Structured Review

GE Healthcare e coli bl21
Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
E Coli Bl21, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli bl21/product/GE Healthcare
Average 93 stars, based on 45 article reviews
Price from $9.99 to $1999.99
e coli bl21 - by Bioz Stars, 2020-08
93/100 stars

Images

1) Product Images from "A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells"

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells

Journal: Oncotarget

doi: 10.18632/oncotarget.9179

Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
Figure Legend Snippet: Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

Techniques Used: Mutagenesis, Amplification, Recombinant, Purification, Incubation, Immunoprecipitation

2) Product Images from "Recombinant Human Parathyroid Hormone Related Protein 1-34 and 1-84 and Their Roles in Osteoporosis Treatment"

Article Title: Recombinant Human Parathyroid Hormone Related Protein 1-34 and 1-84 and Their Roles in Osteoporosis Treatment

Journal: PLoS ONE

doi: 10.1371/journal.pone.0088237

Preparation of Recombinant hPTHrP1-34 and 1-84. (a) Determination of the recombinants by PCR and double-enzyme (EcoR I+ BamH I) digestion. LaneM1, l-Hind III digest DNA marker; Lane1-3, double-enzyme digestion patterns of recombinant hPTHrP1-34 , hPTHrP1-84 and pGEX-2TK ; LaneM2, DL2000 DNA marker; Lane4-5, PCR band patterns of recombinant hPTHrP1-34 and hPTHrP1-84. SDS-PAGE analysis of the GST-hPTHrP1-34 (b) or GST-hPTHrP1-84 (d) fusion protein under inducing condition and stained with coomassie blue. LaneM, molecular weight marker; Lane1, total cell soluble protein of BL21, control; Lanes2–6, cells with pGEX-2TK/hPTHrP1-34 or pGEX-2TK/hPTHrP1-84 after inducing with IPTG 0 h, 1 h, 2 h, 3 h, 4 h respectively. SDS-PAGE analyses of hPTHrP1-34 (c) or hPTHrP1-84 (e) peptide expression and purification. LaneM, molecular weight marker; Lane1, IPTG induction of BL21 transformed with pGEX-2TK without insert (expression control); Lane2, BL21 transformed with pGEX-2TK/hPTHrP1-34 or pGEX-2TK/hPTHrP1-84 without IPTG induction (induction control); Lane3, IPTG induction of BL21 transformed with pGEX-2TK/hPTHrP1-34 or pGEX-2TK/hPTHrP1-84 ; Lane4, The proteins not bound to GSTrap FF column; Lane5, Purified hPTHrP1-34 or hPTHrP1-84 obtained after binding to GSTrap FF column and cleaved by thrombin; Lane6, GST-tag eluted from GSTrap FF column. (f) Western blot analysis of purified recombinant hPTHrP1-34 and hPTHrP1-84 with N-terminal hPTHrP antibody.
Figure Legend Snippet: Preparation of Recombinant hPTHrP1-34 and 1-84. (a) Determination of the recombinants by PCR and double-enzyme (EcoR I+ BamH I) digestion. LaneM1, l-Hind III digest DNA marker; Lane1-3, double-enzyme digestion patterns of recombinant hPTHrP1-34 , hPTHrP1-84 and pGEX-2TK ; LaneM2, DL2000 DNA marker; Lane4-5, PCR band patterns of recombinant hPTHrP1-34 and hPTHrP1-84. SDS-PAGE analysis of the GST-hPTHrP1-34 (b) or GST-hPTHrP1-84 (d) fusion protein under inducing condition and stained with coomassie blue. LaneM, molecular weight marker; Lane1, total cell soluble protein of BL21, control; Lanes2–6, cells with pGEX-2TK/hPTHrP1-34 or pGEX-2TK/hPTHrP1-84 after inducing with IPTG 0 h, 1 h, 2 h, 3 h, 4 h respectively. SDS-PAGE analyses of hPTHrP1-34 (c) or hPTHrP1-84 (e) peptide expression and purification. LaneM, molecular weight marker; Lane1, IPTG induction of BL21 transformed with pGEX-2TK without insert (expression control); Lane2, BL21 transformed with pGEX-2TK/hPTHrP1-34 or pGEX-2TK/hPTHrP1-84 without IPTG induction (induction control); Lane3, IPTG induction of BL21 transformed with pGEX-2TK/hPTHrP1-34 or pGEX-2TK/hPTHrP1-84 ; Lane4, The proteins not bound to GSTrap FF column; Lane5, Purified hPTHrP1-34 or hPTHrP1-84 obtained after binding to GSTrap FF column and cleaved by thrombin; Lane6, GST-tag eluted from GSTrap FF column. (f) Western blot analysis of purified recombinant hPTHrP1-34 and hPTHrP1-84 with N-terminal hPTHrP antibody.

Techniques Used: Recombinant, Polymerase Chain Reaction, Marker, SDS Page, Staining, Molecular Weight, Expressing, Purification, Transformation Assay, Binding Assay, Western Blot

3) Product Images from "Vimentin is a novel AKT1 target mediating motility and invasion"

Article Title: Vimentin is a novel AKT1 target mediating motility and invasion

Journal: Oncogene

doi: 10.1038/onc.2010.421

AKT1 C-Terminal tail domain interacts with vimentin head domain A. full-length AKT1 (AKT1-FL), AKT1 pleckstrin homology domain (AKT1-PH), AKT1 catalytic domain (AKT1-CAT), AKT1 C-terminal tail domain (AKT1-TAIL), full-length Vim (VIM-FL), Vim head domain (VIM-HEAD), Vim coiled-coil domain (VIM-CC), and Vim tail domain (VIM-TAIL) cDNA fragments were cloned into the pGEX4T1 vector to produce GST fusion proteins in E. coli BL21; B. GST-pull down assay indicated that the GST-AKT1-FL and GST-AKT1-TAIL domains interact with Vim in SKLMS1 cells; C. GST-pull down assay indicated that GST-VIM-FL and GST-VIM-HEAD domain interact with AKT1 in SKLMS1 cells; D. In vitro protein binding assays indicated that the GST-VIM-HEAD and the GST-AKT1-TAIL domains directly interact.
Figure Legend Snippet: AKT1 C-Terminal tail domain interacts with vimentin head domain A. full-length AKT1 (AKT1-FL), AKT1 pleckstrin homology domain (AKT1-PH), AKT1 catalytic domain (AKT1-CAT), AKT1 C-terminal tail domain (AKT1-TAIL), full-length Vim (VIM-FL), Vim head domain (VIM-HEAD), Vim coiled-coil domain (VIM-CC), and Vim tail domain (VIM-TAIL) cDNA fragments were cloned into the pGEX4T1 vector to produce GST fusion proteins in E. coli BL21; B. GST-pull down assay indicated that the GST-AKT1-FL and GST-AKT1-TAIL domains interact with Vim in SKLMS1 cells; C. GST-pull down assay indicated that GST-VIM-FL and GST-VIM-HEAD domain interact with AKT1 in SKLMS1 cells; D. In vitro protein binding assays indicated that the GST-VIM-HEAD and the GST-AKT1-TAIL domains directly interact.

Techniques Used: Clone Assay, Plasmid Preparation, Pull Down Assay, In Vitro, Protein Binding

4) Product Images from "Drosophila Prominin-like, a homolog of CD133, interacts with ND20 to maintain mitochondrial function"

Article Title: Drosophila Prominin-like, a homolog of CD133, interacts with ND20 to maintain mitochondrial function

Journal: Cell & Bioscience

doi: 10.1186/s13578-019-0365-0

Prominin-like interacts with ND20 proteins. a Schematic illustration of truncated Prominin-like region. The cDNA fragments encoding amino acid: 55–164, 236–491, 558–851, and 875–1014 of prominin - like were cloned into vectors for interaction assays. b , c Yeast two-hybrid assays: pGBKT7-53 and pGADT7-T were used as positive controls with pGBKT7-Lam and pGADT7-T as negative controls; Mated yeast strains containing both bait vectors (pGBKT7-PL-1,-2,-3 or -4) and prey vectors (pGADT7-ND20) were plated on double dropout (DDO/X) ( b ) and higher stringency quadruple dropout (QDO/X/A) selective agar medium ( c ); there were one-to-one correspondences among a – f in b and c . d GST pull-down assays. GST or GST-PL-1 fusion protein generated by E. Coli BL21 cells was purified by glutathione agarose resin, followed by incubation of the resin with HA-ND20 protein expressed in S2 cells. After washing with PBS, the bound proteins were analyzed by Western blotting with anti-HA antibodies. e , f Co-IP assay analysis of the interaction between Prominin-like and ND20. Cells were co-transfected with pAC5.1-Flag-Prominin-like and pAHW-HA-ND20 in S2 cells; co-transfection of pAC5.1-Flag and pAHW-HA served as negative controls. Some of the lysates were subjected to input assays to assess β-tubulin, Flag-Prominin-like and HA-ND20 protein levels, and the remainder were subjected to IP assays. e HA-ND20 proteins were detected by Western blotting using anti-HA antibodies. f Flag-prominin-like proteins were detected by Western blotting using anti-Flag antibodies in the presence of the cross linker, DTSSP
Figure Legend Snippet: Prominin-like interacts with ND20 proteins. a Schematic illustration of truncated Prominin-like region. The cDNA fragments encoding amino acid: 55–164, 236–491, 558–851, and 875–1014 of prominin - like were cloned into vectors for interaction assays. b , c Yeast two-hybrid assays: pGBKT7-53 and pGADT7-T were used as positive controls with pGBKT7-Lam and pGADT7-T as negative controls; Mated yeast strains containing both bait vectors (pGBKT7-PL-1,-2,-3 or -4) and prey vectors (pGADT7-ND20) were plated on double dropout (DDO/X) ( b ) and higher stringency quadruple dropout (QDO/X/A) selective agar medium ( c ); there were one-to-one correspondences among a – f in b and c . d GST pull-down assays. GST or GST-PL-1 fusion protein generated by E. Coli BL21 cells was purified by glutathione agarose resin, followed by incubation of the resin with HA-ND20 protein expressed in S2 cells. After washing with PBS, the bound proteins were analyzed by Western blotting with anti-HA antibodies. e , f Co-IP assay analysis of the interaction between Prominin-like and ND20. Cells were co-transfected with pAC5.1-Flag-Prominin-like and pAHW-HA-ND20 in S2 cells; co-transfection of pAC5.1-Flag and pAHW-HA served as negative controls. Some of the lysates were subjected to input assays to assess β-tubulin, Flag-Prominin-like and HA-ND20 protein levels, and the remainder were subjected to IP assays. e HA-ND20 proteins were detected by Western blotting using anti-HA antibodies. f Flag-prominin-like proteins were detected by Western blotting using anti-Flag antibodies in the presence of the cross linker, DTSSP

Techniques Used: Clone Assay, Laser Capture Microdissection, Generated, Purification, Incubation, Western Blot, Co-Immunoprecipitation Assay, Transfection, Cotransfection

5) Product Images from "A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi"

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20020885

(A) Purification of recombinant TcOYE. TcOYE was expressed as a fusion protein with GSH in E. coli BL21. Lane 1, molecular weight markers; lane 2, lysates from noninduced E. coli BL21 cells expressing pGEX-TcOYE; lane 3, lysates from IPTG-induced E. coli BL21 cells expressing pGEX-TcOYE; lane 4, after affinity chromatography; lane 5, pure recombinant TcOYE. (B) Immunoblot analyses of cell extracts from T. cruzi epimastigote and T. brucei bloodstream form. After blotting, the membranes were incubated with anti-TcOYE or anti-TbPGFS polyclonal antibodies. On the left, SDS-PAGE of the lysates corresponding to T. brucei (Tb) and T. cruzi (Tc) is shown. The proteins were detected with Coomassie Brilliant Blue (CBB). The middle shows a Western blot for proteins incubated with anti-TcOYE polyclonal antibody. The right shows a Western blot for proteins incubated with anti-TbPGFS polyclonal antibody. (C) LC-MS chromatograms of the relative ion intensity for TcOYE-generated PGF 2α . Top, standard PGF 2α ; left, substrate (9,11-endoperoxide PGH 2 ) showing traces of nonenzymatic degradation products (PGE 2 , 11β-PGE 2 , PGD 2 , and PGJ 2 ); bottom, PGF 2α resulting from the reduction of the substrate by TcOYE. The chromatograms for PGE 2 , 11β-PGE 2 , PGD 2 , and PGH 2 were visualized at m/z = 351.2, whereas that of PGF 2α was monitored at m/z = 353.2. (D) Mass spectra showing the [M-H] − ions of authentic PGF 2α (top), PGH 2 (middle), and TcOYE-generated PGF 2α (bottom).
Figure Legend Snippet: (A) Purification of recombinant TcOYE. TcOYE was expressed as a fusion protein with GSH in E. coli BL21. Lane 1, molecular weight markers; lane 2, lysates from noninduced E. coli BL21 cells expressing pGEX-TcOYE; lane 3, lysates from IPTG-induced E. coli BL21 cells expressing pGEX-TcOYE; lane 4, after affinity chromatography; lane 5, pure recombinant TcOYE. (B) Immunoblot analyses of cell extracts from T. cruzi epimastigote and T. brucei bloodstream form. After blotting, the membranes were incubated with anti-TcOYE or anti-TbPGFS polyclonal antibodies. On the left, SDS-PAGE of the lysates corresponding to T. brucei (Tb) and T. cruzi (Tc) is shown. The proteins were detected with Coomassie Brilliant Blue (CBB). The middle shows a Western blot for proteins incubated with anti-TcOYE polyclonal antibody. The right shows a Western blot for proteins incubated with anti-TbPGFS polyclonal antibody. (C) LC-MS chromatograms of the relative ion intensity for TcOYE-generated PGF 2α . Top, standard PGF 2α ; left, substrate (9,11-endoperoxide PGH 2 ) showing traces of nonenzymatic degradation products (PGE 2 , 11β-PGE 2 , PGD 2 , and PGJ 2 ); bottom, PGF 2α resulting from the reduction of the substrate by TcOYE. The chromatograms for PGE 2 , 11β-PGE 2 , PGD 2 , and PGH 2 were visualized at m/z = 351.2, whereas that of PGF 2α was monitored at m/z = 353.2. (D) Mass spectra showing the [M-H] − ions of authentic PGF 2α (top), PGH 2 (middle), and TcOYE-generated PGF 2α (bottom).

Techniques Used: Purification, Recombinant, Molecular Weight, Expressing, Affinity Chromatography, Incubation, SDS Page, Western Blot, Liquid Chromatography with Mass Spectroscopy, Generated

6) Product Images from "Development and application of an antibody detection ELISA for Haemophilus parasuis based on a monomeric autotransporter passenger domain"

Article Title: Development and application of an antibody detection ELISA for Haemophilus parasuis based on a monomeric autotransporter passenger domain

Journal: BMC Veterinary Research

doi: 10.1186/s12917-019-2128-x

Expression, purification, and screening of EspP1, rEspP2, and rApd. a Expression of rEspP1, rEspP2, and rApd in E. coli BL21 (DE3). MW, molecular weight. Lane 1, Transformants including vectors; Lane 2, Non-induced transformants including plasmids pET-espP1, pET-espP2, and pET-apd; Lane 3, Induced transformants including plasmids pET-espP1, pET-espP2, and pET-apd; Lane 4, Supernatants from the sonication of the induced transformants; Lane 5, Pellets from the sonication of the induced transformants. Asterisk indicates the target protein bands. b Purification of the rEspP1, rEspP2, and rApd. Lane 1, Non-binding effluent fraction when loading; Lane 2–8, Eluted fraction using elution buffer containing imidazole at 5, 20, 50, 100, 150, 200, and 300 mM. Asterisks indicate the target protein bands. c rEspP1, rEspP2, and rApd were used to coat ELISA plates at 1 μg/ml to detect 12 positive and 12 negative porcine sera of H. parasuis . The line represents the average OD 630 value of the positive sera, and the dotted line represents that of the negative sera. For rEspP1 and rEspP2, the OD 630 values of negative sera were comparable with those of positive sera ( P > 0.05), whereas rApd clearly discriminated the positive from negative samples according to the OD 630 value ( P
Figure Legend Snippet: Expression, purification, and screening of EspP1, rEspP2, and rApd. a Expression of rEspP1, rEspP2, and rApd in E. coli BL21 (DE3). MW, molecular weight. Lane 1, Transformants including vectors; Lane 2, Non-induced transformants including plasmids pET-espP1, pET-espP2, and pET-apd; Lane 3, Induced transformants including plasmids pET-espP1, pET-espP2, and pET-apd; Lane 4, Supernatants from the sonication of the induced transformants; Lane 5, Pellets from the sonication of the induced transformants. Asterisk indicates the target protein bands. b Purification of the rEspP1, rEspP2, and rApd. Lane 1, Non-binding effluent fraction when loading; Lane 2–8, Eluted fraction using elution buffer containing imidazole at 5, 20, 50, 100, 150, 200, and 300 mM. Asterisks indicate the target protein bands. c rEspP1, rEspP2, and rApd were used to coat ELISA plates at 1 μg/ml to detect 12 positive and 12 negative porcine sera of H. parasuis . The line represents the average OD 630 value of the positive sera, and the dotted line represents that of the negative sera. For rEspP1 and rEspP2, the OD 630 values of negative sera were comparable with those of positive sera ( P > 0.05), whereas rApd clearly discriminated the positive from negative samples according to the OD 630 value ( P

Techniques Used: Expressing, Purification, Molecular Weight, Positron Emission Tomography, Sonication, Binding Assay, Enzyme-linked Immunosorbent Assay

7) Product Images from "PIASxα Ligase Enhances SUMO1 Modification of PTEN Protein as a SUMO E3 Ligase *"

Article Title: PIASxα Ligase Enhances SUMO1 Modification of PTEN Protein as a SUMO E3 Ligase *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M113.508515

PTEN is modified by SUMO1 in vitro . A , purified proteins used for SUMOylation assay in vitro . His-tagged proteins were expressed in E. coli strain BL21 (DE3) and purified with Ni 2+ -Sepharose. The purified proteins were detected by Western blot with anti-His
Figure Legend Snippet: PTEN is modified by SUMO1 in vitro . A , purified proteins used for SUMOylation assay in vitro . His-tagged proteins were expressed in E. coli strain BL21 (DE3) and purified with Ni 2+ -Sepharose. The purified proteins were detected by Western blot with anti-His

Techniques Used: Modification, In Vitro, Purification, Western Blot

Related Articles

Flow Cytometry:

Article Title: Development and application of an antibody detection ELISA for Haemophilus parasuis based on a monomeric autotransporter passenger domain
Article Snippet: .. EspP1, EspP2, and Apd were expressed as His fusion proteins in E. coli BL21 (DE3) and purified using Ni Sepharose 6Fast Flow (GE Healthcare Biosciences, Pittsburgh, PA, USA). .. The three purified protein concentrations were measured using a BCA kit (Bioshap, Hefei City, China).

Affinity Chromatography:

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi
Article Snippet: .. The soluble recombinant protein was produced in E. coli BL21 and purified by affinity chromatography on glutathione (GSH)-Sepharose 4B resin (Amersham Biosciences), ion exchange chromatography, and gel filtration according to the manufacturer's protocol. .. Electron Spin Resonance (ESR) Experiments.

Ion Exchange Chromatography:

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi
Article Snippet: .. The soluble recombinant protein was produced in E. coli BL21 and purified by affinity chromatography on glutathione (GSH)-Sepharose 4B resin (Amersham Biosciences), ion exchange chromatography, and gel filtration according to the manufacturer's protocol. .. Electron Spin Resonance (ESR) Experiments.

In Vitro:

Article Title: Vimentin is a novel AKT1 target mediating motility and invasion
Article Snippet: .. GST Fusion Protein Pull-Down and In Vitro Protein Binding Assays Expression of GST and GST-tagged full-length Vim, Vim fragments, full-length AKT1, and AKT1 fragments was induced in E. coli BL21, and proteins were purified by immobilization on glutathione-Sepharose-4B beads (GE Healthcare). .. For GST fusion protein pull-down assays, 50 μl of beads (5 μg of immobilized protein) were incubated with 500–1,000 μg of whole-cell lysates in 1% NP-40 buffer for 4 h at 4°C.

Protein Binding:

Article Title: Vimentin is a novel AKT1 target mediating motility and invasion
Article Snippet: .. GST Fusion Protein Pull-Down and In Vitro Protein Binding Assays Expression of GST and GST-tagged full-length Vim, Vim fragments, full-length AKT1, and AKT1 fragments was induced in E. coli BL21, and proteins were purified by immobilization on glutathione-Sepharose-4B beads (GE Healthcare). .. For GST fusion protein pull-down assays, 50 μl of beads (5 μg of immobilized protein) were incubated with 500–1,000 μg of whole-cell lysates in 1% NP-40 buffer for 4 h at 4°C.

Purification:

Article Title: Identification of Novel MAGE-G1-Interacting Partners in Retinoic Acid-Induced P19 Neuronal Differentiation Using SILAC-Based Proteomics
Article Snippet: .. GST pull-down assay GST, GST-FSCN1 or GST-VIME proteins were expressed in Escherichia coli BL21 and purified with Glutathione-Sepharose 4B beads (GE Healthcare, UK) and washed, then beads were incubated with Flag-MAGE-G1 expressed in HEK293T for 4 h at 4 °C. ..

Article Title: Vimentin is a novel AKT1 target mediating motility and invasion
Article Snippet: .. GST Fusion Protein Pull-Down and In Vitro Protein Binding Assays Expression of GST and GST-tagged full-length Vim, Vim fragments, full-length AKT1, and AKT1 fragments was induced in E. coli BL21, and proteins were purified by immobilization on glutathione-Sepharose-4B beads (GE Healthcare). .. For GST fusion protein pull-down assays, 50 μl of beads (5 μg of immobilized protein) were incubated with 500–1,000 μg of whole-cell lysates in 1% NP-40 buffer for 4 h at 4°C.

Article Title: Recombinant Human Parathyroid Hormone Related Protein 1-34 and 1-84 and Their Roles in Osteoporosis Treatment
Article Snippet: .. Purification of hPTHrP1-34 and 1-84 Purification of soluble hPTHrP1-34 and 1-84 separately from 1 liter culture of E. coli BL21 were performed on Glutathione Sepharose 4B columns (Amersham) using the recommended procedure. .. The fusion protein was digested 4h on the column with 20 U thrombin (Amersham) and eluted with 1 ml 1×PBS.

Article Title: PIASxα Ligase Enhances SUMO1 Modification of PTEN Protein as a SUMO E3 Ligase *
Article Snippet: .. His-tagged PTEN, SUMO1, Aos1 & Uba2 (SUMO E1-activating enzyme) and Ubc9 (SUMO E2-conjugating enzyme) expressed in E. coli BL21 (DE3) were purified by Ni2+ -Sepharose beads (GE Healthcare). .. Each in vitro SUMOylation reaction mixture contained 125 ng of PTEN, 1 μg of SUMO1, 250 ng of Aos1 & Uba2, 500 ng of Ubc9, and 8 μl of 5× reaction buffer (100 m m Hepes, pH 7.5, 25 m m MgCl2 , 125 m m NaCl, 1 m m DTT, 2 m m ATP); H2 O was added to make the final volume of 40 μl.

Article Title: Development and application of an antibody detection ELISA for Haemophilus parasuis based on a monomeric autotransporter passenger domain
Article Snippet: .. EspP1, EspP2, and Apd were expressed as His fusion proteins in E. coli BL21 (DE3) and purified using Ni Sepharose 6Fast Flow (GE Healthcare Biosciences, Pittsburgh, PA, USA). .. The three purified protein concentrations were measured using a BCA kit (Bioshap, Hefei City, China).

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi
Article Snippet: .. The soluble recombinant protein was produced in E. coli BL21 and purified by affinity chromatography on glutathione (GSH)-Sepharose 4B resin (Amersham Biosciences), ion exchange chromatography, and gel filtration according to the manufacturer's protocol. .. Electron Spin Resonance (ESR) Experiments.

Article Title: Drosophila Prominin-like, a homolog of CD133, interacts with ND20 to maintain mitochondrial function
Article Snippet: .. GST or GST-PL1 proteins were separately expressed in E. coli BL21 and purified using Glutathione Sepharose 4B beads (GE Healthcare) according to the manufacturer’s instructions. .. In brief, BL21 cells expressing GST or GST-PL1 protein were treated with pull-down lysis buffer on ice for 30 min, followed by immobilization on an equilibrated glutathione agarose resin for 2 h at 4 °C.

Produced:

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi
Article Snippet: .. The soluble recombinant protein was produced in E. coli BL21 and purified by affinity chromatography on glutathione (GSH)-Sepharose 4B resin (Amersham Biosciences), ion exchange chromatography, and gel filtration according to the manufacturer's protocol. .. Electron Spin Resonance (ESR) Experiments.

Incubation:

Article Title: Identification of Novel MAGE-G1-Interacting Partners in Retinoic Acid-Induced P19 Neuronal Differentiation Using SILAC-Based Proteomics
Article Snippet: .. GST pull-down assay GST, GST-FSCN1 or GST-VIME proteins were expressed in Escherichia coli BL21 and purified with Glutathione-Sepharose 4B beads (GE Healthcare, UK) and washed, then beads were incubated with Flag-MAGE-G1 expressed in HEK293T for 4 h at 4 °C. ..

Expressing:

Article Title: Vimentin is a novel AKT1 target mediating motility and invasion
Article Snippet: .. GST Fusion Protein Pull-Down and In Vitro Protein Binding Assays Expression of GST and GST-tagged full-length Vim, Vim fragments, full-length AKT1, and AKT1 fragments was induced in E. coli BL21, and proteins were purified by immobilization on glutathione-Sepharose-4B beads (GE Healthcare). .. For GST fusion protein pull-down assays, 50 μl of beads (5 μg of immobilized protein) were incubated with 500–1,000 μg of whole-cell lysates in 1% NP-40 buffer for 4 h at 4°C.

Filtration:

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi
Article Snippet: .. The soluble recombinant protein was produced in E. coli BL21 and purified by affinity chromatography on glutathione (GSH)-Sepharose 4B resin (Amersham Biosciences), ion exchange chromatography, and gel filtration according to the manufacturer's protocol. .. Electron Spin Resonance (ESR) Experiments.

Recombinant:

Article Title: A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi
Article Snippet: .. The soluble recombinant protein was produced in E. coli BL21 and purified by affinity chromatography on glutathione (GSH)-Sepharose 4B resin (Amersham Biosciences), ion exchange chromatography, and gel filtration according to the manufacturer's protocol. .. Electron Spin Resonance (ESR) Experiments.

Plasmid Preparation:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham. .. TUNEL assay A549 cells were assessed for the induction of single strand breaks (indicative of apoptosis) by the terminal deoxynucleotidyl transferase mediated X-dUTP nick end labeling (TUNEL) assay using the in situ cell death detection kit (Boehringer/Roche), according to the manufacturer's recommendations.

Pull Down Assay:

Article Title: Identification of Novel MAGE-G1-Interacting Partners in Retinoic Acid-Induced P19 Neuronal Differentiation Using SILAC-Based Proteomics
Article Snippet: .. GST pull-down assay GST, GST-FSCN1 or GST-VIME proteins were expressed in Escherichia coli BL21 and purified with Glutathione-Sepharose 4B beads (GE Healthcare, UK) and washed, then beads were incubated with Flag-MAGE-G1 expressed in HEK293T for 4 h at 4 °C. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    GE Healthcare h10 t mtc28 bap protein
    Purification of <t>MTC28-BAP</t> protein. Chromatogram showing (A) Elution profile of <t>H10-T-MTC28-BAP</t> protein on Ni Sepharose Fast Flow (NiFF) affinity column. Fraction numbers 6–17 were pooled (NiFF pool). (B) Elution profile of H10-T-MTC28-BAP protein on Superdex 75 gel-filtration column. Fraction numbers 16–24 were pooled (GFC pool). The GFC pool was treated with H6-TEV protease to cleave H10 tag from the protein followed by removal of cleaved tag and H6-TEV protease using Ni-affinity chromatography. (C) Elution profile of MTC28-BAP protein on Q Sepharose HP column. Fraction numbers 22–27 were pooled (QHP pool). (D) SDS-PAGE analysis of H10-T-MTC28-BAP protein at different stages during purification. The samples were analyzed by 0.1% SDS-12.5% PAGE under reducing conditions. The protein bands were visualized with Coomassie brilliant blue R-250 staining. Lane M, molecular weight marker, broad range (Bio-Rad, Hercules, CA) (shown in kDa); Lane 1, total cell after homogenization; Lane 2, High-High Speed Supernatant; Lane 3, NiFF pool; Lane 4, GFC pool; Lane 5, NiFF-TT pool (after desalting); Lane 6, QHP pool.
    H10 T Mtc28 Bap Protein, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/h10 t mtc28 bap protein/product/GE Healthcare
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    h10 t mtc28 bap protein - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    88
    GE Healthcare bl21 de3 plyss e coli
    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot. " width="250" height="auto" />
    Bl21 De3 Plyss E Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss e coli/product/GE Healthcare
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss e coli - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    94
    GE Healthcare escherichia coli
    Expression patterns and subcellular localization of AtPR5K2. (A) The expression of AtPR5K2 in various tissues of Arabidopsis thaliana . Total RNA was extracted from the roots, rosette leaves, cauline leaves, stems, flowers, and siliques of the wild-type plants. The transcript levels of AtPR5K2 were measured using quantitative reverse transcription PCR (qRT-PCR) and calculated relative to the expression of the endogenous control gene, TUBULIN2 . Error bars represent the ± SD from three independent experiments. (B) Subcellular localization of AtPR5K2 in Arabidopsis protoplasts. 35S:AtPR5K2-GFP and Aquaporin-RFP were coexpressed in Arabidopsis protoplasts, which were analyzed using confocal fluorescence microscopy and photographed after 24 h of incubation at 22°C. Aquaporin-RFP is a plasma-membrane marker. Scale bars represent 10 μm. (C) Subcellular localization of AtPR5K2 in the epidermal cells of tobacco ( Nicotiana benthamiana ) leave expressing 35S:AtPR5K2-GFP before and after plasmolysis. The epidermal cells were analyzed using confocal fluorescence microscopy and photographed after 48 h of incubation at 25°C. Scale bars represent 20 μm. Red asterisk indicates that AtPR5K2-GFP signal remains in the Hechtian strands. Red arrowheads point to the retracted plasma membrane. (D) In vitro kinase assays of AtPR5K2. The upper panel indicates the schematic structure of the GST-fused AtPR5K2 kinase domain (wPR5K2KD) and the GST-fused mutagenized AtPR5K2 kinase domain (mPR5K2KD). Each kinase domain was individually expressed in <t>Escherichia</t> coli , and 2 μg purified proteins was incubated in kinase assay buffer. Radioactive-labeled products were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and detected using radioactivity (bottom right). After electrophoresis, the purified products were stained with Coomassie brilliant blue (bottom left).
    Escherichia Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 339 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli/product/GE Healthcare
    Average 94 stars, based on 339 article reviews
    Price from $9.99 to $1999.99
    escherichia coli - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    GE Healthcare bl21 cells
    Localization of SET binding site within the M3-i3 loop. A, the carboxyl-terminal end of the third intracellular loop of the M3-MR (Thr 450 -Q 490 ) was expressed in <t>BL21</t> cells as a GST fusion protein and purified on glutathione Sepharose 4B. Purified GST
    Bl21 Cells, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 cells/product/GE Healthcare
    Average 93 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    bl21 cells - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    Purification of MTC28-BAP protein. Chromatogram showing (A) Elution profile of H10-T-MTC28-BAP protein on Ni Sepharose Fast Flow (NiFF) affinity column. Fraction numbers 6–17 were pooled (NiFF pool). (B) Elution profile of H10-T-MTC28-BAP protein on Superdex 75 gel-filtration column. Fraction numbers 16–24 were pooled (GFC pool). The GFC pool was treated with H6-TEV protease to cleave H10 tag from the protein followed by removal of cleaved tag and H6-TEV protease using Ni-affinity chromatography. (C) Elution profile of MTC28-BAP protein on Q Sepharose HP column. Fraction numbers 22–27 were pooled (QHP pool). (D) SDS-PAGE analysis of H10-T-MTC28-BAP protein at different stages during purification. The samples were analyzed by 0.1% SDS-12.5% PAGE under reducing conditions. The protein bands were visualized with Coomassie brilliant blue R-250 staining. Lane M, molecular weight marker, broad range (Bio-Rad, Hercules, CA) (shown in kDa); Lane 1, total cell after homogenization; Lane 2, High-High Speed Supernatant; Lane 3, NiFF pool; Lane 4, GFC pool; Lane 5, NiFF-TT pool (after desalting); Lane 6, QHP pool.

    Journal: PLoS ONE

    Article Title: Biotin-tagged proteins: Reagents for efficient ELISA-based serodiagnosis and phage display-based affinity selection

    doi: 10.1371/journal.pone.0191315

    Figure Lengend Snippet: Purification of MTC28-BAP protein. Chromatogram showing (A) Elution profile of H10-T-MTC28-BAP protein on Ni Sepharose Fast Flow (NiFF) affinity column. Fraction numbers 6–17 were pooled (NiFF pool). (B) Elution profile of H10-T-MTC28-BAP protein on Superdex 75 gel-filtration column. Fraction numbers 16–24 were pooled (GFC pool). The GFC pool was treated with H6-TEV protease to cleave H10 tag from the protein followed by removal of cleaved tag and H6-TEV protease using Ni-affinity chromatography. (C) Elution profile of MTC28-BAP protein on Q Sepharose HP column. Fraction numbers 22–27 were pooled (QHP pool). (D) SDS-PAGE analysis of H10-T-MTC28-BAP protein at different stages during purification. The samples were analyzed by 0.1% SDS-12.5% PAGE under reducing conditions. The protein bands were visualized with Coomassie brilliant blue R-250 staining. Lane M, molecular weight marker, broad range (Bio-Rad, Hercules, CA) (shown in kDa); Lane 1, total cell after homogenization; Lane 2, High-High Speed Supernatant; Lane 3, NiFF pool; Lane 4, GFC pool; Lane 5, NiFF-TT pool (after desalting); Lane 6, QHP pool.

    Article Snippet: For H10-T-MTC28-BAP protein, gel-filtration chromatography of NiFF pool was performed on 480 ml Superdex 75 column (XK 26/100, GE Healthcare).

    Techniques: Purification, Flow Cytometry, Affinity Column, Filtration, Affinity Chromatography, SDS Page, Polyacrylamide Gel Electrophoresis, Staining, Molecular Weight, Marker, Homogenization

    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as "A", full sequence of ROP2 without signal sequence; "B", 1/2 Nt sequence of ROP2; "C", 1/2 Ct containing kinase domain; "D", 1/4 Nt; "E", middle 1/4 Ct; "G", 1/4Ct; "H", 1/2 Nt of kinase domain; and "I", 1/2 Ct of kinase domain. (B) Expression of recombinant ROP2 antigens. All recombinant proteins were well induced and tested by western blot with anti-GST antibody. (C) Antigenicity of recombinant ROP2 antigens. The antigenicity was tested by western blot against patient serum. (D) Solubility of recombinant ROP2 antigens. Solubility of rGST-ROP2 324-561 induced was confirmed by western blot with anti-GST antibody. (E) Expression of recombinant linker ROP2 antigens. "L", lysate of BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot.

    Article Snippet: The pGEX-4T-1 and recombinant plasmids were transformed into BL21 (DE3) pLysS E. coli .

    Techniques: Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility, Transformation Assay

    Production of GST-GRA2 fusion protein.

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-GRA2 fusion protein. "N" indicates lysate of BL21 (DE3) pLysS E. coli without induction; "G", lysate of E. coli transformed with vector after induction; "R", Toxoplasma lysate antigen (TLA) of RH strain; "T", total lysates of E. coli ; "S", soluble fraction; and "P", insoluble fraction. The meaning of abbreviations is the same in the following context without extra illustration. (A) Design of fragmentation of cDNA of GRA2; 7 fragments of GRA2 were cloned. The name of clones and amino acid regions are indicated. "F", full sequence of GRA2 without signal sequence; "A", 2/3 N-terminal (Nt); "B", 2/3 C-terminal (Ct); "C", half Nt; "D", half Ct; "E", middle 1/3 sequence; and "L", linker, is the high disorder sequence of Nt. (B) Expression of recombinant GRA2 antigens induced at 30℃, 0.5 mM IPTG. Target bands against GST by western blot were marked with asterisks. (C) Antigenicity of recombinant GRA2 antigens. Patient serum was applied to detect the antigenicity of recombinant proteins against human IgG by western blot. The detectable signal was marked with asterisks. (D) Solubility of recombinant GRA2 antigens. The solubility of rGST-GRA2 25-105 was tested by western blot against GST.

    Article Snippet: The pGEX-4T-1 and recombinant plasmids were transformed into BL21 (DE3) pLysS E. coli .

    Techniques: Transformation Assay, Plasmid Preparation, Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility

    Production of GST-MIC2 fusion protein. (A) Design of fragmentation of cDNA of MIC2. Ten fragments of MIC2 were cloned as

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-MIC2 fusion protein. (A) Design of fragmentation of cDNA of MIC2. Ten fragments of MIC2 were cloned as "F", full sequence of MIC2; "A", full sequence without Ct transmembrane region; "B", 2/3 Nt; "C", 2/3 Ct; "D", 1/3 Nt; "E", middle 1/3; "G", 1/3 Ct; "H", half Nt of D; "I", half Ct of D; and "J", middle 1/3 of D. (B) Expression of recombinant MIC2 antigens. All recombinant proteins were well induced and tested by western blot against anti-GST antibody. (C) Antigenicity of recombinant MIC2 antigens. The antigenicity of GST-MIC2 was tested by western blot against patient serum. (D) Solubility of recombinant MIC2 antigens. Total lysate, soluble, and insoluble fractions of rGST-MIC2 1-284 were detected against GST antibody. (E) Expression of recombinant linker MIC2 antigens. BL21 (DE3) pLysS E. coli containing GST and GST linker MIC2 1-284 recombinant plasmids were induced; "L", lysate transformed with pGEX-4T-1/GRA2 31-71 ; "M2", that with pGEX-4T-1/MIC2 1-284 ; and "LM", that with pGEX-4T-1/GRA2 31-71 -MIC2 1-284 . The expression was confirmed against anti-GST antibody. (F) Antigenicity of recombinant linker MIC2 antigens. It was tested against patient serum. (G) Solubility of recombinant linker MIC2 antigens. The soluble and insoluble fractions of rGST-GRA2 31-71 -MIC2 1-284 protein were tested by western blot.

    Article Snippet: The pGEX-4T-1 and recombinant plasmids were transformed into BL21 (DE3) pLysS E. coli .

    Techniques: Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility, Transformation Assay

    Expression patterns and subcellular localization of AtPR5K2. (A) The expression of AtPR5K2 in various tissues of Arabidopsis thaliana . Total RNA was extracted from the roots, rosette leaves, cauline leaves, stems, flowers, and siliques of the wild-type plants. The transcript levels of AtPR5K2 were measured using quantitative reverse transcription PCR (qRT-PCR) and calculated relative to the expression of the endogenous control gene, TUBULIN2 . Error bars represent the ± SD from three independent experiments. (B) Subcellular localization of AtPR5K2 in Arabidopsis protoplasts. 35S:AtPR5K2-GFP and Aquaporin-RFP were coexpressed in Arabidopsis protoplasts, which were analyzed using confocal fluorescence microscopy and photographed after 24 h of incubation at 22°C. Aquaporin-RFP is a plasma-membrane marker. Scale bars represent 10 μm. (C) Subcellular localization of AtPR5K2 in the epidermal cells of tobacco ( Nicotiana benthamiana ) leave expressing 35S:AtPR5K2-GFP before and after plasmolysis. The epidermal cells were analyzed using confocal fluorescence microscopy and photographed after 48 h of incubation at 25°C. Scale bars represent 20 μm. Red asterisk indicates that AtPR5K2-GFP signal remains in the Hechtian strands. Red arrowheads point to the retracted plasma membrane. (D) In vitro kinase assays of AtPR5K2. The upper panel indicates the schematic structure of the GST-fused AtPR5K2 kinase domain (wPR5K2KD) and the GST-fused mutagenized AtPR5K2 kinase domain (mPR5K2KD). Each kinase domain was individually expressed in Escherichia coli , and 2 μg purified proteins was incubated in kinase assay buffer. Radioactive-labeled products were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and detected using radioactivity (bottom right). After electrophoresis, the purified products were stained with Coomassie brilliant blue (bottom left).

    Journal: Frontiers in Plant Science

    Article Title: AtPR5K2, a PR5-Like Receptor Kinase, Modulates Plant Responses to Drought Stress by Phosphorylating Protein Phosphatase 2Cs

    doi: 10.3389/fpls.2019.01146

    Figure Lengend Snippet: Expression patterns and subcellular localization of AtPR5K2. (A) The expression of AtPR5K2 in various tissues of Arabidopsis thaliana . Total RNA was extracted from the roots, rosette leaves, cauline leaves, stems, flowers, and siliques of the wild-type plants. The transcript levels of AtPR5K2 were measured using quantitative reverse transcription PCR (qRT-PCR) and calculated relative to the expression of the endogenous control gene, TUBULIN2 . Error bars represent the ± SD from three independent experiments. (B) Subcellular localization of AtPR5K2 in Arabidopsis protoplasts. 35S:AtPR5K2-GFP and Aquaporin-RFP were coexpressed in Arabidopsis protoplasts, which were analyzed using confocal fluorescence microscopy and photographed after 24 h of incubation at 22°C. Aquaporin-RFP is a plasma-membrane marker. Scale bars represent 10 μm. (C) Subcellular localization of AtPR5K2 in the epidermal cells of tobacco ( Nicotiana benthamiana ) leave expressing 35S:AtPR5K2-GFP before and after plasmolysis. The epidermal cells were analyzed using confocal fluorescence microscopy and photographed after 48 h of incubation at 25°C. Scale bars represent 20 μm. Red asterisk indicates that AtPR5K2-GFP signal remains in the Hechtian strands. Red arrowheads point to the retracted plasma membrane. (D) In vitro kinase assays of AtPR5K2. The upper panel indicates the schematic structure of the GST-fused AtPR5K2 kinase domain (wPR5K2KD) and the GST-fused mutagenized AtPR5K2 kinase domain (mPR5K2KD). Each kinase domain was individually expressed in Escherichia coli , and 2 μg purified proteins was incubated in kinase assay buffer. Radioactive-labeled products were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and detected using radioactivity (bottom right). After electrophoresis, the purified products were stained with Coomassie brilliant blue (bottom left).

    Article Snippet: The GST-fused recombinant proteins were expressed in Escherichia coli (BL21 strain) and purified using glutathione sepharose 4B (GE Healthcare, Chicago, IL, USA), according to the manufacturer’s instructions.

    Techniques: Expressing, Polymerase Chain Reaction, Quantitative RT-PCR, Fluorescence, Microscopy, Incubation, Marker, In Vitro, Purification, Kinase Assay, Labeling, Polyacrylamide Gel Electrophoresis, SDS Page, Radioactivity, Electrophoresis, Staining

    Localization of SET binding site within the M3-i3 loop. A, the carboxyl-terminal end of the third intracellular loop of the M3-MR (Thr 450 -Q 490 ) was expressed in BL21 cells as a GST fusion protein and purified on glutathione Sepharose 4B. Purified GST

    Journal: Molecular Pharmacology

    Article Title:

    doi: 10.1124/mol.111.075523

    Figure Lengend Snippet: Localization of SET binding site within the M3-i3 loop. A, the carboxyl-terminal end of the third intracellular loop of the M3-MR (Thr 450 -Q 490 ) was expressed in BL21 cells as a GST fusion protein and purified on glutathione Sepharose 4B. Purified GST

    Article Snippet: GST fusion proteins were expressed in BL21 cells and purified on glutathione Sepharose 4B (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK) as described previously ( , ).

    Techniques: Binding Assay, Purification