Structured Review

Agilent technologies e coli bl21
E Coli Bl21, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 95/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli bl21/product/Agilent technologies
Average 95 stars, based on 33 article reviews
Price from $9.99 to $1999.99
e coli bl21 - by Bioz Stars, 2020-01
95/100 stars

Images

Related Articles

Clone Assay:

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. HspB177–171 and variants thereof were cloned into the same vector and expressed in the same manner, with both proteins containing a residual Gly-Ser overhang between the tobacco etch virus (TEV) protease recognition site and the beginning of the HspB1 sequence.

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For optimized crystallization, VHHs L-P2-B10 and L-P2-D07 were cloned into the pETX-24 vector containing a C-terminal His6 -tag. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Decoding and reprogramming fungal iterative nonribosomal peptide synthetases
Article Snippet: Strains and plasmids E. coli XL1-Blue (Agilent Technologies) was used for routine cloning and pJET1.2 (Fermentas) was used as the cloning vector. .. E. coli BL21(DE3) (Agilent Technologies) cells were used for expression of C1(BbBEAS) , C2(BbBEAS) , C3(BbBEAS) , C3(BbBEAS-H2901A) , C3(BbBSLS) and MT(BbBEAS) .

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: Cloning was achieved using XhoI and BamHI sites (for cloning into pET11a-link-N-GFP) or NcoI and Aat II sites (for cloning into pMRBAD-link-C-GFP) sites, except for Dps, for which SphI replaced NcoI. .. E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar.

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For optimized crystallization, VHHs L-P2-B10 and L-P2-D07 were cloned into the pETX-24 vector containing a C-terminal His6 -tag. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Centrifugation:

Article Title: Architecture of Microcin B17 Synthetase: An Octameric Protein Complex Converting a Ribosomally Synthesized Peptide into a DNA Gyrase Poison
Article Snippet: Purification of MBP-Tagged Peptides For purification of MBP-tagged peptides (McbA and its variants), 0.75 L of 2xYT medium containing 50 μg/mL kanamycin was inoculated with 20 mL of overnight culture of E. coli BL21(DE3) Gold (Agilent), transformed with the relevant plasmid (e.g., pET28MBP mcbA). .. Cells were harvested by centrifugation at 5,000 rpm for 10 min, resuspended in MBP Lysis Buffer [50 mM Tris·HCl pH 7.5, 500 mM NaCl, 2.5% glycerol (v/v), 0.1% Triton X-100, 2 mg/mL lysozyme] supplemented with protease inhibitor cocktail (Thermo) and lysed by sonication.

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent). .. Cells were harvested by centrifugation and resuspended in buffer 2 (20 mM HEPES pH 7.5, 500 mM NaCl).

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction . .. Cellular debris was removed by centrifugation for 30 min at 8000 × g and filtered with a glass fiber prefilter (Ministart, Sartorius).

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached. .. Protein production was induced by cold-shock (20 min on ice) and IPTG addition to a final concentration of 0.2 mM. β-Actin production was carried out for 20 hr at 15°C, 200 rpm, and harvested by centrifugation (6,000 × g for 10 min).

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction . .. Cellular debris was removed by centrifugation for 30 min at 8000 × g and filtered with a glass fiber prefilter (Ministart, Sartorius).

Amplification:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: To test the contribution of the N-terminus to actin-binding affinity, the coding sequences for WT ABD (amino acids 1–284) or truncated WT ABD (amino acids 52–284) were PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAGCAGCACGCTGTCACCC or AAACACCTGCAAAAAGGTGCAGATGAACGAGAAGCTGTGC and reverse primer AAATCTAGACTACTTCATCTTGGAGAAGTAATGGTAGTAAG. .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent).

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: For this purpose, the genes encoding RIC a truncated version of the RIC (lacking the first 57 amino acid residues in the N terminal [ ]), Dps, Bfr, and FtnA were PCR amplified from genomic DNA of E. coli K-12 using the oligonucleotides described in . .. E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar.

Filtration:

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: The untagged protein was further purified by gel filtration on a High Load 16/60 Superdex 75 column (GE Healthcare) equilibrated in 20 mM HEPES, pH 7.5, 300 mM NaCl, 0.5 mM TCEP and 5 μM ZnCl2 . .. For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent).

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively. .. Proteins were purified over a 5 mL HisTrap column (GE Healthcare), followed by 5 mL HiTrap SP column (GE Healthcare), and then a HiLoad 26/60 Superdex 200 gel filtration column (GE Healthcare).

Construct:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent). ..

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. For crystallography, residue K171 was deleted using a site-directed mutagenesis kit (Agilent) and HspB184–170 was expressed and purified as described.

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: Paragraph title: 4.1. Hsp70 Variant Constructs ... Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ].

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Paragraph title: Expression and purification of FLNCd18–21 constructs ... The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent).

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: .. For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached. .. Protein production was induced by cold-shock (20 min on ice) and IPTG addition to a final concentration of 0.2 mM. β-Actin production was carried out for 20 hr at 15°C, 200 rpm, and harvested by centrifugation (6,000 × g for 10 min).

Nuclear Magnetic Resonance:

Article Title: Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses
Article Snippet: The E. coli MBP (residues 1–370) protein was expressed in E. coli BL21(DE3) cells (Agilent Technologies) . .. For the selective 13 CH3 -labelling of methyl groups, E. coli cells were grown in deuterated M9 media, and 50 mg l−1 of [methyl-13 C, 3-2 H2 ]-α-ketobutyric acid (for Ileδ1) (CIL) and 300 mg l−1 of [2-methyl 13 C, 4-2 H3 ]-acetolactate (for Leuδ2 and Valγ2) (NMR-Bio) were both added 1 h before the induction.

Expressing:

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. For crystallography, residue K171 was deleted using a site-directed mutagenesis kit (Agilent) and HspB184–170 was expressed and purified as described.

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: .. Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. For protein expression and uniform labeling with 15 N, transformed E. coli BL21 (DE3) (Agilent Technologies) were first grown in LB-medium (Sigma-Aldrich) and then diluted 1:100 into 1 liter of minimal medium (48 mM Na2 HPO4, 22 mM KH2 PO4, 8.56 mM NaCl and 18.7 mM 15 NHCl (Euriso-top, Germany), supplemented with 20 ml of a 20% (w/v) glucose solution (Sigma-Aldrich), 2 ml of 1 M MgSO4 , 0.3 ml of 1 M CaCl2 and 100 μg/ml ampicillin) and further cultured at 37 °C in an orbital shaker.

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: .. For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent). .. Cells were harvested by centrifugation and resuspended in buffer 2 (20 mM HEPES pH 7.5, 500 mM NaCl).

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: Paragraph title: Expression and purification of VHH domains ... The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Decoding and reprogramming fungal iterative nonribosomal peptide synthetases
Article Snippet: .. E. coli BL21(DE3) (Agilent Technologies) cells were used for expression of C1(BbBEAS) , C2(BbBEAS) , C3(BbBEAS) , C3(BbBEAS-H2901A) , C3(BbBSLS) and MT(BbBEAS) . ..

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Paragraph title: Expression and purification of FLNCd18–21 constructs ... The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent).

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: Paragraph title: Protein expression and purification ... Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively.

Article Title: Near-infrared optogenetic pair for protein regulation and spectral multiplexing
Article Snippet: Paragraph title: Protein expression and purification. ... PpsR2 mutants fused with mRuby2 bearing a Streptag II at the N terminus and 6× His at the C terminus were expressed in E.coli BL21(DE3) (Agilent Technologies) grown in LB medium supplemented with ampicillin for 6 h, with 250 μM of IPTG induction.

Bradford Assay:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: A Bradford assay (Biorad) was then used to determine protein concentrations which equaled 44.0 and 40.6 µM for WT and L253P, respectively. .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent).

Modification:

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Expression and purification of FLNCd18–21 constructs The region of human FLNC comprising domains 18 to 21 (WT, residues 1943 to 2408 from UniProt ID Q14315; ∆I, residues 1943 to 2408 excluding 2163 to 2243) was encoded in a modified pET23a/EEF with C-terminal 6× His and EEF tags. .. The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent).

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: .. Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively. .. Proteins were purified over a 5 mL HisTrap column (GE Healthcare), followed by 5 mL HiTrap SP column (GE Healthcare), and then a HiLoad 26/60 Superdex 200 gel filtration column (GE Healthcare).

Transformation Assay:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent). ..

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. For crystallography, residue K171 was deleted using a site-directed mutagenesis kit (Agilent) and HspB184–170 was expressed and purified as described.

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. For protein expression and uniform labeling with 15 N, transformed E. coli BL21 (DE3) (Agilent Technologies) were first grown in LB-medium (Sigma-Aldrich) and then diluted 1:100 into 1 liter of minimal medium (48 mM Na2 HPO4, 22 mM KH2 PO4, 8.56 mM NaCl and 18.7 mM 15 NHCl (Euriso-top, Germany), supplemented with 20 ml of a 20% (w/v) glucose solution (Sigma-Aldrich), 2 ml of 1 M MgSO4 , 0.3 ml of 1 M CaCl2 and 100 μg/ml ampicillin) and further cultured at 37 °C in an orbital shaker.

Article Title: Architecture of Microcin B17 Synthetase: An Octameric Protein Complex Converting a Ribosomally Synthesized Peptide into a DNA Gyrase Poison
Article Snippet: .. Purification of MBP-Tagged Peptides For purification of MBP-tagged peptides (McbA and its variants), 0.75 L of 2xYT medium containing 50 μg/mL kanamycin was inoculated with 20 mL of overnight culture of E. coli BL21(DE3) Gold (Agilent), transformed with the relevant plasmid (e.g., pET28MBP mcbA). ..

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent). .. To generate the Mβ construct, mutations E2136R and I2138E were introduced by site-directed mutagenesis.

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: .. For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached. .. Protein production was induced by cold-shock (20 min on ice) and IPTG addition to a final concentration of 0.2 mM. β-Actin production was carried out for 20 hr at 15°C, 200 rpm, and harvested by centrifugation (6,000 × g for 10 min).

Over Expression:

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: Paragraph title: Overexpression and purification of the recombinant β-actin inclusion-body protein ... For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached.

Crystallization Assay:

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For optimized crystallization, VHHs L-P2-B10 and L-P2-D07 were cloned into the pETX-24 vector containing a C-terminal His6 -tag. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For optimized crystallization, VHHs L-P2-B10 and L-P2-D07 were cloned into the pETX-24 vector containing a C-terminal His6 -tag. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Flow Cytometry:

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction . .. VHHs were purified using Ni-Sepharose 6 Fast Flow beads (GE Healthcare).

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction . .. VHHs were purified using Ni-Sepharose 6 Fast Flow beads (GE Healthcare).

Chromatography:

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: Subtractive Ni-NTA chromatography (IMAC Sepharose 6 FF, GE Healthcare) was then employed to remove the residual His-tag and TEV protease. .. For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent).

Protease Inhibitor:

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. Phosphomimic mutations S78E and S82D were introduced using site-directed mutagenesis, expressed according to the same protocol, and purified as follows: Cells were lysed using a cell press with added protease inhibitor cocktail (Roche).

Buffer Exchange:

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: Protein-containing fractions were pooled and imidazole was removed by either buffer exchange (PD Multitrap G-25) or extensive dialysis (snakeskin dialysis tubes MWC 10 kDa, Invitrogen). .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: Protein-containing fractions were pooled and imidazole was removed by either buffer exchange (PD Multitrap G-25) or extensive dialysis (snakeskin dialysis tubes MWC 10 kDa, Invitrogen). .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Cell Culture:

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. For protein expression and uniform labeling with 15 N, transformed E. coli BL21 (DE3) (Agilent Technologies) were first grown in LB-medium (Sigma-Aldrich) and then diluted 1:100 into 1 liter of minimal medium (48 mM Na2 HPO4, 22 mM KH2 PO4, 8.56 mM NaCl and 18.7 mM 15 NHCl (Euriso-top, Germany), supplemented with 20 ml of a 20% (w/v) glucose solution (Sigma-Aldrich), 2 ml of 1 M MgSO4 , 0.3 ml of 1 M CaCl2 and 100 μg/ml ampicillin) and further cultured at 37 °C in an orbital shaker.

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: .. For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached. .. Protein production was induced by cold-shock (20 min on ice) and IPTG addition to a final concentration of 0.2 mM. β-Actin production was carried out for 20 hr at 15°C, 200 rpm, and harvested by centrifugation (6,000 × g for 10 min).

Polymerase Chain Reaction:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: PCR products were digested with AarI and Xba1 restriction enzymes and ligated into the BsaI site of pE-SUMOpro (LifeSensors) containing His and SUMO tags. .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent).

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: Hsp70 Variant Constructs The different complementary peptides were grafted at the C-terminal end of human Hsp70 (human Hsp70 1A, GenBank entry NP005336) by means of mutagenic polymerase chain reaction (PCR) with phosphorylated oligonucleotides. .. Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ].

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: For this purpose, the genes encoding RIC a truncated version of the RIC (lacking the first 57 amino acid residues in the N terminal [ ]), Dps, Bfr, and FtnA were PCR amplified from genomic DNA of E. coli K-12 using the oligonucleotides described in . .. E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar.

Sonication:

Article Title: Architecture of Microcin B17 Synthetase: An Octameric Protein Complex Converting a Ribosomally Synthesized Peptide into a DNA Gyrase Poison
Article Snippet: Purification of MBP-Tagged Peptides For purification of MBP-tagged peptides (McbA and its variants), 0.75 L of 2xYT medium containing 50 μg/mL kanamycin was inoculated with 20 mL of overnight culture of E. coli BL21(DE3) Gold (Agilent), transformed with the relevant plasmid (e.g., pET28MBP mcbA). .. Cells were harvested by centrifugation at 5,000 rpm for 10 min, resuspended in MBP Lysis Buffer [50 mM Tris·HCl pH 7.5, 500 mM NaCl, 2.5% glycerol (v/v), 0.1% Triton X-100, 2 mg/mL lysozyme] supplemented with protease inhibitor cocktail (Thermo) and lysed by sonication.

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction . .. VHHs were extracted by sonication in PBS.

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction . .. VHHs were extracted by sonication in PBS.

Recombinant:

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: .. Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ]. .. Preparation of hIAPP for Cell Viability Tests hIAPP (AnaSpec, Fremont, CA, USA) was dissolved at 1 mg/mL in hexafluoroisopropanol (HFIP) and incubated over night at room temperature in order to dissolve preformed aggregates.

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: .. E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar. ..

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: Paragraph title: Overexpression and purification of the recombinant β-actin inclusion-body protein ... For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached.

Molecular Weight:

Article Title: Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses
Article Snippet: MQ relaxation analyses of MBP To test whether the R MQ,ex and ΔR MQ,ex can be correctly evaluated in high molecular weight proteins, we applied the method to the MBP/β-cyclodextrin complex (MBP, molecular weight of 42 K) , in which the significant chemical exchange processes were reportedly absent in the majority of the side chain methyl groups . .. The E. coli MBP (residues 1–370) protein was expressed in E. coli BL21(DE3) cells (Agilent Technologies) .

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: The final protein was concentrated to 15 mg/ml in a prewashed Amicon Ultra-15 Centrifugal filter (Molecular weight cut off = 10kDa; EMD Millipore), flash frozen in liquid N2 and stored at -80 °C. .. For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent).

Fluorescence:

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: Paragraph title: Bimolecular fluorescence complementation (BiFC) assays. ... E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar.

Mutagenesis:

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. For crystallography, residue K171 was deleted using a site-directed mutagenesis kit (Agilent) and HspB184–170 was expressed and purified as described.

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent). .. To generate the Mβ construct, mutations E2136R and I2138E were introduced by site-directed mutagenesis.

Bimolecular Fluorescence Complementation Assay:

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: Paragraph title: Bimolecular fluorescence complementation (BiFC) assays. ... E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar.

Size-exclusion Chromatography:

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The final purification step (using PBS) was performed with size exclusion chromatography ( SEC) using a Superdex 75 HiLoad 16 60 column (GE Healthcare Life Sciences). .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: The final purification step (using PBS) was performed with size exclusion chromatography (SEC) using a Superdex 75 HiLoad 16 60 column (GE Healthcare Life Sciences). .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Labeling:

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. For protein expression and uniform labeling with 15 N, transformed E. coli BL21 (DE3) (Agilent Technologies) were first grown in LB-medium (Sigma-Aldrich) and then diluted 1:100 into 1 liter of minimal medium (48 mM Na2 HPO4, 22 mM KH2 PO4, 8.56 mM NaCl and 18.7 mM 15 NHCl (Euriso-top, Germany), supplemented with 20 ml of a 20% (w/v) glucose solution (Sigma-Aldrich), 2 ml of 1 M MgSO4 , 0.3 ml of 1 M CaCl2 and 100 μg/ml ampicillin) and further cultured at 37 °C in an orbital shaker.

Purification:

Article Title: Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses
Article Snippet: The E. coli MBP (residues 1–370) protein was expressed in E. coli BL21(DE3) cells (Agilent Technologies) . .. The protein was purified sequentially with Q sepharose (GE) and Amylose Resin (New England Biolabs), from which MBP was eluted as the maltose-bound form.

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. For crystallography, residue K171 was deleted using a site-directed mutagenesis kit (Agilent) and HspB184–170 was expressed and purified as described.

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: .. Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. For protein expression and uniform labeling with 15 N, transformed E. coli BL21 (DE3) (Agilent Technologies) were first grown in LB-medium (Sigma-Aldrich) and then diluted 1:100 into 1 liter of minimal medium (48 mM Na2 HPO4, 22 mM KH2 PO4, 8.56 mM NaCl and 18.7 mM 15 NHCl (Euriso-top, Germany), supplemented with 20 ml of a 20% (w/v) glucose solution (Sigma-Aldrich), 2 ml of 1 M MgSO4 , 0.3 ml of 1 M CaCl2 and 100 μg/ml ampicillin) and further cultured at 37 °C in an orbital shaker.

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: .. Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ]. .. Preparation of hIAPP for Cell Viability Tests hIAPP (AnaSpec, Fremont, CA, USA) was dissolved at 1 mg/mL in hexafluoroisopropanol (HFIP) and incubated over night at room temperature in order to dissolve preformed aggregates.

Article Title: Architecture of Microcin B17 Synthetase: An Octameric Protein Complex Converting a Ribosomally Synthesized Peptide into a DNA Gyrase Poison
Article Snippet: .. Purification of MBP-Tagged Peptides For purification of MBP-tagged peptides (McbA and its variants), 0.75 L of 2xYT medium containing 50 μg/mL kanamycin was inoculated with 20 mL of overnight culture of E. coli BL21(DE3) Gold (Agilent), transformed with the relevant plasmid (e.g., pET28MBP mcbA). ..

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: Paragraph title: Expression and Purification ... For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent).

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: Paragraph title: Expression and purification of VHH domains ... The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Paragraph title: Expression and purification of FLNCd18–21 constructs ... The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent).

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: Paragraph title: Overexpression and purification of the recombinant β-actin inclusion-body protein ... For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached.

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: Paragraph title: Protein expression and purification ... Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively.

Article Title: Near-infrared optogenetic pair for protein regulation and spectral multiplexing
Article Snippet: Paragraph title: Protein expression and purification. ... PpsR2 mutants fused with mRuby2 bearing a Streptag II at the N terminus and 6× His at the C terminus were expressed in E.coli BL21(DE3) (Agilent Technologies) grown in LB medium supplemented with ampicillin for 6 h, with 250 μM of IPTG induction.

Protein Purification:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: Paragraph title: Protein purification ... The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent).

Sequencing:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent). ..

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. HspB177–171 and variants thereof were cloned into the same vector and expressed in the same manner, with both proteins containing a residual Gly-Ser overhang between the tobacco etch virus (TEV) protease recognition site and the beginning of the HspB1 sequence.

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: Briefly, the thumb domain coding sequence, comprising residues 237-318 of RT, was inserted between the NdeI and XhoI sites in the pET21 plasmid (Novagen). .. Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively.

Positron Emission Tomography:

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: .. Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ]. .. Preparation of hIAPP for Cell Viability Tests hIAPP (AnaSpec, Fremont, CA, USA) was dissolved at 1 mg/mL in hexafluoroisopropanol (HFIP) and incubated over night at room temperature in order to dissolve preformed aggregates.

Microscopy:

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar. .. Cells were examined for green fluorescence in a Leica DM6000 B upright microscope coupled to an Andor iXon+ camera, using 1000× amplification and a fluorescein isothiocyanate (FITC) filter.

SDS Page:

Article Title: Structural basis for high-affinity actin binding revealed by a β-III-spectrin SCA5 missense mutation
Article Snippet: Elution fractions of the Superdex 200 column containing pure ABD proteins as assessed by SDS-PAGE were pooled and concentrated (Amicon Ultra-4 Centrifugal Filter, 10 K MWCO). .. The final constructs pE-SUMO-ABD WT and pE-SUMO-A52-ABD WT were sequence verified and transformed into E. coli BL21 (DE3)pLysS (Agilent).

Plasmid Preparation:

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. Expression and purification of HspB1 constructs A pET28d(+) vector encoding human HspB1 ACD (residues 84 to 171) was transformed into Escherichia coli BL21(DE3) cells (Agilent) and expressed and purified as described previously ( ). .. For crystallography, residue K171 was deleted using a site-directed mutagenesis kit (Agilent) and HspB184–170 was expressed and purified as described.

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: .. Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ]. .. Preparation of hIAPP for Cell Viability Tests hIAPP (AnaSpec, Fremont, CA, USA) was dissolved at 1 mg/mL in hexafluoroisopropanol (HFIP) and incubated over night at room temperature in order to dissolve preformed aggregates.

Article Title: Architecture of Microcin B17 Synthetase: An Octameric Protein Complex Converting a Ribosomally Synthesized Peptide into a DNA Gyrase Poison
Article Snippet: .. Purification of MBP-Tagged Peptides For purification of MBP-tagged peptides (McbA and its variants), 0.75 L of 2xYT medium containing 50 μg/mL kanamycin was inoculated with 20 mL of overnight culture of E. coli BL21(DE3) Gold (Agilent), transformed with the relevant plasmid (e.g., pET28MBP mcbA). ..

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For optimized crystallization, VHHs L-P2-B10 and L-P2-D07 were cloned into the pETX-24 vector containing a C-terminal His6 -tag. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Decoding and reprogramming fungal iterative nonribosomal peptide synthetases
Article Snippet: Strains and plasmids E. coli XL1-Blue (Agilent Technologies) was used for routine cloning and pJET1.2 (Fermentas) was used as the cloning vector. .. E. coli BL21(DE3) (Agilent Technologies) cells were used for expression of C1(BbBEAS) , C2(BbBEAS) , C3(BbBEAS) , C3(BbBEAS-H2901A) , C3(BbBSLS) and MT(BbBEAS) .

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: .. The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent). .. To generate the Mβ construct, mutations E2136R and I2138E were introduced by site-directed mutagenesis.

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: The plasmid pCOLD I that encodes the human protein was a kind gift from Dr. Minoru Tamura (Ehime University, Japan) and was prepared as described by . .. For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached.

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For optimized crystallization, VHHs L-P2-B10 and L-P2-D07 were cloned into the pETX-24 vector containing a C-terminal His6 -tag. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: Expression from this plasmid results in a protein that possesses an N-terminal methionine and a C-terminal hexa-histidine tag. .. Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively.

Article Title: Near-infrared optogenetic pair for protein regulation and spectral multiplexing
Article Snippet: N-terminally 6× His-tagged BphP1 was expressed in E.coli LMG194 (Life Technologies/Invitrogen) together with hemeoxygenase from pWA23h plasmid for biliverdin IXα (BV) synthesis . .. PpsR2 mutants fused with mRuby2 bearing a Streptag II at the N terminus and 6× His at the C terminus were expressed in E.coli BL21(DE3) (Agilent Technologies) grown in LB medium supplemented with ampicillin for 6 h, with 250 μM of IPTG induction.

Binding Assay:

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For initial crystallization screens, binding experiments and in vitro assays, VHHs with a C-terminal V5-FLAG3- His6 -tag were used. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For initial crystallization screens, binding experiments and in vitro assays, VHHs with a C-terminal V5-FLAG3- His6 -tag were used. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

In Vitro:

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For initial crystallization screens, binding experiments and in vitro assays, VHHs with a C-terminal V5-FLAG3- His6 -tag were used. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Article Title: Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells
Article Snippet: For initial crystallization screens, binding experiments and in vitro assays, VHHs with a C-terminal V5-FLAG3- His6 -tag were used. .. The VHHs were expressed in E. coli BL21(DE3)pLysS cells (Agilent) by lactose auto-induction .

Incubation:

Article Title: Transcription factor dimerization activates the p300 acetyltransferase
Article Snippet: The resin was washed with buffer 1 and incubated with His-tagged TEV protease (1:100 w/w) for 14-16 h at 4°C. .. For the expression of Y701 phosphorylated variants (pSTAT1ΔN, pSTAT1ΔNC), proteins were co-expressed with Elk receptor tyrosine kinase domain in E.coli BL21(DE3) TKB1 cells (Agilent).

Article Title: The Di-iron RIC Protein (YtfE) of Escherichia coli Interacts with the DNA-Binding Protein from Starved Cells (Dps) To Diminish RIC Protein-Mediated Redox Stress
Article Snippet: E. coli BL21(DE3)Gold (Agilent) was cotransformed with the resulting recombinant pET11a-link-N-GFP and pMRBAD-link-C-GFP vectors in various combinations (RIC/Dps, truncated RIC/Dps, RIC/Bfr, and RIC/FtnA), and plated on selective LB agar. .. After an overnight incubation at 30°C followed by 2 days of incubation at room temperature, colonies were suspended in phosphate-buffered saline (PBS) and spread onto 1.7% agarose slides.

Produced:

Article Title: NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Article Snippet: .. Uniformly 15 N- or 13 C,15 N-labeled thumb domain protein was produced in E. coli BL21(DE3) gold cells (Agilent Technologies, Santa Clara, CA), in modified minimal medium at 27°C, using 15 NH4 Cl and 13 C6 -glucose as the sole nitrogen and carbon sources, respectively. .. Proteins were purified over a 5 mL HisTrap column (GE Healthcare), followed by 5 mL HiTrap SP column (GE Healthcare), and then a HiLoad 26/60 Superdex 200 gel filtration column (GE Healthcare).

Concentration Assay:

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. Protein expression was induced at an OD600 of ~0.8 by addition of isopropyl-1-thio-β-D-galactopyranoside to a final concentration of 0.5 mM.

Article Title: HspB1 phosphorylation regulates its intramolecular dynamics and mechanosensitive molecular chaperone interaction with filamin C
Article Snippet: The plasmid was transformed into E. coli BL21(DE3) pLysS cells (Agilent). .. Isopropylthiogalactoside was then added to a final concentration of 0.5 mM to induce expression for 16 to 18 hours at 21°C.

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached. .. Protein production was induced by cold-shock (20 min on ice) and IPTG addition to a final concentration of 0.2 mM. β-Actin production was carried out for 20 hr at 15°C, 200 rpm, and harvested by centrifugation (6,000 × g for 10 min).

Lysis:

Article Title: Binding of the protein ICln to α-integrin contributes to the activation of IClswell current
Article Snippet: Protein expression and purification cICln and TcICln were overexpressed and labelled with 15 N as N-terminal His6 -tagged fusion proteins in E. coli BL21(DE3) strain (Agilent Technologies, Santa Clara, CA, USA). .. The bacterial pellet obtained from a 1 liter 15 N labelled M9 minimal medium culture was resuspended in 30 ml of lysis buffer (50 mM K2 HPO4, pH 8.0) and lysed using a French-press.

Article Title: Architecture of Microcin B17 Synthetase: An Octameric Protein Complex Converting a Ribosomally Synthesized Peptide into a DNA Gyrase Poison
Article Snippet: Purification of MBP-Tagged Peptides For purification of MBP-tagged peptides (McbA and its variants), 0.75 L of 2xYT medium containing 50 μg/mL kanamycin was inoculated with 20 mL of overnight culture of E. coli BL21(DE3) Gold (Agilent), transformed with the relevant plasmid (e.g., pET28MBP mcbA). .. Cells were harvested by centrifugation at 5,000 rpm for 10 min, resuspended in MBP Lysis Buffer [50 mM Tris·HCl pH 7.5, 500 mM NaCl, 2.5% glycerol (v/v), 0.1% Triton X-100, 2 mg/mL lysozyme] supplemented with protease inhibitor cocktail (Thermo) and lysed by sonication.

Article Title: Structural insights into SETD3-mediated histidine methylation on β-actin
Article Snippet: For β-actin production, E. coli BL21(DE3) (Agilent, USA) cells were transformed with the DNA construct and cultured in 500 ml of LB broth (with 100 μg/ml ampicillin) at 37°C and 200 rpm until an OD600 of 0.5 was reached. .. The cell paste was resuspended in 27.5 ml lysis buffer consisting of 20 mM Hepes (pH 7.5), 1 mM DTT, 1 mM ADP, 0.5 mM PMSF, 2 μg/ml leupeptin, 2 μg/ml antipain, 0.2 mg/ml hen egg white lysozyme (BioShop), and 1,000 U Viscolase (A and A Biotechnology, Poland).

Variant Assay:

Article Title: A Rationally Designed Hsp70 Variant Rescues the Aggregation-Associated Toxicity of Human IAPP in Cultured Pancreatic Islet β-Cells
Article Snippet: Paragraph title: 4.1. Hsp70 Variant Constructs ... Recombinant wild type and designed N-hexa-His-tagged Hsp70 variants were overexpressed from the pET-28b vector (Merck KGaA, Darmstadt, Germany) in E. coli BL21(DE3) Gold Strain (Agilent Technologies, Santa Clara, CA, USA) and purified as previously described [ ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    Agilent technologies iptg induced e coli bl21 harboring pet28a buri
    Purification of recombinant <t>BurI</t> protein from insoluble fraction of induced E. coli <t>BL21</t> harboring <t>pET28a-</t> burI . Lane M, protein marker in kDa; Lane 1, precipitation dissolved in 8M urea; lane 2, flow through; lane 3, resin after elution step; lane 4, wash fraction using 8M urea, lane 5, wash fraction using 8M urea containing 20 mM imidazole; lane 6, eluted fraction using 8M urea containing 500 mM imidazole. The recombinant BurI protein was successfully purified from its inclusion bodies with fairly good purity.
    Iptg Induced E Coli Bl21 Harboring Pet28a Buri, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iptg induced e coli bl21 harboring pet28a buri/product/Agilent technologies
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    iptg induced e coli bl21 harboring pet28a buri - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    98
    Agilent technologies bl21 de3 plyss
    Enzymatic activity assays using glucanase- and xylanase-IFP fusion proteins expressed in E. coli . LIC-pDEST-LC1-/LC2 vectors encoding 6xHis-IFP-TEV-endo-β-1,4-glucanase/-xylanase and endo-β-1,4-glucanase-/xylanase-TEV-IFP-6xHis fusion proteins were transformed into the E. coli strains <t>BL21</t> (DE3) <t>pLysS</t> (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’) and Rosetta (DE3) pRARE (‘Rosetta’). Enzymatic activity was tested by Congo Red staining and destaining with 1 M NaCl on carboxymethylcellulose- (left panel) or xylan- (right panel) containing agar plates after transferring 2 µL of the respective expression strains and over-night incubation at 37°C. Glucanase activity leads to the formation of a white halo around the colonies, whereas xylanase activity leads to the formation of a black halo [31] . E. coli cells expressing IFP-6xHis fusion protein were used as negative control, and cell-free supernatant of Pichia pastoris expression cultures containing secreted endo-β-1,4-glucanase-myc-6xHis or endo-β-1,4-xylanase-myc-6xHis fusion proteins were used as positive controls (P).
    Bl21 De3 Plyss, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 98/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss/product/Agilent technologies
    Average 98 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    77
    Agilent technologies bl21 de3 codonplus ril
    Enzymatic activity assays using glucanase- and xylanase-IFP fusion proteins expressed in E. coli . LIC-pDEST-LC1-/LC2 vectors encoding 6xHis-IFP-TEV-endo-β-1,4-glucanase/-xylanase and endo-β-1,4-glucanase-/xylanase-TEV-IFP-6xHis fusion proteins were transformed into the E. coli strains <t>BL21</t> (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) <t>CodonPlus-RIL</t> (‘Codon’) and Rosetta (DE3) pRARE (‘Rosetta’). Enzymatic activity was tested by Congo Red staining and destaining with 1 M NaCl on carboxymethylcellulose- (left panel) or xylan- (right panel) containing agar plates after transferring 2 µL of the respective expression strains and over-night incubation at 37°C. Glucanase activity leads to the formation of a white halo around the colonies, whereas xylanase activity leads to the formation of a black halo [31] . E. coli cells expressing IFP-6xHis fusion protein were used as negative control, and cell-free supernatant of Pichia pastoris expression cultures containing secreted endo-β-1,4-glucanase-myc-6xHis or endo-β-1,4-xylanase-myc-6xHis fusion proteins were used as positive controls (P).
    Bl21 De3 Codonplus Ril, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 codonplus ril/product/Agilent technologies
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 codonplus ril - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    Image Search Results


    Purification of recombinant BurI protein from insoluble fraction of induced E. coli BL21 harboring pET28a- burI . Lane M, protein marker in kDa; Lane 1, precipitation dissolved in 8M urea; lane 2, flow through; lane 3, resin after elution step; lane 4, wash fraction using 8M urea, lane 5, wash fraction using 8M urea containing 20 mM imidazole; lane 6, eluted fraction using 8M urea containing 500 mM imidazole. The recombinant BurI protein was successfully purified from its inclusion bodies with fairly good purity.

    Journal: PeerJ

    Article Title: Whole genome sequencing enables the characterization of BurI, a LuxI homologue of Burkholderia cepacia strain GG4

    doi: 10.7717/peerj.1117

    Figure Lengend Snippet: Purification of recombinant BurI protein from insoluble fraction of induced E. coli BL21 harboring pET28a- burI . Lane M, protein marker in kDa; Lane 1, precipitation dissolved in 8M urea; lane 2, flow through; lane 3, resin after elution step; lane 4, wash fraction using 8M urea, lane 5, wash fraction using 8M urea containing 20 mM imidazole; lane 6, eluted fraction using 8M urea containing 500 mM imidazole. The recombinant BurI protein was successfully purified from its inclusion bodies with fairly good purity.

    Article Snippet: The spent culture supernatants of the IPTG-induced E. coli BL21 harboring pET28a-burI were analyzed using Agilent 6490 Triple-Quad LC-MS/MS system.

    Techniques: Purification, Recombinant, Marker, Flow Cytometry

    SDS-PAGE profile of overproduction of BurI in E. coli BL21 (DE3) pLysS followed by CBB staining. SDS-PAGE analysis on (A) cell lysate and (B) on soluble and insoluble fraction of cell lysate after centrifugation at 14,000 rpm. Cell lysate of E. coli harboring pET28a- burI without IPTG induction (lane 1); overnight IPTG induction at 15 °C (lane 2); overnight IPTG induction at 37 °C (lanes 3 and 4); soluble fraction of E. coli harboring pET28a- burI with overnight IPTG induction at 37 °C (lane 5); insoluble fraction of E. coli harboring pET28a- burI with overnight IPTG induction at 37 °C (lane 6); protein marker in kDa (lane M). The BurI protein was found to be overexpressed at approximately 25 kDa in inclusion bodies.

    Journal: PeerJ

    Article Title: Whole genome sequencing enables the characterization of BurI, a LuxI homologue of Burkholderia cepacia strain GG4

    doi: 10.7717/peerj.1117

    Figure Lengend Snippet: SDS-PAGE profile of overproduction of BurI in E. coli BL21 (DE3) pLysS followed by CBB staining. SDS-PAGE analysis on (A) cell lysate and (B) on soluble and insoluble fraction of cell lysate after centrifugation at 14,000 rpm. Cell lysate of E. coli harboring pET28a- burI without IPTG induction (lane 1); overnight IPTG induction at 15 °C (lane 2); overnight IPTG induction at 37 °C (lanes 3 and 4); soluble fraction of E. coli harboring pET28a- burI with overnight IPTG induction at 37 °C (lane 5); insoluble fraction of E. coli harboring pET28a- burI with overnight IPTG induction at 37 °C (lane 6); protein marker in kDa (lane M). The BurI protein was found to be overexpressed at approximately 25 kDa in inclusion bodies.

    Article Snippet: The spent culture supernatants of the IPTG-induced E. coli BL21 harboring pET28a-burI were analyzed using Agilent 6490 Triple-Quad LC-MS/MS system.

    Techniques: SDS Page, Staining, Centrifugation, Marker

    MS analyses of the extract of spent culture supernatant from IPTG-induced E. coli BL21 harboring pET28a- burI . By comparing with the corresponding synthetic AHL standard, the mass spectra demonstrated the presence of 3-oxo-C6-HSL at m / z 214.0000. (A) Mass spectra of E. coli BL21 harboring pET28a alone (control); (B) mass spectra of non-induced E. coli BL21 harboring pET28a- burI (control); (C) mass spectra of induced E. coli BL21 harboring pET28a- burI .

    Journal: PeerJ

    Article Title: Whole genome sequencing enables the characterization of BurI, a LuxI homologue of Burkholderia cepacia strain GG4

    doi: 10.7717/peerj.1117

    Figure Lengend Snippet: MS analyses of the extract of spent culture supernatant from IPTG-induced E. coli BL21 harboring pET28a- burI . By comparing with the corresponding synthetic AHL standard, the mass spectra demonstrated the presence of 3-oxo-C6-HSL at m / z 214.0000. (A) Mass spectra of E. coli BL21 harboring pET28a alone (control); (B) mass spectra of non-induced E. coli BL21 harboring pET28a- burI (control); (C) mass spectra of induced E. coli BL21 harboring pET28a- burI .

    Article Snippet: The spent culture supernatants of the IPTG-induced E. coli BL21 harboring pET28a-burI were analyzed using Agilent 6490 Triple-Quad LC-MS/MS system.

    Techniques: Mass Spectrometry

    MS analyses of the extract of spent culture supernatant from IPTG-induced E. coli BL21 harboring pET28a- burI . By comparing with the corresponding synthetic AHL standard, the mass spectra demonstrated the presence of 3-hydroxy-C8-HSL at m / z 244.0000. (A) Mass spectra of E. coli BL21 harboring pET28a alone (control); (B) mass spectra of non-induced E. coli BL21 harboring pET28a- burI (control); (C) mass spectra of induced E. coli BL21 harboring pET28a- burI .

    Journal: PeerJ

    Article Title: Whole genome sequencing enables the characterization of BurI, a LuxI homologue of Burkholderia cepacia strain GG4

    doi: 10.7717/peerj.1117

    Figure Lengend Snippet: MS analyses of the extract of spent culture supernatant from IPTG-induced E. coli BL21 harboring pET28a- burI . By comparing with the corresponding synthetic AHL standard, the mass spectra demonstrated the presence of 3-hydroxy-C8-HSL at m / z 244.0000. (A) Mass spectra of E. coli BL21 harboring pET28a alone (control); (B) mass spectra of non-induced E. coli BL21 harboring pET28a- burI (control); (C) mass spectra of induced E. coli BL21 harboring pET28a- burI .

    Article Snippet: The spent culture supernatants of the IPTG-induced E. coli BL21 harboring pET28a-burI were analyzed using Agilent 6490 Triple-Quad LC-MS/MS system.

    Techniques: Mass Spectrometry

    MS analyses of the extract of spent culture supernatant from IPTG-induced E. coli BL21 harboring pET28a- burI . By comparing with the corresponding synthetic AHL standard, the mass spectra demonstrated the presence of C8-HSL at m / z 228.3000. (A) Mass spectra of E. coli BL21 harboring pET28a alone (control); (B) mass spectra of non-induced E. coli BL21 harboring pET28a- burI (control); (C) mass spectra of induced E. coli BL21 harboring pET28a- burI .

    Journal: PeerJ

    Article Title: Whole genome sequencing enables the characterization of BurI, a LuxI homologue of Burkholderia cepacia strain GG4

    doi: 10.7717/peerj.1117

    Figure Lengend Snippet: MS analyses of the extract of spent culture supernatant from IPTG-induced E. coli BL21 harboring pET28a- burI . By comparing with the corresponding synthetic AHL standard, the mass spectra demonstrated the presence of C8-HSL at m / z 228.3000. (A) Mass spectra of E. coli BL21 harboring pET28a alone (control); (B) mass spectra of non-induced E. coli BL21 harboring pET28a- burI (control); (C) mass spectra of induced E. coli BL21 harboring pET28a- burI .

    Article Snippet: The spent culture supernatants of the IPTG-induced E. coli BL21 harboring pET28a-burI were analyzed using Agilent 6490 Triple-Quad LC-MS/MS system.

    Techniques: Mass Spectrometry

    Enzymatic activity assays using glucanase- and xylanase-IFP fusion proteins expressed in E. coli . LIC-pDEST-LC1-/LC2 vectors encoding 6xHis-IFP-TEV-endo-β-1,4-glucanase/-xylanase and endo-β-1,4-glucanase-/xylanase-TEV-IFP-6xHis fusion proteins were transformed into the E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’) and Rosetta (DE3) pRARE (‘Rosetta’). Enzymatic activity was tested by Congo Red staining and destaining with 1 M NaCl on carboxymethylcellulose- (left panel) or xylan- (right panel) containing agar plates after transferring 2 µL of the respective expression strains and over-night incubation at 37°C. Glucanase activity leads to the formation of a white halo around the colonies, whereas xylanase activity leads to the formation of a black halo [31] . E. coli cells expressing IFP-6xHis fusion protein were used as negative control, and cell-free supernatant of Pichia pastoris expression cultures containing secreted endo-β-1,4-glucanase-myc-6xHis or endo-β-1,4-xylanase-myc-6xHis fusion proteins were used as positive controls (P).

    Journal: PLoS ONE

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

    doi: 10.1371/journal.pone.0018900

    Figure Lengend Snippet: Enzymatic activity assays using glucanase- and xylanase-IFP fusion proteins expressed in E. coli . LIC-pDEST-LC1-/LC2 vectors encoding 6xHis-IFP-TEV-endo-β-1,4-glucanase/-xylanase and endo-β-1,4-glucanase-/xylanase-TEV-IFP-6xHis fusion proteins were transformed into the E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’) and Rosetta (DE3) pRARE (‘Rosetta’). Enzymatic activity was tested by Congo Red staining and destaining with 1 M NaCl on carboxymethylcellulose- (left panel) or xylan- (right panel) containing agar plates after transferring 2 µL of the respective expression strains and over-night incubation at 37°C. Glucanase activity leads to the formation of a white halo around the colonies, whereas xylanase activity leads to the formation of a black halo [31] . E. coli cells expressing IFP-6xHis fusion protein were used as negative control, and cell-free supernatant of Pichia pastoris expression cultures containing secreted endo-β-1,4-glucanase-myc-6xHis or endo-β-1,4-xylanase-myc-6xHis fusion proteins were used as positive controls (P).

    Article Snippet: Protein expression for the purification of GST (empty pDEST15 vector) or GST-GRF fusion proteins (pDEST15-GRF1/2/3/4/5/6 vectors) was carried out in 100 mL culture volume in BL21 (DE3) pLysS (Agilent Technologies) cells (30°C, 1 mM IPTG, 4 h), followed by sonication of cells in 10 mL lysis buffer as described above.

    Techniques: Activity Assay, Transformation Assay, Staining, Transferring, Expressing, Incubation, Negative Control

    Infrared analysis of in vitro and in vivo expressed IFP fusion proteins. Infrared scanning of all samples was performed in microtiter plates using the Odyssey Infrared Imaging System from LI-COR Biosciences. ( A ) In vitro transcription/translation products were analysed by infrared scanning using the whole reaction mixtures. 6xHis-GFP and IFP-6xHis fusion protein-expressing samples were used as negative (-) and positive (+) controls, respectively. ( B ) In-cell detection of IFP fusion protein (6xHis-IFP-TEV-ANAC042 shown as an example) in two randomly selected clones each from the E. coli strains (BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’). 6xHis-GFP and IFP-6xHis fusion protein-expressing cells were used as negative (-) and positive (+) controls, respectively. ( C ), ( D ) and ( E ) In-cell detection of IFP fusion protein (SAM1-TEV-IFP-6xHis shown as an example) in randomly selected K. lactis , P. pastoris and L. tarentolae clones. Cell lines not expressing IPF or expressing IFP-6xHis fusion protein were used as negative (-) and positive (+) controls, respectively. No positive control was available for expression in K. lactis . Note that strong infrared signal appears white in the digital images.

    Journal: PLoS ONE

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

    doi: 10.1371/journal.pone.0018900

    Figure Lengend Snippet: Infrared analysis of in vitro and in vivo expressed IFP fusion proteins. Infrared scanning of all samples was performed in microtiter plates using the Odyssey Infrared Imaging System from LI-COR Biosciences. ( A ) In vitro transcription/translation products were analysed by infrared scanning using the whole reaction mixtures. 6xHis-GFP and IFP-6xHis fusion protein-expressing samples were used as negative (-) and positive (+) controls, respectively. ( B ) In-cell detection of IFP fusion protein (6xHis-IFP-TEV-ANAC042 shown as an example) in two randomly selected clones each from the E. coli strains (BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’). 6xHis-GFP and IFP-6xHis fusion protein-expressing cells were used as negative (-) and positive (+) controls, respectively. ( C ), ( D ) and ( E ) In-cell detection of IFP fusion protein (SAM1-TEV-IFP-6xHis shown as an example) in randomly selected K. lactis , P. pastoris and L. tarentolae clones. Cell lines not expressing IPF or expressing IFP-6xHis fusion protein were used as negative (-) and positive (+) controls, respectively. No positive control was available for expression in K. lactis . Note that strong infrared signal appears white in the digital images.

    Article Snippet: Protein expression for the purification of GST (empty pDEST15 vector) or GST-GRF fusion proteins (pDEST15-GRF1/2/3/4/5/6 vectors) was carried out in 100 mL culture volume in BL21 (DE3) pLysS (Agilent Technologies) cells (30°C, 1 mM IPTG, 4 h), followed by sonication of cells in 10 mL lysis buffer as described above.

    Techniques: In Vitro, In Vivo, Imaging, Expressing, Clone Assay, Positive Control

    Expression of IFP fusion proteins in E. coli . Protein extracts obtained from IFP fusion protein-expressing E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’) were separated by SDS-PAGE and analysed by in-gel infrared imaging at 700 nm to detect IFP moieties (upper panel), followed by western transfer and immunological detection at 800 nm (using monoclonal mouse antibody directed against the 6xHis epitope; lower panel). IFP-6xHis fusion protein-expressing cells were used as positive control. Supernatant (S) and pellet (P) fractions of disrupted cells were analyzed after ultracentrifugation. M, molecular mass marker (kDa). Arrows indicate expected proteins.

    Journal: PLoS ONE

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

    doi: 10.1371/journal.pone.0018900

    Figure Lengend Snippet: Expression of IFP fusion proteins in E. coli . Protein extracts obtained from IFP fusion protein-expressing E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’) were separated by SDS-PAGE and analysed by in-gel infrared imaging at 700 nm to detect IFP moieties (upper panel), followed by western transfer and immunological detection at 800 nm (using monoclonal mouse antibody directed against the 6xHis epitope; lower panel). IFP-6xHis fusion protein-expressing cells were used as positive control. Supernatant (S) and pellet (P) fractions of disrupted cells were analyzed after ultracentrifugation. M, molecular mass marker (kDa). Arrows indicate expected proteins.

    Article Snippet: Protein expression for the purification of GST (empty pDEST15 vector) or GST-GRF fusion proteins (pDEST15-GRF1/2/3/4/5/6 vectors) was carried out in 100 mL culture volume in BL21 (DE3) pLysS (Agilent Technologies) cells (30°C, 1 mM IPTG, 4 h), followed by sonication of cells in 10 mL lysis buffer as described above.

    Techniques: Expressing, SDS Page, Imaging, Western Blot, Positive Control, Marker

    Enzymatic activity assays using glucanase- and xylanase-IFP fusion proteins expressed in E. coli . LIC-pDEST-LC1-/LC2 vectors encoding 6xHis-IFP-TEV-endo-β-1,4-glucanase/-xylanase and endo-β-1,4-glucanase-/xylanase-TEV-IFP-6xHis fusion proteins were transformed into the E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’) and Rosetta (DE3) pRARE (‘Rosetta’). Enzymatic activity was tested by Congo Red staining and destaining with 1 M NaCl on carboxymethylcellulose- (left panel) or xylan- (right panel) containing agar plates after transferring 2 µL of the respective expression strains and over-night incubation at 37°C. Glucanase activity leads to the formation of a white halo around the colonies, whereas xylanase activity leads to the formation of a black halo [31] . E. coli cells expressing IFP-6xHis fusion protein were used as negative control, and cell-free supernatant of Pichia pastoris expression cultures containing secreted endo-β-1,4-glucanase-myc-6xHis or endo-β-1,4-xylanase-myc-6xHis fusion proteins were used as positive controls (P).

    Journal: PLoS ONE

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

    doi: 10.1371/journal.pone.0018900

    Figure Lengend Snippet: Enzymatic activity assays using glucanase- and xylanase-IFP fusion proteins expressed in E. coli . LIC-pDEST-LC1-/LC2 vectors encoding 6xHis-IFP-TEV-endo-β-1,4-glucanase/-xylanase and endo-β-1,4-glucanase-/xylanase-TEV-IFP-6xHis fusion proteins were transformed into the E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’) and Rosetta (DE3) pRARE (‘Rosetta’). Enzymatic activity was tested by Congo Red staining and destaining with 1 M NaCl on carboxymethylcellulose- (left panel) or xylan- (right panel) containing agar plates after transferring 2 µL of the respective expression strains and over-night incubation at 37°C. Glucanase activity leads to the formation of a white halo around the colonies, whereas xylanase activity leads to the formation of a black halo [31] . E. coli cells expressing IFP-6xHis fusion protein were used as negative control, and cell-free supernatant of Pichia pastoris expression cultures containing secreted endo-β-1,4-glucanase-myc-6xHis or endo-β-1,4-xylanase-myc-6xHis fusion proteins were used as positive controls (P).

    Article Snippet: Protein expression in E. coli and TEV protease cleavage For protein expression in E. coli LIC-pDEST-LC1/LC2 plasmid templates were transformed into different expression strains, i.e. BL21 (DE3) pLysS (Agilent Technologies, Waldbronn, Germany), BL21 (DE3) CodonPlus-RIL (Agilent Technologies), and Rosetta (DE3) pRARE (Merck, Darmstadt, Germany).

    Techniques: Activity Assay, Transformation Assay, Staining, Transferring, Expressing, Incubation, Negative Control

    Infrared analysis of in vitro and in vivo expressed IFP fusion proteins. Infrared scanning of all samples was performed in microtiter plates using the Odyssey Infrared Imaging System from LI-COR Biosciences. ( A ) In vitro transcription/translation products were analysed by infrared scanning using the whole reaction mixtures. 6xHis-GFP and IFP-6xHis fusion protein-expressing samples were used as negative (-) and positive (+) controls, respectively. ( B ) In-cell detection of IFP fusion protein (6xHis-IFP-TEV-ANAC042 shown as an example) in two randomly selected clones each from the E. coli strains (BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’). 6xHis-GFP and IFP-6xHis fusion protein-expressing cells were used as negative (-) and positive (+) controls, respectively. ( C ), ( D ) and ( E ) In-cell detection of IFP fusion protein (SAM1-TEV-IFP-6xHis shown as an example) in randomly selected K. lactis , P. pastoris and L. tarentolae clones. Cell lines not expressing IPF or expressing IFP-6xHis fusion protein were used as negative (-) and positive (+) controls, respectively. No positive control was available for expression in K. lactis . Note that strong infrared signal appears white in the digital images.

    Journal: PLoS ONE

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

    doi: 10.1371/journal.pone.0018900

    Figure Lengend Snippet: Infrared analysis of in vitro and in vivo expressed IFP fusion proteins. Infrared scanning of all samples was performed in microtiter plates using the Odyssey Infrared Imaging System from LI-COR Biosciences. ( A ) In vitro transcription/translation products were analysed by infrared scanning using the whole reaction mixtures. 6xHis-GFP and IFP-6xHis fusion protein-expressing samples were used as negative (-) and positive (+) controls, respectively. ( B ) In-cell detection of IFP fusion protein (6xHis-IFP-TEV-ANAC042 shown as an example) in two randomly selected clones each from the E. coli strains (BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’). 6xHis-GFP and IFP-6xHis fusion protein-expressing cells were used as negative (-) and positive (+) controls, respectively. ( C ), ( D ) and ( E ) In-cell detection of IFP fusion protein (SAM1-TEV-IFP-6xHis shown as an example) in randomly selected K. lactis , P. pastoris and L. tarentolae clones. Cell lines not expressing IPF or expressing IFP-6xHis fusion protein were used as negative (-) and positive (+) controls, respectively. No positive control was available for expression in K. lactis . Note that strong infrared signal appears white in the digital images.

    Article Snippet: Protein expression in E. coli and TEV protease cleavage For protein expression in E. coli LIC-pDEST-LC1/LC2 plasmid templates were transformed into different expression strains, i.e. BL21 (DE3) pLysS (Agilent Technologies, Waldbronn, Germany), BL21 (DE3) CodonPlus-RIL (Agilent Technologies), and Rosetta (DE3) pRARE (Merck, Darmstadt, Germany).

    Techniques: In Vitro, In Vivo, Imaging, Expressing, Clone Assay, Positive Control

    Expression of IFP fusion proteins in E. coli . Protein extracts obtained from IFP fusion protein-expressing E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’) were separated by SDS-PAGE and analysed by in-gel infrared imaging at 700 nm to detect IFP moieties (upper panel), followed by western transfer and immunological detection at 800 nm (using monoclonal mouse antibody directed against the 6xHis epitope; lower panel). IFP-6xHis fusion protein-expressing cells were used as positive control. Supernatant (S) and pellet (P) fractions of disrupted cells were analyzed after ultracentrifugation. M, molecular mass marker (kDa). Arrows indicate expected proteins.

    Journal: PLoS ONE

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

    doi: 10.1371/journal.pone.0018900

    Figure Lengend Snippet: Expression of IFP fusion proteins in E. coli . Protein extracts obtained from IFP fusion protein-expressing E. coli strains BL21 (DE3) pLysS (‘pLysS’), BL21 Star (DE3) pRARE (‘Star’), BL21 (DE3) CodonPlus-RIL (‘Codon’), and Rosetta (DE3) pRARE (‘Rosetta’) were separated by SDS-PAGE and analysed by in-gel infrared imaging at 700 nm to detect IFP moieties (upper panel), followed by western transfer and immunological detection at 800 nm (using monoclonal mouse antibody directed against the 6xHis epitope; lower panel). IFP-6xHis fusion protein-expressing cells were used as positive control. Supernatant (S) and pellet (P) fractions of disrupted cells were analyzed after ultracentrifugation. M, molecular mass marker (kDa). Arrows indicate expected proteins.

    Article Snippet: Protein expression in E. coli and TEV protease cleavage For protein expression in E. coli LIC-pDEST-LC1/LC2 plasmid templates were transformed into different expression strains, i.e. BL21 (DE3) pLysS (Agilent Technologies, Waldbronn, Germany), BL21 (DE3) CodonPlus-RIL (Agilent Technologies), and Rosetta (DE3) pRARE (Merck, Darmstadt, Germany).

    Techniques: Expressing, SDS Page, Imaging, Western Blot, Positive Control, Marker