Structured Review

GE Healthcare e coli bl21
Expression of Thc_Cut1_hfb4 in E. coli <t>BL21-Gold(DE3)</t> at 25°C. Lane 1, uninduced cells; lanes 2 to 4, soluble cell fractions after 5 h, 10 h, and 21 h of induction; lanes 5 and 6, insoluble cell fractions after 10 h and 21 h of induction; lane 7, standard (PageRuler prestained protein ladder). Molecular masses are given on the right.
E Coli Bl21, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli bl21/product/GE Healthcare
Average 75 stars, based on 1 article reviews
Price from $9.99 to $1999.99
e coli bl21 - by Bioz Stars, 2020-01
75/100 stars

Images

1) Product Images from "Enhanced Cutinase-Catalyzed Hydrolysis of Polyethylene Terephthalate by Covalent Fusion to Hydrophobins"

Article Title: Enhanced Cutinase-Catalyzed Hydrolysis of Polyethylene Terephthalate by Covalent Fusion to Hydrophobins

Journal:

doi: 10.1128/AEM.04111-14

Expression of Thc_Cut1_hfb4 in E. coli BL21-Gold(DE3) at 25°C. Lane 1, uninduced cells; lanes 2 to 4, soluble cell fractions after 5 h, 10 h, and 21 h of induction; lanes 5 and 6, insoluble cell fractions after 10 h and 21 h of induction; lane 7, standard (PageRuler prestained protein ladder). Molecular masses are given on the right.
Figure Legend Snippet: Expression of Thc_Cut1_hfb4 in E. coli BL21-Gold(DE3) at 25°C. Lane 1, uninduced cells; lanes 2 to 4, soluble cell fractions after 5 h, 10 h, and 21 h of induction; lanes 5 and 6, insoluble cell fractions after 10 h and 21 h of induction; lane 7, standard (PageRuler prestained protein ladder). Molecular masses are given on the right.

Techniques Used: Expressing

2) Product Images from "A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells"

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells

Journal: Oncotarget

doi: 10.18632/oncotarget.9179

Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
Figure Legend Snippet: Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

Techniques Used: Mutagenesis, Amplification, Recombinant, Purification, Incubation, Immunoprecipitation

3) Product Images from "Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea"

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea

Journal:

doi: 10.1128/IAI.00550-17

Construction and detection of tagless adhesin-toxoid MEFA CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A . (A) Schematic illustration of the construction of tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA. PCRs were carried out to remove nucleotides coding the 6×His tag, to replace the fragment coding amino acids 31 to 159 of LTA with nucleotides coding the CFA/I/II/IV MEFA, and to generate an ORF coding a tagless adhesin-toxoid MEFA. (B) Coomassie blue staining of extracted and refolded tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA recombinant protein to assess protein purity. (C) Western blot assays to detect tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA protein with anti-CFA/I, -CS1, -CS2, -CS3, -CS4, -CS5, and -CS6 MAb hybridoma supernatant (1:100; provided by A. M. Svennerholm), and rabbit anti-STa (1:5,000; provided by D. C. Robertson) and anti-CT (1:5,000; Sigma) antisera, in 12% PAGE gel. IRDye-labeled goat anti-mouse and anti-rabbit IgG (1:5,000; LI-COR) were used as the secondary antibodies. Two protein samples were included: 1, the tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA proteins; 2, total proteins of E. coli BL21 host strain, with a protein marker (in kilodaltons; Precision Plus Protein prestained standards; Bio-Rad).
Figure Legend Snippet: Construction and detection of tagless adhesin-toxoid MEFA CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A . (A) Schematic illustration of the construction of tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA. PCRs were carried out to remove nucleotides coding the 6×His tag, to replace the fragment coding amino acids 31 to 159 of LTA with nucleotides coding the CFA/I/II/IV MEFA, and to generate an ORF coding a tagless adhesin-toxoid MEFA. (B) Coomassie blue staining of extracted and refolded tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA recombinant protein to assess protein purity. (C) Western blot assays to detect tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA protein with anti-CFA/I, -CS1, -CS2, -CS3, -CS4, -CS5, and -CS6 MAb hybridoma supernatant (1:100; provided by A. M. Svennerholm), and rabbit anti-STa (1:5,000; provided by D. C. Robertson) and anti-CT (1:5,000; Sigma) antisera, in 12% PAGE gel. IRDye-labeled goat anti-mouse and anti-rabbit IgG (1:5,000; LI-COR) were used as the secondary antibodies. Two protein samples were included: 1, the tagless CFA/I/II/IV-3xSTaN12S -mnLTR192G/L211A MEFA proteins; 2, total proteins of E. coli BL21 host strain, with a protein marker (in kilodaltons; Precision Plus Protein prestained standards; Bio-Rad).

Techniques Used: Staining, Recombinant, Western Blot, Polyacrylamide Gel Electrophoresis, Labeling, Marker

Related Articles

Clone Assay:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Full-length FHIT cDNA (441 bp) and shorter cDNAs, FHIT -TR1 (332 bp), FHIT -TR2 (212 bp), and FHIT -TR3 (113 bp) containing the common FHIT 5′-end were cloned in the pGEX-2T plasmid, and were expressed in E. coli (BL21). .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

Article Title: Enhanced Cutinase-Catalyzed Hydrolysis of Polyethylene Terephthalate by Covalent Fusion to Hydrophobins
Article Snippet: Stellar competent cells from E. coli HST04 were purchased from Clontech (TaKaRa Bio Company, CA, USA) and were used for the cloning of hydrophobin-encoding genes and the propagation of plasmid DNA. .. E. coli BL21 (protease deficient) and expression plasmid pGEX-4T-2 were purchased from GE Healthcare (Amersham, England).

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. Expression of the glutathione S -transferase (GST)-fusion protein and preparation of cell extracts were performed according to the manufacturer’s instructions.

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: PCR products were cloned into the BamHI and SmaI sites of pGEX-2TK (GE Healthcare Life Sciences). .. Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: Expression and purification of recombinant GST-P46L proteins : P46L cDNA, containing TGG codons that had been substituted for TGA, was cloned into pGEX-6P-2 (GE Healthcare Bio-Science, Piscataway, NJ, U.S.A.) between the Bam HI andEco RI recognition sites. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth. .. Expression of proteins was induced through the addition of 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG).

Article Title: Recombinant Production of the Amino Terminal Cytoplasmic Region of Dengue Virus Non-Structural Protein 4A for Structural Studies
Article Snippet: E. coli Mach 1 cells obtained from Life Technologies GmbH (Darmstadt, Germany) were used for cloning purposes. .. E. coli BL21-(DE3) (Agilent Technologies, Inc., Santa Clara, CA, USA) or E. coli BL21 (GE Healthcare, Freiburg, Germany) strains were used for peptide expression.

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: Immunoprecipitates were resuspended in heated 2× Laemmli sample buffer (Bio-Rad). .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously . .. Proteins (1 μg) were incubated with hippocampal synaptosomal lysates (100 μg) in co-IP buffer overnight at 4 °C.

Article Title: Coagulase and Efb of Staphylococcus aureus Have a Common Fibrinogen Binding Motif
Article Snippet: Our human subject research protocol was reviewed and approved by the Institutional Review Board of Texas A & M University Human Research Protection Program (HRPP; approved protocol IRB2011-0890D). .. Escherichia coli XL-1 Blue (Stratagene) was used as the host for plasmid cloning, whereas E. coli BL21 (GE Healthcare) were used for expression of GST-tagged fusion proteins. .. Chromosomal DNA from S. aureus strain Newman was used to amplify the Coa DNA sequence.

Centrifugation:

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: Cell debris and high molecular weight DNA were removed by centrifugation at 10,000g for 30 min. For Co-IP, the supernatant of lysate was diluted in the binding buffer [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 0.1 mM EDTA, 0.2 % NP-40, 2.5 % glycerol, and 1 mM DTT], and incubated with 1 μg of an anti-Flag tag antibody and A/G PLUS-agarose (Santa Cruz Biotechnology) for 3 h at 4 °C. .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: The second day protein A/G plus agarose beads (Santa Cruz) were added and incubated for another 4 h. Beads were collected by centrifugation and washed 3 times with co-IP buffer. .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously .

Amplification:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. Expression of the glutathione S -transferase (GST)-fusion protein and preparation of cell extracts were performed according to the manufacturer’s instructions.

Expressing:

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea
Article Snippet: ETEC field isolates producing CFA/I, CS3, CS4/CS6, CS5/CS6, or CS6 (provided by Johns Hopkins University, Washington University, and the University of Gothenburg E. coli Reference Strain Center, Sweden) and E. coli recombinant strains expressing CS1 or CS2 fimbrial adhesin ( , ) were used for bacterial fimbria extraction (for coating antigens of antibody titration enzyme-linked immunosorbent assays [ELISAs]) and for in vitro antibody adherence inhibition assays. .. Vector pET28α (Novagen, Madison, WI) and E. coli BL21 (GE Healthcare, Piscataway, NJ) were used to express the adhesin-toxoid MEFA recombinant protein.

Article Title: Enhanced Cutinase-Catalyzed Hydrolysis of Polyethylene Terephthalate by Covalent Fusion to Hydrophobins
Article Snippet: Stellar competent cells from E. coli HST04 were purchased from Clontech (TaKaRa Bio Company, CA, USA) and were used for the cloning of hydrophobin-encoding genes and the propagation of plasmid DNA. .. E. coli BL21 (protease deficient) and expression plasmid pGEX-4T-2 were purchased from GE Healthcare (Amersham, England). .. The strains were cultivated on Luria broth (LB) agar plates at 28°C.

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare).

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: Paragraph title: 4.1. Expression and Preparation of the IDP Samples And Non-IDP Proteins ... The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: Primers for Rsl1 FL (see ) were forward primer 5′-AAAAGGATCCATGCGGCTATCGATTCC-3′ and reverse primer 5′-TTATCACATGTGTGTGGATTT-3′. .. Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG). .. SDS-PAGE analysis of bacterial lysates revealed that ZNFs 2 to 4 inhibited Rsl1FL synthesis in E. coli (see ).

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: In brief, TAT and TAT-GILZ sequences were inserted into the pGEX-4T2 plasmid (GE Healthcare, #28-9545-50) to produce an in-frame fusion protein. .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502). .. After lysis by sonication, proteins were purified with glutathione-sepharose 4B beads (GE Healthcare, #17-0756-01) according to the manufacturer's instructions.

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: In brief, TAT and TAT-GILZ sequences were inserted into the pGEX-4T2 plasmid (GE Healthcare, #28-9545-50) to produce an in-frame fusion protein. .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502). .. After lysis by sonication, proteins were purified with glutathione-sepharose 4B beads (GE Healthcare, #17-0756-01) according to the manufacturer's instructions.

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: Expression and purification of recombinant GST-P46L proteins : P46L cDNA, containing TGG codons that had been substituted for TGA, was cloned into pGEX-6P-2 (GE Healthcare Bio-Science, Piscataway, NJ, U.S.A.) between the Bam HI andEco RI recognition sites. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Article Title: Modified Heat-Stable Toxins (hSTa) of Enterotoxigenic Escherichia coli Lose Toxicity but Display Antigenicity after Being Genetically Fused to Heat-Labile Toxoid LT(R192G)
Article Snippet: ETEC strain E. coli H10407 (O78:H11) was used to isolate the STa gene (estA ), and E. coli BL21 (GE Healthcare, Piscataway, NJ, USA) was used as the host strain in this study. .. Vector pUC19 (Promega, Madison, WI, USA) was used to clone and express the wildtype and mutated STa genes, and expression vector pET28α (Invitrogen, Carlsbad, CA, USA) was used to express LT and STa toxoid fusions.

Article Title: Recombinant Production of the Amino Terminal Cytoplasmic Region of Dengue Virus Non-Structural Protein 4A for Structural Studies
Article Snippet: E. coli Mach 1 cells obtained from Life Technologies GmbH (Darmstadt, Germany) were used for cloning purposes. .. E. coli BL21-(DE3) (Agilent Technologies, Inc., Santa Clara, CA, USA) or E. coli BL21 (GE Healthcare, Freiburg, Germany) strains were used for peptide expression. .. All enzymes used for cloning were obtained from MBI Fermentas (St. Leon-Rot, Germany) if not stated otherwise.

Article Title: Coagulase and Efb of Staphylococcus aureus Have a Common Fibrinogen Binding Motif
Article Snippet: Our human subject research protocol was reviewed and approved by the Institutional Review Board of Texas A & M University Human Research Protection Program (HRPP; approved protocol IRB2011-0890D). .. Escherichia coli XL-1 Blue (Stratagene) was used as the host for plasmid cloning, whereas E. coli BL21 (GE Healthcare) were used for expression of GST-tagged fusion proteins. .. Chromosomal DNA from S. aureus strain Newman was used to amplify the Coa DNA sequence.

Positive Control:

Article Title: Modified Heat-Stable Toxins (hSTa) of Enterotoxigenic Escherichia coli Lose Toxicity but Display Antigenicity after Being Genetically Fused to Heat-Labile Toxoid LT(R192G)
Article Snippet: ETEC strain E. coli H10407 (O78:H11) was used to isolate the STa gene (estA ), and E. coli BL21 (GE Healthcare, Piscataway, NJ, USA) was used as the host strain in this study. .. Vector pUC19 (Promega, Madison, WI, USA) was used to clone and express the wildtype and mutated STa genes, and expression vector pET28α (Invitrogen, Carlsbad, CA, USA) was used to express LT and STa toxoid fusions.

Construct:

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon. .. The protein sample was affinity-purified by glutathione-Sepharose® according to the manufacturer’s instruction.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon. .. The protein sample was affinity-purified by glutathione-Sepharose® according to the manufacturer’s instruction.

Article Title: Characterization of Heat-Stable (STa) Toxoids of Enterotoxigenic Escherichia coli Fused to Double Mutant Heat-Labile Toxin Peptide in Inducing Neutralizing Anti-STa Antibodies
Article Snippet: Toxoid fusion recombinant strains 8751, 8752, and 8753, which were constructed previously , were used as templates to construct STa-toxoid -dmLT toxoid fusions. .. E. coli BL21 (GE Healthcare, Piscataway, NJ) was used as the host strain.

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: Immunoprecipitates were resuspended in heated 2× Laemmli sample buffer (Bio-Rad). .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously . .. Proteins (1 μg) were incubated with hippocampal synaptosomal lysates (100 μg) in co-IP buffer overnight at 4 °C.

Electrophoresis:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Expression of E. coli invasin and H. pylori CagY MRR was detected by electrophoresis of lysates of liquid-cultured bacteria as described previously , using polyclonal rabbit antisera to invasin (1:15,000) or CagY MRR (1:10,000) as the primary antibodies. .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare).

Incubation:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Membranes were blocked in 5% non-fat dry milk, incubated with primary anti-Annexin 4, GAPDH, and E-Cadherin antibodies (Santa Cruz Biotechnology), detected by the appropriate secondary antibodies, and revealed by enhanced chemiluminescence (ECL; Amersham Inc.). .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

Article Title: Crk Adaptors Negatively Regulate Actin Polymerization in Pedestals Formed by Enteropathogenic Escherichia coli (EPEC) by Binding to Tir Effector
Article Snippet: GST and the GST-SH2 domains of Nck, CrkII and CrkL were produced in E. coli BL21, then purified and coupled to GSH beads (GE Healthcare Life Sciences) by standard protocols as previously described . .. HeLa cells were grown on 150-mm plates to 70–80% confluence and infected at an MOI of 180 for 1 or 2 h, washed three times with D-PBS and scraped into 600 μl of modified RIPA buffer.

Article Title: VE-cadherin interacts with cell polarity protein Pals1 to regulate vascular lumen formation
Article Snippet: Briefly, GST-fusion proteins were expressed in Escherichia coli BL21 (GE Healthcare). .. For GST pull-down experiments, the prey proteins were generated in vitro using the TNT T7-coupled reticulocyte lysate system (Promega, Madison, WI) in the presence of 35 [S]methionine as described by the manufacturer.

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: Cell debris and high molecular weight DNA were removed by centrifugation at 10,000g for 30 min. For Co-IP, the supernatant of lysate was diluted in the binding buffer [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 0.1 mM EDTA, 0.2 % NP-40, 2.5 % glycerol, and 1 mM DTT], and incubated with 1 μg of an anti-Flag tag antibody and A/G PLUS-agarose (Santa Cruz Biotechnology) for 3 h at 4 °C. .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: The second day protein A/G plus agarose beads (Santa Cruz) were added and incubated for another 4 h. Beads were collected by centrifugation and washed 3 times with co-IP buffer. .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously .

Mass Spectrometry:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Total lysates with enriched plasma membrane proteins, used for both mass spectrometry and immunoprecipitations analyses, were obtained using Mem-PER Eukaryotic Membrane Protein Extraction Kit (Pierce). .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

Modification:

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG). .. Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Western Blot:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Paragraph title: Immunoblots. ... To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare).

Article Title: Api5 a new cofactor of estrogen receptor alpha involved in breast cancer outcome
Article Snippet: REα domains RE (amino acids 2-184) A/B; RE (amino acids 179-312) C/D; RE (amino acids 251-312) D; RE (amino acids 251-595) D/E/F; RE (amino acids 313-599) E/F and full length RE (amino acids 1-595) (generous gift of Dany Chalbos) were linked to Glutathione S -transferase (GST) and were expressed as well as GST alone in Escherichia coli BL21 and bound to glutathione-Sepharose 4B beads (Amersham Pharmacia). .. Recombinant Api5 protein was produced and incubated with the pre-incubated beads and treated as recommended by the manufacturer.

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: The bound proteins were resolved via SDS-PAGE (polyacrylamide gel electrophoresis) and transferred to a nitrocellulose membrane for western blot assay with ECL illumination (LH149493; Thermo, IL, USA). .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Transformation Assay:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. Expression of the glutathione S -transferase (GST)-fusion protein and preparation of cell extracts were performed according to the manufacturer’s instructions.

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: Expression and purification of recombinant GST-P46L proteins : P46L cDNA, containing TGG codons that had been substituted for TGA, was cloned into pGEX-6P-2 (GE Healthcare Bio-Science, Piscataway, NJ, U.S.A.) between the Bam HI andEco RI recognition sites. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth. .. Expression of proteins was induced through the addition of 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG).

High Performance Liquid Chromatography:

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The IDPs were expressed and the N-terminal tags were removed and finally purified by reversed phase HPLC (COSMOSIL® 5C18-AR-300, Nacalai Tesque, ϕ4.6 mm × 250 mm) with 0.1% trifluoroacetic acid—acetonitrile solvent system. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The IDPs were expressed and the N-terminal tags were removed and finally purified by reversed phase HPLC (COSMOSIL® 5C18-AR-300, Nacalai Tesque, ϕ4.6 mm × 250 mm) with 0.1% trifluoroacetic acid—acetonitrile solvent system. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Cell Culture:

Article Title: Modified Heat-Stable Toxins (hSTa) of Enterotoxigenic Escherichia coli Lose Toxicity but Display Antigenicity after Being Genetically Fused to Heat-Labile Toxoid LT(R192G)
Article Snippet: ETEC strain E. coli H10407 (O78:H11) was used to isolate the STa gene (estA ), and E. coli BL21 (GE Healthcare, Piscataway, NJ, USA) was used as the host strain in this study. .. BL21 strain expressing native STa was used as the positive control, whereas BL21 with vector pUC19 as the negative control.

Reverse Transcription Polymerase Chain Reaction:

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: The Rsl1 cDNA was cloned by RT-PCR (forward primer, 5′-GGTCTGTACTCGTGCGTCTTT-3′; reverse primer, 5′-ACAACATCCATTTGCCTGGTA-3′) from WT liver RNA into the pGEM-T Easy vector (Promega). .. Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Generated:

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The cell-permeable trans-activator of transcription peptide (TAT)-GILZ fusion protein and the respective control protein (TAT-Co) were generated and purified as previously ( , ). .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502).

Article Title: VE-cadherin interacts with cell polarity protein Pals1 to regulate vascular lumen formation
Article Snippet: Briefly, GST-fusion proteins were expressed in Escherichia coli BL21 (GE Healthcare). .. Briefly, GST-fusion proteins were expressed in Escherichia coli BL21 (GE Healthcare).

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The cell-permeable trans-activator of transcription peptide (TAT)-GILZ fusion protein and the respective control protein (TAT-Co) were generated and purified as previously ( , ). .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502).

Inhibition:

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea
Article Snippet: ETEC field isolates producing CFA/I, CS3, CS4/CS6, CS5/CS6, or CS6 (provided by Johns Hopkins University, Washington University, and the University of Gothenburg E. coli Reference Strain Center, Sweden) and E. coli recombinant strains expressing CS1 or CS2 fimbrial adhesin ( , ) were used for bacterial fimbria extraction (for coating antigens of antibody titration enzyme-linked immunosorbent assays [ELISAs]) and for in vitro antibody adherence inhibition assays. .. Vector pET28α (Novagen, Madison, WI) and E. coli BL21 (GE Healthcare, Piscataway, NJ) were used to express the adhesin-toxoid MEFA recombinant protein.

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG). .. SDS-PAGE analysis of bacterial lysates revealed that ZNFs 2 to 4 inhibited Rsl1FL synthesis in E. coli (see ).

Negative Control:

Article Title: Modified Heat-Stable Toxins (hSTa) of Enterotoxigenic Escherichia coli Lose Toxicity but Display Antigenicity after Being Genetically Fused to Heat-Labile Toxoid LT(R192G)
Article Snippet: ETEC strain E. coli H10407 (O78:H11) was used to isolate the STa gene (estA ), and E. coli BL21 (GE Healthcare, Piscataway, NJ, USA) was used as the host strain in this study. .. Vector pUC19 (Promega, Madison, WI, USA) was used to clone and express the wildtype and mutated STa genes, and expression vector pET28α (Invitrogen, Carlsbad, CA, USA) was used to express LT and STa toxoid fusions.

Polymerase Chain Reaction:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. Expression of the glutathione S -transferase (GST)-fusion protein and preparation of cell extracts were performed according to the manufacturer’s instructions.

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: PCR products were cloned into the BamHI and SmaI sites of pGEX-2TK (GE Healthcare Life Sciences). .. Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: DNA fragments obtained by PCR were cloned into the pGEM-T Easy vector (Promega, Madison, WI, U.S.A.) and confirmed by sequencing with an ABI PRISM 377 DNA sequencer (Applied Biosystems, Foster City, CA, U.S.A.). .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Sonication:

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth. .. Expression of proteins was induced through the addition of 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG).

Recombinant:

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea
Article Snippet: ETEC field isolates producing CFA/I, CS3, CS4/CS6, CS5/CS6, or CS6 (provided by Johns Hopkins University, Washington University, and the University of Gothenburg E. coli Reference Strain Center, Sweden) and E. coli recombinant strains expressing CS1 or CS2 fimbrial adhesin ( , ) were used for bacterial fimbria extraction (for coating antigens of antibody titration enzyme-linked immunosorbent assays [ELISAs]) and for in vitro antibody adherence inhibition assays. .. Vector pET28α (Novagen, Madison, WI) and E. coli BL21 (GE Healthcare, Piscataway, NJ) were used to express the adhesin-toxoid MEFA recombinant protein. .. PCRs with designed primers ( ) were used to amplify the CFA/I/II/IV MEFA gene from strain 9175 ( ) and the toxoid fusion 3xSTaN12S -mnLTR192G/L211A gene from strain 9331 ( ).

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: As a control for folded proteins and protein domains, we used hen egg lysozyme (Wako, 122-02673) and the first PSD-95/Dlg/ZO-1 (PDZ) domain of recombinant mouse ZO-1 (mZO1-PDZ1) [ ]. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: As a control for folded proteins and protein domains, we used hen egg lysozyme (Wako, 122-02673) and the first PSD-95/Dlg/ZO-1 (PDZ) domain of recombinant mouse ZO-1 (mZO1-PDZ1) [ ]. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: Expression and purification of recombinant GST-P46L proteins : P46L cDNA, containing TGG codons that had been substituted for TGA, was cloned into pGEX-6P-2 (GE Healthcare Bio-Science, Piscataway, NJ, U.S.A.) between the Bam HI andEco RI recognition sites. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Article Title: Characterization of Heat-Stable (STa) Toxoids of Enterotoxigenic Escherichia coli Fused to Double Mutant Heat-Labile Toxin Peptide in Inducing Neutralizing Anti-STa Antibodies
Article Snippet: Toxoid fusion recombinant strains 8751, 8752, and 8753, which were constructed previously , were used as templates to construct STa-toxoid -dmLT toxoid fusions. .. E. coli BL21 (GE Healthcare, Piscataway, NJ) was used as the host strain.

Molecular Weight:

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: Cell debris and high molecular weight DNA were removed by centrifugation at 10,000g for 30 min. For Co-IP, the supernatant of lysate was diluted in the binding buffer [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 0.1 mM EDTA, 0.2 % NP-40, 2.5 % glycerol, and 1 mM DTT], and incubated with 1 μg of an anti-Flag tag antibody and A/G PLUS-agarose (Santa Cruz Biotechnology) for 3 h at 4 °C. .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Gene Knockout:

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: Synaptosomal fractions from WT and STEP KO mouse hippocampus were lysed in co-IP buffer (20 mM Tris–HCl, pH 8, 150 m NaCl, 0.5% NP-40, proteases and phosphatase inhibitors) and subjected to immunoprecipitation with anti-STEP antibody (Millipore) overnight at 4 °C. .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously .

Pull Down Assay:

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: Paragraph title: Co-immunoprecipitation (IP) and GST pull-down assay ... For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Mutagenesis:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare).

Isolation:

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: Paragraph title: In vitro DNA binding. (i) GST fusion protein isolation. ... Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Article Title: Crk Adaptors Negatively Regulate Actin Polymerization in Pedestals Formed by Enteropathogenic Escherichia coli (EPEC) by Binding to Tir Effector
Article Snippet: GST and the GST-SH2 domains of Nck, CrkII and CrkL were produced in E. coli BL21, then purified and coupled to GSH beads (GE Healthcare Life Sciences) by standard protocols as previously described . .. Pull-downs were washed four times with 200 μl lysis buffer diluted 1∶10 in PBS as described .

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth. .. The resulting cell pellet was resuspended in PBS containing 1% Triton X-100 and 1% Tween 20, sonicated and centrifuged.

Size-exclusion Chromatography:

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Purification:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare).

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The IDPs were expressed and the N-terminal tags were removed and finally purified by reversed phase HPLC (COSMOSIL® 5C18-AR-300, Nacalai Tesque, ϕ4.6 mm × 250 mm) with 0.1% trifluoroacetic acid—acetonitrile solvent system. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The IDPs were expressed and the N-terminal tags were removed and finally purified by reversed phase HPLC (COSMOSIL® 5C18-AR-300, Nacalai Tesque, ϕ4.6 mm × 250 mm) with 0.1% trifluoroacetic acid—acetonitrile solvent system. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: Crk Adaptors Negatively Regulate Actin Polymerization in Pedestals Formed by Enteropathogenic Escherichia coli (EPEC) by Binding to Tir Effector
Article Snippet: Images in , , , and S5 were acquired on a Zeiss AX10 Imager A.1 fluorescence microscope equipped with an AxioCam MRm camera and AxioVision Release 4.7 software. .. GST and the GST-SH2 domains of Nck, CrkII and CrkL were produced in E. coli BL21, then purified and coupled to GSH beads (GE Healthcare Life Sciences) by standard protocols as previously described . .. HeLa cells were grown on 150-mm plates to 70–80% confluence and infected at an MOI of 180 for 1 or 2 h, washed three times with D-PBS and scraped into 600 μl of modified RIPA buffer.

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The cell-permeable trans-activator of transcription peptide (TAT)-GILZ fusion protein and the respective control protein (TAT-Co) were generated and purified as previously ( , ). .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502).

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The cell-permeable trans-activator of transcription peptide (TAT)-GILZ fusion protein and the respective control protein (TAT-Co) were generated and purified as previously ( , ). .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502).

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: Expression and purification of recombinant GST-P46L proteins : P46L cDNA, containing TGG codons that had been substituted for TGA, was cloned into pGEX-6P-2 (GE Healthcare Bio-Science, Piscataway, NJ, U.S.A.) between the Bam HI andEco RI recognition sites. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Sequencing:

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: DNA fragments obtained by PCR were cloned into the pGEM-T Easy vector (Promega, Madison, WI, U.S.A.) and confirmed by sequencing with an ABI PRISM 377 DNA sequencer (Applied Biosystems, Foster City, CA, U.S.A.). .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Protein Extraction:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Total lysates with enriched plasma membrane proteins, used for both mass spectrometry and immunoprecipitations analyses, were obtained using Mem-PER Eukaryotic Membrane Protein Extraction Kit (Pierce). .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

Affinity Chromatography:

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon. .. The protein sample of EGFP was expressed in E. coli BL21(DE3) harboring pET-15b-based plasmid containing a synthetic DNA construct encoding enhanced green fluorescent protein (EGFP) (Genbank:AAB02572) with an appropriate stop codon.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon. .. The protein sample of EGFP was expressed in E. coli BL21(DE3) harboring pET-15b-based plasmid containing a synthetic DNA construct encoding enhanced green fluorescent protein (EGFP) (Genbank: ) with an appropriate stop codon.

Polyacrylamide Gel Electrophoresis:

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: The bound proteins were resolved via SDS-PAGE (polyacrylamide gel electrophoresis) and transferred to a nitrocellulose membrane for western blot assay with ECL illumination (LH149493; Thermo, IL, USA). .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Lysis:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Total proteins were extracted with Nonidet P40 (NP-40) lysis buffer; cytosolic and plasma membrane proteins were extracted using the FractionPREP-cell fractionation system (Biovision). .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

Article Title: Crk Adaptors Negatively Regulate Actin Polymerization in Pedestals Formed by Enteropathogenic Escherichia coli (EPEC) by Binding to Tir Effector
Article Snippet: GST and the GST-SH2 domains of Nck, CrkII and CrkL were produced in E. coli BL21, then purified and coupled to GSH beads (GE Healthcare Life Sciences) by standard protocols as previously described . .. The GST-fusion proteins were added to 150 μl of cell lysate from each condition and incubated for 5 h with tumbling at 4°C.

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: At 36 h after expression of Flag-cCHD3, cells were lysed using lysis buffer [50 mM Tris (pH 8.0), 100 mM NaCl, 20 mM NaF, 50 mM KH2 PO4 , 1 % Triton X-100, 10 % glycerol, and 0.1 mM dithiothreitol (DTT)] containing the 1 mM phenylmethyl sulfonylfluoride (PMSF; Amerisco, OH, USA). .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Titration:

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea
Article Snippet: ETEC field isolates producing CFA/I, CS3, CS4/CS6, CS5/CS6, or CS6 (provided by Johns Hopkins University, Washington University, and the University of Gothenburg E. coli Reference Strain Center, Sweden) and E. coli recombinant strains expressing CS1 or CS2 fimbrial adhesin ( , ) were used for bacterial fimbria extraction (for coating antigens of antibody titration enzyme-linked immunosorbent assays [ELISAs]) and for in vitro antibody adherence inhibition assays. .. Vector pET28α (Novagen, Madison, WI) and E. coli BL21 (GE Healthcare, Piscataway, NJ) were used to express the adhesin-toxoid MEFA recombinant protein.

SDS Page:

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare).

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502). .. After lysis by sonication, proteins were purified with glutathione-sepharose 4B beads (GE Healthcare, #17-0756-01) according to the manufacturer's instructions.

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502). .. After lysis by sonication, proteins were purified with glutathione-sepharose 4B beads (GE Healthcare, #17-0756-01) according to the manufacturer's instructions.

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth. .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: The bound proteins were resolved via SDS-PAGE (polyacrylamide gel electrophoresis) and transferred to a nitrocellulose membrane for western blot assay with ECL illumination (LH149493; Thermo, IL, USA). .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Plasmid Preparation:

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea
Article Snippet: ETEC field isolates producing CFA/I, CS3, CS4/CS6, CS5/CS6, or CS6 (provided by Johns Hopkins University, Washington University, and the University of Gothenburg E. coli Reference Strain Center, Sweden) and E. coli recombinant strains expressing CS1 or CS2 fimbrial adhesin ( , ) were used for bacterial fimbria extraction (for coating antigens of antibody titration enzyme-linked immunosorbent assays [ELISAs]) and for in vitro antibody adherence inhibition assays. .. Vector pET28α (Novagen, Madison, WI) and E. coli BL21 (GE Healthcare, Piscataway, NJ) were used to express the adhesin-toxoid MEFA recombinant protein. .. PCRs with designed primers ( ) were used to amplify the CFA/I/II/IV MEFA gene from strain 9175 ( ) and the toxoid fusion 3xSTaN12S -mnLTR192G/L211A gene from strain 9331 ( ).

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Full-length FHIT cDNA (441 bp) and shorter cDNAs, FHIT -TR1 (332 bp), FHIT -TR2 (212 bp), and FHIT -TR3 (113 bp) containing the common FHIT 5′-end were cloned in the pGEX-2T plasmid, and were expressed in E. coli (BL21). .. To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham. .. A549 cells were assessed for the induction of single strand breaks (indicative of apoptosis) by the terminal deoxynucleotidyl transferase mediated X-dUTP nick end labeling (TUNEL) assay using the in situ cell death detection kit (Boehringer/Roche), according to the manufacturer's recommendations.

Article Title: Enhanced Cutinase-Catalyzed Hydrolysis of Polyethylene Terephthalate by Covalent Fusion to Hydrophobins
Article Snippet: Stellar competent cells from E. coli HST04 were purchased from Clontech (TaKaRa Bio Company, CA, USA) and were used for the cloning of hydrophobin-encoding genes and the propagation of plasmid DNA. .. E. coli BL21 (protease deficient) and expression plasmid pGEX-4T-2 were purchased from GE Healthcare (Amersham, England). .. The strains were cultivated on Luria broth (LB) agar plates at 28°C.

Article Title: CagY-Dependent Regulation of Type IV Secretion in Helicobacter pylori Is Associated with Alterations in Integrin Binding
Article Snippet: Detection of CagY expression in the ΔcagY MRR mutant, which contains an in-frame deletion of the MRR, was performed using antiserum from rabbits immunized with the VirB10 portion at the C terminus of CagY (1:1,000). .. To generate the antiserum, DNA encoding the C terminus of H. pylori J166 CagY was PCR amplified , cloned into pGEX-4T-3 vector, and transformed into E. coli BL21 (both from GE Healthcare). .. Expression of the glutathione S -transferase (GST)-fusion protein and preparation of cell extracts were performed according to the manufacturer’s instructions.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon. .. The protein sample was affinity-purified by glutathione-Sepharose® according to the manufacturer’s instruction.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon. .. The protein sample was affinity-purified by glutathione-Sepharose® according to the manufacturer’s instruction.

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: The resulting plasmid was the PCR template to create full-length (FL) glutathione S -transferase (GST)-Rsl1 fusion plasmid pGEXRsl1 and a 5′ and 3′ deletion series of the ZNFs. .. Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: In brief, TAT and TAT-GILZ sequences were inserted into the pGEX-4T2 plasmid (GE Healthcare, #28-9545-50) to produce an in-frame fusion protein. .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502).

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: In brief, TAT and TAT-GILZ sequences were inserted into the pGEX-4T2 plasmid (GE Healthcare, #28-9545-50) to produce an in-frame fusion protein. .. The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502).

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: DNA fragments obtained by PCR were cloned into the pGEM-T Easy vector (Promega, Madison, WI, U.S.A.) and confirmed by sequencing with an ABI PRISM 377 DNA sequencer (Applied Biosystems, Foster City, CA, U.S.A.). .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Article Title: Modified Heat-Stable Toxins (hSTa) of Enterotoxigenic Escherichia coli Lose Toxicity but Display Antigenicity after Being Genetically Fused to Heat-Labile Toxoid LT(R192G)
Article Snippet: ETEC strain E. coli H10407 (O78:H11) was used to isolate the STa gene (estA ), and E. coli BL21 (GE Healthcare, Piscataway, NJ, USA) was used as the host strain in this study. .. Vector pUC19 (Promega, Madison, WI, USA) was used to clone and express the wildtype and mutated STa genes, and expression vector pET28α (Invitrogen, Carlsbad, CA, USA) was used to express LT and STa toxoid fusions.

Article Title: Recombinant Production of the Amino Terminal Cytoplasmic Region of Dengue Virus Non-Structural Protein 4A for Structural Studies
Article Snippet: E. coli BL21-(DE3) (Agilent Technologies, Inc., Santa Clara, CA, USA) or E. coli BL21 (GE Healthcare, Freiburg, Germany) strains were used for peptide expression. .. E. coli BL21-(DE3) (Agilent Technologies, Inc., Santa Clara, CA, USA) or E. coli BL21 (GE Healthcare, Freiburg, Germany) strains were used for peptide expression.

Article Title: Characterization of Heat-Stable (STa) Toxoids of Enterotoxigenic Escherichia coli Fused to Double Mutant Heat-Labile Toxin Peptide in Inducing Neutralizing Anti-STa Antibodies
Article Snippet: Vector pUC19 (Promega, Madison, WI) was used to clone STa toxoids, and vector pET28α (Novagen, Madison, WI) was used to clone and express toxoid fusion genes. .. E. coli BL21 (GE Healthcare, Piscataway, NJ) was used as the host strain.

Article Title: Coagulase and Efb of Staphylococcus aureus Have a Common Fibrinogen Binding Motif
Article Snippet: Our human subject research protocol was reviewed and approved by the Institutional Review Board of Texas A & M University Human Research Protection Program (HRPP; approved protocol IRB2011-0890D). .. Escherichia coli XL-1 Blue (Stratagene) was used as the host for plasmid cloning, whereas E. coli BL21 (GE Healthcare) were used for expression of GST-tagged fusion proteins. .. Chromosomal DNA from S. aureus strain Newman was used to amplify the Coa DNA sequence.

Co-Immunoprecipitation Assay:

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: Cell debris and high molecular weight DNA were removed by centrifugation at 10,000g for 30 min. For Co-IP, the supernatant of lysate was diluted in the binding buffer [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 0.1 mM EDTA, 0.2 % NP-40, 2.5 % glycerol, and 1 mM DTT], and incubated with 1 μg of an anti-Flag tag antibody and A/G PLUS-agarose (Santa Cruz Biotechnology) for 3 h at 4 °C. .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: The second day protein A/G plus agarose beads (Santa Cruz) were added and incubated for another 4 h. Beads were collected by centrifugation and washed 3 times with co-IP buffer. .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously .

Binding Assay:

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: Paragraph title: In vitro DNA binding. (i) GST fusion protein isolation. ... Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Article Title: VE-cadherin interacts with cell polarity protein Pals1 to regulate vascular lumen formation
Article Snippet: Paragraph title: In vitro binding experiments ... Briefly, GST-fusion proteins were expressed in Escherichia coli BL21 (GE Healthcare).

Article Title: Development of an ELISA Using a Recombinant P46-Like Lipoprotein for Diagnosis of Mycoplasma pulmonis Infection in Rodents
Article Snippet: The nucleotide sequence of all primers and their binding positions are based on the sequence of M.pulmonis (GenBank Accession Number NC_002771) as listed in . .. E. coli BL21 (GE Healthcare, Buckinghamshire, U.K.) was used for transformation of the cloned plasmids with transformed cells grown in LB broth.

Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
Article Snippet: Cell debris and high molecular weight DNA were removed by centrifugation at 10,000g for 30 min. For Co-IP, the supernatant of lysate was diluted in the binding buffer [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 0.1 mM EDTA, 0.2 % NP-40, 2.5 % glycerol, and 1 mM DTT], and incubated with 1 μg of an anti-Flag tag antibody and A/G PLUS-agarose (Santa Cruz Biotechnology) for 3 h at 4 °C. .. For GST pull-down, the GST–NS2 and GST proteins were expressed in Escherichia coli BL21 (DE3) and bound to glutathione-Sepharose 4B (GE Healthcare, Fairfield, CT, USA) for 2 h at 4 °C, respectively.

In Vitro:

Article Title: Enterotoxigenic Escherichia coli Adhesin-Toxoid Multiepitope Fusion Antigen CFA/I/II/IV-3xSTaN12S-mnLTG192G/L211A-Derived Antibodies Inhibit Adherence of Seven Adhesins, Neutralize Enterotoxicity of LT and STa Toxins, and Protect Piglets against Diarrhea
Article Snippet: ETEC field isolates producing CFA/I, CS3, CS4/CS6, CS5/CS6, or CS6 (provided by Johns Hopkins University, Washington University, and the University of Gothenburg E. coli Reference Strain Center, Sweden) and E. coli recombinant strains expressing CS1 or CS2 fimbrial adhesin ( , ) were used for bacterial fimbria extraction (for coating antigens of antibody titration enzyme-linked immunosorbent assays [ELISAs]) and for in vitro antibody adherence inhibition assays. .. Vector pET28α (Novagen, Madison, WI) and E. coli BL21 (GE Healthcare, Piscataway, NJ) were used to express the adhesin-toxoid MEFA recombinant protein.

Article Title: The KRAB Zinc Finger Protein RSL1 Regulates Sex- and Tissue-Specific Promoter Methylation and Dynamic Hormone-Responsive Chromatin Configuration
Article Snippet: Paragraph title: In vitro DNA binding. (i) GST fusion protein isolation. ... Plasmids were used to transform Escherichia coli BL21 (GE Healthcare Life Sciences), and protein expression was induced with 0.1 mM isopropyl-β- d -thiogalactopyranoside (IPTG).

Article Title: VE-cadherin interacts with cell polarity protein Pals1 to regulate vascular lumen formation
Article Snippet: Paragraph title: In vitro binding experiments ... Briefly, GST-fusion proteins were expressed in Escherichia coli BL21 (GE Healthcare).

Produced:

Article Title: Crk Adaptors Negatively Regulate Actin Polymerization in Pedestals Formed by Enteropathogenic Escherichia coli (EPEC) by Binding to Tir Effector
Article Snippet: Images in , , , and S5 were acquired on a Zeiss AX10 Imager A.1 fluorescence microscope equipped with an AxioCam MRm camera and AxioVision Release 4.7 software. .. GST and the GST-SH2 domains of Nck, CrkII and CrkL were produced in E. coli BL21, then purified and coupled to GSH beads (GE Healthcare Life Sciences) by standard protocols as previously described . .. HeLa cells were grown on 150-mm plates to 70–80% confluence and infected at an MOI of 180 for 1 or 2 h, washed three times with D-PBS and scraped into 600 μl of modified RIPA buffer.

Immunoprecipitation:

Article Title: STEP activation by Gαq coupled GPCRs opposes Src regulation of NMDA receptors containing the GluN2A subunit
Article Snippet: Synaptosomal fractions from WT and STEP KO mouse hippocampus were lysed in co-IP buffer (20 mM Tris–HCl, pH 8, 150 m NaCl, 0.5% NP-40, proteases and phosphatase inhibitors) and subjected to immunoprecipitation with anti-STEP antibody (Millipore) overnight at 4 °C. .. For GST pull-down assays, GST-STEP fusion constructs were cloned and expressed in E. coli BL21 (DE3) and conjugated to glutathione-sepharose 4B beads (GE Lifesciences, Piscataway, NJ) as described previously .

Fractionation:

Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells
Article Snippet: Paragraph title: Immunoblotting, GST pull-down and fractionation analysis ... To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

Staining:

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502). .. After lysis by sonication, proteins were purified with glutathione-sepharose 4B beads (GE Healthcare, #17-0756-01) according to the manufacturer's instructions.

Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages
Article Snippet: The GST fusion protein expression was induced in E. coli BL21 (GE Healthcare, #27-1542-01) with 0.1 mM isopropyl β-d-thiogalactopyranoside (Sigma-Aldrich, #I5502). .. After lysis by sonication, proteins were purified with glutathione-sepharose 4B beads (GE Healthcare, #17-0756-01) according to the manufacturer's instructions.

Positron Emission Tomography:

Article Title: Enhanced Cutinase-Catalyzed Hydrolysis of Polyethylene Terephthalate by Covalent Fusion to Hydrophobins
Article Snippet: Vector pET-26b(+) (Novagen, Germany) was used for the expression of hydrophobins and fusion proteins in E. coli strain BL21-Gold(DE3) (GE Healthcare, Amersham, England). .. E. coli BL21 (protease deficient) and expression plasmid pGEX-4T-2 were purchased from GE Healthcare (Amersham, England).

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: In brief, the N-terminal autoprotease N(pro) from bovine viral diarrhea virus was selected as a fusion partner for protein expression using the pET-based N(pro) fusion protein expression system [ ] optimized for IDP preparation. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Article Title: Discovery of Cryoprotective Activity in Human Genome-Derived Intrinsically Disordered Proteins
Article Snippet: In brief, the N-terminal autoprotease N(pro) from bovine viral diarrhea virus was selected as a fusion partner for protein expression using the pET-based N(pro) fusion protein expression system [ ] optimized for IDP preparation. .. The active Schistosoma japonicum glutathione-S transferase (Sj26 GST) enzyme was expressed in E. coli BL21(DE3) harboring pGEX-3T (GE Healthcare Bioscience, Little Chalfont, UK) with an appropriate stop codon.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    GE Healthcare bl21 de3 plyss e coli
    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot. " width="250" height="auto" />
    Bl21 De3 Plyss E Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 78/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss e coli/product/GE Healthcare
    Average 78 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss e coli - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    Image Search Results


    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as "A", full sequence of ROP2 without signal sequence; "B", 1/2 Nt sequence of ROP2; "C", 1/2 Ct containing kinase domain; "D", 1/4 Nt; "E", middle 1/4 Ct; "G", 1/4Ct; "H", 1/2 Nt of kinase domain; and "I", 1/2 Ct of kinase domain. (B) Expression of recombinant ROP2 antigens. All recombinant proteins were well induced and tested by western blot with anti-GST antibody. (C) Antigenicity of recombinant ROP2 antigens. The antigenicity was tested by western blot against patient serum. (D) Solubility of recombinant ROP2 antigens. Solubility of rGST-ROP2 324-561 induced was confirmed by western blot with anti-GST antibody. (E) Expression of recombinant linker ROP2 antigens. "L", lysate of BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot.

    Article Snippet: The pGEX-4T-1 vector and BL21 (DE3) pLysS E. coli were from GE Healthcare (Little Chalfont, UK).

    Techniques: Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility, Transformation Assay

    Production of GST-GRA2 fusion protein.

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-GRA2 fusion protein. "N" indicates lysate of BL21 (DE3) pLysS E. coli without induction; "G", lysate of E. coli transformed with vector after induction; "R", Toxoplasma lysate antigen (TLA) of RH strain; "T", total lysates of E. coli ; "S", soluble fraction; and "P", insoluble fraction. The meaning of abbreviations is the same in the following context without extra illustration. (A) Design of fragmentation of cDNA of GRA2; 7 fragments of GRA2 were cloned. The name of clones and amino acid regions are indicated. "F", full sequence of GRA2 without signal sequence; "A", 2/3 N-terminal (Nt); "B", 2/3 C-terminal (Ct); "C", half Nt; "D", half Ct; "E", middle 1/3 sequence; and "L", linker, is the high disorder sequence of Nt. (B) Expression of recombinant GRA2 antigens induced at 30℃, 0.5 mM IPTG. Target bands against GST by western blot were marked with asterisks. (C) Antigenicity of recombinant GRA2 antigens. Patient serum was applied to detect the antigenicity of recombinant proteins against human IgG by western blot. The detectable signal was marked with asterisks. (D) Solubility of recombinant GRA2 antigens. The solubility of rGST-GRA2 25-105 was tested by western blot against GST.

    Article Snippet: The pGEX-4T-1 vector and BL21 (DE3) pLysS E. coli were from GE Healthcare (Little Chalfont, UK).

    Techniques: Transformation Assay, Plasmid Preparation, Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility

    Production of GST-MIC2 fusion protein. (A) Design of fragmentation of cDNA of MIC2. Ten fragments of MIC2 were cloned as

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-MIC2 fusion protein. (A) Design of fragmentation of cDNA of MIC2. Ten fragments of MIC2 were cloned as "F", full sequence of MIC2; "A", full sequence without Ct transmembrane region; "B", 2/3 Nt; "C", 2/3 Ct; "D", 1/3 Nt; "E", middle 1/3; "G", 1/3 Ct; "H", half Nt of D; "I", half Ct of D; and "J", middle 1/3 of D. (B) Expression of recombinant MIC2 antigens. All recombinant proteins were well induced and tested by western blot against anti-GST antibody. (C) Antigenicity of recombinant MIC2 antigens. The antigenicity of GST-MIC2 was tested by western blot against patient serum. (D) Solubility of recombinant MIC2 antigens. Total lysate, soluble, and insoluble fractions of rGST-MIC2 1-284 were detected against GST antibody. (E) Expression of recombinant linker MIC2 antigens. BL21 (DE3) pLysS E. coli containing GST and GST linker MIC2 1-284 recombinant plasmids were induced; "L", lysate transformed with pGEX-4T-1/GRA2 31-71 ; "M2", that with pGEX-4T-1/MIC2 1-284 ; and "LM", that with pGEX-4T-1/GRA2 31-71 -MIC2 1-284 . The expression was confirmed against anti-GST antibody. (F) Antigenicity of recombinant linker MIC2 antigens. It was tested against patient serum. (G) Solubility of recombinant linker MIC2 antigens. The soluble and insoluble fractions of rGST-GRA2 31-71 -MIC2 1-284 protein were tested by western blot.

    Article Snippet: The pGEX-4T-1 vector and BL21 (DE3) pLysS E. coli were from GE Healthcare (Little Chalfont, UK).

    Techniques: Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility, Transformation Assay