dynabeads oligo dt 25  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Dynabeads Oligo(dT)25
    Description:
    Dynabeads Oligo(dT)25 mRNA isolation beads specifically target and capture mRNA molecules from virtually any crude sample and eliminate the need to purify total RNA when the desired information-bearing nucleic acid is mRNA. Since mRNA comprises only about 1–5% ot total cellular RNA, the isolation of total RNA is not the most efficient way to isolate mRNA. Other technologies designed to purify total RNA yield ~80% ribosomal RNA and force mRNA to compete with ribosomal RNA, transfer RNA, micro RNA, small nucleolar RNA, and small cytoplasmic RNA for membrane binding. Advantages of Dynabeads Oligo(dT)25 beads:• Fast and gentle procedure yields pure intact mRNA• Extremely pure mRNA isolation, best choice upstream of cDNA synthesis• Exquisitely sensitive mRNA isolation enables cDNA synthesis and cDNA library construction from ultra-small starting samples (enables cDNA library construction from a single cell)How the beads workThe oligo(dT)25-coated Dynabeads specifically target and capture the mRNA transcriptome from an extremely wide variety of crude starting samples. Ribosomal RNA, DNA, proteins, and small RNA molecules (such as transfer RNA, micro RNA, and small nucleolar RNA) do not bind to the beads and are discarded. Only polyadenylated RNA species (mRNA) are captured. Isolated mRNA is pure, eliminating the need for ribosomal RNA subtraction or a post-extraction DNase treatment. This column-free system ensures the highest transcriptome recovery:• Physical mRNA capture on mobile magnetic beads• Rapid and gentle magnetic handling procedures• No mRNA lost during high g-force spins• No mRNA trapped in column membranes during elutionApplicationsmRNA is suitable for all downstream molecular applications, including gene cloning, cDNA synthesis, cDNA library construction, RT-PCR, quantitative RT-PCR, RPA (Ribonuclease Protection Assay), subtractive hybridization, primer extension, SAGE, RACE, and others. The Dynabeads Oligo(dT)25 mRNA isolation beads are the ideal mRNA purification method prior to cDNA library construction. Use of these beads ensures the highest recovery and enrichment of the transcriptome. These beads capture more of the transcriptome than is possible with methods that integrate a total RNA isolation step upstream of mRNA isolation.Verastile elution optionsElution can be performed in any volume down to 5 µL. mRNA elution is optional because enzymatic reactions in downstream procedures are not inhibited by presence of Dynabeads. Additionally, one can perform cDNA synthesis directly on the beads to create a reusable solid-phase cDNA library.
    Catalog Number:
    61002
    Price:
    None
    Applications:
    Automated mRNA Isolation|Bead-Based IVD Assay Development|Bead-Based Nucleic Acid IVD|Clinical|DNA & RNA Purification & Analysis|Diagnostic Development|Molecular Diagnostic Test Development|RNA Extraction|mRNA Isolation|Automated Nucleic Acid Purification
    Size:
    2 mL
    Category:
    Beads & Microspheres, Magnetic Beads Ligand-Coupled, Magnetic Beads Oligo(dT)
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher dynabeads oligo dt 25
    Dynabeads Oligo(dT)25 mRNA isolation beads specifically target and capture mRNA molecules from virtually any crude sample and eliminate the need to purify total RNA when the desired information-bearing nucleic acid is mRNA. Since mRNA comprises only about 1–5% ot total cellular RNA, the isolation of total RNA is not the most efficient way to isolate mRNA. Other technologies designed to purify total RNA yield ~80% ribosomal RNA and force mRNA to compete with ribosomal RNA, transfer RNA, micro RNA, small nucleolar RNA, and small cytoplasmic RNA for membrane binding. Advantages of Dynabeads Oligo(dT)25 beads:• Fast and gentle procedure yields pure intact mRNA• Extremely pure mRNA isolation, best choice upstream of cDNA synthesis• Exquisitely sensitive mRNA isolation enables cDNA synthesis and cDNA library construction from ultra-small starting samples (enables cDNA library construction from a single cell)How the beads workThe oligo(dT)25-coated Dynabeads specifically target and capture the mRNA transcriptome from an extremely wide variety of crude starting samples. Ribosomal RNA, DNA, proteins, and small RNA molecules (such as transfer RNA, micro RNA, and small nucleolar RNA) do not bind to the beads and are discarded. Only polyadenylated RNA species (mRNA) are captured. Isolated mRNA is pure, eliminating the need for ribosomal RNA subtraction or a post-extraction DNase treatment. This column-free system ensures the highest transcriptome recovery:• Physical mRNA capture on mobile magnetic beads• Rapid and gentle magnetic handling procedures• No mRNA lost during high g-force spins• No mRNA trapped in column membranes during elutionApplicationsmRNA is suitable for all downstream molecular applications, including gene cloning, cDNA synthesis, cDNA library construction, RT-PCR, quantitative RT-PCR, RPA (Ribonuclease Protection Assay), subtractive hybridization, primer extension, SAGE, RACE, and others. The Dynabeads Oligo(dT)25 mRNA isolation beads are the ideal mRNA purification method prior to cDNA library construction. Use of these beads ensures the highest recovery and enrichment of the transcriptome. These beads capture more of the transcriptome than is possible with methods that integrate a total RNA isolation step upstream of mRNA isolation.Verastile elution optionsElution can be performed in any volume down to 5 µL. mRNA elution is optional because enzymatic reactions in downstream procedures are not inhibited by presence of Dynabeads. Additionally, one can perform cDNA synthesis directly on the beads to create a reusable solid-phase cDNA library.
    https://www.bioz.com/result/dynabeads oligo dt 25/product/Thermo Fisher
    Average 95 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    dynabeads oligo dt 25 - by Bioz Stars, 2020-01
    95/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: After incubation for 10 min on ice, the nucleoplasm and chromatin fraction were then separated by centrifugation at 4°C, 15,000 g , for 2 min. Fractionation efficiency was validated by Western blotting using antibodies specific to marker proteins for each fraction: β-tubulin (Sigma, Cat#T8328) for cytoplasm, U1-70k (a kind gift from Dr. Douglas Black) for nucleoplasm, and Histone 3 (Abcam, Cat#ab1791) for chromatin. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Amplification:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Fragments of 350 ± 50 bp were size-selected using Agencourt AMPure XP beads, and subjected to ligation-mediated PCR amplification (LM-PCR), using Q5 DNA polymerase (NEB). .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNaseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 μL SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50°C for 90 minutes, in a total reaction volume of 21 μl. .. PCR reactions were pooled, purified using AMPureXP beads (1.0x) and eluted in 18 μL 0.1xTE.

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. The levels of cDNA were assessed by quantitative real-time PCR using Fast SYBR® Green Master Mix (Applied Biosystems, Life Technologies Corporation, Carlsbad, California, USA).

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°. .. Subsequent steps to generate the sequencing libraries were performed with the NebNext kit for Illumina sequencing with minor modifications, i.e., after indexed adapter ligation to the dsDNA fragments, the library was treated with USER enzyme (NEB M5505L) in order to digest the second strand derived fragments.

    Article Title: Genomics of Natural Populations: How Differentially Expressed Genes Shape the Evolution of Chromosomal Inversions in Drosophila pseudoobscura
    Article Snippet: Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0). .. Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0).

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002). .. Second strand synthesis then incorporated Uridine residues into cDNA. cDNA was purified with AMPure beads (Agencourt). cDNA was then dA-tailed and NEBNext adaptors for Illumina were ligated before another AMPure purification.

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA. .. This protocol includes a heat-based mRNA fragmentation step (15 min at 94°C in first-strand cDNA synthesis buffer), and actinomycin D (Sigma-Aldrich A1410) is added during first-strand cDNA synthesis to inhibit DNA-dependent DNA polymerase activity and prevent template switching.

    Synthesized:

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion). .. After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion).

    Genome Wide:

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Paragraph title: Genome-wide expression profiling by RNA-seq ... Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002).

    RNA Sequencing Assay:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: RNA-seq was performed in SGC7901 cells with overexpression of ISL1. .. For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , . .. The ChIP primers used are listed in Supplementary Table .

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Libraries were quantified by qPCR using primers annealing to the adaptor sequence and sequenced at a concentration of 10 pM on an Illumina HiSeq 2000. .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ). .. Once dUTP-marked double-stranded cDNA was obtained, the remaining library construction steps followed the same protocol as described above for ChIP-seq libraries.

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: Paragraph title: Cell fractionation and RNA-seq library construction ... Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Article Title: Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq
    Article Snippet: TRAP RNA from 50 embryos was pooled for RNA-seq. .. The polyadenylated RNA was purified by binding to oligo (dT) magnetic beads (ThermoFisher Scientific, 61005).

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: Strand specific RNA-seq libraries were generated using the method described by [ ] with minor modifications. .. In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°.

    Article Title: Genomics of Natural Populations: How Differentially Expressed Genes Shape the Evolution of Chromosomal Inversions in Drosophila pseudoobscura
    Article Snippet: Paragraph title: RNA-seq ... Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0).

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Paragraph title: Genome-wide expression profiling by RNA-seq ... Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002).

    Article Title: Totipotent Embryonic Stem Cells Arise in Ground-State Culture Conditions
    Article Snippet: Paragraph title: RNA-Seq ... Approximately 10 μg of total RNA underwent two rounds of mRNA enrichment with Dynalbeads Oligo(dT)25 (61005, Life Technologies).

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: For the analysis of differentially expressed genes, the Aiptasia larval RNA-Seq datasets described in Baumgarten et al. were obtained from the NCBI SRA database, with two replicates for aposymbiotic (accession no.: SRX757531) and symbiotic (accession no.: SRX757532) larvae each. .. For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific).

    Article Title: Analysis of Post-Traumatic Brain Injury Gene Expression Signature Reveals Tubulins, Nfe2l2, Nfkb, Cd44, and S100a4 as Treatment Targets
    Article Snippet: Paragraph title: Preparation of the sequencing library and RNA-sequencing ... RNA was extracted from the perilesional cortex, thalamus, and hippocampus DNaesy Blood & Tissue kit (#69504, Qiagen, Hilden, Germany) followed by DNase digestion. mRNA from 2 μg of total RNA was enriched using Dynabeads Oligo (dT)25 beads (#61002, Invitrogen, Carlsbad, CA, USA).

    Construct:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: RNA-seq was performed in SGC7901 cells with overexpression of ISL1. .. For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , . .. The ChIP primers used are listed in Supplementary Table .

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Libraries were quantified by qPCR using primers annealing to the adaptor sequence and sequenced at a concentration of 10 pM on an Illumina HiSeq 2000. .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ). .. Once dUTP-marked double-stranded cDNA was obtained, the remaining library construction steps followed the same protocol as described above for ChIP-seq libraries.

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°. .. In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°.

    Real-time Polymerase Chain Reaction:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Libraries were quantified by qPCR using primers annealing to the adaptor sequence and sequenced at a concentration of 10 pM on an Illumina HiSeq 2000. .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNaseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 μL SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50°C for 90 minutes, in a total reaction volume of 21 μl. .. PCR reactions were pooled, purified using AMPureXP beads (1.0x) and eluted in 18 μL 0.1xTE.

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Paragraph title: Quantitative Real-Time PCR ... Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol.

    Article Title: Totipotent Embryonic Stem Cells Arise in Ground-State Culture Conditions
    Article Snippet: Approximately 10 μg of total RNA underwent two rounds of mRNA enrichment with Dynalbeads Oligo(dT)25 (61005, Life Technologies). .. ATP (0.83 mM, 11140965001, Roche) and 10 U of T4 PNK (M0201L, NEB) were added and incubated at 37°C for 30 min. RNA was purified using Purelink RNA Micro Kit (12183-016, Life Technologies).

    Microarray:

    Article Title: Microarray Analysis of Tomato Plants Exposed to the Nonviruliferous or Viruliferous Whitefly Vector HarboringPepper golden mosaic virus
    Article Snippet: Paragraph title: Microarray Hybridization ... Enrichment and purification of messenger RNA (mRNA) was conducted with Dynabeads Oligo (dT) 25 (Dynal Biotech, Lake Success, NY).

    Incubation:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: After pre-clearing with BSA-blocked proteinA/G Sepharose, chromatin was incubated with antibodies at 4 °C overnight. .. For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , .

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: After incubation for 10 min on ice, the nucleoplasm and chromatin fraction were then separated by centrifugation at 4°C, 15,000 g , for 2 min. Fractionation efficiency was validated by Western blotting using antibodies specific to marker proteins for each fraction: β-tubulin (Sigma, Cat#T8328) for cytoplasm, U1-70k (a kind gift from Dr. Douglas Black) for nucleoplasm, and Histone 3 (Abcam, Cat#ab1791) for chromatin. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Article Title: Totipotent Embryonic Stem Cells Arise in Ground-State Culture Conditions
    Article Snippet: Approximately 10 μg of total RNA underwent two rounds of mRNA enrichment with Dynalbeads Oligo(dT)25 (61005, Life Technologies). .. Approximately 10 μg of total RNA underwent two rounds of mRNA enrichment with Dynalbeads Oligo(dT)25 (61005, Life Technologies).

    Infection:

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: Briefly, larvae 3–4 dpf were infected with Symbiodinium strain SSB01 at a concentration of 2.5–5 × 104 algae/ml for 5–6 days (FASW as negative control). .. For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific).

    Activity Assay:

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA. .. Beads were washed three times with Oligo-dT Washing Buffer (10 mM Tris, pH 7.5, 150 mM LiCl, 1 mM EDTA), and eluted in 10 μl BTE buffer by heating at 80°C for 2 min. Strand-specific cDNA libraries were generated using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs , E7420S).

    Cell Culture:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer. .. The flow-through was collected, and the RNA was extracted using TRIzol LS as nonpolyadenylated RNA.

    Expressing:

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. Standard curves and melting curves were determined for each set of primers to confirm that a single amplicon was generated.

    Article Title: Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq
    Article Snippet: Paragraph title: Gene expression analysis ... The polyadenylated RNA was purified by binding to oligo (dT) magnetic beads (ThermoFisher Scientific, 61005).

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Paragraph title: Genome-wide expression profiling by RNA-seq ... Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002).

    Cell Fractionation:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: Paragraph title: Cell fractionation and RNA-seq library construction ... Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Western Blot:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: After incubation for 10 min on ice, the nucleoplasm and chromatin fraction were then separated by centrifugation at 4°C, 15,000 g , for 2 min. Fractionation efficiency was validated by Western blotting using antibodies specific to marker proteins for each fraction: β-tubulin (Sigma, Cat#T8328) for cytoplasm, U1-70k (a kind gift from Dr. Douglas Black) for nucleoplasm, and Histone 3 (Abcam, Cat#ab1791) for chromatin. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Over Expression:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: RNA-seq was performed in SGC7901 cells with overexpression of ISL1. .. For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , .

    Derivative Assay:

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°. .. Second strand was generated using dUTP instead of dTTP to tag the second strand.

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: In the present study, two male KO and two male WT mice were used per gene model. For each individual, 2.5 μg of total RNA derived from muscle were chemically fragmented with RNA fragmentation buffer (AM8740, Ambion). .. After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion).

    Hybridization:

    Article Title: Microarray Analysis of Tomato Plants Exposed to the Nonviruliferous or Viruliferous Whitefly Vector HarboringPepper golden mosaic virus
    Article Snippet: Paragraph title: Microarray Hybridization ... Enrichment and purification of messenger RNA (mRNA) was conducted with Dynabeads Oligo (dT) 25 (Dynal Biotech, Lake Success, NY).

    Ligation:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Fragments of 350 ± 50 bp were size-selected using Agencourt AMPure XP beads, and subjected to ligation-mediated PCR amplification (LM-PCR), using Q5 DNA polymerase (NEB). .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°. .. Second strand was generated using dUTP instead of dTTP to tag the second strand.

    Transferring:

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: Before transferring into micro titer plate, total RNA, stored at −80 °C, was quantified & qualified using Nanodrop & BioAnalyzer (Agilent) instruments. .. Desired total RNA quantities were diluted into Binding Buffer provided with the DynabeadsOligo(dT)25 Kit (61002, Life Technologies) and BSA (B14, Thermo Scientific) was added to a final concentration of 0.4%.

    Introduce:

    Article Title: Genomics of Natural Populations: How Differentially Expressed Genes Shape the Evolution of Chromosomal Inversions in Drosophila pseudoobscura
    Article Snippet: Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0). .. First-strand complementary DNA (cDNA) was synthesized using the Superscript III reverse transcriptase (Life Technologies, cat. no. 18080-044) and purified using Agencourt RNAClean XP beads (Beckman Coulter, cat. no. A63987).

    Generated:

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. The levels of cDNA were assessed by quantitative real-time PCR using Fast SYBR® Green Master Mix (Applied Biosystems, Life Technologies Corporation, Carlsbad, California, USA).

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: Strand specific RNA-seq libraries were generated using the method described by [ ] with minor modifications. .. In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°.

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA. .. RNA and beads were incubated at room temperature for 10 min, shaking.

    Polymerase Chain Reaction:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Fragments of 350 ± 50 bp were size-selected using Agencourt AMPure XP beads, and subjected to ligation-mediated PCR amplification (LM-PCR), using Q5 DNA polymerase (NEB). .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNaseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 μL SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50°C for 90 minutes, in a total reaction volume of 21 μl. .. To repress residual plasmid DNA contamination, cDNA was PCR amplified using a combination of primers (152 STARR reporter specific primer 2 fw, GGGCCAGCTGTTGGGGTG∗ T∗ C∗ C∗ A∗ C and 153 STARR reporter specific primer 2 rv, CTTATCATGTCTGCTCGA∗ A∗ G∗ C, where ∗ represent phosphorothioate bonds) spanning a synthetic intron in the STARR-seq plasmid, as previously described ( ).

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer. .. To prepare for RNA-seq libraries, we started with 50 ng RNA extracted from each sample.

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion). .. After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion).

    Article Title: Genomics of Natural Populations: How Differentially Expressed Genes Shape the Evolution of Chromosomal Inversions in Drosophila pseudoobscura
    Article Snippet: Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0). .. Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0).

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002). .. Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002).

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA. .. This protocol includes a heat-based mRNA fragmentation step (15 min at 94°C in first-strand cDNA synthesis buffer), and actinomycin D (Sigma-Aldrich A1410) is added during first-strand cDNA synthesis to inhibit DNA-dependent DNA polymerase activity and prevent template switching.

    Sonication:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: For ChIP-seq library construction, cross-linked and isolated nuclei were sonicated to an average size of ~250 bp, and ~1 ng of DNA was prepared as described previously . .. For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , .

    Binding Assay:

    Article Title: Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq
    Article Snippet: TRAP RNA from 50 embryos was pooled for RNA-seq. .. The polyadenylated RNA was purified by binding to oligo (dT) magnetic beads (ThermoFisher Scientific, 61005). .. RNA-seq libraries were prepared with ScriptSeq v2 kit (Illumina, SSV 21106) according to the manufacturer’s instructions.

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Purified total RNA was diluted to 50 μl in BTE buffer (10 mM Bis-tris, pH 6.7, 1 mM EDTA), denatured by heating at 65°C for 5 minutes, and place immediately on ice. .. Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA. .. RNA and beads were incubated at room temperature for 10 min, shaking.

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: Before transferring into micro titer plate, total RNA, stored at −80 °C, was quantified & qualified using Nanodrop & BioAnalyzer (Agilent) instruments. .. Desired total RNA quantities were diluted into Binding Buffer provided with the DynabeadsOligo(dT)25 Kit (61002, Life Technologies) and BSA (B14, Thermo Scientific) was added to a final concentration of 0.4%. .. For the preparation of the paramagnetic beads solutions for droplet generation, after resuspending Dynabeads in the vial, 100 μL was transfer to a tube and placed in a magnet for 1 min.

    ChIP-sequencing:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: Paragraph title: ChIP, ChIP-seq, and RNA-seq ... For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , .

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Paragraph title: ChIP, ChIP-seq and RNA-seq ... For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Gene Knockout:

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: In the present study, two male KO and two male WT mice were used per gene model. For each individual, 2.5 μg of total RNA derived from muscle were chemically fragmented with RNA fragmentation buffer (AM8740, Ambion). .. After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion).

    Magnetic Beads:

    Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
    Article Snippet: Translation efficiency values were calculated by dividing normalized Riboseq read counts by normalized RNAseq read counts for each replicate. .. Total RNA was isolated from MOLM-13 cells by Trizol and poly(A)+ RNA isolated using Dynabeads Oligo-(dT)25 magnetic beads (ThermoFisher Scientific). .. Five micrograms of anti-m6 A antibody (Abcam, ab151230) was pre-bound to Protein A/G magnetic beads (Pierce) in IP buffer (20 mM Tris pH 7.5, 140 mM NaCl, 1%% NP-40, 2 mM EDTA) for one hour.

    Article Title: Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq
    Article Snippet: TRAP RNA from 50 embryos was pooled for RNA-seq. .. The polyadenylated RNA was purified by binding to oligo (dT) magnetic beads (ThermoFisher Scientific, 61005). .. RNA-seq libraries were prepared with ScriptSeq v2 kit (Illumina, SSV 21106) according to the manufacturer’s instructions.

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: In the present study, two male KO and two male WT mice were used per gene model. For each individual, 2.5 μg of total RNA derived from muscle were chemically fragmented with RNA fragmentation buffer (AM8740, Ambion). .. After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion). .. Reverse transcription with SuperScript III Reverse Transcriptase (18080, Invitrogen) was used to synthesize first cDNA strand with integration of both 5′adaptor and 3′adaptor.

    Isolation:

    Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
    Article Snippet: Translation efficiency values were calculated by dividing normalized Riboseq read counts by normalized RNAseq read counts for each replicate. .. Total RNA was isolated from MOLM-13 cells by Trizol and poly(A)+ RNA isolated using Dynabeads Oligo-(dT)25 magnetic beads (ThermoFisher Scientific). .. Five micrograms of anti-m6 A antibody (Abcam, ab151230) was pre-bound to Protein A/G magnetic beads (Pierce) in IP buffer (20 mM Tris pH 7.5, 140 mM NaCl, 1%% NP-40, 2 mM EDTA) for one hour.

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: RNA-seq was performed in SGC7901 cells with overexpression of ISL1. .. For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , . .. The ChIP primers used are listed in Supplementary Table .

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Libraries were quantified by qPCR using primers annealing to the adaptor sequence and sequenced at a concentration of 10 pM on an Illumina HiSeq 2000. .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ). .. Once dUTP-marked double-stranded cDNA was obtained, the remaining library construction steps followed the same protocol as described above for ChIP-seq libraries.

    Article Title: Genome-wide identification of Drosophila dorso-ventral enhancers by differential histone acetylation analysis
    Article Snippet: Total mRNA was extracted from 20–100 mg Tl 10b embryos in duplicates and from gd 7 and Tl rm9/rm10 embryos in triplicates using the Maxwell Total mRNA purification kit (AS1225, Promega) according to the manufacturer’s instructions. .. PolyA-mRNA was isolated using Dynabeads oligo (dT) (61002, Life Technologies). .. Libraries were prepared following the instructions of the TruSeq DNA Sample Preparation Kit (FC-121-2001, Illumina) and sequenced on the HiSeq 2500 (Illumina).

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: Total RNA was extracted from each fractionated sample using TRIzol LS (Thermo Fisher Scientific, Cat# 10296028), and ribosomal RNA was depleted using the RiboMinus Transcriptome Isolation Kit (Thermo Fisher Scientific, Cat# K1550-02) according to the manufacturer's instructions. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Using a mice brain slice matrix, 500 µm slices were cut and with the help of anatomical coordinates (The Mouse Brain in Stereotaxic Coordinates, Second Edition, Paxinos and Franklin) the SNpc was localised and dissected. .. Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. The eluted mRNA was immediately used for cDNA synthesis according to High-Capacity cDNA Reverse Transcription Kit protocol (Applied Biosystems, Warrington, UK).

    Article Title: Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq
    Article Snippet: E10.5 Rosa26fsTrap/+ ;Tie2Cre embryos were isolated from Swiss Webster strain pregnant females crossed to Rosa26fsTrap/Trap ;Tie2Cre males. .. The polyadenylated RNA was purified by binding to oligo (dT) magnetic beads (ThermoFisher Scientific, 61005).

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: Strand specific RNA-seq libraries were generated using the method described by [ ] with minor modifications. .. In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°. .. Random hexamer primed first strand was generated in presence of dATP, dGTP, dCTP and cTTP.

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Strand specific RNA-seq libraries were made using the NEBNext Ultra Strand-specific RNA-seq library prep kit (NEB #E7420S/L) with manufacturers instructions. .. Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002). .. RNA was fragmented and first strand synthesis performed with ProtoScript II reverse transcriptase and random hexamers.

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: Paragraph title: RNA isolation and sequencing ... For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific).

    Article Title: Drosophila poised enhancers are generated during tissue patterning with the help of repression
    Article Snippet: Total mRNA was extracted from 50–100 mg 2–4 h AED Tl 10b embryos in duplicates and gd 7 embryos in triplicates using the Maxwell total mRNA purification kit (Promega, no. AS1225) according to the manufacturer's instructions. .. PolyA-mRNA was isolated using Dynabeads oligo(dT) (Life Technologies, no. 61002). .. Libraries were prepared following the instructions of the TruSeq DNA sample preparation kit (Illumina, no. FC-121-2001) and sequenced on the HiSeq 2500 (Illumina) or the NextSeq 500 (Illumina).

    Multiplex Assay:

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002). .. USER excision removed the second strand and libraries were amplified with NEBNext High Fidelity PCR master mix (NEB).

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA. .. This protocol includes a heat-based mRNA fragmentation step (15 min at 94°C in first-strand cDNA synthesis buffer), and actinomycin D (Sigma-Aldrich A1410) is added during first-strand cDNA synthesis to inhibit DNA-dependent DNA polymerase activity and prevent template switching.

    Purification:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNaseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 μL SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50°C for 90 minutes, in a total reaction volume of 21 μl. .. PCR was performed with Phusion polymerase and High-fidelity buffer, in 6 × 50 μl reactions (cycling conditions: 98°C 2 min, (98°C 10 s, 62°C 30 s, 72°C 70 s) x15, 72°C 5 min, 4°C hold).

    Article Title: Genome-wide identification of Drosophila dorso-ventral enhancers by differential histone acetylation analysis
    Article Snippet: Total mRNA was extracted from 20–100 mg Tl 10b embryos in duplicates and from gd 7 and Tl rm9/rm10 embryos in triplicates using the Maxwell Total mRNA purification kit (AS1225, Promega) according to the manufacturer’s instructions. .. PolyA-mRNA was isolated using Dynabeads oligo (dT) (61002, Life Technologies).

    Article Title: Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq
    Article Snippet: TRAP RNA from 50 embryos was pooled for RNA-seq. .. The polyadenylated RNA was purified by binding to oligo (dT) magnetic beads (ThermoFisher Scientific, 61005). .. RNA-seq libraries were prepared with ScriptSeq v2 kit (Illumina, SSV 21106) according to the manufacturer’s instructions.

    Article Title: Comparative Transcriptome Analysis Reveals Different Silk Yields of Two Silkworm Strains
    Article Snippet: Contaminating genomic DNA was removed from a 3 μg total RNA aliquot by treatment with 10 μg DNase I (Takara, Japan) for 30 min at 37°C. .. RNA was purified from the digest using Dynabeads® Oligo (dT) 25 (Life Tech, USA). .. Finally, 100 ng purified mRNA per sample were used to construct the respective cDNA libraries using an NEBNext® UltraTM RNA Library Prep Kit for Illumina (NEB, USA).

    Article Title: A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity
    Article Snippet: Strand specific RNA-seq libraries were made using the NEBNext Ultra Strand-specific RNA-seq library prep kit (NEB #E7420S/L) with manufacturers instructions. .. Briefly, RNA was isolated by standard acid phenol chloroform extraction and poly-adenylated RNA was purified with oligo (dT) dynabeads (Thermo Fisher #61002). .. RNA was fragmented and first strand synthesis performed with ProtoScript II reverse transcriptase and random hexamers.

    Article Title: Microarray Analysis of Tomato Plants Exposed to the Nonviruliferous or Viruliferous Whitefly Vector HarboringPepper golden mosaic virus
    Article Snippet: Total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA). .. Enrichment and purification of messenger RNA (mRNA) was conducted with Dynabeads Oligo (dT) 25 (Dynal Biotech, Lake Success, NY). .. The mRNA was reverse transcribed and labeled with Cy3- and Cy5-deoxyuridine triphosphate (Amersham Biosciences, Piscataway, NJ).

    Article Title: Genomic and Proteomic Resolution of Heterochromatin and its Restriction of Alternate Fate Genes
    Article Snippet: Purified total RNA was diluted to 50 μl in BTE buffer (10 mM Bis-tris, pH 6.7, 1 mM EDTA), denatured by heating at 65°C for 5 minutes, and place immediately on ice. .. Oligo(dT)25 Dynabeads (Thermo Fisher Scientific #61002) were washed three times in 2x Oligo-dT Binding Buffer (2xOBB: 20 mM Tris, pH 7.5, 1 M LiCl, 2 mM EDTA), resuspended in 50 μl 2xOBB, and mixed with an equal volume of denatured RNA.

    Article Title: Totipotent Embryonic Stem Cells Arise in Ground-State Culture Conditions
    Article Snippet: Approximately 10 μg of total RNA underwent two rounds of mRNA enrichment with Dynalbeads Oligo(dT)25 (61005, Life Technologies). .. Approximately 10 μg of total RNA underwent two rounds of mRNA enrichment with Dynalbeads Oligo(dT)25 (61005, Life Technologies).

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: Two separate crosses were used for duplicate pairs, with cross 1 containing 6,500 larvae per treatment and cross 2 containing 8,400 larvae per treatment. .. For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific). .. The sequencing libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit (#E7420, NEB) with 180 bp insert sizes and sequenced on an Illumina HiSeq2000 at 2 × 101 bp read length.

    Article Title: Drosophila poised enhancers are generated during tissue patterning with the help of repression
    Article Snippet: Total mRNA was extracted from 50–100 mg 2–4 h AED Tl 10b embryos in duplicates and gd 7 embryos in triplicates using the Maxwell total mRNA purification kit (Promega, no. AS1225) according to the manufacturer's instructions. .. PolyA-mRNA was isolated using Dynabeads oligo(dT) (Life Technologies, no. 61002).

    Sequencing:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Libraries were quantified by qPCR using primers annealing to the adaptor sequence and sequenced at a concentration of 10 pM on an Illumina HiSeq 2000. .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Inter- and intra-species variation in genome-wide gene expression of Drosophila in response to parasitoid wasp attack
    Article Snippet: Paragraph title: Sequencing ... In short, mRNA was isolated from 500 ng total RNA using oligo-dT Dynabeads (LifeTech 61002) and fragmented to 150–200 nt in first strand buffer for 3 minutes at 94°.

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: Paragraph title: Preparation of WTTS-seq libraries and sequencing ... After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion).

    Article Title: Genomics of Natural Populations: How Differentially Expressed Genes Shape the Evolution of Chromosomal Inversions in Drosophila pseudoobscura
    Article Snippet: Illumina RNA-seq ( ) was performed following standard protocols by the Baylor College of Medicine Human Genome Sequencing Center (Houston) on an Illumina HiSequation 2000 sequencing platform. .. Briefly, poly-A+ messenger RNA (mRNA) was extracted from 1 μg total RNA using Oligo(dT)25 Dynabeads (Life Technologies, cat. no. 61002) followed by fragmentation of the mRNA by heat at 94 ° for 3 min [for samples with RNA Integrity Number (RNI) = 3–6] or 4 min (for samples with RIN of ≥6.0).

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: Paragraph title: RNA isolation and sequencing ... For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific).

    Article Title: Analysis of Post-Traumatic Brain Injury Gene Expression Signature Reveals Tubulins, Nfe2l2, Nfkb, Cd44, and S100a4 as Treatment Targets
    Article Snippet: Paragraph title: Preparation of the sequencing library and RNA-sequencing ... RNA was extracted from the perilesional cortex, thalamus, and hippocampus DNaesy Blood & Tissue kit (#69504, Qiagen, Hilden, Germany) followed by DNase digestion. mRNA from 2 μg of total RNA was enriched using Dynabeads Oligo (dT)25 beads (#61002, Invitrogen, Carlsbad, CA, USA).

    Immunoprecipitation:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Briefly, immunoprecipitated DNA was first end-repaired using End-It Repair Kit (Epicentre), tailed with deoxyadenine using Klenow exo minus (NEB), and ligated to custom adapters with T4 Rapid DNA Ligase (Enzymatics). .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Quantitative RT-PCR:

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: Paragraph title: Preparation of the solutions for RT-qPCR performed in the droplet platform ... Desired total RNA quantities were diluted into Binding Buffer provided with the DynabeadsOligo(dT)25 Kit (61002, Life Technologies) and BSA (B14, Thermo Scientific) was added to a final concentration of 0.4%.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: After incubation for 10 min on ice, the nucleoplasm and chromatin fraction were then separated by centrifugation at 4°C, 15,000 g , for 2 min. Fractionation efficiency was validated by Western blotting using antibodies specific to marker proteins for each fraction: β-tubulin (Sigma, CatT8328) for cytoplasm, U1-70k (a kind gift from Dr. Douglas Black) for nucleoplasm, and Histone 3 (Abcam, Cat#ab1791) for chromatin. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Mouse Assay:

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Using a mice brain slice matrix, 500 µm slices were cut and with the help of anatomical coordinates (The Mouse Brain in Stereotaxic Coordinates, Second Edition, Paxinos and Franklin) the SNpc was localised and dissected. .. Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. The eluted mRNA was immediately used for cDNA synthesis according to High-Capacity cDNA Reverse Transcription Kit protocol (Applied Biosystems, Warrington, UK).

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: In the present study, two male KO and two male WT mice were used per gene model. For each individual, 2.5 μg of total RNA derived from muscle were chemically fragmented with RNA fragmentation buffer (AM8740, Ambion). .. After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion).

    Chromatin Immunoprecipitation:

    Article Title: ISL1 predicts poor outcomes for patients with gastric cancer and drives tumor progression through binding to the ZEB1 promoter together with SETD7
    Article Snippet: Paragraph title: ChIP, ChIP-seq, and RNA-seq ... For the RNA-seq libraries, polyA + RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method , .

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Paragraph title: ChIP, ChIP-seq and RNA-seq ... For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Paragraph title: ChIP-STARR-seq RNA and DNA samples ... The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNaseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 μL SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50°C for 90 minutes, in a total reaction volume of 21 μl.

    RNA Extraction:

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Using a mice brain slice matrix, 500 µm slices were cut and with the help of anatomical coordinates (The Mouse Brain in Stereotaxic Coordinates, Second Edition, Paxinos and Franklin) the SNpc was localised and dissected. .. Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. The eluted mRNA was immediately used for cDNA synthesis according to High-Capacity cDNA Reverse Transcription Kit protocol (Applied Biosystems, Warrington, UK).

    Article Title: Comparative Transcriptome Analysis Reveals Different Silk Yields of Two Silkworm Strains
    Article Snippet: Paragraph title: RNA extraction and library preparation ... RNA was purified from the digest using Dynabeads® Oligo (dT) 25 (Life Tech, USA).

    Plasmid Preparation:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNaseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 μL SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50°C for 90 minutes, in a total reaction volume of 21 μl. .. PCR reactions were pooled, purified using AMPureXP beads (1.0x) and eluted in 18 μL 0.1xTE.

    SYBR Green Assay:

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol.

    Negative Control:

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: Briefly, larvae 3–4 dpf were infected with Symbiodinium strain SSB01 at a concentration of 2.5–5 × 104 algae/ml for 5–6 days (FASW as negative control). .. For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific).

    Selection:

    Article Title: Alternative polyadenylation drives genome-to-phenome information detours in the AMPKα1 and AMPKα2 knockout mice
    Article Snippet: After that, poly(A)+ RNA was enriched by Dynabeads oligo(T) magnetic beads (61002, Ambion). .. After all RNA molecules were removed by both RNases H (M0297L, NEB) and I (EN0601, Thermo Scientific), solid-phase reversible immobilization beads were used to select 300–600 bp first-strand cDNA molecules (A63880, Beckman Coulter), and second-strand cDNA was synthesized by PCR.

    In Vitro:

    Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
    Article Snippet: Total RNA was isolated from MOLM-13 cells by Trizol and poly(A)+ RNA isolated using Dynabeads Oligo-(dT)25 magnetic beads (ThermoFisher Scientific). .. Five micrograms of anti-m6 A antibody (Abcam, ab151230) was pre-bound to Protein A/G magnetic beads (Pierce) in IP buffer (20 mM Tris pH 7.5, 140 mM NaCl, 1%% NP-40, 2 mM EDTA) for one hour.

    Electrophoresis:

    Article Title: Analysis of Post-Traumatic Brain Injury Gene Expression Signature Reveals Tubulins, Nfe2l2, Nfkb, Cd44, and S100a4 as Treatment Targets
    Article Snippet: RNA was extracted from the perilesional cortex, thalamus, and hippocampus DNaesy Blood & Tissue kit (#69504, Qiagen, Hilden, Germany) followed by DNase digestion. mRNA from 2 μg of total RNA was enriched using Dynabeads Oligo (dT)25 beads (#61002, Invitrogen, Carlsbad, CA, USA). .. The sequencing library was prepared with the NEBNext mRNA Library Prep Reagent Set (#E6100S, New England Biolabs, Ipswich, MA, USA).

    Concentration Assay:

    Article Title: ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells
    Article Snippet: Libraries were quantified by qPCR using primers annealing to the adaptor sequence and sequenced at a concentration of 10 pM on an Illumina HiSeq 2000. .. For RNA-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo (dT) 25 (Invitrogen) and constructed into strand-specific libraries using the dUTP method ( ).

    Article Title: Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians
    Article Snippet: Briefly, larvae 3–4 dpf were infected with Symbiodinium strain SSB01 at a concentration of 2.5–5 × 104 algae/ml for 5–6 days (FASW as negative control). .. For all samples, total RNA was extracted using TriZol (#15596, Thermo Fisher Scientific) and the mRNA was purified using Dynabeads oligo(dT)25 (#61002, Thermo Fisher Scientific).

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: Before transferring into micro titer plate, total RNA, stored at −80 °C, was quantified & qualified using Nanodrop & BioAnalyzer (Agilent) instruments. .. Desired total RNA quantities were diluted into Binding Buffer provided with the DynabeadsOligo(dT)25 Kit (61002, Life Technologies) and BSA (B14, Thermo Scientific) was added to a final concentration of 0.4%. .. For the preparation of the paramagnetic beads solutions for droplet generation, after resuspending Dynabeads in the vial, 100 μL was transfer to a tube and placed in a magnet for 1 min.

    Fractionation:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: After incubation for 10 min on ice, the nucleoplasm and chromatin fraction were then separated by centrifugation at 4°C, 15,000 g , for 2 min. Fractionation efficiency was validated by Western blotting using antibodies specific to marker proteins for each fraction: β-tubulin (Sigma, Cat#T8328) for cytoplasm, U1-70k (a kind gift from Dr. Douglas Black) for nucleoplasm, and Histone 3 (Abcam, Cat#ab1791) for chromatin. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Marker:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: After incubation for 10 min on ice, the nucleoplasm and chromatin fraction were then separated by centrifugation at 4°C, 15,000 g , for 2 min. Fractionation efficiency was validated by Western blotting using antibodies specific to marker proteins for each fraction: β-tubulin (Sigma, Cat#T8328) for cytoplasm, U1-70k (a kind gift from Dr. Douglas Black) for nucleoplasm, and Histone 3 (Abcam, Cat#ab1791) for chromatin. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Lysis:

    Article Title: RNA editing in nascent RNA affects pre-mRNA splicing
    Article Snippet: An equal volume (100 µL) of nuclei lysis buffer (10 mM HEPES [pH 7.6], 1 mM DTT, 7.5 mM MgCl2 , 0.2 mM EDTA, 0.3 M NaCl, 1 M Urea, 1% Nonidet P-40) was added. .. Polyadenylated RNA was then selected by Oligo (dT)25 Dynabeads (Thermo Fisher Scientific, Cat# 61002) following the instructions provided by manufacturer.

    Article Title: Cell Fate Analysis of Embryonic Ventral Mesencephalic Grafts in the 6-OHDA Model of Parkinson's Disease
    Article Snippet: Using a mice brain slice matrix, 500 µm slices were cut and with the help of anatomical coordinates (The Mouse Brain in Stereotaxic Coordinates, Second Edition, Paxinos and Franklin) the SNpc was localised and dissected. .. Samples of the VM cell suspension as well as dissected grafts and the SNpc tissue of adult GFP mice where immediately transferred into lysis buffer for RNA extraction and messenger RNA (mRNA) was isolated using Dynabeads® Oligo (dT) 25 (Invitrogen Corporation, Paisley, UK) following the manufacturer's protocol. .. The eluted mRNA was immediately used for cDNA synthesis according to High-Capacity cDNA Reverse Transcription Kit protocol (Applied Biosystems, Warrington, UK).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Thermo Fisher dynabeads oligo dt 25
    Dynabeads Oligo Dt 25, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynabeads oligo dt 25/product/Thermo Fisher
    Average 95 stars, based on 131 article reviews
    Price from $9.99 to $1999.99
    dynabeads oligo dt 25 - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    Image Search Results