Various mutant comparison data are shown, pEAK86 was purified by alkaline lysis only, values are means of three independent measurements ± SEM. The star identifies the value already reported in panel “F”. I. R-loop removal by RNase HI or by RNase A. pAM34 isolated from rnhA (strain L-413) by the total genomic DNA protocol.

    Article Snippet: To remove potential (RNA-DNA) intermediates formed in plasmids, the DNA samples were treated in 30 μl of 70% formamide at 65°C for 5 minutes, chilled on ice, precipitated with 500 mM NaCl and ethanol, dried on air and dissolved in water and aliquotted into three 20 μl reactions for treatment with RNase HI or RNase HII.

    Techniques: In Vitro, Incubation, Polyacrylamide Gel Electrophoresis, Plasmid Preparation, Isolation, Alkaline Lysis, Agarose Gel Electrophoresis, Southern Blot, Mutagenesis, Purification